
Sample records for promoter region rs2233408

  1. IkappaBalpha polymorphism at promoter region (rs2233408) influences the susceptibility of gastric cancer in Chinese. (United States)

    Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun


    Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  2. IκBα polymorphism at promoter region (rs2233408 influences the susceptibility of gastric cancer in Chinese

    Directory of Open Access Journals (Sweden)

    Sung Joseph JY


    Full Text Available Abstract Background Nuclear factor of kappa B inhibitor alpha (IκBα protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of IκBα to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. Methods A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in IκBα were analyzed by TaqMan SNP genotyping assay. Results Both rs2233408 T homozygote (TT and T heterozygotes (TC and TT had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037, compared with rs2233408 C homozygote (CC. rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014, but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40 (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02. rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006, but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. Conclusions IκBα rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.

  3. Promoting regional mobility

    DEFF Research Database (Denmark)

    Jensen, Anne

    Pricing of transport has been part of EU's common transport policy since this gained momentum in the early 1990s. Since then, it has been closely connected to the trans-European transport network (TEN-T) and to rising demands of efficient mobility systems at a local, regional and Community scale....... Development of pricing policies is contested at Community level and has taken place in a clash between different policy rationalities. Significantly though, the effects of the pricing policies are closely related to regional mobility systems, e.g. through financing large trans-border infrastructure projects...... and establishing common technical charging systems thus changing the conditions for regional mobility. This paper explores how policies of infrastructure pricing shape new ways of governing mobility which influences trans-border, regional policy-making. The key findings are that there is a tendency to include...

  4. Unveiling DNA structural properties of promoter regions of ...

    Indian Academy of Sciences (India)

    Aditya Kumar

    Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...

  5. Identification and annotation of promoter regions in microbial ...

    Indian Academy of Sciences (India)



    Jun 15, 2007 ... It remains important, not only to detect rarely expressed genes but also for ... well as in identifying genes associated with rRNA, tRNA and ... DNA stability; free energy calculation; promoter; upstream and downstream region.

  6. [Health-Promoting Schools Regional Initiative of the Americas]. (United States)

    Ippolito-Shepherd, Josefa; Cerqueira, Maria Teresa; Ortega, Diana Patricia


    In Latin America, comprehensive health promotion programmes and activities are being implemented in the school setting, which take into account the conceptual framework of the Health-Promoting Schools Regional Initiative of the Pan American Health Organization, Regional office of the World Health Organization (PAHO/WHO). These programmes help to strengthen the working relationships between the health and education sectors. The Health-Promoting Schools Regional Initiative, officially launched by PAHO/WHO in 1995, aims to form future generations to have the knowledge, abilities, and skills necessary for promoting and caring for their health and that of their family and community, as well as to create and maintain healthy environments and communities. The Initiative focuses on three main components: comprehensive health education, the creation and maintenance of healthy physical and psychosocial environments, and the access to health and nutrition services, mental health, and active life. In 2001, PAHO conducted a survey in 19 Latin American countries to assess the status and trends of Health-Promoting Schools in the Region, for the appropriate regional, subregional, and national planning of pertinent health promotion and health education programmes and activities. The results of this survey provided information about policies and national plans, multisectoral coordination mechanisms for the support of health promotion in the school settings, the formation and participation in national and international networks of Health-Promoting Schools and about the level of dissemination of the strategy. For the successful development of Health-Promoting Schools is essential to involve the society as a whole, in order to mobilise human resources and materials necessary for implementing health promotion in the school settings. Thus, the constitution and consolidation of networks has been a facilitating mechanism for the exchange of ideas, resources and experiences to strengthen

  7. Identification and annotation of promoter regions in microbial

    Indian Academy of Sciences (India)


    Jun 15, 2007 ... Analysis of various predicted structural properties of promoter regions in prokaryotic as well as eukaryotic genomes had earlier indicated that they have several common features, such as lower stability, higher curvature and less bendability, when compared with their neighboring regions. Based on the ...

  8. Perspectives on Promoting Regional Renewable Energy Research and Development

    International Nuclear Information System (INIS)

    Dresselhaus, M.


    Recent discussions at the Washington International Renewable Energy Conference (WIREC), hosted in March 2008 by the United States Government, with nearly 9000 participants including 103 ministers from 126 countries, concluded that a major acceleration in the adoption of renewable energy technologies was needed by mid-century. Because of different climatic conditions and societal preferences, regional cooperation is expected to play a major role in the efficient adoption of appropriate renewable energy technologies, and countries with special expertise in specific technologies seem eager to collaborate internationally to promote global goals in renewable energy. A review will be given of what we learned from this conference about renewable energy research and development strategies with a special focus given to using this basic knowledge base to promote the development of renewable energy technologies appropriate to specific regions of the world.(author)

  9. Mechanosensitive promoter region in the human HB-GAM gene

    DEFF Research Database (Denmark)

    Liedert, Astrid; Kassem, Moustapha; Claes, Lutz


    Mechanical loading is essential for maintaining bone mass in the adult skeleton. However, the underlying process of the transfer of the physical stimulus into a biochemical response, which is termed mechanotransduction is poorly understood. Mechanotransduction results in the modulation of gene...... cells. Analysis of the human HB-GAM gene upstream regulatory region with luciferase reporter gene assays revealed that the upregulation of HB-GAM expression occurred at the transcriptional level and was mainly dependent on the HB-GAM promoter region most upstream containing three potential AP-1 binding...

  10. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)


    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  11. Promotion and regional development. Implementation of regional productive development agencies. The case of Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Enrique Yamil Alul González


    Full Text Available The Regional Productive Development Agencies implemented in Chile in 2006, were developed as a way to answer the longing desire to territorially decentralize, and that the own Regions be whom define their future. The Agencies have the responsibility to develop innovation and productive development Agendas in participative processes, which means with public, academic and private actors. Also, the Agencies have the mission to implement Competitive Improvement Plans-PMC (clusters in prioritized economic sectors by the own region. These PMC are leaded by private actors in each sector.

  12. Genetic recombination is targeted towards gene promoter regions in dogs. (United States)

    Auton, Adam; Rui Li, Ying; Kidd, Jeffrey; Oliveira, Kyle; Nadel, Julie; Holloway, J Kim; Hayward, Jessica J; Cohen, Paula E; Greally, John M; Wang, Jun; Bustamante, Carlos D; Boyko, Adam R


    The identification of the H3K4 trimethylase, PRDM9, as the gene responsible for recombination hotspot localization has provided considerable insight into the mechanisms by which recombination is initiated in mammals. However, uniquely amongst mammals, canids appear to lack a functional version of PRDM9 and may therefore provide a model for understanding recombination that occurs in the absence of PRDM9, and thus how PRDM9 functions to shape the recombination landscape. We have constructed a fine-scale genetic map from patterns of linkage disequilibrium assessed using high-throughput sequence data from 51 free-ranging dogs, Canis lupus familiaris. While broad-scale properties of recombination appear similar to other mammalian species, our fine-scale estimates indicate that canine highly elevated recombination rates are observed in the vicinity of CpG rich regions including gene promoter regions, but show little association with H3K4 trimethylation marks identified in spermatocytes. By comparison to genomic data from the Andean fox, Lycalopex culpaeus, we show that biased gene conversion is a plausible mechanism by which the high CpG content of the dog genome could have occurred.

  13. US-India Technical Collaboration to Promote Regional Stability

    International Nuclear Information System (INIS)

    Killinger, Mark H.; Griggs, James R.; Apt, Kenneth E.; Doyle, James E.


    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, DOE has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US agencies and the Indian government and scientific communities to identify appropriate non-sensitive areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national/international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes research done on the Indian scientific organization and infrastructure, potential areas for collaboration, the approach for this engagement, and current status of the initiative.


    International Nuclear Information System (INIS)

    Killinger, M.H.; Griggs, J.R.; Apt, Kenneth E.; Doyle, J.E.


    Two US-India documents were signed in 2000 that provided new impetus for scientific and technical cooperation between the two countries. The first document is the US-India Science and Technology Agreement, which is aimed at 'promoting scientific and technological cooperation between the people of their two countries.' The second is the US-India Joint Statement on Energy and Environment, which states 'the United States and India believe that energy and environment could be one of the most important areas of cooperation between the two countries.' In addition to the work already underway as part of these two agreements, the US Department of Energy (DOE) has established a US-India Science and Technology Initiative to utilize the expertise of DOE national laboratories to conduct activities that support US policy objectives in South Asia. PNNL and LANL are working with US government agencies to identify appropriate non-sensitive, non-nuclear areas for US-Indian technical collaboration. The objectives of such collaboration are to address visible national and international problems, build trust between the United States and India, and contribute to regional stability in South Asia. This paper describes the approach for this engagement, the Indian scientific organization and infrastructure, potential areas for collaboration, and current status of the initiative.

  15. Business networking for SMEs as a means to promote regional competitiveness: A Theoretical Framework


    Vitor Braga


    The competitiveness of regions, as a means of promoting the competitiveness of a country as a whole, has been one of the main topics on the agenda of policy makers over the last decades. Several attempts at promoting competitiveness have been made with different degrees of success. In most cases, public investment in the regions was perceived as the solution to promote regional competitiveness and top-down policies were implemented. However, competitiveness also has an important dimension tha...

  16. Constructing a State Policy To Promote Regionalism in School Government. (United States)

    Zukowsky, Jerome; And Others.

    This paper defines regionalism, sets some tentative directions for the concept, and raises difficult questions related to its application in New York State. Regionalism, which offers an alternative to a State-local school governing system, is used to decentralize the planning and management of public services. A regional unit permits district…

  17. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)

    Tumor suppressor gene PTEN plays an important role in cell cycle. Disorder of PTEN protein can cause cell growth and division in an uncontrolled way, which can lead to the formation of tumors. It has been proven that epigenetic mechanisms, such as promoter hypermethylation, may account for inactivation of PTEN in a ...

  18. Promoting regional energy co-operation in South Asia

    International Nuclear Information System (INIS)

    Srivastava, Leena; Misra, Neha


    Energy is a key ingredient of the socio-economic development of any region. South Asia is not only one of the fastest growing regions in the world; it is also one of the poorest, which thus puts energy at the very heart of the development process in the region. This paper looks at the challenges faced by the South Asia sub-region for economic co-operation (SASEC) comprised of Bangladesh, Bhutan, India and Nepal, and also at the role of greater regional energy co-operation therein. The region is characterized by pressures of growing economies and increasing population. While the per capita energy consumption is one of the lowest in the world, energy intensity continues to be very high. A large portion of the population lacks access to modern sources of energy and depends on traditional sources that are not only inefficient but also have severe health and environmental problems associated with them. Increasing oil import dependency and huge investment needs for energy market development pose a further challenge. The region has a good resource potential and tremendous scope for energy co-operation, which can play a key role in addressing many of these energy security concerns and in putting it on the path of sustainable development. It is ironic that the record in the area has been so limited and that too in the most basic form of co-operation, i.e. bilateral arrangements between countries. This paper puts forth a multi-pronged strategy for sub-regional energy co-operation encompassing softer options aimed at confidence building to more substantial and larger scale co-operation efforts. Delays in decision making to ensure stronger and mutually beneficial co-operation efforts are associated with high costs not only to the energy sector but also for the entire development agenda. With the precarious energy situation in the region and unprecedented increases in international oil prices seen in recent times, it is high time for policy makers, financing institutions, NGOs

  19. The Digital North Denmark Programme -Promoting Regional Change?

    DEFF Research Database (Denmark)

    Østergaard, Christian Richter


    The Digital North Denmark (DDN) was an IT programme running from 2000 to 2003 in the North Jutland County in Denmark with national government support of € 23 million. The Danish government initiated the programme with the aim of further strengthening regions with an already proven ICT capability...... (Dybkjær and Lindegaard, 1999, p.96-100). The declared approach was to build on the existing competencies in industry as well as at universities. The national government chose two regions – Ørestaden, a new concentration of knowledge-based institutions near Copenhagen Airport, and North Jutland......-offers within four themes. The participants - meant to be project consortia of ideally private firms, public or private organisations as well as regional and municipal government bodies - could get a maximum national government support of one third of the total project sum.This chapter investigates how...

  20. A new polymorphism in goat β-lactoglobulin promoter region

    Directory of Open Access Journals (Sweden)

    Mirella Graziano


    Full Text Available An individual variability in β-lactoglobulin content has been previously observed in Girgentana goat milk by HPLC analysis. To identify eventual mutations affecting the transcription level of the gene, the prooter region was characterized in goats showing an anomalous phenotype, consisting in a reduced content of β-lactoglobulin respect to α-lactoalbumine. A single nucleotide substitution not previously reported has been detected. A PCR-RFLP procedure was developed for fast detection of the mutation in different goat breeds: Girgentana, Garganica, Sarda, Alpine, Montefalcone and Saanen. The Montefalcone goat showed the highest frequency of the mutation, confirming one more the peculiarity of this breed.

  1. Graduate Management Project (GMP) Retrospective Analysis of Promotional Mediums for Tricare Prime in Tricare Region 11

    National Research Council Canada - National Science Library

    Carpenter, Steven


    This study provides retrospective market research information about the population who enrolled in TRICARE Prime in TRICARE Region 11 and the advertising mediums used to promote enrollment in the TRICARE Prime program...

  2. Active sales promotion in urban regions; Aktive Verkaufsfoerderung in Verdichtungsgebieten

    Energy Technology Data Exchange (ETDEWEB)

    Becker, H.D. [Oeffentlichkeitsarbeit, Maingas AG, Frankfurt am Main (Germany)


    The first step in any worthwhile marketing strategy for urban regions is to make a survey of all real estates without a gas supply. The data stock thus obtained serves as a short, medium, and long-term basis for all further activity. It cal be used to set up yearly personnel and activity plans. The activities are rounded off by incentives in the form of conversion aids or financing offers and additional measures presented within a Full Service Package Defining clear aims makes it easier to evaluate the success of the activities. (orig.) [Deutsch] Der erste Schritt zu einer erfolgreichen Marktbearbeitung in Verdichtungsgebieten ist die Erhebung aller Liegenschaften ohne Gasversorgung. Der gewonnene Datenbestand dient kurz-, mittel- und langfristig als Grundlage aller Aktivitaeten. Eine Personal- und Aktivitaetenplanung kann jaehrlich daraus abgeleitet werden. Kaufanreize in Form von Umstellhilfen, Finanzierungsangeboten und zusaetzlichen Dienstleistungen im Rahmen eines Full-Service-Angebotes runden die Aktivitaeten ab. Die klare Vorgabe von Zielen erleichert die Erfolgskontrolle. (orig.)

  3. Social Media Marketing as a tool for promoting the regional investment portals

    Directory of Open Access Journals (Sweden)

    Alisa Yu. Fadeyeva


    Full Text Available Objective to investigate the potential of Social Media Marketing as a tool for promoting regional investment portals in the information environment to identify the most effective ways of its implementation and to determine the level of mastering of this tool by the Russian regions. Methods general scientific methods observation comparison analysis induction deduction analogy classification. Results the analysis showed that today Social Media Marketing is an essential tool for interaction with the investment community and one of the most effective ways to promote the regional portal which allows to increase the knowledge of and loyalty to the brand to increase the targeted website traffic to increase the awareness of investors about the specific features of the portal and the regional development agenciesrsquo functioning to promptly receive information about the investment environment and to establish contacts with investors. At the same time the study of SMMactivity in the Russian regions revealed a very low level of quality of communication with investors through social networks. Scientific novelty for the first time the article investigates the significance and makes the comparative analysis of the Social Media Marketing channels with regard to investment promotion agencies as well as the results of the regional structures functioning for effective communication through social networks. Practical significance the main results of the research can be used by the regional investment agencies in order to promote their websites increase the quality of communication with investors and promote the investment attractiveness of the region as a whole. nbsp

  4. Genome-wide analysis of regions similar to promoters of histone genes

    KAUST Repository

    Chowdhary, Rajesh


    Background: The purpose of this study is to: i) develop a computational model of promoters of human histone-encoding genes (shortly histone genes), an important class of genes that participate in various critical cellular processes, ii) use the model so developed to identify regions across the human genome that have similar structure as promoters of histone genes; such regions could represent potential genomic regulatory regions, e.g. promoters, of genes that may be coregulated with histone genes, and iii/ identify in this way genes that have high likelihood of being coregulated with the histone genes.Results: We successfully developed a histone promoter model using a comprehensive collection of histone genes. Based on leave-one-out cross-validation test, the model produced good prediction accuracy (94.1% sensitivity, 92.6% specificity, and 92.8% positive predictive value). We used this model to predict across the genome a number of genes that shared similar promoter structures with the histone gene promoters. We thus hypothesize that these predicted genes could be coregulated with histone genes. This hypothesis matches well with the available gene expression, gene ontology, and pathways data. Jointly with promoters of the above-mentioned genes, we found a large number of intergenic regions with similar structure as histone promoters.Conclusions: This study represents one of the most comprehensive computational analyses conducted thus far on a genome-wide scale of promoters of human histone genes. Our analysis suggests a number of other human genes that share a high similarity of promoter structure with the histone genes and thus are highly likely to be coregulated, and consequently coexpressed, with the histone genes. We also found that there are a large number of intergenic regions across the genome with their structures similar to promoters of histone genes. These regions may be promoters of yet unidentified genes, or may represent remote control regions that

  5. How to promote the regional cooperation in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Masayuki [International Affairs and Safeguards Division, Atomic Energy Bureau, Science and Technology Agency, Tokyo (Japan)


    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  6. How to promote the regional cooperation in Asia

    International Nuclear Information System (INIS)

    Nakano, Masayuki


    The Tenth International Conference for Nuclear Cooperation in Asia was held in Tokyo on March 10, 1999. Representatives participated from Australia, China, Indonesia, Japan, Korea, Malaysia, the Philippines, Thailand, and Vietnam as well as IAEA as an observer. The countries reflected on the positive achievements of the past ten years and affirmed the major goals for the future, the major theme of the meeting being the evolution of the framework. Some typical cooperative activities have result in: (a) new varieties of plants with greater productivity under a range of environmental conditions (b) development and adoptions of improved analytical procedures to track air pollution in major cities where the identification of the major sources will facilitate remediation measures (c) coordinated trials for radiation therapy of cervical cancer and the development of rigorous protocols (d) training of staff in research reactor operation and in the use of research reactors for the study of new materials. The participating countries have committed to reviewing the six existing sub-categories, namely (1) utilization of research reactors, (2,3) application of radiation and radioisotope in the agriculture and the medical fields, (4) public acceptance of nuclear energy, (5) radioactive waste management, and (6) nuclear safety culture. To share knowledge on human resources development within the region and to consider measures for the further development of human resources in relevant fields, a seminar for human resources development, sponsored by Japan, will be held in Japan. The conference will be renamed as (Forum for Nuclear Cooperation in Asia) beginning with the next conference. The Forum for Nuclear Cooperation in Asia will be held in Japan and in a participating country other than Japan in alternating years. To enhance the regional nuclear cooperation activities under this framework, each participating country will register a Coordinator and Project Leaders to facilitate

  7. Regional differences in gender promotion and scholarly productivity in otolaryngology. (United States)

    Eloy, Jean Anderson; Mady, Leila J; Svider, Peter F; Mauro, Kevin M; Kalyoussef, Evelyne; Setzen, Michael; Baredes, Soly; Chandrasekhar, Sujana S


    To identify whether regional differences exist in gender disparities in scholarly productivity and faculty rank among academic otolaryngologists. Academic otolaryngologists' bibliometric data analyses. Online faculty listings from 98 otolaryngology departments were organized by gender, academic rank, fellowship training status, and institutional location. The Scopus database was used to assess bibliometrics of these otolaryngologists, including the h-index, number of publications, and publication experience. Analysis included 1127 otolaryngologists, 916 men (81.3%) and 211 women (18.7%). Female faculty comprised 15.4% in the Midwest, 18.8% in the Northeast, 21.3% in the South, and 19.0% in the West (P = .44). Overall, men obtained significantly higher senior academic ranks (associate professor or professor) compared to women (59.8% vs. 40.2%, P .05). Gender disparities in academic rank and scholarly productivity exist most notably in the Northeast, where women in otolaryngology are most underrepresented relative to men at senior academic ranks and in scholarly productivity.

  8. Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)


    The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

  9. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    Directory of Open Access Journals (Sweden)

    Carlos Guerrero-Bosagna


    Full Text Available Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a was found to be due to a copy number variation (CNV and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  10. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome. (United States)

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K


    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  11. Identification of functional DNA variants in the constitutive promoter region of MDM2

    Directory of Open Access Journals (Sweden)

    Lalonde Marie-Eve


    Full Text Available Abstract Although mutations in the oncoprotein murine double minute 2 (MDM2 are rare, MDM2 gene overexpression has been observed in several human tumors. Given that even modest changes in MDM2 levels might influence the p53 tumor suppressor signaling pathway, we postulated that sequence variation in the promoter region of MDM2 could lead to disregulated expression and variation in gene dosage. Two promoters have been reported for MDM2; an internal promoter (P2, which is located near the end of intron 1 and is p53-responsive, and an upstream constitutive promoter (P1, which is p53-independent. Both promoter regions contain DNA variants that could influence the expression levels of MDM2, including the well-studied single nucleotide polymorphism (SNP SNP309, which is located in the promoter P2; i.e., upstream of exon 2. In this report, we screened the promoter P1 for DNA variants and assessed the functional impact of the corresponding SNPs. Using the dbSNP database and genotyping validation in individuals of European descent, we identified three common SNPs (−1494 G > A; indel 40 bp; and −182 C > G. Three major promoter haplotypes were inferred by using these three promoter SNPs together with rs2279744 (SNP309. Following subcloning into a gene reporter system, we found that two of the haplotypes significantly influenced MDM2 promoter activity in a haplotype-specific manner. Site-directed mutagenesis experiments indicated that the 40 bp insertion/deletion variation is causing the observed allelic promoter activity. This study suggests that part of the variability in the MDM2 expression levels could be explained by allelic p53-independent P1 promoter activity.

  12. Growing Significance of EU Institutions in Promotion of Inter-regional policies

    Directory of Open Access Journals (Sweden)

    Ella V. Ermakova


    Full Text Available The article explores the variety of tools and vehicles applied within the EU to expand the prerogative of the regions of the EU member states. The author uses as an example the inter-regional policies in Belgium in respect of the Flemish Region and the Walloon Region. The author analyzes the mechanisms of promotion of external regional relations in Belgium as a means of addressing different problems both on national and all-European level, supporting the arguments and conclusions by examples of relevant EU initiatives. The article details the activities of the EU Regional Committee (RC, the EU advisory body with the powers of political initiative, upholding the principle ofsubsidarity in the implementation of the EU member states' regional policies. The involvement of the Flemish Region and the Walloon Region in the activities of EU RC is described and summarized. As a case study, the article deals with Belgium's rotating six months presidency in the EUin 2010 when the country, which was going through a severe political crisis with no federal government in place, was represented by the two regions. The special focus of the article is on the strategic EU program "Europe2020" and its implementation by the regions of Belgium. There is an account of the initiatives undertaken by the Flemish Region and the Walloon Region within the framework of this program outlining the interaction of the two regions. The author provides a comprehensive analysis of the involvement of the Flemish Region and the Walloon Region with various EU institutions describing how each party achieves the promotion of its regional interests. Within this context, it is a noteworthy development that the Flemish Region is participating in the international program "Pact 2020" on energy all by its own. The article features quotations by Flemish and Walloon political figures which serve as an illustration of the prevailing attitudes in the Belgian society to the process of

  13. Does FDI promote regional development? Evidence from local and regional productivity spillovers in Greece

    Directory of Open Access Journals (Sweden)



    Full Text Available Studies on the productivity spillovers of FDI have concentrated on the nationalsectoral level. As a result, little is known about the impact of FDI on absolute and relative regional economic performance. In this paper we examine this issue by relying on a unique dataset of over 20,000 Greek firms for the period 2002-2006 covering all sectors of economic activity. We examine the spatial distribution of foreign-owned firms in the country and analyse the effect that their presence – at the local, regional and national levels – has on the productivity of domestic firms. We find strong evidence suggesting that foreignowned firms self-select into regions and sectors of high productivity. Net of this selection effect, the impact of foreign presence on domestic productivity is negative – although at the very local level some positive spillover effects are identifiable. The bulk of the effects concentrate in non-manufacturing activities, high-tech sectors, and medium-sized high-productivity firms. Importantly, this effect is not constant across space however. Productivity spillovers tend to be negative in the regions hosting the main urban areas in the country but positive in smaller and more peripheral regions. In this way, despite the tendency of FDI to concentrate in a limited number of areas within the country – those of the highest level of development – the externalities that FDI activity generates to the local economies appear to be of a rather equilibrating character.

  14. Role of regional policies in promoting networking and innovation activity of firms


    Kirsi Mukkala; Jari Ritsilä


    The success of firms and regions is increasingly defined by their innovation and learning capabilities. It has been emphasized in several studies that a local operational environment may have a positive impact on innovation activity of firms. From policy point of view, the relationship between firms and their local environment is an important research topic. The purpose of this paper is to explore whether there is a demand for regional policy makers in promoting innovative and networking acti...

  15. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.


    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  16. A study of the frequency of methylation of gene promoter regions in ...

    Indian Academy of Sciences (India)


    Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.

  17. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls ... Laboratory, ICAR-Central Institute for Research on Cattle, Meerut 250 001, India; School of Atmospheric Stress Management, ICAR-National Institute of Abiotic Stress Management, Baramati 413 115, India ...

  18. Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

    Directory of Open Access Journals (Sweden)

    Susanne Helm

    Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

  19. Clinical significance of promoter region hypermethylation of microRNA-148a in gastrointestinal cancers

    Directory of Open Access Journals (Sweden)

    Sun JX


    Full Text Available Jingxu Sun,1,* Yongxi Song,1,* Zhenning Wang,1 Guoli Wang,2 Peng Gao,1 Xiaowan Chen,1 Zhaohua Gao,1 Huimian Xu1 1Department of Surgical Oncology and General Surgery, First Hospital of China Medical University, Shenyang, People’s Republic of China; 2Department of Biochemistry and Molecular Biology, China Medical University, Shenyang, People’s Republic of China *These authors contributed equally to this work Background: MicroRNAs are associated with tumor genesis and progression in various carcinomas. MicroRNA-148a (miR-148a was reported to have low expression in gastrointestinal cancers, and might be regulated by promoter region DNA methylation. Methods: Bisulfite-modified sequencing was used to determine the promoter region DNA methylation status of human gastrointestinal cancer cell lines. Expression levels of miR-148a in cell lines treated with 5-aza-2′-deoxycytidine were determined by quantitative real-time polymerase chain reaction. Total DNA was extracted from the tissues of 64 patients with gastric cancer and 51 patients with colorectal cancer. Methylation status was determined by methylation-specific polymerase chain reaction. All statistical analyses were performed with SPSS 17.0 software. Results: The promoter regions of genes in human gastrointestinal cancer cell lines were all hypermethylated, except for HT-29, and the expression of miR-148a tended to be higher than in controls after treatment with 5-aza-2′-deoxycytidine. The methylation-specific polymerase chain reaction results showed that 56.25% of gastric cancer tissues and 19.61% of colorectal cancer tissues were hypermethylated. A strong correlation was found between the expression of miR-148a and the methylation status of promoter regions (P<0.001, chi-square test and Pearson’s correlation. Furthermore, promoter region CpG site hypermethylation of miR-148a was correlated with increased tumor size (P=0.01 in gastric cancer after analyzing the correlation between

  20. The system of Regional Contact Offices for promoting GMES services and the use of Space Technologies in European Regions. (United States)

    Carrara, Paola; Antoninetti, Massimo; Bacai, Hina; Basoni, Anna; Bosc, Christelle; Clave, Magali; Cornacchia, Carmela; L'Astorina, Alba; Monbet, Philippe; Mueller, Bastian; Nicolau, Sonia; Pergola, Nicola; Rampini, Anna; Tramutoli, Valerio; Schumacher, Volker; Wells, Alan; Zepeda Juarez, Jesus; Zolotikova, Svetlana


    which have significant impact on the economy, environment and the quality of life of the citizens To this aim since 2011 the system of Regional Contact Offices (RCOs) was promoted by the EU FP7 DORIS_Net (Downsteam Observatory organized by Regions Active in Space - Network, project as the regional link to the services provided by the European GMES programme. Since then a first nucleus of 12 pilot European Regions were working together establishing 6 first RCOs around Europe. This paper will present RCOs network goals, achievements and perspectives as well as its planned actions devoted to improve quality of Space Technology products from one side, to promote awareness and use of them by potential end-users (and particularly LRAs), from the other side.

  1. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  2. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  3. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis


    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  4. Regional Cooperation Efforts in the Mekong River Basin: Mitigating river-related security threats and promoting regional development

    Directory of Open Access Journals (Sweden)

    Susanne Schmeier


    Full Text Available The development of international rivers is often perceived as leading to conflicts or even water wars. However, as the development of the Mekong River shows, cooperation has not only prevailed in the last decades, but River Basin Organizations (RBOs, established to mitigate river-related conflicts and/or develop the river basin, have also contributed to the emergence of more general cooperation structures, mainly by creating spill-over effects in other issue-areas, bringing cooperation to policy fields beyond the river itself. This article assesses the contribution of the Mekong River Commission (MRC and the Greater Mekong Sub-Region (GMS to the sustainable development of the Mekong Region as well as to the promotion of regional cooperation in mainland South-East Asia in general. --- Die Entwicklung grenzüberschreitender Flüsse wird oft mit Konflikten oder gar Kriegen um Wasser assoziiert. Wie jedoch die Entwicklung im Mekong-Becken zeigt, waren die vergangenen Jahrzehnte nicht nur von Kooperation gezeichnet, sondern Flussbeckenorganisationen konnten außerdem dazu beitragen, weitreichendere Kooperationsstrukturen zu entwickeln, die sich auf andere Politikfelder ausdehnen. Dieser Artikel beschäftigt sich mit dem Beitrag der Mekong River Commission (MRC und der Greater Mekong Sub-Region (GMS zur nachhaltigen Entwicklung in der Mekong Region sowie zur Förderung allgemeiner regionaler Kooperation im Festländischen Südostasien.

  5. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.


    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

  6. Brand Products of Regional Cuisine in the Promotion of Tourism in Roztocze

    Directory of Open Access Journals (Sweden)

    Bekier-Jaworska Ewa


    Full Text Available Introduction. There has been a trend over the last few years of using specialties of regional cuisine as an independent tourist attraction. The creation of local brands is an important element in the promotion of a given region and it also influences the development of culinary tourism. The aim of the studies conducted was to identify regional dishes - a choice of dishes that could be described as 'brand dishes' and the use of those dishes as tourist attractions in Roztocze. Material and methods. Studies were conducted on a group of students studying tourism and recreation at State Higher School of Vocational Education (PWSZ in Zamość using a questionnaire. Results. The questionnaire provided an assessment of the levels of knowledge of regional cuisine among Polish and Ukrainian students, identified the most characteristic dishes and selected brand products, and helped to arrive at a suitable method of promotion. Conclusions. Nationality, family customs and selection of local restaurants highly influence knowledge of regional cuisine. Interviewees decided that the most outstanding products from Roztocze were Zwierzyniec beer, and Biłgoraj pie. Regional products should be used as a tourist attraction in Roztocze.

  7. Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC). (United States)

    Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G


    Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  8. Genome-wide function of H2B ubiquitylation in promoter and genic regions. (United States)

    Batta, Kiran; Zhang, Zhenhai; Yen, Kuangyu; Goffman, David B; Pugh, B Franklin


    Nucleosomal organization in and around genes may contribute substantially to transcriptional regulation. The contribution of histone modifications to genome-wide nucleosomal organization has not been systematically evaluated. In the present study, we examine the role of H2BK123 ubiquitylation, a key regulator of several histone modifications, on nucleosomal organization at promoter, genic, and transcription termination regions in Saccharomyces cerevisiae. Using high-resolution MNase chromatin immunoprecipitation and sequencing (ChIP-seq), we map nucleosome positioning and occupancy in mutants of the H2BK123 ubiquitylation pathway. We found that H2B ubiquitylation-mediated nucleosome formation and/or stability inhibits the assembly of the transcription machinery at normally quiescent promoters, whereas ubiquitylation within highly active gene bodies promotes transcription elongation. This regulation does not proceed through ubiquitylation-regulated histone marks at H3K4, K36, and K79. Our findings suggest that mechanistically similar functions of H2B ubiquitylation (nucleosome assembly) elicit different functional outcomes on genes depending on its positional context in promoters (repressive) versus transcribed regions (activating).

  9. Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer

    Directory of Open Access Journals (Sweden)

    Jae Sook Sung


    Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.

  10. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration (United States)

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu


    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  11. Governmental promotion of the Information Society in the Spanish Region of Valencia

    Directory of Open Access Journals (Sweden)

    Emilio Feliu-García, Ph.D.


    Full Text Available Regional spheres are considered essential in the governmental promotion of the Information Society at the international level. The regional initiatives in Spain aim to strengthen and complement the initiatives promoted at the national level. This article analyses ICT penetration in the Valencian Community from 1996 to 2008. The objective is to identify which of the actions carried out by the Valencian Regional Government have had a positive effect on its society.The methodology employed in this study is benchmarking. The selection of indicators is based on the policies evaluation model proposed in the Plan Avanza (Spain’s national Information Society strategy. Data were collected from official statistical sources (like Spain’s National Statistics Institute, INE. Three statistical tests were applied to verify the hypotheses (Pearson’s r2, Chi-square and Student’s t.The results indicate that it is not possible to affirm that the actions implemented by the Valencian Regional Government have had a more positive effect on its society than those implemented by the Spanish Central Government. A reason for this may lie in the specific objectives of the political strategy implemented by the Valencian Government, which has focused primarily on e-Government and does not include enough projects centred on the implementation of new technologies in the private sector. Moreover, the integration of new technologies in everyday life is placed in a second level of importance despite citizens are central actors in the international agenda.

  12. The promotion of regional integration of electricity markets: Lessons for developing countries

    International Nuclear Information System (INIS)

    Oseni, Musiliu O.; Pollitt, Michael G.


    This paper focuses on how to promote regional cooperation in electricity. We begin by discussing the theory of international trade cooperation in electricity, with a view to discussing what preconditions might be important in facilitating wide area trading across national borders. We then develop lessons based on the comparison of four case studies. These include three regional developing country power pools – the Southern African Power pool (SAPP), West African Power pool (WAPP) and the Central American Power Market (MER). We contrast these with Northern Europe's Nord Pool. These cases highlight both the potential and difficulty of having cross-jurisdictional power pools. In the light of the theory and evidence we present, we draw key lessons in the areas of: preconditions for trading; necessary institutional arrangements; practicalities of timetabling; reasons to be hopeful about future prospects. - Highlights: • This paper focuses on how to promote regional electricity cooperation. • We develop lessons based on comparison of four international case studies. • The cases highlight both the potential and difficulty of power pools. • We identify preconditions, institutional arrangements and timetabling. • We conclude that the future prospects for regional power pools are good.

  13. Quantifying Surface Coal-Mining Patterns to Promote Regional Sustainability in Ordos, Inner Mongolia

    Directory of Open Access Journals (Sweden)

    Xiaoji Zeng


    Full Text Available Ordos became the new “coal capital” of China within a few decades since the country’s economic reform in 1978, as large-scale surface coal mining dramatically propelled its per capita GDP from being one of the lowest to one of the highest in China, exceeding Hong Kong in 2009. Surface coal-mining areas (SCMAs have continued to expand in this region during recent decades, resulting in serious environmental and socioeconomic consequences. To understand these impacts and promote regional sustainability, quantifying the spatiotemporal patterns of SCMAs is urgently needed. Thus, the main objectives of this study were to quantify the spatiotemporal patterns of SCMAs in the Ordos region from 1990 to 2015, and to examine some of the major environmental and socioeconomic impacts in the study region. We extracted the SCMAs using remote-sensing data, and then quantified their spatiotemporal patterns using landscape metrics. The loss of natural habitat and several socioeconomic indicators were examined in relation to surface coal mining. Our results show that the area of SCMAs increased from 7.12 km2 to 355.95 km2, an increase of nearly 49 times from 1990 to 2015 in the Ordos region. The number of SCMAs in this region increased from 82 to 651, a nearly seven-fold increase. In particular, Zhungeer banner (an administrative division, Yijinhuoluo banner, Dongsheng District and Dalate banner in the north-eastern part of the Ordos region had higher growth rates of SCMAs. The income gap between urban and rural residents increased along with the growth in SCMAs, undermining social equity in the Ordos region. Moreover, the rapid increase in SCMAs resulted in natural habitat loss (including grasslands, forests, and deserts across this region. Thus, we suggest that regional sustainability in Ordos needs to emphasize effective measures to curb large-scale surface coal mining in order to reduce the urban–rural income gap, and to restore degraded natural

  14. Boundary Dpp promotes growth of medial and lateral regions of the Drosophila wing. (United States)

    Barrio, Lara; Milán, Marco


    The gradient of Decapentaplegic (Dpp) in the Drosophila wing has served as a paradigm to characterize the role of morphogens in regulating patterning. However, the role of this gradient in regulating tissue size is a topic of intense debate as proliferative growth is homogenous. Here, we combined the Gal4/UAS system and a temperature-sensitive Gal80 molecule to induce RNAi-mediated depletion of dpp and characterise the spatial and temporal requirement of Dpp in promoting growth. We show that Dpp emanating from the AP compartment boundary is required throughout development to promote growth by regulating cell proliferation and tissue size. Dpp regulates growth and proliferation rates equally in central and lateral regions of the developing wing appendage and reduced levels of Dpp affects similarly the width and length of the resulting wing. We also present evidence supporting the proposal that graded activity of Dpp is not an absolute requirement for wing growth.

  15. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence. (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa


    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. The role of COMESA in promoting intra-regional agricultural trade: Case study of Sudan

    Directory of Open Access Journals (Sweden)

    Azharia Abdelbagi Elbushra


    Full Text Available African countries have created many regional trade agreements with the economic objectives of reducing trade barriers and encouraging economic growth. The COMESA is an example of regional integration singed on 1993 by 19 African countries including Sudan. COMESA represents a chance for member countries to enhance their economic and social relations through increasing intra-trade. The objective of this paper is to assess the role of COMESA in promoting intra-regional agricultural trade between Sudan and COMESA countries. A multi-market model with Armington non-linear specification was applied. The paper results showed that there is a great potential for Sudan to increase its agricultural exports to other COMESA countries. The domestic agricultural markets are expected to be hampered by imports surge and increase in competition, while the producers of agricultural export commodities will be better off. In order to compete and benefit from potential in the COMESA markets, the paper recommended improving efficiency in the Sudanese agricultural sector through increasing productivity, lowering cost of production, enhancing marketing services, attaining economies of scale and attracting foreign investment.

  17. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region. (United States)

    Wyszyńska-Koko, J; Kurył, J


    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  18. Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum). (United States)

    Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K


    Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

  19. Allelic polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria severity in Ghanaian children

    DEFF Research Database (Denmark)

    Gyan, B A; Goka, B; Cvetkovic, J T


    Immunoglobulin E has been associated with severe malaria suggesting a regulatory role for interleukin (IL)-4 and/or IgE in the pathogenesis of severe malaria. We have investigated possible associations between polymorphisms in the IL-4 repeat region (intron 3) and promoter regions (IL-4 +33CT and...

  20. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes. (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S


    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  1. Identification of a single-nucleotide insertion in the promoter region affecting the sodC promoter activity in Brucella neotomae.

    Directory of Open Access Journals (Sweden)

    Dina A Moustafa

    Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.

  2. Assessing the effects of data selection and representation on the development of reliable E. coli sigma 70 promoter region predictors.

    Directory of Open Access Journals (Sweden)

    Mostafa M Abbas

    Full Text Available As the number of sequenced bacterial genomes increases, the need for rapid and reliable tools for the annotation of functional elements (e.g., transcriptional regulatory elements becomes more desirable. Promoters are the key regulatory elements, which recruit the transcriptional machinery through binding to a variety of regulatory proteins (known as sigma factors. The identification of the promoter regions is very challenging because these regions do not adhere to specific sequence patterns or motifs and are difficult to determine experimentally. Machine learning represents a promising and cost-effective approach for computational identification of prokaryotic promoter regions. However, the quality of the predictors depends on several factors including: i training data; ii data representation; iii classification algorithms; iv evaluation procedures. In this work, we create several variants of E. coli promoter data sets and utilize them to experimentally examine the effect of these factors on the predictive performance of E. coli σ70 promoter models. Our results suggest that under some combinations of the first three criteria, a prediction model might perform very well on cross-validation experiments while its performance on independent test data is drastically very poor. This emphasizes the importance of evaluating promoter region predictors using independent test data, which corrects for the over-optimistic performance that might be estimated using the cross-validation procedure. Our analysis of the tested models shows that good prediction models often perform well despite how the non-promoter data was obtained. On the other hand, poor prediction models seems to be more sensitive to the choice of non-promoter sequences. Interestingly, the best performing sequence-based classifiers outperform the best performing structure-based classifiers on both cross-validation and independent test performance evaluation experiments. Finally, we propose a

  3. Public health and health promotion capacity at national and regional level: a review of conceptual frameworks

    Directory of Open Access Journals (Sweden)

    Christoph Aluttis


    Full Text Available The concept of capacity building for public health has gained much attention during the last decade. National as well as international organizations increasingly focus their efforts on capacity building to improve performance in the health sector. During the past two decades, a variety of conceptual frameworks have been developed which describe relevant dimensions for public health capacity. Notably, these frameworks differ in design and conceptualization. This paper therefore reviews the existing conceptual frameworks and integrates them into one framework, which contains the most relevant dimensions for public health capacity at the country or regional level. A comprehensive literature search was performed to identify frameworks addressing public health capacity building at the national or regional level. We content-analysed these frameworks to identify the core dimensions of public health capacity. The dimensions were subsequently synthesized into a set of thematic areas to construct a conceptual framework which describes the most relevant dimensions for capacities at the national or regional level. The systematic review resulted in the identification of seven core domains for public health capacity: resources, organizational structures, workforce, partnerships, leadership and governance, knowledge development and country specific context. Accordingly, these dimensions were used to construct a framework, which describes these core domains more in detail. Our research shows that although there is no generally agreed upon model of public health capacity, a number of key domains for public health and health promotion capacity are consistently recurring in existing frameworks, regardless of their geographical location or thematic area. As only little work on the core concepts of public health capacities has yet taken place, this study adds value to the discourse by identifying these consistencies across existing frameworks and by synthesising

  4. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others


    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  5. Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

    International Nuclear Information System (INIS)

    Cui Wei; Yin Lingling; Dong Lingyue


    Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

  6. Selection for Unequal Densities of Sigma70 Promoter-like Signalsin Different Regions of Large Bacterial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Huerta, Araceli M.; Francino, M. Pilar; Morett, Enrique; Collado-Vides, Julio


    The evolutionary processes operating in the DNA regions that participate in the regulation of gene expression are poorly understood. In Escherichia coli, we have established a sequence pattern that distinguishes regulatory from nonregulatory regions. The density of promoter-like sequences, that are recognizable by RNA polymerase and may function as potential promoters, is high within regulatory regions, in contrast to coding regions and regions located between convergently-transcribed genes. Moreover, functional promoter sites identified experimentally are often found in the subregions of highest density of promoter-like signals, even when individual sites with higher binding affinity for RNA polymerase exist elsewhere within the regulatory region. In order to investigate the generality of this pattern, we have used position weight matrices describing the -35 and -10 promoter boxes of E. coli to search for these motifs in 43 additional genomes belonging to most established bacterial phyla, after specific calibration of the matrices according to the base composition of the noncoding regions of each genome. We have found that all bacterial species analyzed contain similar promoter-like motifs, and that, in most cases, these motifs follow the same genomic distribution observed in E. coli. Differential densities between regulatory and nonregulatory regions are detectable in most bacterial genomes, with the exception of those that have experienced evolutionary extreme genome reduction. Thus, the phylogenetic distribution of this pattern mirrors that of genes and other genomic features that require weak selection to be effective in order to persist. On this basis, we suggest that the loss of differential densities in the reduced genomes of host-restricted pathogens and symbionts is the outcome of a process of genome degradation resulting from the decreased efficiency of purifying selection in highly structured small populations. This implies that the differential

  7. Two negative cis-regulatory regions involved in fruit-specific promoter activity from watermelon (Citrullus vulgaris S.). (United States)

    Yin, Tao; Wu, Hanying; Zhang, Shanglong; Lu, Hongyu; Zhang, Lingxiao; Xu, Yong; Chen, Daming; Liu, Jingmei


    A 1.8 kb 5'-flanking region of the large subunit of ADP-glucose pyrophosphorylase, isolated from watermelon (Citrullus vulgaris S.), has fruit-specific promoter activity in transgenic tomato plants. Two negative regulatory regions, from -986 to -959 and from -472 to -424, were identified in this promoter region by fine deletion analyses. Removal of both regions led to constitutive expression in epidermal cells. Gain-of-function experiments showed that these two regions were sufficient to inhibit RFP (red fluorescent protein) expression in transformed epidermal cells when fused to the cauliflower mosaic virus (CaMV) 35S minimal promoter. Gel mobility shift experiments demonstrated the presence of leaf nuclear factors that interact with these two elements. A TCCAAAA motif was identified in these two regions, as well as one in the reverse orientation, which was confirmed to be a novel specific cis-element. A quantitative beta-glucuronidase (GUS) activity assay of stable transgenic tomato plants showed that the activities of chimeric promoters harbouring only one of the two cis-elements, or both, were approximately 10-fold higher in fruits than in leaves. These data confirm that the TCCAAAA motif functions as a fruit-specific element by inhibiting gene expression in leaves.

  8. Geoheritage promotion of Thonon-les-Bains (Fr) region by the development of a geotourism product (United States)

    Fanguin, Pauline


    Since 2012, the Chablais region (only in France) has acquired the Geopark label. This Geopark contributes to sustainable economic development of the region through geotourism. Moreover, the three Chablais (figure 1) are concerned by an Interreg IV program since 2009 (program of cooperation between European countries). The main objective of this program is to enhance the heritage resources (nature, culture and lifestyle of the region) ( Therefore, the geotourism offer in this area just waiting to expand. The geodidactics models like the simplification of the scientific content are essential for geoheritage promotion, because this content must be available to a wide audience, allowing thereby the geoheritage recognition. The geotourism permits to apply different models (Cayla et al. 2010, Sellier, 2009) through a wide range of geotourism products, like guide, educational panels, thematic hikes and recently developed, new medias (website, smartphone applications). A geotourism product is based on four areas of questioning and was developed by Martin et al. (2010): (1) site (choice of sites to be valued), (2) public (a family public, good example of heterogeneous public), (3) contents (reasoning on geodidactics models) and (4) support (smartphone application). These four areas are very fundamental before the creation of any geotourism product. These reflexions aim to obtain a mediation product that integrates into geotourism offer of a region and contributes to its development and meets public expectations. New media, such as digital media - smartphone, tablets, website - become geotourism products more and more attractive. In addition, the necessary technologies to develop new media help to integrate a high interactivity potential with the public and thus get their attention. The architecture of this geotourism product is based on the new application developed by the Institute of Geography and sustainability, and the Bureau Relief. One

  9. Gel shift analysis of the empA promoter region in Vibrio anguillarum

    Directory of Open Access Journals (Sweden)

    Denkin Steven M


    Full Text Available Abstract Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20, nine salts solution + 200 μg/ml mucus (NSSM, 3M (marine minimal medium, or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V

  10. “Fear or Love Thy Neighbour”? The EU Framework for Promoting Regional Cooperation in the South Caucasus

    Directory of Open Access Journals (Sweden)

    Nelli Babayan


    Full Text Available Building on the model of the enlargement policy, the European Union (EU designed the European Neighbourhood Policy and the Eastern Partnership to further promote its norms and principles. One of the goals of its new policies has been to foster regional cooperation among partner countries and their neighbours. This article specifies the EU’s framework for promoting regional cooperation through the aforementioned policies and discusses its potential impact on the example of the South Caucasus republics of Armenia, Azerbaijan, and Georgia. The South Caucasus has not only been an arena of intraregional conflicts, but has also often been troubled by disputes between its neighbours. This article argues that, due to a lack of proactive and consistent engagement, the EU’s framework risks leaving regional conflicts in the current state of stagnation and without advancement in regional cooperation.

  11. Regional Differences in Correlates of Daily Walking among Middle Age and Older Australian Rural Adults: Implications for Health Promotion

    Directory of Open Access Journals (Sweden)

    James Dollman


    Full Text Available Rural Australians are less physically active than their metropolitan counterparts, and yet very little is known of the candidate intervention targets for promoting physical activity in rural populations. As rural regions are economically, socially and environmentally diverse, drivers of regular physical activity are likely to vary between regions. This study explored the region-specific correlates of daily walking among middle age and older adults in rural regions with contrasting dominant primary industries. Participants were recruited through print and electronic media, primary care settings and community organisations. Pedometers were worn by 153 adults for at least four days, including a weekend day. A questionnaire identified potential intra-personal, social and environmental correlates of physical activity, according to a social ecological framework. Regression modelling identified independent correlates of daily walking separately in the two study regions. In one region, there were independent correlates of walking from all levels of the social ecological framework. In the other region, significant correlates of daily walking were almost all demographic (age, education and marital status. Participants living alone were less likely to be physically active regardless of region. This study highlights the importance of considering region-specific factors when designing strategies for promoting regular walking among rural adults.

  12. Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans. (United States)

    Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce


    Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

  13. Carcass and meat quality determination as a tool to promote local meat consumption in outermost regions of Europe

    DEFF Research Database (Denmark)

    Hernandez Castellano, Lorenzo E; Morales-delaNuez, Antonio; Moreno-Indias, Isabel


    of this study, therefore, was to evaluate local and imported carcasses and meat quality in order to promote the consumption of local breeds, using the Canary Islands (Spain) as a model for other subtropical outermost regions. For this study 20 half-carcasses from Palmera breed and 20 imported half...

  14. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis. (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida


    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  15. New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro. (United States)

    Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja


    Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.

  16. A prospective evaluation of first people's health promotion program design in the goulburn-murray rivers region. (United States)

    Doyle, Joyce; Atkinson-Briggs, Sharon; Atkinson, Petah; Firebrace, Bradley; Calleja, Julie; Reilly, Rachel; Cargo, Margaret; Riley, Therese; Crumpen, Tui; Rowley, Kevin


    Aboriginal Community Controlled Organisations (ACCOs) provide community-focussed and culturally safe services for First Peoples in Australia, including crisis intervention and health promotion activities, in a holistic manner. The ecological model of health promotion goes some way towards describing the complexity of such health programs. The aims of this project were to: 1) identify the aims and purpose of existing health promotion programs conducted by an alliance of ACCOs in northern Victoria, Australia; and 2) evaluate the extent to which these programs are consistent with an ecological model of health promotion, addressing both individual and environmental determinants of health. The project arose from a long history of collaborative research. Three ACCOs and a university formed the Health Promotion Alliance to evaluate their health promotion programs. Local community members were trained in, and contributed to developing culturally sensitive methods for, data collection. Information on the aims and design of 88 health promotion activities making up 12 different programs across the ACCOs was systematically and prospectively collected. There was a wide range of activities addressing environmental and social determinants of health, as well as physical activity, nutrition and weight loss. The design of the great majority of activities had a minimal Western influence and were designed within a local Aboriginal cultural framework. The most common focus of the activities was social connectedness (76 %). Physical activity was represented in two thirds of the activities, and nutrition, weight loss and culture were each a focus of about half of the activities. A modified coding procedure designed to assess the ecological nature of these programs showed that they recruited from multiple settings; targeted a range of individual, social and environmental determinants; and used numerous and innovative strategies to achieve change. First Peoples' health promotion in the

  17. A prospective evaluation of first people’s health promotion program design in the goulburn-murray rivers region

    Directory of Open Access Journals (Sweden)

    Joyce Doyle


    achieve change. Conclusion First Peoples’ health promotion in the Goulburn-Murray Rivers region encompasses a broad range of social, cultural, lifestyle and community development activities, including reclaiming and strengthening cultural identity and social connectedness as a response to colonisation.

  18. Exploring DNA methylation changes in promoter, intragenic, and intergenic regions as early and late events in breast cancer formation

    International Nuclear Information System (INIS)

    Rauscher, Garth H.; Kresovich, Jacob K.; Poulin, Matthew; Yan, Liying; Macias, Virgilia; Mahmoud, Abeer M.; Al-Alem, Umaima; Kajdacsy-Balla, Andre; Wiley, Elizabeth L.; Tonetti, Debra; Ehrlich, Melanie


    Breast cancer formation is associated with frequent changes in DNA methylation but the extent of very early alterations in DNA methylation and the biological significance of cancer-associated epigenetic changes need further elucidation. Pyrosequencing was done on bisulfite-treated DNA from formalin-fixed, paraffin-embedded sections containing invasive tumor and paired samples of histologically normal tissue adjacent to the cancers as well as control reduction mammoplasty samples from unaffected women. The DNA regions studied were promoters (BRCA1, CD44, ESR1, GSTM2, GSTP1, MAGEA1, MSI1, NFE2L3, RASSF1A, RUNX3, SIX3 and TFF1), far-upstream regions (EN1, PAX3, PITX2, and SGK1), introns (APC, EGFR, LHX2, RFX1 and SOX9) and the LINE-1 and satellite 2 DNA repeats. These choices were based upon previous literature or publicly available DNA methylome profiles. The percent methylation was averaged across neighboring CpG sites. Most of the assayed gene regions displayed hypermethylation in cancer vs. adjacent tissue but the TFF1 and MAGEA1 regions were significantly hypomethylated (p ≤0.001). Importantly, six of the 16 regions examined in a large collection of patients (105 – 129) and in 15-18 reduction mammoplasty samples were already aberrantly methylated in adjacent, histologically normal tissue vs. non-cancerous mammoplasty samples (p ≤0.01). In addition, examination of transcriptome and DNA methylation databases indicated that methylation at three non-promoter regions (far-upstream EN1 and PITX2 and intronic LHX2) was associated with higher gene expression, unlike the inverse associations between cancer DNA hypermethylation and cancer-altered gene expression usually reported. These three non-promoter regions also exhibited normal tissue-specific hypermethylation positively associated with differentiation-related gene expression (in muscle progenitor cells vs. many other types of normal cells). The importance of considering the exact DNA region analyzed and the

  19. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions. (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado


    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  20. Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC) (United States)

    Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG


    Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

  1. Hypermethylation of the DPYD promoter region is not a major predictor of severe toxicity in 5-fluorouracil based chemotherapy

    Directory of Open Access Journals (Sweden)

    Aebi Stefan


    Full Text Available Abstract Background The activity of dihydropyrimidine dehydrogenase (DPD, the key enzyme of pyrimidine catabolism, is thought to be an important determinant for the occurrence of severe toxic reactions to 5-fluorouracil (5-FU, which is one of the most commonly prescribed chemotherapeutic agents for the treatment of solid cancers. Genetic variation in the DPD gene (DPYD has been proposed as a main factor for variation in DPD activity in the population. However, only a small proportion of severe toxicities in 5-FU based chemotherapy can be explained with such rare deleterious DPYD mutations resulting in severe enzyme deficiencies. Recently, hypermethylation of the DPYD promoter region has been proposed as an alternative mechanism for DPD deficiency and thus as a major cause of severe 5-FU toxicity. Methods Here, the prognostic significance of this epigenetic marker with respect to severe 5-FU toxicity was assessed in 27 cancer patients receiving 5-FU based chemotherapy, including 17 patients experiencing severe toxic side effects following drug administration, none of which were carriers of a known deleterious DPYD mutation, and ten control patients. The methylation status of the DPYD promoter region in peripheral blood mononuclear cells was evaluated by analysing for each patient between 19 and 30 different clones of a PCR-amplified 209 base pair fragment of the bisulfite-modified DPYD promoter region. The fragments were sequenced to detect bisulfite-induced, methylation-dependent sequence differences. Results No evidence of DPYD promoter methylation was observed in any of the investigated patient samples, whereas in a control experiment, as little as 10% methylated genomic DNA could be detected. Conclusion Our results indicate that DYPD promoter hypermethylation is not of major importance as a prognostic factor for severe toxicity in 5-FU based chemotherapy.

  2. Targets of DNA-binding proteins in bacterial promoter regions present enhanced probabilities for spontaneous thermal openings

    International Nuclear Information System (INIS)

    Apostolaki, Angeliki; Kalosakas, George


    We mapped promoter regions of double-stranded DNA with respect to the probabilities of appearance of relatively large bubble openings exclusively due to thermal fluctuations at physiological temperatures. We analyzed five well-studied promoter regions of procaryotic type and found a spatial correlation between the binding sites of transcription factors and the position of peaks in the probability pattern of large thermal openings. Other distinct peaks of the calculated patterns correlate with potential binding sites of DNA-binding proteins. These results suggest that a DNA molecule would more frequently expose the bases that participate in contacts with proteins, which would probably enhance the probability of the latter to reach their targets. It also stands for using this method as a means to analyze DNA sequences based on their intrinsic thermal properties

  3. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III


    Matsutani Sachiko


    Abstract Background In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFII...

  4. Promoting effect of ethanol on dewetting transition in the confined region of melittin tetramer

    International Nuclear Information System (INIS)

    Ren Xiuping; Zhou Bo; Wang Chunlei


    To study the influence of ethanol molecules on the melittin tetramer folding, we investigated the dewetting transition of the melittin tetramer immersed in pure water and 8% aqueous ethanol solution (mass fraction) by the molecular dynamics simulations. We found that the marked dewetting transitions occurred inside a nanoscale channel of the melittin tetramer both in pure water and in aqueous ethanol solution. Also, ethanol molecules promoted this dewetting transition. We attributed this promoting effect to ethanol molecules which prefer to locate at the liquid-vapor interface and decrease the liquid-vapor surface energy. The results provide insight into the effect of ethanol on the water dewetting phenomena. (authors)

  5. A Participatory Regional Partnership Approach to Promote Nutrition and Physical Activity Through Environmental and Policy Change in Rural Missouri. (United States)

    Barnidge, Ellen K; Baker, Elizabeth A; Estlund, Amy; Motton, Freda; Hipp, Pamela R; Brownson, Ross C


    Rural residents are less likely than urban and suburban residents to meet recommendations for nutrition and physical activity. Interventions at the environmental and policy level create environments that support healthy eating and physical activity. Healthier Missouri Communities (Healthier MO) is a community-based research project conducted by the Prevention Research Center in St. Louis with community partners from 12 counties in rural southeast Missouri. We created a regional partnership to leverage resources and enhance environmental and policy interventions to improve nutrition and physical activity in rural southeast Missouri. Partners were engaged in a participatory action planning process that included prioritizing, implementing, and evaluating promising evidence-based interventions to promote nutrition and physical activity. Group interviews were conducted with Healthier MO community partners post intervention to evaluate resource sharing and sustainability efforts of the regional partnership. Community partners identified the benefits and challenges of resource sharing within the regional partnership as well as the opportunities and threats to long-term partnership sustainability. The partners noted that the regional participatory process was difficult, but the benefits outweighed the challenges. Regional rural partnerships may be an effective way to leverage relationships to increase the capacity of rural communities to implement environmental and policy interventions to promote nutrition and physical activity.

  6. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents. (United States)

    Xu, Meixiang; Nekhayeva, Ilona; Cross, Courtney E; Rondelli, Catherine M; Wickliffe, Jeffrey K; Abdel-Rahman, Sherif Z


    The O6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18-119% increase; P alkylating agents.

  7. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi


    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  8. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)



    Mar 7, 2011 ... promoter methylation in CDH1 gene inactivation in breast cancer, the CpG methylation status of E- ..... 5'CpG island of CDH1 in prostate, lung, liver, bladder, .... and estrogen receptor alpha from Sp1 sites to induce cell cycle.

  9. The effect of mutations in the AmpC promoter region on β-lactam ...

    African Journals Online (AJOL)



    Aug 4, 2008 ... between the -10 and -35 boxes affects the resistance of bacteria to β-lactam antibiotics. .... The chromosomal cephalosporinase gene, ampC, of E. .... mutation in the ampC promoter increasing resistance to β-lactams in.

  10. A distal region of the human TGM1 promoter is required for expression in transgenic mice and cultured keratinocytes

    Directory of Open Access Journals (Sweden)

    Lu Ying


    Full Text Available Abstract Background TGM1(transglutaminase 1 is an enzyme that crosslinks the cornified envelope of mature keratinocytes. Appropriate expression of the TGM1 gene is crucial for proper keratinocyte function as inactivating mutations lead to the debilitating skin disease, lamellar ichthyosis. TGM1 is also expressed in squamous metaplasia, a consequence in some epithelia of vitamin A deficiency or toxic insult that can lead to neoplasia. An understanding of the regulation of this gene in normal and abnormal differentiation states may contribute to better disease diagnosis and treatment. Methods In vivo requirements for expression of the TGM1 gene were studied by fusing various lengths of promoter DNA to a reporter and injecting the DNA into mouse embryos to generate transgenic animals. Expression of the reporter was ascertained by Western blotting and immunohistochemistry. Further delineation of a transcriptionally important distal region was determined by transfections of progressively shortened or mutated promoter DNA into cultured keratinocytes. Results In vivo analysis of a reporter transgene driven by the TGM1 promoter revealed that 1.6 kilobases, but not 1.1 kilobases, of DNA was sufficient to confer tissue-specific and cell layer-specific expression. This same region was responsible for reporter expression in tissues undergoing squamous metaplasia as a response to vitamin A deprivation. Mutation of a distal promoter AP1 site or proximal promoter CRE site, both identified as important transcriptional elements in transfection assays, did not prevent appropriate expression. Further searching for transcriptional elements using electrophoretic mobility shift (EMSA and transfection assays in cultured keratinocytes identified two Sp1 elements in a transcriptionally active region between -1.6 and -1.4 kilobases. While mutation of either Sp1 site or the AP1 site singly had only a small effect, mutation of all three sites eliminated nearly all the

  11. Promoting University and Industry Links at the Regional Level: Comparing China's Reform and International Experience (United States)

    Po, Yang; Cai, Yuzhuo; Lyytinen, Anu; Hölttä, Seppo


    This paper intends to learn from international experiences in order to facilitating China's ongoing regional university transformation with an ultimate goal to enhance the role of university in regional economic development and innovation. In so doing, this paper compares major models of universities of applied sciences (UAS) around the world from…

  12. Murine leukemia virus vector integration favors promoter regions and regional hot spots in a human T-cell line

    International Nuclear Information System (INIS)

    Tsukahara, Tomonori; Agawa, Hideyuki; Matsumoto, Sayori; Matsuda, Mizuho; Ueno, Shuichi; Yamashita, Yuki; Yamada, Koichiro; Tanaka, Nobuyuki; Kojima, Katsuhiko; Takeshita, Toshikazu


    Genomic analysis of integration will be important in evaluating the safety of human gene therapy with retroviral vectors. Here, we investigated MLV vector integration sites in human T-cells, since they are amenable to gene transfer studies, and have been used therapeutically in clinical trials. We mapped 340 MLV vector integration sites in the infected human T-cell clones we established. The data showed that MLV preferred integration near the transcription start sites (±5 kb), near CpG islands (±1 kb), and within the first intron of RefSeq genes. We also identified MLV integration hot spots that contained three or more integrations within a 100 kb region. RT-PCR revealed that mRNA-levels of T-cell clones that contained MLV integrations near transcription start sites or introns were dysregulated compared to the uninfected cells. These studies help define the profile of MLV integration in T-cells and the risks associated with MLV-based gene therapy

  13. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan. (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul


    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society.

  14. Promoting survival: A grounded theory study of consequences of modern health practices in Ouramanat region of Iranian Kurdistan (United States)

    Mohammadpur, Ahmad; Rezaei, Mehdi; Sadeghi, Rasoul


    The aim of this qualitative study is to explore the way people using modern health care perceive its consequences in Ouraman-e-Takht region of Iranian Kurdistan. Ouraman-e-Takht is a rural, highly mountainous and dry region located in the southwest Kurdistan province of Iran. Recently, modern health practices have been introduced to the region. The purpose of this study was to investigate, from the Ouramains' point of view, the impact that modern health services and practices have had on the Ouraman traditional way of life. Interview data from respondents were analyzed by using grounded theory. Promoting survival was the core category that explained the impact that modern health practices have had on the Ouraman region. The people of Ouraman interpreted modern health practices as increasing their quality of life and promoting their survival. Results are organized around this core category in a paradigm model consisting of conditions, interactions, and consequences. This model can be used to understand the impact of change from the introduction of modern health on a traditional society. PMID:20640020

  15. Promotion of physical activity in the European region: content analysis of 27 national policy documents

    DEFF Research Database (Denmark)

    Daugbjerg, Signe B; Kahlmeier, Sonja; Racioppi, Francesca


    . Population groups most in need such as people with low levels of physical activity were rarely specifically targeted. Most policies emphasized the importance of an evaluation. However, only about half of them indicated a related intention or requirement. CONCLUSION: In recent years there has been......BACKGROUND: Over the past years there has been increasing interest in physical activity promotion and the development of appropriate policy. So far, there has been no comprehensive overview of the activities taking place in Europe in this area of public health policy. METHODS: Using different...... search methods, 49 national policy documents on physical activity promotion were identified. An analysis grid covering key features was developed for the analysis of the 27 documents published in English. RESULTS: Analysis showed that many general recommendations for policy developments are being...

  16. Analysis of the Impact of the Flow of Migrant Workers on Regional Economy: Based on the Thought about the Promotion of Jiangxi Regional Economic Competitiveness

    Directory of Open Access Journals (Sweden)

    Sun Yuping


    Full Text Available Labor resource is the necessary productive factor in regional economic development, and one of important indexes to evaluate regional economic competitiveness. The great economic achievement brought by the 30-year reform and opening up of China is due to the fact that China brought the backward advantage of “demographic dividend” into play, promoted the fast development of industrialization and urbanization, and became the second largest economy in the world. The entity of “demographic dividend” is the non-agricultural migrant population, i.e., migrant workers. The transfer employment of migrant workers has typical regional liquidity, and the imbalance of regional economy causes the flow of many migrant workers. In order to achieve harmonious development and coordinated development, underdeveloped areas must understand the character and regulation, adopt positive industrial policy and supportive policy, guide the reasonable flow of migrant workers, and realize the transfer of local employment and citizenization of migrant workers, which can enhance regional economic competitiveness

  17. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.


    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  18. Finding Combination of Features from Promoter Regions for Ovarian Cancer-related Gene Group Classification

    KAUST Repository

    Olayan, Rawan S.


    In classification problems, it is always important to use the suitable combination of features that will be employed by classifiers. Generating the right combination of features usually results in good classifiers. In the situation when the problem is not well understood, data items are usually described by many features in the hope that some of these may be the relevant or most relevant ones. In this study, we focus on one such problem related to genes implicated in ovarian cancer (OC). We try to recognize two important OC-related gene groups: oncogenes, which support the development and progression of OC, and oncosuppressors, which oppose such tendencies. For this, we use the properties of promoters of these genes. We identified potential “regulatory features” that characterize OC-related oncogenes and oncosuppressors promoters. In our study, we used 211 oncogenes and 39 oncosuppressors. For these, we identified 538 characteristic sequence motifs from their promoters. Promoters are annotated by these motifs and derived feature vectors used to develop classification models. We made a comparison of a number of classification models in their ability to distinguish oncogenes from oncosuppressors. Based on 10-fold cross-validation, the resultant model was able to separate the two classes with sensitivity of 96% and specificity of 100% with the complete set of features. Moreover, we developed another recognition model where we attempted to distinguish oncogenes and oncosuppressors as one group from other OC-related genes. That model achieved accuracy of 82%. We believe that the results of this study will help in discovering other OC-related oncogenes and oncosuppressors not identified as yet.

  19. Association of a Human FABP1 Gene Promoter Region Polymorphism with Altered Serum Triglyceride Levels.

    Directory of Open Access Journals (Sweden)

    Xian-E Peng

    Full Text Available Liver fatty acid-binding protein (L-FABP, also known as fatty acid-binding protein 1 (FABP1, is a key regulator of hepatic lipid metabolism. Elevated FABP1 levels are associated with an increased risk of cardiovascular disease (CVD and metabolic syndromes. In this study, we examine the association of FABP1 gene promoter variants with serum FABP1 and lipid levels in a Chinese population. Four promoter single-nucleotide polymorphisms (SNPs of FABP1 gene were genotyped in a cross-sectional survey of healthy volunteers (n = 1,182 from Fuzhou city of China. Results showed that only the rs2919872 G>A variant was significantly associated with serum TG concentration(P = 0.032.Compared with the rs2919872 G allele, rs2919872 A allele contributed significantly to reduced serum TG concentration, and this allele dramatically decreased the FABP1 promoter activity(P < 0.05. The rs2919872 A allele carriers had considerably lower serum FABP1 levels than G allele carriers (P < 0.01. In the multivariable linear regression analysis, the rs2919872 A allele was negatively associated with serum FABP1 levels (β = -0.320, P = 0.003, while serum TG levels were positively associated with serum FABP1 levels (β = 0.487, P = 0.014. Our data suggest that compared with the rs2919872 G allele, the rs2919872 A allele reduces the transcriptional activity of FABP1 promoter, and thereby may link FABP1 gene variation to TG level in humans.

  20. DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep. (United States)

    Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng


    Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

  1. Association of the Resistin Gene Promoter Region Polymorphism with Kawasaki Disease in Chinese Children

    Directory of Open Access Journals (Sweden)

    Ruixi Liu


    Full Text Available Objectives. The −420C>G polymorphism located in the resistin gene (RETN promoter has recently been suggested to play a potential role in proinflammatory conditions and cardiovascular disease. This study investigated the association of the RETN promoter polymorphism with Kawasaki disease (KD and its clinical parameters in Chinese children. Methods. We compared patients with complete KD to incomplete KD children. Genotyping of the RETN promoter polymorphism was performed using MassARRAY system, and serum resistin levels were estimated using the sandwich enzyme immunoassay method. Results. There was no significant difference in RETN (−420C>G genotypes between KD and control groups. However, the frequency of the G allele was higher in iKD patients than in cKD children due to a significantly increased frequency of the GG genotypes. Serum levels of resistin were significantly higher in KD patients than in controls regardless of the presence of coronary artery lesions (CALs. Conclusion. The present findings suggest that while resistin may play a role in the pathogenesis of KD, there is no apparent association between CAL and the RETN (−420C>G gene polymorphism in KD children. However, the diagnosis of iKD is challenging but can be supported by the presence of the G allele and the GG genotypes.

  2. Developing regionally specific grazing practices to promote production, profitability, and environmental quality (United States)

    Rangelands are valued for their capacity to provide diverse suites of ecosystem services, from food production to carbon storage to biological diversity. Although rangelands worldwide share common characteristics, differences among biogeographic regions result in differences in the types of opportun...

  3. Cytosine deletion at AP2-box region of HSP70 promoter and its ...

    Indian Academy of Sciences (India)

    of thermotolerance in cells (Leung et al. 1996). ... region of HSP70 significantly affected cellular thermotol- erance ... The double PCR-RFLP using ScrFI confirmed the occur- ... suade of HSP70 on defense of proteins related to respiration.

  4. Regional differences in gene expression and promoter usage in aged human brains

    KAUST Repository

    Pardo, Luba M.; Rizzu, Patrizia; Francescatto, Margherita; Vitezic, Morana; Leday, Gwenaë l G.R.; Sanchez, Javier Simon; Khamis, Abdullah M.; Takahashi, Hazuki; van de Berg, Wilma D.J.; Medvedeva, Yulia A.; van de Wiel, Mark A.; Daub, Carsten O.; Carninci, Piero; Heutink, Peter


    To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites

  5. Development of model for studies on momentum transfer in electrochemical cells with entry region coil as turbulence promoter (United States)

    Penta Rao, Tamarba; Rajendra Prasad, P.


    Entry region swirl promoters gain importance in industry because of its effectiveness in augmentation of mass and heat transfer augmentation. Design of equipment needs momentum transfer data along with mass or heat transfer data. Hence an experimental investigation was carried out with coaxially placed entry region spiral coil as turbulence promoters on momentum transfer in forced convection flow of electrolyte in circular conduits. Aqueous solution of sodium hydroxide and 0.01 M equimolal Ferri-ferro cyanide system was chosen for the study. The study covered parameters like effect of pitch of the coil, effect of length of the coil, diameter of the coil, diameter of the coil wire, diameter of the annular rod. The promoter is measured by limiting current technique using diffusion controlled electrochemical reactions. The study comprises of evaluation of momentum transfer rates at the outer wall of the electrochemical cell. Pressure drop measurements were also made to obtain the energy consumption pattern. Within the range of variables covered. The results are correlated by the momentum transfer similarity function. Momentum transfer coefficients were evaluated from measured limiting currents. Effect of each parameter was studied in terms of friction factor. A model was developed for momentum transfer. The experimental data on momentum transfer was modeled in terms of momentum transfer function and Reynolds number, geometric parameters.

  6. No evidence for promoter region methylation of the succinate dehydrogenase and fumarate hydratase tumour suppressor genes in breast cancer

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander


    Full Text Available Abstract Background Succinate dehydrogenase (SDH and fumarate hydratase (FH are tricarboxylic acid (TCA cycle enzymes that are also known to act as tumour suppressor genes. Increased succinate or fumarate levels as a consequence of SDH and FH deficiency inhibit hypoxia inducible factor-1α (HIF-1α prolyl hydroxylases leading to sustained HIF-1α expression in tumours. Since HIF-1α is frequently expressed in breast carcinomas, DNA methylation at the promoter regions of the SDHA, SDHB, SDHC and SDHD and FH genes was evaluated as a possible mechanism in silencing of SDH and FH expression in breast carcinomas. Findings No DNA methylation was identified in the promoter regions of the SDHA, SDHB, SDHC, SDHD and FH genes in 72 breast carcinomas and 10 breast cancer cell lines using methylation-sensitive high resolution melting which detects both homogeneous and heterogeneous methylation. Conclusion These results show that inactivation via DNA methylation of the promoter CpG islands of SDH and FH is unlikely to play a major role in sporadic breast carcinomas.

  7. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III

    Directory of Open Access Journals (Sweden)

    Matsutani Sachiko


    Full Text Available Abstract Background In eukaryotes, RNA polymerase III (RNAP III transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs. The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Results Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Conclusion Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and α-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants

  8. Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III. (United States)

    Matsutani, Sachiko


    In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.

  9. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni


    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information.Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  10. Perceptions of health promoters about health promotion programmes for families with adolescents orphaned as a result of AIDS in the rural Hammanskraal region in South Africa

    Directory of Open Access Journals (Sweden)

    Maseapo P. Mthobeni


    Full Text Available South African communities are still greatly affected by the high rate of infection with HIV or who are living with AIDS, mirrored in the 2008 overall national HIV prevalence of 29.3%(UNAIDS 2010:10. In addressing the challenge, the health system is dependent on community care level workers such as caregivers to render health promotion and education in the homes and communities. The caregivers based in the communities are the ones with first-hand information on what is needed for the success of health promotion programmes. This study, aimed at exploring the challenges faced by the health promoters, described their perceptions regarding a health promotion programme for families with adolescents orphaned as a result of AIDS. Data were collected on the purposively selected participants at the rural Hammanskraal region in South Africa and the research question: ‘What is your perception regarding health promotion programmes for families with adolescents orphaned as a result of AIDS’ was asked and discussed by participants in a focus group interview. Data were analysed using the adapted Tesch method to organize and isolate the main categories, sub-categories and themes. The following main categories were isolated: attitudes of adolescents, effectiveness of home visits, need for health education and limited resources. Based on the findings, it was therefore recommended that health care planners assist in the improvement of health promotion and education by using the community and national media, providing information material and providing access to the internet in order to allow more people, including young people, to access the information. Suid-Afrikaanse gemeenskappe word steeds grootliks beïnvloed deur die hoë vlak van MIV en vigs, soos weerspieël in die algehele nasionale MIV-syfer in 2008 van 29.3% (UNAIDS 2010:10. In die aanspreek van hierdie uitdaging is die gesondheidstelsel afhanklik van gemeenskapsorgwerkers om gesondheidsbevordering

  11. MICB gene diversity and balancing selection on its promoter region in Yao population in southern China. (United States)

    Chen, Xiang; Liu, Xuexiang; Wei, Xiaomou; Meng, Yuming; Liu, Limin; Qin, Shini; Liu, Yanyu; Dai, Shengming


    To comprehensively examine the MICB gene polymorphism and identify its differences in Chinese Yao population from other ethnic groups, we investigated the polymorphism in the 5'-upstream regulation region (5'-URR), coding region (exons 2-4), and the 3'-untranslated region (3'-UTR) of MICB gene by using PCR-SBT method in 125 healthy unrelated Yao individuals in Guangxi Zhuang Autonomous Region. Higher polymorphism was observed in the 5'-URR, nine single nucleotide polymorphisms (SNPs) and a two base pairs deletion at position -139/-138 were found in our study. Only five different variation sites, however, were detected in exons 2-4 and three were observed in the 3'-UTR. The minor allele frequencies of all variants were greater than 5%, except for rs3828916, rs3131639, rs45627734, rs113620316, rs779737471, and the variation at position +11803 in the 3'-UTR. The first nine SNPs of 5'-URR and rs1065075, rs1051788 of the coding region showed significant linkage disequilibrium with each other. Ten different MICB extended haplotypes (EH) encompassing the 5'-URR, exons 2-4, and 3'-UTR were found in this population, and the most frequent was EH1 (23.2%). We provided several evidences for balancing selection effect on the 5'-URR of MICB gene in Yao population. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  12. Hypermethylation of the FANCC and FANCL Promoter Regions in Sporadic Acute Leukaemia

    Directory of Open Access Journals (Sweden)

    C. J. Hess


    Full Text Available Objective: Inactivation of the FA-BRCA pathway results in chromosomal instability. Fanconi anaemia (FA patients have an inherited defect in this pathway and are strongly predisposed to the development of acute myeloid leukaemia (AML. Studies in sporadic cancers have shown promoter methylation of the FANCF gene in a significant proportion of various solid tumours. However, only a single leukaemic case with methylation of one of the FA-BRCA genes has been described to date, i.e. methylation of FANCF in cell line CHRF-288. We investigated the presence of aberrant methylation in 11 FA-BRCA genes in sporadic cases of leukaemia.

  13. CAGE-defined promoter regions of the genes implicated in Rett Syndrome

    DEFF Research Database (Denmark)

    Vitezic, Morana; Bertin, Nicolas; Andersson, Robin


    BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

  14. Fish farming as an innovative strategy for promoting food security in drought risk regions of Zimbabwe

    Directory of Open Access Journals (Sweden)

    Elvin Shava


    Full Text Available This article examines the implementation of fish farming as an innovative and economic strategy for promoting food security and dietary diversities among vulnerable households in drought risk areas of Zimbabwe. The declining climatic conditions and lack of economic opportunities in Mwenezi district of Zimbabwe attracted the attention of three nongovernmental organisations (NGOs to implement fish farming as an innovative mechanism to stimulate food security and generate employment in the district. The article used a qualitative research approach that includes semi-structured interviews and secondary data. The purposive sampling technique was adopted to interview participants in Mwenezi district who were involved in fish farming to assess and explore the experiences and benefits they derive from such development projects. Results for the article revealed that fish farming was well embraced by local communities as it led to improvements in food security, household income and employment regeneration. The local government including traditional leadership (Chiefs and Headmen’s supported the NGO activities as they benefited local communities. The article concludes that although fish farming was instrumental in regenerating employment, some participants still fail to participate because of laziness and desire to maintain dependency syndrome. The article recommends the NGOs to launch awareness campaigns in rural communities and increase networking with the donor community which is fundamental in attracting sustainable funding. The government can also promote fish farming in vulnerable rural communities by providing funding and capacity building programmes.

  15. Polymorphism in the oxytocin promoter region in patients with lactase non-persistence is not related to symptoms

    Directory of Open Access Journals (Sweden)

    Simrén Magnus


    Full Text Available Abstract Background Oxytocin and the oxytocin receptor have been demonstrated in the gastrointestinal (GI tract and have been shown to exert physiological effects on gut motility. The role for oxytocin in the pathophysiology of GI complaints is unknown. The aim of this study was to examine genetic variations or polymorphism of oxytocin (OXT and its receptor (OXTR genes in patients with GI complaints without visible organic abnormalities. Methods Genetic variants in the OXT promoter region, and in the OXTR gene in DNA samples from 131 rigorously evaluated patients with Irritable Bowel Syndrome (IBS, 408 homozygous subjects referred for lactase (LCT-13910 C>T, rs4988235 genotyping, and 299 asymptomatic blood donors were compared. One polymorphism related to the OXT gene (rs6133010 A>G and 4 related to the OXTR gene (rs1465386 G>T, rs3806675 G>A, rs968389 A>G, rs1042778 G>T were selected for genotyping using Applied Biosystems 7900 HT allele discrimination assays. Results There were no statistically significant differences in the genotype or allele frequencies in any of the SNPs when IBS patients were compared to healthy controls. Among subjects referred for lactase genotyping, the rs6133010 A>G OXT promoter A/G genotype tended to be more common in the 154 non-persistent (27.3% subjects than in the 254 lactase persistant (18.1% subjects and in the healthy controls (19.4% (p = 0.08. When direct comparing, the A/G genotype was less common in the OXT promoter region in controls (p = 0.09 and in subjects with lactase persistence (p = 0.03 compared to subjects with lactase non-persistence. When healthy controls were viewed according to their own LCT-13910 genotypes, the C/C lactase non-persistent controls had a higher frequency for the OXT promoter A/G genotype than LCT-13910 T/T lactase persistent controls (41.2% vs 13.1%. No significant differences in frequencies of the investigated OXTR SNPs were noted in this study. Conclusion The results suggest

  16. Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia. (United States)

    Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J


    Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Regional efforts to promote forestry best management practices: a southern success story (United States)

    Herb Nicholson; John Colberg; Hughes Simpson; Tom Gerow; Wib Owen


    The Southern Group of State Foresters has a long history of water resource protection efforts, providing leadership in BMP development, improvement, and implementation, enhancing state BMP programs, establishing effective partnerships, and standardizing an approach to consistently monitor implementation across the region.

  18. Evaluation of methylation pattern in promoter region of E-cadherin ...

    African Journals Online (AJOL)

    The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.

  19. Epigenetic changes within the promoter region of the HLA-G gene in ovarian tumors

    Directory of Open Access Journals (Sweden)

    Matyunina Lilya V


    Full Text Available Abstract Background Previous findings have suggested that epigenetic-mediated HLA-G expression in tumor cells may be associated with resistance to host immunosurveillance. To explore the potential role of DNA methylation on HLA-G expression in ovarian cancer, we correlated differences in HLA-G expression with methylation changes within the HLA-G regulatory region in an ovarian cancer cell line treated with 5-aza-deoxycytidine (5-aza-dC and in malignant and benign ovarian tumor samples and ovarian surface epithelial cells (OSE isolated from patients with normal ovaries. Results A region containing an intact hypoxia response element (HRE remained completely methylated in the cell line after treatment with 5-aza-dC and was completely methylated in all of the ovarian tumor (malignant and benign samples examined, but only variably methylated in normal OSE samples. HLA-G expression was significantly increased in the 5-aza-dC treated cell line but no significant difference was detected between the tumor and OSE samples examined. Conclusion Since HRE is the binding site of a known repressor of HLA-G expression (HIF-1, we hypothesize that methylation of the region surrounding the HRE may help maintain the potential for expression of HLA-G in ovarian tumors. The fact that no correlation exists between methylation and HLA-G gene expression between ovarian tumor samples and OSE, suggests that changes in methylation may be necessary but not sufficient for HLA-G expression in ovarian cancer.

  20. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.


    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  1. Inter-organizational relations for regional development: an expansion policy promoted by the federal network of professional education, science & technology

    Directory of Open Access Journals (Sweden)

    Cleidson Nogueira Dias


    Full Text Available This research paper examines the importance of inter-organizational network management as a government policy tool to promote regional development. This pattern requires Federal Government intervention so as to compensate for the imbalance that this causes and to guarantee that economic growth resulting from government actions leads to development in all regions of the country, thereby avoiding the traditional mechanisms of wealth concentration. For this, a methodology of content analysis was used based on a relevant public policy aimed at promoting development within Brazil and by analyzing the data collected in relation to the current theory related to strategy, local development and inter-organizational networks in general.  The analysis results show that, when the policy studied in this work, applied in the federal network of professional education, science & technology, was implemented the networks had a positive influence on the outcome of the policy objectives and represented an extremely powerful support tool, being one of the most important factors to boost development.

  2. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M


    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  3. Export Promotion Aims and Reality: A Comparison of the Iberian, Baltic and Central European Region

    Directory of Open Access Journals (Sweden)

    Éltető Andrea


    Full Text Available As a consequence of the international crisis in 2008-2009, the role of exports in economic growth came into focus in most countries. Exports of EU Member States gained momentum from 2010 onward but with certain changes in their structure and direction. In several countries, the turn towards non-EU areas, such as China or Latin America was part of the state export strategy. On the one hand, our article describes these foreign trade strategies and their institutional framework of the Iberian, Baltic and Central European governments, detecting possible similarities. On the other hand, we analyse recent export data. This way we can get a picture on the structure and direction of exports of periphery economies and this can be compared to the aims of the given states. Our hypothesis is that there is a gap between the reality and the intentions of the governments. The size of this gap varies and is influenced by certain factors such as the different involvement of multinational companies in foreign trade or the different economic structure of these countries. In our paper we list which countries adopted a government strategy and with what aim. We provide a short literature review on state trade promotion policies and discuss these policies and their institutions in the Baltic, Visegrád and Iberian countries.

  4. Methylation of Promoter Regions of Genes of the Human Intrauterine Renin Angiotensin System and Their Expression

    Directory of Open Access Journals (Sweden)

    Shane D. Sykes


    Full Text Available The intrauterine renin angiotensin system (RAS is implicated in placentation and labour onset. Here we investigate whether promoter methylation of RAS genes changes with gestation or labour and if it affects gene expression. Early gestation amnion and placenta were studied, as were term amnion, decidua, and placenta collected before labour (at elective caesarean section or after spontaneous labour and delivery. The expression and degree of methylation of the prorenin receptor (ATP6AP2, angiotensin converting enzyme (ACE, angiotensin II type 1 receptor (AGTR1, and two proteases that can activate prorenin (kallikrein, KLK1, and cathepsin D, CTSD were measured by qPCR and a DNA methylation array. There was no effect of gestation or labour on the methylation of RAS genes and CTSD. Amnion and decidua displayed strong correlations between the percent hypermethylation of RAS genes and CTSD, suggestive of global methylation. There were no correlations between the degree of methylation and mRNA abundance of any genes studied. KLK1 was the most methylated gene and the proportion of hypermethylated KLK1 alleles was lower in placenta than decidua. The presence of intermediate methylated alleles of KLK1 in early gestation placenta and in amnion after labour suggests that KLK1 methylation is uniquely dynamic in these tissues.

  5. Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty. (United States)

    Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro


    Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

  6. Tobacco advertising, promotion and sponsorship in entertainment media: a phenomenon requiring stronger controls in the Eastern Mediterranean Region. (United States)

    El-Awa, Fatimah M S; El Naga, Randa Abou; Labib, Sahar; Latif, Nisreen Abdel


    Tobacco use and placement of tobacco products in television (TV) productions and movies is a way to promote tobacco use while avoiding tobacco advertising bans that exist in most countries. The fact that such productions are broadcast widely and viewed by millions, including children and young people, is of concern. This paper reviews the evidence on the use of tobacco advertising, promotion and sponsorship (TAPS) in TV and films in the Eastern Mediterranean Region and the ways to combat it. Evidence from Egypt shows considerable and increasing use of tobacco products by actors on screen, including female actors, in programmes aired during Ramadan in 2015-2017. A study of Iranian movies in 2015 showed that tobacco scenes in Iranian movies were increasing. In 2014, the WHO Regional Office for the Eastern Mediterranean held a consultative meeting on TAPS in drama. The consultation recommended regulating the tobacco presence in movies and TV through complete implementation of Article 13 of the WHO FCTC, and raising the issue to the WHO FCTC Conference of the Parties. In 2016, the Conference of the Parties called on parties to consider scaling up the implementation of WHO FCTC Article 13 and monitoring the use of TAPS in entertainment media in accordance with national legislation. A comprehensive approach is essential to end the tobacco industry's use of TV productions and movies to promote their products. Copyright © World Health Organization (WHO) 2018. Some rights reserved. This work is available under the CC BY-NC-SA 3.0 IGO license (

  7. Cloning and analysis of the promoter region of the human fibronectin gene

    International Nuclear Information System (INIS)

    Dean, D.C.; Bowlus, C.L.; Bourgeois, S.


    Human fibronectin (FN) genomic clones were isolated by screening a human genomic library with a 75-base oligonucleotide. The sequence of the oligonucleotide corresponds to a region near the 5' end of the human FN cDNA clone pFH6 that contains the amino-terminal coding sequences but does not extend to the 5' end of the mRNA. The 5' end of the FN gene is found on a 3.7-kilobase-pair EcoRI fragment that contains about 2.7 kilobase pairs of flanking sequence. The first exon is 414 base pairs long, with a 5' untranslated region of 267 base pairs. As deduced on the basis of the position of the initiation codon, FN is synthesized with a 31-residue amino acid extension on the amion terminus that is not present in the mature polypeptide. This amino-terminal extension appears to contain both a signal peptide and a propeptide. The first 200 base pairs of 5'-flanking sequence is very G+C rich. Upstream of this the sequence becomes relatively A+T rich. The sequence ATATAA is found at -25 and the sequence CAAT is present at -150. The sequence GGGGCGGGGC at -102 exhibits homology to the binding site for the transcription factor SP1, and the sequence TGACGTCA at -173 exhibits homology to 5'-flanking sequences important for induction by cAMP

  8. Efforts to promote regional security dialogue and cooperation in the North Pacific

    International Nuclear Information System (INIS)

    Mason, P.


    Indifference to the new realities of the post-cold war era does nothing to preserve the traditional priorities laid down in the Final Document of the first special session on disarmament. On the contrary, such attitudes directly contribute to the trend towards marginalization which began when publics no longer feared the threat of a nuclear holocaust. It is believed that the expertise of forty years of multilateral arms control and disarmament efforts is directly relevant to the broader efforts of the international community to restore, maintain and promote international peace and security. Who can deny that confidence-building is central to preventive diplomacy? Or that the arms control component-from disarming to demobilization-is not equally central to peace operations whether they be traditional peace-keeping or post-conflict peace-building? Indeed the success or failure of the disarmament aspect of a peace operation is often critical to its overall success-Somalia surely being one recent sad example. The multilateral disarmament community must apply itself more directly and systematically to these broader problems - just as the United Nations Secretariat has increasingly begun to do - or risk indifference from Governments forced to make tough choices against a range of competing priorities. It is undeniably true that the post-cold war has significantly increased the potential for the international community to negotiate historic new multilateral disarmament treaties. And this window of opportunity must be utilized to the fullest. At the same time, due account must be taken of the hard fact that, for an increasing number of countries, expensive obligations in relation to advanced unconventional weapons which neither they nor their neighbours seek to possess may count for less than practical assistance in finding solutions to more parochial, but no less urgent, problems

  9. Clinicopathologic Risk Factor Distributions for MLH1 Promoter Region Methylation in CIMP-Positive Tumors. (United States)

    Levine, A Joan; Phipps, Amanda I; Baron, John A; Buchanan, Daniel D; Ahnen, Dennis J; Cohen, Stacey A; Lindor, Noralane M; Newcomb, Polly A; Rosty, Christophe; Haile, Robert W; Laird, Peter W; Weisenberger, Daniel J


    The CpG island methylator phenotype (CIMP) is a major molecular pathway in colorectal cancer. Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations, and family colorectal cancer history with MLH1 methylation status in a large population-based sample of CIMP-positive colorectal cancers defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, and more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR, 0.50; 95% confidence interval, 0.31-0.82). These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. MLH1 DNA methylation status should be taken into account in etiologic studies. ©2015 American Association for Cancer Research.

  10. Clinicopathological risk factor distributions for MLH1 promoter region methylation in CIMP positive tumors (United States)

    Levine, A. Joan; Phipps, Amanda I.; Baron, John A.; Buchanan, Daniel D.; Ahnen, Dennis J.; Cohen, Stacey A.; Lindor, Noralane M.; Newcomb, Polly A.; Rosty, Christophe; Haile, Robert W.; Laird, Peter W.; Weisenberger, Daniel J.


    Background The CpG Island Methylator Phenotype (CIMP) is a major molecular pathway in colorectal cancer (CRC). Approximately 25% to 60% of CIMP tumors are microsatellite unstable (MSI-H) due to DNA hypermethylation of the MLH1 gene promoter. Our aim was to determine if the distributions of clinicopathologic factors in CIMP-positive tumors with MLH1 DNA methylation differed from those in CIMP-positive tumors without DNA methylation of MLH1. Methods We assessed the associations between age, sex, tumor-site, MSI status BRAF and KRAS mutations and family CRC history with MLH1 methylation status in a large population-based sample of CIMP-positive CRCs defined by a 5-marker panel using unconditional logistic regression to assess the odds of MLH1 methylation by study variables. Results Subjects with CIMP-positive tumors without MLH1 methylation were significantly younger, more likely to be male, more likely to have distal colon or rectal primaries and the MSI-L phenotype. CIMP-positive MLH1-unmethylated tumors were significantly less likely than CIMP-positive MLH1-methylated tumors to harbor a BRAF V600E mutation and significantly more likely to harbor a KRAS mutation. MLH1 methylation was associated with significantly better overall survival (HR=0.50; 95% Confidence Interval (0.31, 0.82)). Conclusions These data suggest that MLH1 methylation in CIMP-positive tumors is not a completely random event and implies that there are environmental or genetic determinants that modify the probability that MLH1 will become methylated during CIMP pathogenesis. Impact MLH1 DNA methylation status should be taken into account in etiologic studies. PMID:26512054

  11. Promoting Vehicle to Grid (V2G) in the Nordic Region

    DEFF Research Database (Denmark)

    Kester, Johannes; Noel, Lance; Zarazua de Rubens, Gerardo


    Vehicle to Grid (V2G) holds the promise of cheap, flexible, and fast-responding storage through the use of electric vehicle batteries. Unfortunately, infrastructure, battery degradation and consumer awareness are only some of the challenges to a faster development of this technology. This paper...... offers a qualitative comparative analysis that draws on a subsample of 227 semistructured interviews on electric vehicles with both transportation and electricity experts from 201 institutions and 17 cities within the Nordic region to discuss the reasoning and arguments behind V2G incentives and policy...... mechanisms. A frequency analysis of the most coded V2G responses favoured an update of the electricity market regulation – in particular in relation to electricity taxation and aggregator markets – and support for pilot projects. However, the analysis overall implies that V2G, in contrast to EVs...

  12. Cis-acting elements in the promoter region of the human aldolase C gene. (United States)

    Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F


    We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

  13. Revolutionising engineering education in the Middle East region to promote earthquake-disaster mitigation (United States)

    Baytiyeh, Hoda; Naja, Mohamad K.


    Due to the high market demands for professional engineers in the Arab oil-producing countries, the appetite of Middle Eastern students for high-paying jobs and challenging careers in engineering has sharply increased. As a result, engineering programmes are providing opportunities for more students to enrol on engineering courses through lenient admission policies that do not compromise academic standards. This strategy has generated an influx of students who must be carefully educated to enhance their professional knowledge and social capital to assist in future earthquake-disaster risk-reduction efforts. However, the majority of Middle Eastern engineering students are unaware of the valuable acquired engineering skills and knowledge in building the resilience of their communities to earthquake disasters. As the majority of the countries in the Middle East are exposed to seismic hazards and are vulnerable to destructive earthquakes, engineers have become indispensable assets and the first line of defence against earthquake threats. This article highlights the contributions of some of the engineering innovations in advancing technologies and techniques for effective disaster mitigation and it calls for the incorporation of earthquake-disaster-mitigation education into academic engineering programmes in the Eastern Mediterranean region.

  14. Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males. (United States)

    Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen


    The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

  15. E-Cigarettes: Implications for Health Promotion in the Asian Pacific Region. (United States)

    Jancey, Jonine; Maycock, Bruce; McCausland, Kahlia; Howat, Peter


    Since their introduction to the United States in 2007, electronic cigarettes (e-cigarettes) use has grown exponentially. This rapid growth in e-cigarette use has been heralded by some as a potential important public health measure that could ultimately replace tobacco cigarettes, while others recommend a cautionary approach until there is clear evidence they will not become "new tobacco" bringing a possible myriad of other problems. E-cigarettes may have real benefits, however they do expose users and those nearby to organic compounds, solvents and particulate matter, with there being limited data relating to their health impact. It is unclear as to whether this relatively new device has the potential to exacerbate nicotine addictions, or play a part in reducing harm and smoking cessation. The fundamental requirement of public health practice is to do no harm and from the inconclusive evidence we have to date on e-cigarettes, it appears a cautious approach is warranted. This commentary reviews evidence that supports a cautious approach to e-cigarette availability in Australia and the Asian Pacific region.

  16. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P


    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  17. Identification of a 450-bp region of human papillomavirus type 1 that promotes episomal replication in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Chattopadhyay, Anasuya; Schmidt, Martin C.; Khan, Saleem A.


    Human papillomaviruses (HPVs) replicate as nuclear plasmids in infected cells. Since the DNA replication machinery is generally conserved between humans and Saccharomyces cerevisiae, we studied whether HPV-1 DNA can replicate in yeast. Plasmids containing a selectable marker (with or without a yeast centromere) and either the full-length HPV-1 genome or various regions of the viral long control region (LCR) and the 3' end of the L1 gene were introduced into S. cerevisiae and their ability to replicate episomally was investigated. Our results show that HPV-1 sequences promote episomal replication of plasmids although the yeast centromere is required for plasmid retention. We have mapped the autonomously replicating sequence activity of HPV-1 DNA to a 450 base-pair sequence (HPV-1 nt 6783-7232) that includes 293 nucleotides from the 5' region of the viral LCR and 157 nucleotides from the 3' end of the L1 gene. The HPV-1 ARS does not include the binding sites for the viral E1 and E2 proteins, and these proteins are dispensable for replication in S. cerevisiae

  18. Analysis of upstream promoter region and corresponding 5’ UTR of glucokinase (GCK gene in horse breeds

    Directory of Open Access Journals (Sweden)

    L. Minieri


    Full Text Available A region of glucokinase (GCK gene was sequenced in 14 horses of 14 different breeds. The resulting GCK nucleotide sequence (GenBank number EF136885 showed 77% homology with human GCK gene portion containing the upstream promoter region and the corresponding 5’ UTR of the exon 1. Conserved regulatory sequences near the putative transcriptional start site were identified. The obtained sequences were aligned to detect polymorphism. A new C>T transition within the 5’ UTR of exon 1 was found. Allele frequencies of this polymorphism were studied by PCR-RFLP in 193 horses of 14 breeds (Bardigiano, 21; Esperia Pony, 5; Haflinger, 10; Italian Heavy Draught Horse, 28; Italian Saddle, 25; Italian Trotter, 16; Lipizzan, 12; Maremmano, 15; Murgese, 14; Norico, 10; Salernitano, 12; Thoroughbred, 10; Tolfetano, 7 and Ventasso Horse, 8. The polymorphism was found in all breeds and differences in allelic frequencies among the breeds were observed. The new SNP identified within a regulative region of GCK gene, which plays an important role in insulin secretion and feeding behaviour, could be used for association studies with performance traits of the horses.

  19. Nonrandom community assembly and high temporal turnover promote regional coexistence in tropics but not temperate zone. (United States)

    Freestone, Amy L; Inouye, Brian D


    A persistent challenge for ecologists is understanding the ecological mechanisms that maintain global patterns of biodiversity, particularly the latitudinal diversity gradient of peak species richness in the tropics. Spatial and temporal variation in community composition contribute to these patterns of biodiversity, but how this variation and its underlying processes change across latitude remains unresolved. Using a model system of sessile marine invertebrates across 25 degrees of latitude, from the temperate zone to the tropics, we tested the prediction that spatial and temporal patterns of taxonomic richness and composition, and the community assembly processes underlying these patterns, will differ across latitude. Specifically, we predicted that high beta diversity (spatial variation in composition) and high temporal turnover contribute to the high species richness of the tropics. Using a standardized experimental approach that controls for several confounding factors that hinder interpretation of prior studies, we present results that support our predictions. In the temperate zone, communities were more similar across spatial scales from centimeters to tens of kilometers and temporal scales up to one year than at lower latitudes. Since the patterns at northern latitudes were congruent with a null model, stochastic assembly processes are implicated. In contrast, the communities in the tropics were a dynamic spatial and temporal mosaic, with low similarity even across small spatial scales and high temporal turnover at both local and regional scales. Unlike the temperate zone, deterministic community assembly processes such as predation likely contributed to the high beta diversity in the tropics. Our results suggest that community assembly processes and temporal dynamics vary across latitude and help structure and maintain latitudinal patterns of diversity.

  20. The effect of phenobarbital on the methylation level of the p16 promoter region in rat liver

    International Nuclear Information System (INIS)

    Kostka, Grazyna; Urbanek, Katarzyna; Ludwicki, Jan K.


    It has been suggested that non-genotoxic carcinogens (NGCs) may cause modification of the DNA methylation status. We studied the effects of phenobarbital (PB) - a non-genotoxic rodent liver carcinogen - on the methylation level of the promoter region of the p16 suppressor gene, as well as on hepatomegaly, DNA synthesis, and DNA-methyltransferase (DNMTs) activity in the rat liver. Male Wistar rats received PB in 1, 3 or 14 daily oral doses (at 24-h intervals), each equivalent to 1/10 of the LD 50 value. The study showed that PB has caused persistent elevation in relative liver weight (RLW) as well as a transient increase in DNA synthesis. This suggests that the PB-induced increase in RLW was due to a combination of both hyperplasia and hypertrophy of liver cells. The effect of PB on DNA synthesis corresponded to an increase in the methylation pattern of the p16 promoter sequence. Methylation of cytosine in the analyzed CpG sites of the p16 gene was found after short exposure of the animals to PB. Treatment of rats with PB for 1 and 3 days also produced an increase in nuclear DNMTs activity. After prolonged administration (14 days), DNA synthesis declined, returning to the control level. No changes in methylation of the p16 gene nor in DNMTs activity were observed. The reversibility of early induced changes in target tissues is a mark characteristic of tumor promoters. Thus, transient changes in methylation of the p16 gene, although their direct role in the mechanisms of PB toxicity, including its carcinogenic action, remains doubtful, may therefore be a significant element of such processes


    Directory of Open Access Journals (Sweden)

    Alexandru NEDELEA


    Full Text Available In order to establish an adequate balance between tourists' welfare, the needs of the natural and cultural environment, as well as to develop tourist destinations and organizations' competitiveness, it is necessary to carry out a global and integrated approach, where all interested parties share the same goals regarding the durability of tourism and the approached challenges. The purpose of this work is to identify the factors of reduced risk having a major impact over the sustainability of the tourist region under analysis and to highlight the risk factors' connections and impact in order to minimize and eliminate them, with direct effects over the awareness of tourist industry's values. The identification of lasting development's indicators will take into account all these three aspects of the durable development of tourism, namely ecological, economical and social factors, that play a part in highlighting the real performance of a tourist destination. All these aspects are absolutely necessary for the promotion of the Danube's tourist potential, achievable through the emphasis of the relevant values from the tourist patrimony of the county of Galati. The promotion of the Danube' tourist potential presupposes a series of objectives that are subordinated to the general direction that is marked at the national level, respectively Romania's transformation into a qualitative tourist destination based on its natural and cultural patrimony, in order to correspond to the European Union standards. The new policy regarding tourism proposed by the European Commission aims at offering constant support for this industry to be able to face different challenges, by promoting also competitiveness in general.

  2. Combgap Promotes Ovarian Niche Development and Chromatin Association of EcR-Binding Regions in BR-C. (United States)

    Hitrik, Anna; Popliker, Malka; Gancz, Dana; Mukamel, Zohar; Lifshitz, Aviezer; Schwartzman, Omer; Tanay, Amos; Gilboa, Lilach


    The development of niches for tissue-specific stem cells is an important aspect of stem cell biology. Determination of niche size and niche numbers during organogenesis involves precise control of gene expression. How this is achieved in the context of a complex chromatin landscape is largely unknown. Here we show that the nuclear protein Combgap (Cg) supports correct ovarian niche formation in Drosophila by controlling ecdysone-Receptor (EcR)- mediated transcription and long-range chromatin contacts in the broad locus (BR-C). Both cg and BR-C promote ovarian growth and the development of niches for germ line stem cells. BR-C levels were lower when Combgap was either reduced or over-expressed, indicating an intricate regulation of the BR-C locus by Combgap. Polytene chromosome stains showed that Cg co-localizes with EcR, the major regulator of BR-C, at the BR-C locus and that EcR binding to chromatin was sensitive to changes in Cg levels. Proximity ligation assay indicated that the two proteins could reside in the same complex. Finally, chromatin conformation analysis revealed that EcR-bound regions within BR-C, which span ~30 KBs, contacted each other. Significantly, these contacts were stabilized in an ecdysone- and Combgap-dependent manner. Together, these results highlight Combgap as a novel regulator of chromatin structure that promotes transcription of ecdysone target genes and ovarian niche formation.

  3. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    Energy Technology Data Exchange (ETDEWEB)

    Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)


    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  4. Competitive Promoter-Associated Matrix Attachment Region Binding of the Arid3a and Cux1 Transcription Factors

    Directory of Open Access Journals (Sweden)

    Dongkyoon Kim


    Full Text Available Arid3a/Bright/Dril1 is a B cell-specific transactivator that regulates immunoglobulin heavy chain (IgH gene transcription by binding promoter and enhancer-associated matrix attachment regions (MARs within the IgH gene locus. Promoter MAR-mediated Arid3a transactivation is antagonized by direct competition of MAR binding by Cux1/CDP—a ubiquitously expressed repressor originally termed NF-μNR. We report that the NF-μNR complex includes Arid3a in B cells but not in non-B cells through mobility shift assays. The binding activity of NF-μNR and Arid3a in B cells is reciprocally altered during the cell division cycle and by the B cell mitogen lipopolysaccharide LPS. LPS treatment had no effect on Arid3a localization but increased its total abundance within the nucleus and cytoplasm. We show that this increased level of Arid3a is capable of displacing Cux from the MARs to facilitate IgH gene transcription. Finally, we showed that the MARs (termed Bf150 and Tx125 associated with the VH1 rearranged variable region expressed in the S107 murine plasmacytoma, can repress reporter gene transcription in non-B cells and that they can relieve the repression mediated by Eμ enhancer in B cells. These results have significant implications for early human development and demonstrate that MARs in IgH locus, NF-µNR and Arid3a regulate IgH gene expression in a concerted fashion. This paves the way for future studies examining the misregulation of this pathway in pediatric disease.

  5. High fructose consumption induces DNA methylation at PPARα and CPT1A promoter regions in the rat liver

    International Nuclear Information System (INIS)

    Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji


    DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.

  6. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements. (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A


    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  7. Green Tourism in Mountain Regions - Reducing Vulnerability and Promoting People and Place Centric Development in the Himalayas

    Institute of Scientific and Technical Information of China (English)

    R. B. Singh; D. K. Mishra


    In recent years, mountain regions are attracting great attention to Indian tourists in general and foreign tourists in particular. The potential mountain resources for promoting green tourism are enormous in the form of natural and cultural heritage such as biosphere reserves, flora and fauna, lakes and rivers and traditional rural resources. In order to utilise tourism industry market, uncontrolled numbers of tourists and related haphazard infrastructural facilities in the vulnerable mountain regions pose serious environmental implications. The ecological pressures are threatening land, water and wild life resources through direct and indirect environmental impacts together with generation of solid and liquid wastes, so green tourism is emerging as an important task in order to develop new relationship between communities, government agencies and private sectors. The strategy focuses on ecological understanding, environmental protection and ecodevelopment. The major attributes of the green tourism include environmental conservation and education and distribution of income to local people based on strong partnership. Various knowledge systems go a long way for achieving the goals of the green tourism, which creates awareness about the value of environmental resources.Mountains have ecological, recreational, educational and scientific values, which need to be utilised in sustainable way. Various tourist activities and facilities need to be diversified in order to achieve multiple benefits including scientific field excursion,recreation in natural and cultural areas, community festivals and sport tourisms. Green tourism considers tourism development as an integral part of a national and regional development. The paper discusses the social, economic and environmental dimensions of the green tourism with particular reference to village tourism development programme taking empirical evidences from the Himalaya. Such programme also minimises biophysical and human

  8. Functional Analysis of Promoter Region from Eel Cytochrome P450 1A1 Gene in Transgenic Medaka. (United States)

    Ogino; Itakura; Kato; Aoki; Sato


    : Transcription of the CYP1A1 genes in mammals and fish is stimulated by polyaromatic hydrocarbons. DNA sequencing analysis revealed that CYP1A1 gene in eel (Anguilla japonica) contains two kinds of putative cis-acting regulatory elements, XRE (xenobiotic-responsive element) and ERE (estrogen-responsive element). XRE is known as the enhancer that is responsible for the inducibility of the genes of CYP1A1 and some other drug-metabolizing enzymes. In the eel CYP1A1 gene, XRE motifs are distributed as follows: five times in the region from -2136 to -1125 bp, XRE(-6) to (-2); once in the proximal basal promoter region, XRE(-1); and once in the first intron, XRE(+1). The region between XRE(-2) and XRE(-1) contains three ERE motifs. To investigate the function of the cis-acting regulatory elements in the eel CYP1A1 gene, recombinant plasmids prepared with its 5' upstream sequence and the structural gene for luciferase were microinjected into fertilized eggs of medaka at the one-cell stage. Hatched fry were treated with 3-methylcholanthrene, and the transcription efficiency was assayed using competitive polymerase chain reaction analysis. Deletion of the region containing the five XREs, XRE(-6) to XRE(-2), and the point mutation of XRE(-1) reduced the inducible expressions by 75% and 56%, respectively, showing apparent dependency of the drug induction on the XREs. Constitutive expression, however, was not significantly affected by deletion or disruption of the XREs. When the region between XRE(-2) and XRE(-1) containing no XREs but three ERE motifs was internally deleted, the inducible expression and the constitutive expression were reduced by 88% and 75%, respectively. Replacement of this region with a partial fragment of eel CYP1A1 complementary DNA, with slight alteration of the distance between the five XREs and XRE(-1), reduced the inducible expression and the constitutive expression by 91% and 60%, respectively. These results strongly suggest that not only XRE but

  9. DNA methylation in Cosmc promoter region and aberrantly glycosylated IgA1 associated with pediatric IgA nephropathy.

    Directory of Open Access Journals (Sweden)

    Qiang Sun

    Full Text Available IgA nephropathy (IgAN is one of the most common glomerular diseases leading to end-stage renal failure. Elevation of aberrantly glycosylated IgA1 is a key feature of it. The expression of the specific molecular chaperone of core1ß1, 3galactosyl transferase (Cosmc is known to be reduced in IgAN. We aimed to investigate whether the methylation of CpG islands of Cosmc gene promoter region could act as a possible mechanism responsible for down-regulation of Cosmc and related higher secretion of aberrantly glycosylated IgA1in lymphocytes from children with IgA nephropathy. Three groups were included: IgAN children (n = 26, other renal diseases (n = 11 and healthy children (n = 13. B-lymphocytes were isolated and cultured, treated or not with IL-4 or 5-Aza-2'-deoxycytidine (AZA. The levels of DNA methylation of Cosmc promotor region were not significantly different between the lymphocytes of the three children populations (P = 0.113, but there were significant differences between IgAN lymphocytes and lymphocytes of the other two children populations after IL-4 (P<0.0001 or AZA (P<0.0001. Cosmc mRNA expression was low in IgAN lymphocytes compared to the other two groups (P<0.0001. The level of aberrantly glycosylated IgA1 was markedly higher in IgAN group compared to the other groups (P<0.0001. After treatment with IL-4, the levels of Cosmc DNA methylation and aberrantly glycosylated IgA1 in IgAN lymphocytes were remarkably higher than the other two groups (P<0.0001 with more markedly decreased Cosmc mRNA content (P<0.0001. After treatment with AZA, the levels in IgAN lymphocytes were decreased, but was still remarkably higher than the other two groups (P<0.0001, while Cosmc mRNA content in IgAN lymphocytes were more markedly increased than the other two groups (P<0.0001. The alteration of DNA methylation by IL-4 or AZA specifically correlates in IgAN lymphocytes with alterations in Cosmc mRNA expression and with the level of aberrantly glycosylated

  10. Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S. [Univ. of Bonn (Germany)] [and others


    In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains a functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.

  11. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill. (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam


    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  12. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients. (United States)

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J


    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  13. Effect of Promoter Region Mutations and mgrA Overexpression on Transcription of norA, Which Encodes a Staphylococcus aureus Multidrug Efflux Transporter


    Kaatz, Glenn W.; Thyagarajan, Rama V.; Seo, Susan M.


    NorA is a Staphylococcus aureus multidrug transporter that confers resistance to structurally distinct compounds. The MgrA global regulatory protein is reported to augment norA expression when mgrA is overexpressed from an undefined plasmid-based promoter. Further details about norA regulatory mechanisms are scant. A chromosomal norA::lacZ transcriptional fusion was constructed in different S. aureus strains, and allele replacement was used to define the relevance of promoter region sequences...

  14. Polymorphism of the promoter region and exon 1 of the CTLA4 gene in endemic pemphigus foliaceus (fogo selvagem

    Directory of Open Access Journals (Sweden)

    D.P. Pavoni


    Full Text Available Endemic pemphigus foliaceus (EPF is an autoimmune bullous skin disease characterized by acantholysis and antibodies against a desmosomal protein, desmoglein 1. Genetic and environmental factors contribute to development of this multifactorial disease. HLA class II and some cytokine gene polymorphisms are the only genetic markers thus far known to be associated with susceptibility to or protection from EPF. The cytotoxic T-lymphocyte antigen-4 gene (CTLA4 encodes a key immunoreceptor molecule that regulates and inhibits T-cell proliferation. It participates in the regulatory process controlling autoreactivity and therefore has been considered a strong candidate gene in autoimmune diseases. In the search for genes that might influence EPF pathogenesis, we analyzed variants of the CTLA4 gene in a sample of 118 patients and 291 controls from a Brazilian population. This is the first study investigating the possible role of polymorphisms of the 2q33 chromosomal region in differential susceptibility to pemphigus foliaceus. Promoter region and exon 1 single nucleotide polymorphisms -318 (C,T and 49 (A,G were genotyped using sequence-specific oligonucleotide probes after amplification by the polymerase chain reaction. The allelic and genotypic frequencies did not differ significantly between the patient and the control groups (-318T: 9.8 and 10.9%, 49G: 33.0 and 35.2% were the allelic frequencies in patients and controls, respectively. In addition, no significant difference was found when the patient and control population samples were stratified by the presence of HLA-DRB1 alleles. We conclude that the CTLA4 -318 (C,T and 49 (A,G polymorphisms do not play a major role in EPF development.

  15. RNA polymerase II interacts with the promoter region of the noninduced hsp70 gene in Drosophila melanogaster cells

    International Nuclear Information System (INIS)

    Gilmour, D.S.; Lis, J.T.


    By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation

  16. Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

    International Nuclear Information System (INIS)

    Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.


    The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

  17. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng


    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  18. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.


    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  19. The relationship in Japanese infants between a genetic polymorphism in the promoter region of the insulin-like growth factor I gene and the plasma level. (United States)

    Kinoshita, Yumiko; Kizaki, Zenro; Ishihara, Yasunori; Nakajima, Hisakazu; Adachi, Shinsuke; Kosaka, Kitaro; Kinugasa, Akihiko; Sugimoto, Tohru


    Evidence is accumulating that the promoter region of the insulin-like growth factor I (IGF-I) gene polymorphism and low levels of IGF-I are associated with type 2 diabetes, cardiovascular disease and birth weight; however, the number of wild-type alleles is different in each country. This study aimed to examine the 737/738 marker, a cytosine-adenine repeat in the promoter region of the IGF-I gene polymorphism, and plasma IGF-I levels in Japanese infants and analyze the genetic background. Data were collected for 15 months in Kyoto Prefectural University of Medicine. The body composition parameters of all infants were determined at birth. At 5 days after birth, we took blood samples to measure the product size of the promoter region of the IGF-I gene polymorphism and plasma IGF-I. In a population-based sample of 160 subjects, 6 different alleles and 16 genotypes were identified in the promoter region of the IGF-I gene polymorphism. The existence of a 196-bp allele has proved to result in a low plasma IGF-I level, a small head and chest circumference (p body composition parameters in Japanese infants. Our results suggest genetical influence on prenatal growth and serum IGF-I levels.

  20. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.


    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  1. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K. C.; Zwinderman, Aeilko H.; Olivier, Berend; Waldinger, Marcel D.


    To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE.

  2. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

    NARCIS (Netherlands)

    Janssen, Paddy K C; Zwinderman, Aeilko H; Olivier, Berend; Waldinger, Marcel D

    PURPOSE: To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). MATERIALS AND METHODS: This was a prospective study of 10 weeks of paroxetine

  3. Insulin VNTR and IGF-1 promoter region polymorphisms are not associated with body composition in early childhood: The generation R study

    NARCIS (Netherlands)

    J.A.J.B.M. Maas (Janneke); D.O. Mook-Kanamori (Dennis); L. Ay (Lamise); R.P.M. Steegers-Theunissen (Régine); P. Tikka-Kleemola (Päivi); A. Hofman (Albert); A.C.S. Hokken-Koelega (Anita); V.W.V. Jaddoe (Vincent)


    textabstractObjective: The objective of this study was to examine the associations between insulin gene variable number of tandem repeats (INS VNTR) and insulin-like growth factor 1 (IGF1) gene promoter region polymorphisms with body composition in early childhood. Methods: This study was embedded

  4. Association of human liver bilirubin UDP-glucuronyltransferase activity with a polymorphism in the promoter region of the UGT1A1 gene

    NARCIS (Netherlands)

    Raijmakers, MTM; Jansen, PLM; Steegers, EAP; Peters, WHM

    Background/Aims: Gilbert's syndrome is a benign form of a deficiency in bilirubin glucuronidation. It is associated with a homozygous polymorphism, A(TA)(7)TAA instead of A(TA)(6)TAA, in the TATA-box of the promoter region of the bilirubin UDP-glucuronyltransferase gene. In this study the

  5. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116. (United States)

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho


    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  6. Variability in the precore and core promoter regions of HBV strains in Morocco: characterization and impact on liver disease progression.

    Directory of Open Access Journals (Sweden)

    Bouchra Kitab

    Full Text Available BACKGROUND: Hepatitis B virus (HBV is one of the most common human pathogens that cause aggressive hepatitis and advanced liver disease (AdLD, including liver cirrhosis and Hepatocellular Carcinoma. The persistence of active HBV replication and liver damage after the loss of hepatitis B e antigen (HBeAg has been frequently associated with mutations in the pre-core (pre-C and core promoter (CP regions of HBV genome that abolish or reduce HBeAg expression. The purpose of this study was to assess the prevalence of pre-C and CP mutations and their impact on the subsequent course of liver disease in Morocco. METHODS/PRINCIPAL FINDINGS: A cohort of 186 patients with HBeAg-negative chronic HBV infection was studied (81 inactive carriers, 69 with active chronic hepatitis, 36 with AdLD. Pre-C and CP mutations were analyzed by PCR-direct sequencing method. The pre-C stop codon G1896A mutation was the most frequent (83.9% and was associated with a lower risk of AdLD development (OR, 0.4; 95% CI, 0.15-1.04; p = 0.04. HBV-DNA levels in patients with G1896A were not significantly different from the other patients carrying wild-type strains (p = 0.84. CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were associated with higher HBV-DNA level and increased liver disease severity. Multiple logistic regression analysis showed that older age (≥ 40 years, male sex, high viral load (>4.3 log(10 IU/mL and CP mutations C1653T, T1753V, A1762T/G1764A, and C1766T/T1768A were independent risk factors for AdLD development. Combination of these mutations was significantly associated with AdLD (OR, 7.52; 95% CI, 4.8-8; p<0.0001. CONCLUSIONS: This study shows for the first time the association of HBV viral load and CP mutations with the severity of liver disease in Moroccan HBV chronic carriers. The examination of CP mutations alone or in combination could be helpful for prediction of the clinical outcome.

  7. The first year experience of occupational therapy students at an Australian regional university: Promoting student retention and developing a regional and remote workforce. (United States)

    Boehm, Jackie; Cordier, Reinie; Thomas, Yvonne; Tanner, Bronwyn; Salata, Karen


    Student retention at regional universities is important in addressing regional and remote workforce shortages. Students attending regional universities are more likely to work in regional areas. First year experience at university plays a key role in student retention. This study aimed to explore factors influencing the first year experience of occupational therapy students at a regional Australian university. Surveys were administered to 58 second year occupational therapy students in the first week of second year. Data were analysed using descriptive statistics, inferential statistics (Pearson χ 2 ; Spearman rho) and summarising descriptive responses. An Australian regional university. Second year undergraduate occupational therapy students. Factors influencing students' decisions to study and continue studying occupational therapy; factors enhancing first year experience of university. Fifty-four students completed the survey (93.1%). A quarter (25.9%) of students considered leaving the course during the first year. The primary influence for continuing was the teaching and learning experience. Most valued supports were orientation week (36.7%) and the first year coordinator (36.7%). The importance of the first year experience in retaining occupational therapy students is highlighted. Engagement with other students and staff and academic support are important factors in facilitating student retention. It is important to understand the unique factors influencing students' decisions, particularly those from regional and remote areas, to enter and continue in tertiary education to assist in implementing supports and strategies to improve student retention. © 2015 National Rural Health Alliance Inc.

  8. Regional differences in awareness of tobacco advertising and promotion in China: findings from the ITC China Survey. (United States)

    Yang, Yan; Li, Lin; Yong, Hua-Hie; Borland, Ron; Wu, Xi; Li, Qiang; Wu, Changbao; Foong, Kin


    To examine whether levels of, and factors related to, awareness of tobacco advertising and promotion differ across six cities in China. Data from wave 1 of the International Tobacco Control (ITC) China Survey (April to August 2006) were analysed. The ITC China Survey employed a multistage sampling design in Beijing, Shenyang, Shanghai, Changsha, Guangzhou and Yinchuan. Face-to-face interviews were conducted with a total of 4763 smokers and 1259 non-smokers. Multivariate logistic regression models were used to identify factors associated with awareness of tobacco advertising and promotion. The overall levels of noticing advertisements varied considerably by city. Cities reporting lower levels of advertising tended to report higher levels of point of sale activity. Noticing tobacco industry promotions was associated with more positive attitudes to tobacco companies. The awareness of tobacco advertising and promotional activities was not homogeneous across the six Chinese cities, suggesting variations in the tobacco industry's activities and the diversity of implementing a central set of laws to restrict tobacco promotion. This study clearly demonstrates the need to work with the implementation agencies if national laws are to be properly enforced.

  9. Identification of the promoter region required for human adiponectin gene transcription: Association with CCAAT/enhancer binding protein-β and tumor necrosis factor-α

    International Nuclear Information System (INIS)

    Kita, Atsushi; Yamasaki, Hironori; Kuwahara, Hironaga; Moriuchi, Akie; Fukushima, Keiko; Kobayashi, Masakazu; Fukushima, Tetsuya; Takahashi, Ryoko; Abiru, Norio; Uotani, Shigeo; Kawasaki, Eiji; Eguchi, Katsumi


    Adiponectin, an adipose tissue-specific plasma protein, is involved in insulin sensitizing and has anti-atherosclerotic properties. Plasma levels of adiponectin are decreased in obese individuals and patients with type 2 diabetes with insulin resistance. Tumor necrosis factor-α (TNF-α) decreases the expression of adiponectin in adipocytes. The aims of the present study were: (1) to identify the promoter region responsible for basal transcription of the human adiponectin gene, and (2) to investigate the mechanism by which adiponectin was regulated by TNF-α. The human adiponectin promoter (2.1 kb) was isolated and used for luciferase reporter analysis by transient transfection into 3T3-L1 adipocytes. Deletion analysis demonstrated that the promoter region from -676 to +41 was sufficient for basal transcriptional activity. Mutation analysis of putative response elements for sterol regulatory element binding protein (SREBP) (-431 to -423) and CCAAT/enhancer binding protein (C/EBP) (-230 to -224) showed that both elements were required for basal promoter activity. Adiponectin transcription was increased 3-fold in cells that over-expressed constitutively active C/EBP-β. Electrophoretic mobility shift assay, using nuclear extract from 3T3-L1 cells and the -258 to -199 region as a probe, demonstrated specific DNA-protein binding, which was abolished by TNF-α treatment. The present data indicate that the putative response elements for SREBP and C/EBP are required for human adiponectin promoter activity, and that suppression by TNF-α may, at least in part, be associated with inactivation of C/EBP-β

  10. Promoter-region hypermethylation and expression downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat hepatocarcinogenesis model

    International Nuclear Information System (INIS)

    Abe, Hajime; Ogawa, Takashi; Wang, Liyun; Kimura, Masayuki; Tanaka, Takeshi; Morita, Reiko; Yoshida, Toshinori; Shibutani, Makoto


    Thioacetamide (TAA) has been used to develop a rodent model for hepatocarcinogenesis. To determine the genes with epigenetic modifications in early hepatocarcinogenesis, we did a genome-wide scan for hypermethylated promoter regions using CpG island microarrays in TAA-promoted rat liver tissue. Eight genes were selected based on the microarray profile; of these, Yy1 and Wdr45b were confirmed to be hypermethylated by methylation-specific polymerase chain reaction (PCR) and pyrosequencing and downregulated by real-time reverse transcription PCR. Non-neoplastic liver cells had nuclear Yy1 immunoreactivity, while preneoplastic foci with glutathione S-transferase placental form (GST-P) immunoreactivity had decreased Yy1 immunoreactivity. The incidence of these foci was proportional to the dose of TAA administered. Co-expression analysis of gene products downstream of Yy1 revealed increased nuclear phospho-c-Myc + foci as well as nuclear and cytoplasmic p21 Cip1+ foci in Yy1 − or GST-P + foci in response to TAA-promotion dose. Although the absolute number of cells was low, the incidence of death receptor 5 − foci was increased in Yy1 − foci in proportion to the TAA dose. Yy1 − /GST-P + foci revealed a higher number of proliferating cell nuclear antigen (PCNA)-immunoreactive cells than Yy1 + /GST-P + foci, while cleaved caspase-3 + cells were unchanged between Yy1 – /GST-P + and Yy1 + /GST-P + foci. In the case of Wdr45b, most GST-P + foci were Wdr45b – and were not increased by TAA promotion. These results suggest involvement of Yy1 in the epigenetic gene regulation at the early stages of TAA promoted cell proliferation and concomitant cell cycle arrest in preneoplastic lesions. - Highlights: • Epigenetically downregulated genes were searched in TAA-promnoted rat livers. • Yy1 and Wdr45b showed promoter-region hypermethylation and mRNA downregulation. • TAA promoted increase of preneoplastic Yy1 – /GST-P + foci showing high proliferation. • TAA

  11. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota


    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  12. PTSD and DNA Methylation in Select Immune Function Gene Promoter Regions: A Repeated Measures Case-control Study of U.S. Military Service Members (United States)


    other relevant exposures which may influ- ence DNA methylation , such as dietary factors ( folate , vitamin B12 intake) (Fenech, 2001; Piyathilake and...ARTICLE published: 24 June 2013 doi: 10.3389/fpsyt.2013.00056 PTSD and DNA methylation in select immune function gene promoter regions: a repeated measures...largely unknown. Dis- tinct expression signatures for PTSD have been found, in particular for immune activation transcripts. DNA methylation may be

  13. Regional economic impacts of the unconventional promotion of natural gas (Hydraulic Fracturing). Preliminary study; Regionaloekonomische Auswirkungen der unkonventionellen Erdgasfoerderung (Hydraulic Fracturing). Vorstudie

    Energy Technology Data Exchange (ETDEWEB)

    Bizer, Kilian; Bossmeyer, Christoph


    Actually, there is a controversial public discussion on the exploitation of conventional natural gas by means of hydraulic fracturing (Fracking). The contribution under consideration examines the geologic, toxicological or technical as well as legal points of contact with respect to the different effects for the actor groups. Based on the existing scientific realizations, the regional economic effects of the fracking technology and the subsequent promotion of unconventional natural gas deposits have to be worked out.

  14. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset. (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A


    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  15. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva


    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  16. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana. (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok


    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  17. Isolation and analysis of a multifunctional triterpene synthase KcMS promoter region from mangrove plant kandelia candel (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Sumardi; Oku, H.; Baba, S.; Sagami, H.


    Molecular cloning of Kandelia candel KcMS gene has previously been cloned and encoded a multifunctional triterpene synthase. In this study, the KcMS gene promoter was cloned through Genome walking, sequenced, and analyzed. A 1,358 bp genomic DNA fragment of KcMS promoter was obtained. PLACE and PlantCARE analysis of the KcMS promoter revealed that there was some regulatory elements in response to environmental signals and involved in the regulation of gene expression. Results showed that four kinds of elements are regulated by hormone binding, namely 2 MeJA-responsiveness elements (CGTCA-motif and TGACG-motif), the ABRE (TACGTG) involved in abscisic acid responsiveness, gibberellin-related GARE-motif (AAACAGA), and the TGA-element (AACGAC) as an auxin-responsive element. Several elements in the KcMS have been shown in other plants to be responsive to abiotic stress. These motifs were MBS (CAACTG), TC-rich repeats, and eight light responsive elements. The KcMS promoter was also involved in the activation of defense genes in plants such as HSE (AAAAAATTC) and four circadian control elements (CAANNNNATC). The presence of multipotential regulatory motifs suggested that KcMS may be involved in regulation of plant tolerance to several types of stresses.

  18. Promoting sustainable potato agriculture in the Andean region by supplemental calcium nutrition and breeding for frost tolerance (United States)

    Collaborative research in Peru sought to promote sustainable potato production and, mitigate adverse impacts of climate change through two approaches: first calcium amendments to increase crop yield and, second to enhance frost tolerance in native potatoes. All the multi-year, multi-location experim...

  19. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J


    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  20. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  1. Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

    Directory of Open Access Journals (Sweden)

    J Stephen Dumler


    Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

  2. Building an Entrepreneurial University in Brazil: The Role and Potential of University-Industry Linkages in Promoting Regional Economic Development (United States)

    Amaral, Marcelo; Ferreira, Andre; Teodoro, Pitias


    This study is part of a broader research project, conducted by the Triple Helix Research Group--Brazil, focusing on university-industry-government linkages in the state of Rio de Janeiro. The case study reported here is that of the Regional University of Volta Redonda: the aim was to develop an understanding of how a regional university can be…

  3. Promoting biogas production and using it as transport fuel in the Helsinki region; Suunnitelma liikennebiokaasun tuotannon ja kaeytoen edistaemiseksi Helsingin seudulla

    Energy Technology Data Exchange (ETDEWEB)

    Rasi, S.; Havukainen, J.; Uusitalo, V.; Andersson, R.; Manninen, K.; Aro-Heinilae, E.; Rintala, J.


    The main objective of the project was to promote biogas production and its use as transport fuel. The aims in the four Finnish and two Estonian case areas were to reduce the amount and improve the sustainable use of waste and sludge, to promote biogas production, to start biogas use as transport fuel and to provide tools for implementing the aims. The total biomethane potential in the Helsinki region corresponds to approximately 450 GWh/a. The most potential user for biomethane is public transport. The total amount of biomethane would suffice for 80% of the busses operating in the Helsinki region. Using biogas as a transport fuel instead of energy production in the Helsinki region would result in emission reductions (13 000 t{sub CO2,eq}/a). However if the fuel replacing biogas in energy production would be renewable, the emission reductions would be significantly greater. The economical assessment indicates that the production of biogas is economically feasible if all the produced gas can be sold. Biogas produced near the natural gas grid can also be transported to the Helsinki region where there are better possibilities to find uses for it. In this way, for example, gas that is produced in Kymenlaakso but is not consumed there can be transported via the natural gas grid, assuming that the production plant is reasonably close to the grid. (orig.)

  4. Health-care users, key community informants and primary health care workers' views on health, health promotion, health assets and deficits: qualitative study in seven Spanish regions. (United States)

    Pons-Vigués, Mariona; Berenguera, Anna; Coma-Auli, Núria; Pombo-Ramos, Haizea; March, Sebastià; Asensio-Martínez, Angela; Moreno-Peral, Patricia; Mora-Simón, Sara; Martínez-Andrés, Maria; Pujol-Ribera, Enriqueta


    Although some articles have analysed the definitions of health and health promotion from the perspective of health-care users and health care professionals, no published studies include the simultaneous participation of health-care users, primary health care professionals and key community informants. Understanding the perception of health and health promotion amongst these different stakeholders is crucial for the design and implementation of successful, equitable and sustainable measures that improve the health and wellbeing of populations. Furthermore, the identification of different health assets and deficits by the different informants will generate new evidence to promote healthy behaviours, improve community health and wellbeing and reduce preventable inequalities. The objective of this study is to explore the concept of health and health promotion and to compare health assets and deficits as identified by health-care users, key community informants and primary health care workers with the ultimate purpose to collect the necessary data for the design and implementation of a successful health promotion intervention. A descriptive-interpretive qualitative research was conducted with 276 participants from 14 primary care centres of 7 Spanish regions. Theoretical sampling was used for selection. We organized 11 discussion groups and 2 triangular groups with health-care users; 30 semi-structured interviews with key community informants; and 14 discussion groups with primary health care workers. A thematic content analysis was carried out. Health-care users and key community informants agree that health is a complex, broad, multifactorial concept that encompasses several interrelated dimensions (physical, psychological-emotional, social, occupational, intellectual, spiritual and environmental). The three participants' profiles consider health promotion indispensable despite defining it as complex and vague. In fact, most health-care users admit to having

  5. Attitudes, Beliefs and Predictors of Male Circumcision Promotion among Medical University Students in a Traditionally Non-Circumcising Region

    Directory of Open Access Journals (Sweden)

    Maria Ganczak


    Full Text Available Objective: To evaluate the beliefs of medical university students regarding male circumcision (MC, as well as attitudes and the predictors of its promotion in the case of adults at risk of HIV. Methods: A cross-sectional survey was conducted between 2013–2016 at the Medical University in Szczecin, Poland, among final year Polish/foreign students from Northern Europe, using a standardized questionnaire. Results: There were 539 participants, median age 25 years, 40.8% males, and 66.8% were Polish nationals. The MC rate was 16.7%. Regarding HIV/AIDS knowledge, 66.6% of the students scored more than 75%; and, 34.2% knew that MC reduces the risk of HIV infection. One in eleven respondents (9.1% believed that circumcised men felt more intense sexual pleasure. More than half of the respondents (54.8% declared that they would recommend MC to adult patients at risk for HIV. The belief that circumcised men felt more intense sexual pleasure, and knowledge on MC regarding HIV risk reduction was associated with greater odds of recommending adult MC (OR = 3.35 and OR = 2.13, respectively. Conclusions: Poor knowledge of its benefits and a low willingness to promote the procedure—strongly dependent on personal beliefs—suggest that medical students may need additional training to help them to discuss MC more openly with adult men at risk for HIV infection. Knowledge may be an effective tool when making decisions regarding MC promotion.

  6. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.


    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  7. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994

    International Nuclear Information System (INIS)


    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit

  8. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail:; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail:


    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  9. Promoter trans-activation of protooncogenes c-fos and c-myc, but not c-Ha-ras, by products of adenovirus early region 1A

    International Nuclear Information System (INIS)

    Sassone-Corsi, P.; Borrelli, E.


    The E1A (early region 1A) oncogene products of adenovirus type 2 trans-activate the other early viral transcription units, as well as some cellular promoters. Using a short-term cotransfection assay in murine NIH 3T3 fibroblasts, we show that c-fos and c-myc promoter activities are stimulated by the E1A proteins, whereas c-Ha-ras transcription is not affected. The product of E1A 13S mRNA is responsible for the trans-activation, whereas the 12S mRNA product has no effect. Analysis of the c-fos promoter sequences required for the E1A stimulation shows that responsive sequences are located between positions -402 and -240 upstream of the transcription initiation site. This same region also contains the c-fos serum-responsive element. Furthermore, transcription of the endogenous c-fos gene in HeLa cells is increased after E1A transfection

  10. A Peptide Derived from the HIV-1 gp120 Coreceptor-Binding Region Promotes Formation of PAP248-286 Amyloid Fibrils to Enhance HIV-1 Infection.

    Directory of Open Access Journals (Sweden)

    Jinquan Chen

    Full Text Available Semen is a major vehicle for HIV transmission. Prostatic acid phosphatase (PAP fragments, such as PAP248-286, in human semen can form amyloid fibrils to enhance HIV infection. Other endogenous or exogenous factors present during sexual intercourse have also been reported to promote the formation of seminal amyloid fibrils.Here, we demonstrated that a synthetic 15-residue peptide derived from the HIV-1 gp120 coreceptor-binding region, designated enhancing peptide 2 (EP2, can rapidly self-assemble into nanofibers. These EP2-derivated nanofibers promptly accelerated the formation of semen amyloid fibrils by PAP248-286, as shown by Thioflavin T (ThT and Congo red assays. The amyloid fibrils presented similar morphology, assessed via transmission electron microscopy (TEM, in the presence or absence of EP2. Circular dichroism (CD spectroscopy revealed that EP2 accelerates PAP248-286 amyloid fibril formation by promoting the structural transition of PAP248-286 from a random coil into a cross-β-sheet. Newly formed semen amyloid fibrils effectively enhanced HIV-1 infection in TZM-bl cells and U87 cells by promoting the binding of HIV-1 virions to target cells.Nanofibers composed of EP2 promote the formation of PAP248-286 amyloid fibrils and enhance HIV-1 infection.

  11. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    International Nuclear Information System (INIS)

    Ghazal, P.; Lubon, H.; Hennighausen, L.


    Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

  12. [Drug registries: post-marketing evaluation of the benefit-risk profile and promotion of appropriateness. The regional point of view]. (United States)

    Martelli, Luisa; Venegoni, Mauro


    Italian Regions and the Italian regulatory agency share a common interest in promoting the appropriateness of drug use, containing drug expenditure and acquiring additional evidence on the effectiveness and safety of drugs. Drug registries can help attaining these objectives. Specifically, the registries implemented in Italy were able to cover the first two objectives, whereas some critical issues were raised on the third one. For instance, the data recorded in the registries are not available at regional level to conduct safety and effectiveness investigations. This is a paradox, when considering that drugs included in the registries have a risk-benefit profile that is only partially defined at the moment of marketing. Currently, researchers and regions can conduct epidemiological research (cohort and case control studies), on the basis of record-linkage procedures, on all drugs prescribed in general practice (which are older drugs with a better defined risk-benefit profile). The expected outcomes of registries should be more clearly defined: when the main aim is to promote appropriateness, the recording of only a very limited amount of data should be required (to avoid a bureaucratic burden on clinicians).The Italian centers of the ENCePP network might play an important role in planning and conducting drug registries: through the presence in the steering committees of the registries, and in conducting epidemiological studies that make the most of this powerful instrument.

  13. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis. (United States)

    Smolikov, Sarit; Schild-Prüfert, Kristina; Colaiácovo, Mónica P


    The synaptonemal complex (SC), a tripartite proteinaceous structure that forms between homologous chromosomes during meiosis, is crucial for faithful chromosome segregation. Here we identify CRA-1, a novel and conserved protein that is required for the assembly of the central region of the SC during C. elegans meiosis. In the absence of CRA-1, central region components fail to extensively localize onto chromosomes at early prophase and instead mostly surround the chromatin at this stage. Later in prophase, central region proteins polymerize along chromosome axes, but for the most part fail to connect the axes of paired homologous chromosomes. This defect results in an inability to stabilize homologous pairing interactions, altered double-strand break (DSB) repair progression, and a lack of chiasmata. Surprisingly, DSB formation and repair are required to promote the polymerization of the central region components along meiotic chromosome axes in cra-1 mutants. In the absence of both CRA-1 and any one of the C. elegans homologs of SPO11, MRE11, RAD51, or MSH5, the polymerization observed along chromosome axes is perturbed, resulting in the formation of aggregates of the SC central region proteins. While radiation-induced DSBs rescue this polymerization in cra-1; spo-11 mutants, they fail to do so in cra-1; mre-11, cra-1; rad-51, and cra-1; msh-5 mutants. Taken together, our studies place CRA-1 as a key component in promoting the assembly of a tripartite SC structure. Moreover, they reveal a scenario in which DSB formation and repair can drive the polymerization of SC components along chromosome axes in C. elegans.

  14. Sequence analysis of the Epstein-Barr virus (EBV) latent membrane protein-1 gene and promoter region

    DEFF Research Database (Denmark)

    Sandvej, Kristian; Gratama, J W; Munch, M


    Sequence variations in the Epstein-Barr virus (EBV) encoded latent membrane protein-1 (LMP-1) gene have been described in a Chinese nasopharyngeal carcinoma-derived isolate (CAO), and in viral isolates from various EBV-associated tumors. It has been suggested that these genetic changes, which...... include loss of a Xho I restriction site (position 169425) and a C-terminal 30-base pair (bp) deletion (position 168287-168256), define EBV genotypes associated with increased tumorigenicity or with disease among particular geographic populations. To determine the frequency of LMP-1 variations in European...... wild-type virus isolates, we sequenced the LMP-1 promoter and gene in EBV from lymphoblastoid cell lines from healthy carriers and patients without EBV-associated disease. Sequence changes were often present, and defined at least four main groups of viral isolates, which we designate Groups A through D...

  15. Temporal transcription of the lactococcal temperate phage TP901-1 and DNA sequence of the early promoter region

    DEFF Research Database (Denmark)

    Madsen, Hans Peter Lynge; Hammer, Karin


    to a phage repressor, a single-stranded DNA-binding protein, a topoisomerase, a Cro-like protein and two other phage proteins of unknown function were detected. The gene arrangement in the early transcribed region of TP901-1 thus consists of two transcriptional units: one from PR containing four genes......, of which at least two (the integrase gene and putative repressor) are needed for lysogeny, and the divergent and longer transcriptional unit from PL, presumably encoding functions required for the lytic life cycle. ORFs with homology to proteins involved in DNA replication were identified on the latter......Transcriptional analysis by Northern blotting identified clusters of early, middle and late transcribed regions of the temperate lactococcal bacteriophage TP901-1 during one-step growth experiments. The latent period was found to be 65 min and the burst size 40 +/- 10. The eight early transcripts...

  16. Effect of price and in-store promotion on sales: a study of distinct regions in an emerging market


    Sanchez, Juan Machado


    Increasing competition caused by globalization, high growth of some emerging markets and stagnation of developed economies motivate Consumer Packaged Goods (CPGs) manufacturers to drive their attention to emerging markets. These companies are expected to adapt their marketing activities to the particularities of these markets in order to succeed. In a country classified as emerging market, regions are not alike and some contrasts can be identified. In addition, divergences of marketing variab...

  17. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    International Nuclear Information System (INIS)

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.


    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection

  18. ESR1 gene promoter region methylation in free circulating DNA and its correlation with estrogen receptor protein expression in tumor tissue in breast cancer patients

    International Nuclear Information System (INIS)

    Martínez-Galán, Joaquina; Ríos, Sandra; Delgado, Juan Ramón; Torres-Torres, Blanca; Núñez, María Isabel; López-Peñalver, Jesús; Del Moral, Rosario; Ruiz De Almodóvar, José Mariano; Menjón, Salomón; Concha, Ángel; Chamorro, Clara


    Tumor expression of estrogen receptor (ER) is an important marker of prognosis, and is predictive of response to endocrine therapy in breast cancer. Several studies have observed that epigenetic events, such methylation of cytosines and deacetylation of histones, are involved in the complex mechanisms that regulate promoter transcription. However, the exact interplay of these factors in transcription activity is not well understood. In this study, we explored the relationship between ER expression status in tumor tissue samples and the methylation of the 5′ CpG promoter region of the estrogen receptor gene (ESR1) isolated from free circulating DNA (fcDNA) in plasma samples from breast cancer patients. Patients (n = 110) with non-metastatic breast cancer had analyses performed of ER expression (luminal phenotype in tumor tissue, by immunohistochemistry method), and the ESR1-DNA methylation status (fcDNA in plasma, by quantitative methylation specific PCR technique). Our results showed a significant association between presence of methylated ESR1 in patients with breast cancer and ER negative status in the tumor tissue (p = 0.0179). There was a trend towards a higher probability of ESR1-methylation in those phenotypes with poor prognosis i.e. 80% of triple negative patients, 60% of HER2 patients, compared to 28% and 5.9% of patients with better prognosis such as luminal A and luminal B, respectively. Silencing, by methylation, of the promoter region of the ESR1 affects the expression of the estrogen receptor protein in tumors of breast cancer patients; high methylation of ESR1-DNA is associated with estrogen receptor negative status which, in turn, may be implicated in the patient’s resistance to hormonal treatment in breast cancer. As such, epigenetic markers in plasma may be of interest as new targets for anticancer therapy, especially with respect to endocrine treatment

  19. Workshop to promote the ratification of the protocol on heavy metals across the entire UN ECE region

    Energy Technology Data Exchange (ETDEWEB)



    Within the workshop of the German Federal Environment Agency (Dessau-Rosslau, Federal Republic of Germany) at 14th to 16th May, 2008 in Yerevan (Armenia), the following lectures were held: (1) The convention and its protocols - framework and requirements (Tea Aulavuo); (2) Development of the heavy metals protocol up to now (D. Jost); (3) Experiences in transposing the obligations of the HM protocol into national law (Ivan Angelov); (4) Evaluation of concentrations of air pollutants and depositions of HM over the EECCA region (Ilia Ilyin); (5) The effectiveness of the HM protocol - emission reductions and costs (TNO-study) (M. van het Bolscher); (6) Technologies and techniques and their emission reduction potential and costs (Andre Peeters Weem); (7) Synergies of reduction of HM and particulate matter (Katja Kraus); (8) Critical loads / critical levels and effects of HM - integrated assessment (Jean-Paul Hettelingh); (9) Additional technical measures / options and their reduction potential (M. van het Bolscher); (10) Overview of the situation in the EECCA region - evaluation of a questionnaire of the Secretariat of the LRTAP Convention and ideas on revising the protocol and its annexes (Johan Sliggers); (11) Future aims of the TF (Katja Kraus).

  20. Effects of changes in Italian bioenergy promotion schemes for agricultural biogas projects: Insights from a regional optimization model

    International Nuclear Information System (INIS)

    Chinese, D.; Patrizio, P.; Nardin, G.


    Italy has witnessed an extraordinary growth in biogas generation from livestock effluents and agricultural activities in the last few years as well as a severe isomorphic process, leading to a market dominance of 999 kW power plants owned by “entrepreneurial farms”. Under the pressure of the economic crisis in the country, the Italian government has restructured renewable energy support schemes, introducing a new program in 2013. In this paper, the effects of the previous and current support schemes on the optimal plant size, feedstock mix and profitability were investigated by introducing a spatially explicit biogas supply chain optimization model, which accounts for different incentive structures. By applying the model to a regional case study, homogenization observed to date is recognized as a result of former incentive structures. Considerable reductions in local economic potentials for agricultural biogas power plants without external heat use, are estimated. New plants are likely to be manure-based and due to the lower energy density of such feedstock, wider supply chains are expected although optimal plant size will be smaller. The new support scheme will therefore most likely eliminate past distortions but also slow down investments in agricultural biogas plants. - Highlights: • We review the evolution of agricultural biogas support schemes in Italy over last 20 years. • A biogas supply chain optimization model which accounts for feed-in-tariffs is introduced. • The model is applied to a regional case study under the two most recent support schemes. • Incentives in force until 2013 caused homogenization towards maize based 999 kW el plants. • Wider, manure based supply chains feeding smaller plants are expected with future incentives

  1. Control of growth promotion (CGP) and screening for malnutrition in central region and Lomé-Commune, January to June 2013 Togo

    International Nuclear Information System (INIS)

    Touglo, Adavi Lonlon; Bouraima, Mouawiyatou; Agbozouhoue, A. Eya; Bebou, Midassirou; Tchapo, Dapou; Akolly, Koffi


    Full text: Background: Control of Growth Promotion (CGP) is an activity that can detect early if the child has a developmental problem and investigate the cause and take appropriate decisions to overcome the consequences. In Togo, the goal in 2013 is to weigh at least 80 % of children 0-5 years during the sessions of CGP. What are the levels achieved this goal after the first semester and the problems of malnutrition detected? Method: We conducted a descriptive cross-sectional study data collected in the quarterly reports in two regions of Togo, Lomé - Commune in the South and Central Region in the North. The study involved data from the first semester of 2013 in all districts of the two regions. Database monitoring activities at national level CGP was used. Data from the two regions were separated and analyzed using Excel. Comparison tests of proportions were made using Epi Info 7. Results: Detection rate of nutritional status by the CGP in the first half of 2013 was 29% of the total target of 155,423 children under 5 years in the two regions. This rate was higher for the Central region (33 %) than for Lomé-Commune (26 %). No district has reached half of the goals. Their rates vary from 17.9 % and 18 % respectively for District No. 2 and District No. 4 of Lomé-Commune to 39.7% for the District of Tchaoudjo. The malnutrition rate was 8.8 %. This rate is higher in the Central region (10.9 %) than in Lomé-Commune (6.8 %) with a RR = 1.59, 95% CI = [1.50 to 1.69]. Severe malnutrition was 1.4 %. It is predominant in Lomé-commune (1.7 %) than in the Central region (1.1%) with a RR = 1.55, 95% CI = [1.32 to 1.82]. Conclusion: All districts in the two regions are below the target detection rate in the first half. The CGP has detected cases of moderate and severe malnutrition. To compare that rates with the survey data, the screening tools must be standard and adequate. (author)

  2. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  3. Down-regulation of human topoisomerase IIα expression correlates with relative amounts of specificity factors Sp1 and Sp3 bound at proximal and distal promoter regions

    Directory of Open Access Journals (Sweden)

    Isaacs Richard J


    Full Text Available Abstract Background Topoisomerase IIα has been shown to be down-regulated in doxorubicin-resistant cell lines. The specificity proteins Sp1 and Sp3 have been implicated in regulation of topoisomerase IIα transcription, although the mechanism by which they regulate expression is not fully understood. Sp1 has been shown to bind specifically to both proximal and distal GC elements of the human topoisomerase IIα promoter in vitro, while Sp3 binds only to the distal GC element unless additional flanking sequences are included. While Sp1 is thought to be an activator of human topoisomerase IIα, the functional significance of Sp3 binding is not known. Therefore, we sought to determine the functional relationship between Sp1 and Sp3 binding to the topoisomerase IIα promoter in vivo. We investigated endogenous levels of Sp1, Sp3 and topoisomerase IIα as well as binding of both Sp1 and Sp3 to the GC boxes of the topoisomerase IIα promoter in breast cancer cell lines in vivo after short term doxorubicin exposure. Results Functional effects of Sp1 and Sp3 were studied using transient cotransfection assays using a topoisomerase IIα promoter reporter construct. The in vivo interactions of Sp1 and Sp3 with the GC elements of the topoisomerase IIα promoter were studied in doxorubicin-treated breast cancer cell lines using chromatin immunoprecipitation assays. Relative amounts of endogenous proteins were measured using immunoblotting. In vivo DNA looping mediated by proteins bound at the GC1 and GC2 elements was studied using the chromatin conformation capture assay. Both Sp1 and Sp3 bound to the GC1 and GC2 regions. Sp1 and Sp3 were transcriptional activators and repressors respectively, with Sp3 repression being dominant over Sp1-mediated activation. The GC1 and GC2 elements are linked in vivo to form a loop, thus bringing distal regulatory elements and their cognate transcription factors into close proximity with the transcription start site

  4. Methylation in the promoter regions of WT1, NKX6-1 and DBC1 genes in cervical cancer tissues of Uygur women in Xinjiang

    Directory of Open Access Journals (Sweden)

    Dan Wu

    Full Text Available Abstract This study aimed to explore: 1 DNA methylation in the promoter regions of Wilms tumor gene 1 (WT1, NK6 transcription factor related locus 1 gene (NKX6-1 and Deleted in bladder cancer 1 (DBC1 gene in cervical cancer tissues of Uygur women in Xinjiang, and 2 the correlation of gene methylation with the infection of HPV16/18 viruses. We detected HPV16/18 infection in 43 normal cervical tissues, 30 cervical intraepithelial neoplasia lesions (CIN and 48 cervical cancer tissues with polymerase chain reaction (PCR method. Methylation in the promoter regions of the WT1, NKX6-1 and DBC1 genes in the above-mentioned tissues was measured by methylation-specific PCR (MSP and cloning sequencing. The expression level of these three genes was measured by real-time PCR (qPCR in 10 methylation-positive cervical cancer tissues and 10 methylation-negative normal cervical tissues. We found that the infection of HPV16 in normal cervical tissues, CIN and cervical cancer tissues was 14.0, 36.7 and 66.7%, respectively. The infection of HPV18 was 0, 6.7 and 10.4%, respectively. The methylation rates of WT1, NKX6-1 and DBC1 genes were 7.0, 11.6 and 23.3% in normal cervical tissues, 36.7, 46.7 and 30.0% in CIN tissues, and 89.6, 77.1 and 85.4% in cervical cancer tissues. Furthermore, WT1, NKX6-1 and DBC1 genes were hypermethylated in the high-grade squamous intraepithelial lesion (CIN2, CIN3 and in the cervical cancer tissues with infection of HPV16/18 (both P< 0.05. The expression of WT1, NKX6-1 and DBC1 was significantly lower in the methylation-positive cervical cancer tissues than in methylation-negative normal cervical tissues. Our findings indicated that methylation in the promoter regions of WT1, NKX6-1 and DBC1 is correlated with cervical cancer tumorigenesis in Uygur women. The infection of HPV16/18 might be correlated with methylation in these genes. Gene inactivation caused by methylation might be related to the incidence and development of cervical

  5. The OSMATER project: promotion of stone materials from the Verbano-Cusio-Ossola region (Italy) and the Canton Ticino (Switzerland). (United States)

    Cavallo, Alessandro; Antonella Dino, Giovanna


    The OSMATER (sub-Alpine Observatory Materials Territory Restoration) project, funded by the Piedmont Region (Italy) and the European Community, involved four Italian scientific bodies (Polytechnic of Turin, University of Turin, University of Milan-Bicocca, University of Bologna) and Switzerland (SUPSI). The aim was to investigate the present and historical quarrying and processing activities in the cross-border area between the Ossola Valley (Italy) and the Canton Ticino (Switzerland), and the use of dimension stones in local and national architecture. These materials are in many ways a "unique case", for their abundance and lithological variety. In the past, their extraction, processing and application characterized in a decisive way the architectural and constructive culture, both in terms of prestigious architecture and civil buildings, establishing a relationship between "stones and culture", "territory and its resources". In recent years, many of these traditions are losing importance and interest: this results in a loss of knowledge and historical memory, due mainly to the drastic changes in the market. The loss of this knowledge is likely to become irreversible in the short term, with the disappearance of people and social groups depositary of tradition. We can deduce that the creation of an "observatory", like OSMATER, is desirable and essential indeed, if we want to preserve the historical memory of the stone industry of an entire production area. The OSMATER project aimed the knowledge, recovery and enhancement of the architectural and cultural heritage of the cross-border area, through the census and classification of rocks, quarries (both active and historical - since Roman age), monuments and construction techniques typical of the sub-Alpine region, in order to create a documentation centre through a dedicated website. The first phase of the project was devoted to the identification of architectural works built with stone materials, with particular

  6. Eukaryotic elongation factor 1-beta interacts with the 5' untranslated region of the M gene of Nipah virus to promote mRNA translation. (United States)

    Uchida, Shotaro; Sato, Hiroki; Yoneda, Misako; Kai, Chieko


    Nipah virus belongs to the genus Henipavirus in the family Paramyxoviridae, and its RNA genome is larger than those of other paramyxoviruses because it has long untranslated regions (UTRs) in each gene. However, the functions of these UTRs are not fully understood. In this study, we investigated the functions of the 5' UTRs and found that the 5' UTR of the M gene upregulated the translation of a reporter gene. Using an RNA pull-down assay, we showed that eukaryotic elongation factor 1-beta (EEF1B2) interacts with nucleotides 81-100 of the M 5' UTR and specifically enhances its translation efficiency. Our results suggest that the M 5' UTR promotes the production of M protein and viral budding by recruiting EEF1B2.

  7. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence

    DEFF Research Database (Denmark)

    Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard


    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...

  8. Imperial Tax System and Regional Development in the Eighteenth Century. The Monopoly of Tobacco as a Means for Economic Promotion in Louisiana

    Directory of Open Access Journals (Sweden)

    Laura Náter


    Full Text Available This paper analyzes Spain's Eighteenth-century tobacco policies in Louisiana, where it created a fiscal institution for mainly political reasons, subordinating economical yields and revenues to the  region's political  and  strategic needs.  This  case contrasts with the management  and exploitation of the same institution in other  Spanish colonial  properties,  which  also held monopolies of different products, including tobacco.  This study  shows that the tobacco monopoly was during the Eighteenth-century one of the Real Hacienda's favorite fiscal instruments for increasing revenues with which to promote economic development in certain colonies. The author's main conclusions refer to the mechanisms  through which the Real Hacienda de la Nueva  España used tobacco revenues to strengthen the economy of Louisiana.

  9. A Specific Mutation in the Promoter Region of the Silent cel Cluster Accounts for the Appearance of Lactose-Utilizing Lactococcus lactis MG1363 (United States)

    Solopova, Ana; Bachmann, Herwig; Teusink, Bas; Kok, Jan; Neves, Ana Rute


    The Lactococcus lactis laboratory strain MG1363 has been described to be unable to utilize lactose. However, in a rich medium supplemented with lactose as the sole carbon source, it starts to grow after prolonged incubation periods. Transcriptome analyses showed that L. lactis MG1363 Lac+ cells expressed celB, encoding a putative cellobiose-specific phosphotransferase system (PTS) IIC component, which is normally silent in MG1363 Lac− cells. Nucleotide sequence analysis of the cel cluster of a Lac+ isolate revealed a change from one of the guanines to adenine in the promoter region. We showed here that one particular mutation, taking place at increased frequency, accounts for the lactose-utilizing phenotype occurring in MG1363 cultures. The G-to-A transition creates a −10 element at an optimal distance from the −35 element. Thus, a fully active promoter is created, allowing transcription of the otherwise cryptic cluster. Nuclear magnetic resonance (NMR) spectroscopy results show that MG1363 Lac+ uses a novel pathway of lactose utilization. PMID:22660716

  10. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M


    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  11. Clinical significance of SNP (rs2596542 in histocompatibility complex class I-related gene A promoter region among hepatitis C virus related hepatocellular carcinoma cases

    Directory of Open Access Journals (Sweden)

    Amal A. Mohamed


    Full Text Available The major histocompatibility complex class I-related gene A (MICA is an antigen induced by stress and performs an integral role in immune responses as an anti-infectious and antitumor agent. This work was designed to investigate whether (SNP rs2596542C/T in MICA promoter region is predictive of liver cirrhosis (LC and hepatocellular carcinoma (HCC or not. Forty-seven healthy controls and 94 HCV-infected patients, subdivided into 47 LC and 47 HCC subjects were enrolled in this study. SNP association was studied using real time PCR and soluble serum MICA concentration was measured using ELISA. Results showed that heterozygous genotype rs2596542CT was significantly (P = 0.022 distributed between HCC and LC related CHC patients. The sMICA was significantly higher (P = 0.0001 among HCC and LC. No significant association (P = 0.56 between rs2596542CT genotypes and sMICA levels was observed. Studying SNP rs2596542C/T association with HCC and LC susceptibility revealed that statistical significant differences (P = 0.013, P = 0.027 were only observed between SNP rs2596542C/T and each of HCC and LC, respectively, versus healthy controls, indicating that the rs2596542C/T genetic variation is not a significant contributor to HCC development in LC patients. Moreover, the T allele was considered a risk factor for HCC and LC vulnerability in HCV patients (OR = 1.93 and 2.1, respectively, while the C allele contributes to decreasing HCC risk. Therefore, SNP (rs2596542C/T in MICA promoter region and sMICA levels might be potential useful markers in the assessment of liver disease progression to LC and HCC.

  12. Effect of metallothionein core promoter region polymorphism on cadmium, zinc and copper levels in autopsy kidney tissues from a Turkish population

    International Nuclear Information System (INIS)

    Kayaalti, Zeliha; Mergen, Goerkem; Soeylemezoglu, Tuelin


    Metallothioneins (MTs) are metal-binding, low molecular weight proteins and are involved in pathophysiological processes like metabolism of essential metals, metal ion homeostasis and detoxification of heavy metals. Metallothionein expression is induced by various heavy metals especially cadmium, mercury and zinc; MTs suppress toxicity of heavy metals by binding themselves to these metals. The aim of this study was to investigate the association between the - 5 A/G metallothionein 2A (MT2A) single nucleotide polymorphism (SNP) and Cd, Zn and Cu levels in the renal cortex from autopsy cases. MT2A core promoter region - 5 A/G SNP was analyzed by PCR-RFLP method using 114 autopsy kidney tissues and the genotype frequencies of this polymorphism were found as 87.7% homozygote typical (AA), 11.4% heterozygote (AG) and 0.9% homozygote atypical (GG). In order to assess the Cd, Zn and Cu levels in the same autopsy kidney tissues, a dual atomic absorption spectrophotometer system was used and the average levels of Cd, Zn and Cu were measured as 95.54 ± 65.58 μg/g, 181.20 ± 87.72 μg/g and 17.14 ± 16.28 μg/g, respectively. As a result, no statistical association was found between the - 5 A/G SNP in the MT2A gene and the Zn and Cu levels in the renal cortex (p > 0.05), but considerably high accumulation of Cd was monitored for individuals having AG (151.24 ± 60.21 μg/g) and GG genotypes (153.09 μg/g) compared with individuals having AA genotype (87.72 ± 62.98 μg/g) (p < 0.05). These results show that the core promoter region polymorphism of metallothionein 2A increases the accumulation of Cd in human renal cortex.

  13. Environmental stress affects DNA methylation of a CpG rich promoter region of serotonin transporter gene in a nurse cohort.

    Directory of Open Access Journals (Sweden)

    Jukka S Alasaari

    Full Text Available Shift-working nurses are exposed to a stressful work environment, which puts them at an increased risk for burnout and depression. We explored the effect of environmental stress on serotonin transporter gene (SLC6A4 promoter methylation among nurses from high and low work stress environments.Using bisulfite sequencing, we investigated the methylation status of five CpG residues of a CpG-rich region in the promoter of SLC6A4 by comparing female shift working nurses from a high work stress environment (n = 24 to low work stress environment (n = 25. We also analyzed the association of 5-HTTLPR polymorphism at 5' end of SLC6A4. Work stress was assessed by the Karasek's Model and possible signs of burnout or depression were measured by the Maslach Burnout Index General Survey and Beck Depression Index. Methylation levels were assessed by bisulfite sequencing of DNA extracted from peripheral blood leucocytes. Restriction enzyme treatment followed by standard PCR was used to identify 5-HTTLPR genotypes.We found that nurses in the high stress environment had significantly lower promoter methylation levels at all five CpG residues compared to nurses in the low stress environment (p<0.01. There was no significant interaction of 5-HTTLPR genotype and work stress with methylation (p = 0.58. In unadjusted (bivariate analysis, burnout was not significantly associated to methylation levels. However, when mutually adjusted for both, burnout and work stress were significant contributors (p = 0.038 and p<0.0001 respectively to methylation levels.Our findings show that environmental stress is concurrent with decreased methylation of the SLC6A4 promoter. This may lead to increased transcriptional activity of the gene, increased reuptake of serotonin from synaptic clefts, and termination of the activity of serotonin. This could present a possible coping mechanism for environmental stress in humans that could eventually increase risk for disturbed functional

  14. Staphylococcus aureus RNAIII binds to two distant regions of coa mRNA to arrest translation and promote mRNA degradation.

    Directory of Open Access Journals (Sweden)

    Clément Chevalier


    Full Text Available Staphylococcus aureus RNAIII is the intracellular effector of the quorum sensing system that temporally controls a large number of virulence factors including exoproteins and cell-wall-associated proteins. Staphylocoagulase is one major virulence factor, which promotes clotting of human plasma. Like the major cell surface protein A, the expression of staphylocoagulase is strongly repressed by the quorum sensing system at the post-exponential growth phase. Here we used a combination of approaches in vivo and in vitro to analyze the mechanism used by RNAIII to regulate the expression of staphylocoagulase. Our data show that RNAIII represses the synthesis of the protein through a direct binding with the mRNA. Structure mapping shows that two distant regions of RNAIII interact with coa mRNA and that the mRNA harbors a conserved signature as found in other RNAIII-target mRNAs. The resulting complex is composed of an imperfect duplex masking the Shine-Dalgarno sequence of coa mRNA and of a loop-loop interaction occurring downstream in the coding region. The imperfect duplex is sufficient to prevent the formation of the ribosomal initiation complex and to repress the expression of a reporter gene in vivo. In addition, the double-strand-specific endoribonuclease III cleaves the two regions of the mRNA bound to RNAIII that may contribute to the degradation of the repressed mRNA. This study validates another direct target of RNAIII that plays a role in virulence. It also illustrates the diversity of RNAIII-mRNA topologies and how these multiple RNAIII-mRNA interactions would mediate virulence regulation.

  15. Integration Host Factor (IHF binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

    Directory of Open Access Journals (Sweden)

    Álvarez-Morales Ariel


    Full Text Available Abstract Background Pseudomonas syringae pv. phaseolicola, the causal agent of halo blight disease in beans, produces a toxin known as phaseolotoxin, in whose synthesis participate a group of genes organized within the genome in a region known as the "Pht cluster". This region, which is thought to have been acquired by horizontal gene transfer, includes 5 transcriptional units, two monocistronic (argK, phtL and three polycistronic (phtA, phtD, phtM, whose expression is temperature dependent. So far, the regulatory mechanisms involved in phaseolotoxin synthesis have not been elucidated and the only well-established fact is the requirement of low temperatures for its synthesis. In this work, we searched for regulatory proteins that could be involved in phaseolotoxin synthesis, focusing on the regulation of the phtD operon. Results In this study we identified the global regulator IHF (Integration Host Factor, which binds to the promoter region of the phtD operon, exerting a negative effect on the expression of this operon. This is the first regulatory protein identified as part of the phaseolotoxin synthesis system. Our findings suggest that the Pht cluster was similarly regulated in the ancestral cluster by IHF or similar protein, and integrated into the global regulatory mechanism of P. syringae pv. phaseolicola, after the horizontal gene transfer event by using the host IHF protein. Conclusion This study identifies the IHF protein as one element involved in the regulation of phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121 and provides new insights into the regulatory mechanisms involved in phaseolotoxin production.

  16. A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of myocardial infarction.

    Directory of Open Access Journals (Sweden)

    Massimiliano Ria

    Full Text Available BACKGROUND: The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI in women. This prompted functional studies of TNFSF4 expression. METHODS AND RESULTS: Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293 and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s to the T-allele. CONCLUSIONS: Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

  17. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus. (United States)

    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki


    Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. An Intergenic Region Shared by At4g35985 and At4g35987 in Arabidopsis thaliana Is a Tissue Specific and Stress Inducible Bidirectional Promoter Analyzed in Transgenic Arabidopsis and Tobacco Plants (United States)

    Banerjee, Joydeep; Sahoo, Dipak Kumar; Dey, Nrisingha; Houtz, Robert L.; Maiti, Indu Bhushan


    On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985) are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS) in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85) showed stronger expression (about 3.5 fold) compared to the At4g35987 promoter (P87). The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold) under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications. PMID:24260266

  19. An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic arabidopsis and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Joydeep Banerjee

    Full Text Available On chromosome 4 in the Arabidopsis genome, two neighboring genes (calmodulin methyl transferase At4g35987 and senescence associated gene At4g35985 are located in a head-to-head divergent orientation sharing a putative bidirectional promoter. This 1258 bp intergenic region contains a number of environmental stress responsive and tissue specific cis-regulatory elements. Transcript analysis of At4g35985 and At4g35987 genes by quantitative real time PCR showed tissue specific and stress inducible expression profiles. We tested the bidirectional promoter-function of the intergenic region shared by the divergent genes At4g35985 and At4g35987 using two reporter genes (GFP and GUS in both orientations in transient tobacco protoplast and Agro-infiltration assays, as well as in stably transformed transgenic Arabidopsis and tobacco plants. In transient assays with GFP and GUS reporter genes the At4g35985 promoter (P85 showed stronger expression (about 3.5 fold compared to the At4g35987 promoter (P87. The tissue specific as well as stress responsive functional nature of the bidirectional promoter was evaluated in independent transgenic Arabidopsis and tobacco lines. Expression of P85 activity was detected in the midrib of leaves, leaf trichomes, apical meristemic regions, throughout the root, lateral roots and flowers. The expression of P87 was observed in leaf-tip, hydathodes, apical meristem, root tips, emerging lateral root tips, root stele region and in floral tissues. The bidirectional promoter in both orientations shows differential up-regulation (2.5 to 3 fold under salt stress. Use of such regulatory elements of bidirectional promoters showing spatial and stress inducible promoter-functions in heterologous system might be an important tool for plant biotechnology and gene stacking applications.

  20. The effect of metallothionein 2A core promoter region single-nucleotide polymorphism on accumulation of toxic metals in sinonasal inverted papilloma tissues

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Bryś, Magdalena; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek; Pietkiewicz, Piotr [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Lewy-Trenda, Iwona; Danilewicz, Marian [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); Krześlak, Anna [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland)


    Metallothioneins (MTs) are intracellular thiol-rich heavy metal-binding proteins which join trace metal ions protecting cells against heavy metal toxicity and regulate metal distribution and donation to various enzymes and transcription factors. The goal of this study was to identify the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene, and to investigate its effect on allele-specific gene expression and Cd, Zn, Cu and Ni content in sinonasal inverted papilloma tissue (IP), with non-cancerous sinonasal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was identified by restriction fragment length polymorphism using 117 IP and 132 NCM. MT2A gene analysis was performed by quantitative real-time PCR. Metal levels were analyzed by flame atomic absorption spectrometry. The frequency of A allele carriage was 99.2% and 100% in IP and NCM, respectively. The G allele carriage was detected in 23.9% of IP and in 12.1% of the NCM samples. As a result, a significant association of − 5 A/G SNP in MT2A gene with mRNA expression in both groups was determined. A significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. A highly significant association was detected between the rs28366003 genotype and Cd and Zn content in IP. Furthermore, significant differences were identified between A/A and A/G genotype with regard to the type of metal contaminant. The Spearman rank correlation results showed the MT2A gene expression and both Cd and Cu levels were negatively correlated. The results obtained in this study suggest that the − 5 A/G SNP in the MT2A gene may have an effect on allele-specific gene expression and toxic metal accumulation in sinonasal inverted papilloma. - Highlights: • MT2A gene expression and metal content in sinonasal inverted papilloma tissues • Association between SNP (rs28366003) and expression of MT2A • Significant

  1. Polymorphisms in the presumptive promoter region of the SLC2A9 gene are associated with gout in a Chinese male population. (United States)

    Li, Changgui; Chu, Nan; Wang, Binbin; Wang, Jing; Luan, Jian; Han, Lin; Meng, Dongmei; Wang, Yunlong; Suo, Peisu; Cheng, Longfei; Ma, Xu; Miao, Zhimin; Liu, Shiguo


    Glucose transporter 9 (GLUT9) is a high-capacity/low-affinity urate transporter. To date, several recent genome-wide association studies (GWAS) and follow-up studies have identified genetic variants of SLC2A9 associated with urate concentrations and susceptibility to gout. We therefore investigated associations between gout and polymorphisms and haplotypes in the presumptive promoter region of GLUT9 in Chinese males. The approximately 2000 bp presumptive promoter region upstream of the start site of exon 1 of GLUT9 was sequenced and subjected to genetic analysis. A genotype-phenotype correlation was performed and polymorphisms-induced changes in transcription factor binding sites were predicted. Of 21 SNPs identified in GLUT9, five had not been previously reported. Two of the SNPs (rs13124007 and rs6850166) were associated with susceptibility to gout (p = 0.009 and p = 0.042, respectively). The C allele of rs13124007 appeared to be the risk allele for predisposition to gout (p = 0.006, OR 1.709 [95% CI 1.162-2.514]). For rs6850166, an increased risk of gout was associated with the A allele (p = 0.029, OR 1.645 [95% CI 1.050-2.577]). After Bonferroni correction, there was statistically difference in rs13124007 allele frequencies between gout cases and controls (P = 0.042). Haplotype analyses showed that haplotype GG was a protective haplotype (p = 0.0053) and haplotype CA was associated with increased risk of gout (p = 0.0326). Genotype-phenotype analysis among gout patients revealed an association of rs13124007 with serum triglycerides levels (P = 0.001). The C to G substitution in polymorphism rs13124007 resulted in a loss of a binding site for transcription factor interferon regulatory factor 1 (IRF-1). Polymorphisms rs13124007 and rs6850166 are associated with susceptibility to gout in Chinese males.

  2. Factor H Binds to the Hypervariable Region of Many Streptococcus pyogenes M Proteins but Does Not Promote Phagocytosis Resistance or Acute Virulence (United States)

    Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar


    Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608

  3. Factor H binds to the hypervariable region of many Streptococcus pyogenes M proteins but does not promote phagocytosis resistance or acute virulence.

    Directory of Open Access Journals (Sweden)

    Mattias C U Gustafsson

    Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.

  4. Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

    International Nuclear Information System (INIS)

    Piette, J.; Decuyper-Debergh, D.; Gamper, H.


    Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totally deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion

  5. A multistakeholder platform to promote health and prevent noncommunicable diseases in the region of the Americas: the Pan American Health Organization partners forum for action. (United States)

    Hospedales, C James; Jané-Llopis, Eva


    Noncommunicable diseases (NCDs) and obesity are the most serious health problem facing the countries of the Americas in terms of avoidable deaths as well as costs to governments, families, and business. The main causes are ageing of the population, and widespread risks such as tobacco use, unhealthy diet, physical inactivity, and harmful use of alcohol, linked to major changes in the way we live and work, to public policies, cultural norms, and private sector forces. Underlying determinants are globalization, urbanization, poverty, education, gender, ethnicity, and access to health services. Yet, approximately 80% of cardiovascular disease and diabetes, and 40% of cancer, are preventable through a range of cost-effective population and individual measures for those at high risk of living with NCDs. However, the multisectoral nature of NCDs requires a cross-sector response to succeed. Several governments have commenced intersectoral efforts, and civil society and private sector also have many initiatives, but the responses are fragmented and skewed. The Partners Forum is being launched by the Pan American Health Organization in collaboration with the World Economic Forum and a set of partners including member states, partners in civil society, and partners in the private sector, as a multisector platform to catalyze, recognize, and scale up collaborative action to promote health and prevent and control NCDs at regional, subregional, and country level. The principles of partnership and lessons learned from other partnership experiences are being used in its design.

  6. The -2549 insertion/deletion polymorphism in the promoter region of VEGF is associated with the risk of recurrent spontaneous abortion. (United States)

    Hashemi, Mohammad; Danesh, Hiva; Bizhani, Fatemeh; Mokhtari, Mojgan; Bahari, Gholamreza; Tabasi, Farhad; Taheri, Mohsen


    Recurrent spontaneous abortion (RSA) is a common health problem affecting women of reproductive age. Altered expression of vascular endothelial growth factor ( VEGF ) has been associated with spontaneous abortion. The present case-control study aimed to evaluate the impact of the 18-bp insertion/deletion (ins/del) polymorphism (rs35569394) in the promoter region of the VEGF gene on idiopathic RSA. Genomic DNA from 93 patients with RSA and 93 healthy fertile women of southeastern Iran was isolated using the salting-out method. Genotyping of the rs35569394 variant was performed by a polymerase chain reaction (PCR) method. The findings indicated that the VEGF 18-bp ins/del variant significantly increased the risk of RSA under codominant (ins/ins vs. del/del; OR=2.85, 95% CI=1.31-6.22, P=0.019), dominant (del/ins+ins/ins vs. del/del; OR=2.19, 95% CI=1.20-4.01, P=0.015) and allelic (ins vs. del; OR=1.90, 95% CI=1.25-2.88, P=0.003) inheritance models. In summary, the findings propose a significant association between the VEGF 18-bp ins/del polymorphism and risk of RSA in a sample of the southeast Iranian population. Further studies on larger sample sizes and different ethnicities are required to validate the present findings.

  7. Understanding, promoting and protecting geodiversity and geoheritage of the Piemonte region (Italy) through innovative techniques and public engagement in Earth Science studies (United States)

    Giardino, Marco; Lozar, Francesca; Perotti, Luigi; Palomba, Mauro; Groppo, Chiara; Natalicchio, Marcello; Ghiraldi, Luca; Beltramo, Riccardo; Lombardo, Vincenzo


    The onset of Antropocene demonstrates the importance of considering both 1) geodiversity and 2) geoheritage as parts of the landscape "interfaces" where relationships between natural and socio-economic systems can be studied and interpreted. By definition: 1) is the variety, recognizable in nature ("diversity"), of geological features (rocks, minerals, fossils…), of geomorphological environments (and related forms and processes) and of soil characteristics; 2) is an integral part of the global natural heritage focusing on unique, special and representative sites of geological interests (geosites l.s.). In the Antropocene, both 1) and 2) hold a dynamic character, as the result of actions and interactions of natural and/or human factors. Therefore, geodiversity and geoheritage studies are essential for breaking down geological environments and human territories into their main parts and to understand the variables and mechanisms that control their changes. In this perspective, results of the multidisciplinary project PROGEO-Piemonte ("PROactive management of GEOlogical heritage in the Piemonte Region") are presented here: an innovative approach for assessing geodiversity in order to select areas of high potential value of geoheritage to be enhanced by targeted management actions. Since the geodiversity of Piemonte is materialized by elements of high scientific, educational, tourism, etc. value, the geosites where this geoheritage is preserved have been comprehensively analysed and characterized for encompassing both public and private interests. 9 strategic geothematic areas have been selected in the Piemonte Region to test this approach, and to improve social engagement aimed at protecting and promoting geodiversity ad geoheritage. The investigated areas represent the multifaceted geodiversity of Piemonte; each area is characterized by high potential for scientific studies, enhancement of public understanding of science, recreation activities and for economic

  8. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour


    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  9. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin


    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  10. Susceptibility to gastric cancer and polymorphisms of insertion/deletion at the intron 3 of the XRCC4 and VNTR at the promoter region of the XRCC5. (United States)

    Saadat, Mostafa; Pashaei, Samira; Amerizade, Foroozan


    The genes encoding X-ray repair cross-complementing group 4 (XRCC4; OMIM: 194363) and 5 (XRCC5; OMIM: 194364) are involved in repair of DNA double-strand breaks. To investigating the associations between polymorphisms of Insertion/Deletion (I/D, rs28360071) in the intron 3 of the XRCC4 and VNTR in the promoter region of the XRCC5 and risk of gastric cancer, the present study was carried out. We included 159 (56 females, 103 males) with gastric cancer and 242 (75 females, 167 males) healthy blood donors frequency matched for age and gender. Using PCR-based methods, the genotypes of the study polymorphisms were determined. The alleles of VNTR XRCC5 polymorphism divided into two groups: L (0 and 1 repeats) and H (2 and 3 repeats) alleles. For the I/D XRCC4 polymorphism, after stratification of the subjects according to their family history (FH) of cancer, either the ID (OR = 3.19, 95%CI: 1.35-7.50, P = 0.008) or the DD genotypes (OR = 4.62, 95%CI: 1.63-13.0, P = 0.004) among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and II genotype). For the VNTR XRCC5 polymorphism, the LH + HH genotypes among positive FH persons, increased the risk of gastric cancer compared with the reference group (persons who have negative FH and LL genotype) (OR = 2.88, 95%CI: 1.34-6.18, P = 0.006). Sensitivity analysis showed that the above mentioned associations were not occurred due to the maldistribution of the genotypes among missing data. The present study suggests that both polymorphisms of the XRCC4 and XRCC5 might be risk factors for gastric cancer development especially among persons with positive FH.

  11. Wake-promoting actions of median nerve stimulation in TBI-induced coma: An investigation of orexin-A and orexin receptor 1 in the hypothalamic region. (United States)

    Zhong, Ying-Jun; Feng, Zhen; Wang, Liang; Wei, Tian-Qi


    A coma is a serious complication, which can occur following traumatic brain injury (TBI), for which no effective treatment has been established. Previous studies have suggested that neural electrical stimulation, including median nerve stimulation (MNS), may be an effective method for treating patients in a coma, and orexin‑A, an excitatory hypothalamic neuropeptide, may be involved in wakefulness. However, the exact mechanisms underlying this involvement remain to be elucidated. The present study aimed to examine the arousal‑promoting role of MNS in rats in a TBI‑induced coma and to investigate the potential mechanisms involved. A total of 90 rats were divided into three groups, comprising a control group, sham‑stimulated (TBI) group and a stimulated (TBI + MNS) group. MNS was performed on the animals, which were in a TBI‑induced comatose state. Changes in the behavior of the rats were observed following MNS. Subsequently, hypothalamic tissues were extracted from the rats 6, 12 and 24 h following TBI or MNS, respectively. The expression levels of orexin‑A and orexin receptor‑1 (OX1R) in the hypothalamus were examined using immunohistochemistry, western blotting and an enzyme‑linked immunosorbent assay. The results demonstrated that 21 rats subjected to TBI‑induced coma exhibited a restored righting reflex and response to pain stimuli following MNS. In addition, ignificant differences in the expression levels of orexin‑A and OXIR were observed among the three groups and among the time‑points. Orexin‑A and OX1R were upregulated following MNS. The rats in the stimulated group reacted to the MNS and exhibited a re‑awakening response. The results of the present study indicated that MNS may be a therapeutic option for TBI‑induced coma. The mechanism may be associated with increasing expression levels of the excitatory hypothalamic neuropeptide, orexin-A, and its receptor, OX1R, in the hypothalamic region.

  12. Influence of A-21T and C-262T genetic polymorphisms at the promoter region of the catalase (CAT) on gene expression. (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa


    Catalase (CAT, OMIM: 115500) is one of the major antioxidant enzymes, which plays an important role in the clearance of reactive oxygen species. Three genetic polymorphisms of A-21T (rs7943316), C-262T (rs1001179), and C-844T (rs769214) in the promoter region of the CAT have been reported. It has been suggested that these polymorphisms may alter the recognition sites of transcriptional factors, therefore it might be concluded that these polymorphisms may alter the expression levels of the gene. The aim of the present study is to evaluate the associations between these genetic variations and the CAT mRNA levels in human peripheral blood cells. The present study consisted of 47 healthy students of Shiraz University (south-west Iran). Genotypes of the CAT polymorphisms were determined by PCR based method. The quantitative CAT mRNA expression levels were investigated using quantitative real-time PCR. Analysis of variance revealed significant differences between the study genotypes (For A-21T polymorphism: F = 7.45; df = 2, 44; P = 0.002; For C-262T polymorphism: F = 15.17; df = 2, 44; P CAT in the AC/TT, TC/TC, TC/TT, and TC/TC diplotypes significantly were higher than the mRNA levels in AC/AC diplotype. There was a significant difference between the study genotypes (F = 9.24; df = 5, 41; P CAT mRNA levels compared with the AC/AC diplotype. The present findings indicated that these polymorphisms were significantly associated with the gene expression.

  13. Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation (United States)

    Janssen, Paddy K.C.; Zwinderman, Aeilko H.; Olivier, Berend


    Purpose To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). Materials and Methods This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of the polymorphism were compared between patients and controls. Associations between the LL, SL, and SS genotypes and fold increase of mean IELT were investigated. Results Of the 54 patients, 43 (79.6%) responded to 20-mg paroxetine treatment with an ejaculation delay, whereas 11 patients (20.4%) did not respond; 44%, 18%, and 18% of the patients showed a fold increase in mean IELT of 2-10, 10-20, and more than 20, respectively. Of the 54 men, 14 (25.9%) had the LL genotype, 29 (53.7%) had the SL genotype, and 11 (20.4%) had the SS genotype. In the 92 controls, the LL, SL, and SS genotypes were present in 27 (29.3%), 41 (44.6%), and 24 (26.1%), respectively. No statistically significant differences were found in 5-HTTLPR allelic variations or in 5-HTTLPR gene variations. In all men treated with 20 mg paroxetine, analysis of variance of the natural logarithm of fold increase in the IELT showed no statistically significant difference according to genotype (p=0.83). Conclusions The 5-HTTLPR polymorphism is not associated with daily 20-mg paroxetine treatment-induced ejaculation delay in men with LPE. PMID:24578810

  14. A meta-analysis of the effects of the 5-hydroxytryptamine transporter gene-linked promoter region polymorphism on susceptibility to lifelong premature ejaculation.

    Directory of Open Access Journals (Sweden)

    Lijie Zhu

    Full Text Available OBJECTIVE: Premature ejaculation (PE has been reported as the most common male sexual dysfunction with global prevalence rates estimated at approximately 30%. The neurobiogenesis of ejaculation is very complex and involves the serotoninergic (5-hydroxytryptamine, 5-HT system. Recently, genetic polymorphisms located on SLC6A4 gene codifying for 5-HT transporter (5-HTT, the major regulator of serotonic neurotransmission, have been linked with the pathogenesis and risk of PE. Apparently studies of this type of polymorphism in PE have show conflicting results. METHODS: A meta-analysis was performed that are available in relation with 5-HTT gene-linked promoter region (5-HTTLPR polymorphism and the risk of lifelong PE (LPE in men to clarify this relationship. We searched Pubmed and Embase (last search updated on Aug 2012 using 'premature ejaculation', 'polymorphism or variant', 'genotype', 'ejaculatory function', and 'rapid ejaculation' as keywords and reference lists of studies corresponded to the inclusion criteria for meta-analysis. These studies involved the total number of 481 LPE men and 466 health control men subjects. Odds ratio (OR and 95% confidence intervals (CIs were used to evaluate this relationship. RESULTS: In the overall analysis, significant associations between LPE risk and 5-HTTLPR polymorphism were found (L-allele vs. S-allele OR = 0.86, 95% CI = 0.79-0.95, P = 0.002; LL vs. SS: OR = 0.80, 95% CI = 0.68-0.95, P = 0.009; LS vs. SS: OR = 0.85, 95% CI = 0.76-0.97, P = 0.012 and LL+LS vs. SS: OR = 0.88, 95% CI = 0.81-0.95, P = 0.002. Moreover, in subgroup analysis based on ethnicity, similar significant associations were detected. The Egger's test did not reveal presence of a publication bias. CONCLUSIONS: Our investigations demonstrate that 5-HTTLPR (L>S polymorphism might protect men against LPE risk. Further studies based on larger sample size and gene-environment interactions should

  15. Profile, knowledge, and work patterns of a cadre of maternal, newborn, and child health CHWs focusing on preventive and promotive services in Morogoro Region, Tanzania. (United States)

    LeFevre, Amnesty E; Mpembeni, Rose; Chitama, Dereck; George, Asha S; Mohan, Diwakar; Urassa, David P; Gupta, Shivam; Feldhaus, Isabelle; Pereira, Audrey; Kilewo, Charles; Chebet, Joy J; Cooper, Chelsea M; Besana, Giulia; Lutale, Harriet; Bishanga, Dunstan; Mtete, Emmanuel; Semu, Helen; Baqui, Abdullah H; Killewo, Japhet; Winch, Peter J


    Despite impressive decreases in under-five mortality, progress in reducing maternal and neonatal mortality in Tanzania has been slow. We present an evaluation of a cadre of maternal, newborn, and child health community health worker (MNCH CHW) focused on preventive and promotive services during the antenatal and postpartum periods in Morogoro Region, Tanzania. Study findings review the effect of several critical design elements on knowledge, time allocation, service delivery, satisfaction, and motivation. A quantitative survey on service delivery and knowledge was administered to 228 (of 238 trained) MNCH CHWs. Results are compared against surveys administered to (1) providers in nine health centers (n = 88) and (2) CHWs (n = 53) identified in the same districts prior to the program's start. Service delivery outputs were measured by register data and through a time motion study conducted among a sub-sample of 33 randomly selected MNCH CHWs. Ninety-seven percent of MNCH CHWs (n = 228) were interviewed: 55% male, 58% married, and 52% with secondary school education or higher. MNCH CHWs when compared to earlier CHWs were more likely to be unmarried, younger, and more educated. Mean MNCH CHW knowledge scores were <50% for 8 of 10 MNCH domains assessed and comparable to those observed for health center providers but lower than those for earlier CHWs. MNCH CHWs reported covering a mean of 186 households and were observed to provide MNCH services for 5 h weekly. Attendance of monthly facility-based supervision meetings was nearly universal and focused largely on registers, yet data quality assessments highlighted inconsistencies. Despite program plans to provide financial incentives and bicycles for transport, only 56% of CHWs had received financial incentives and none received bicycles. Initial rollout of MNCH CHWs yields important insights into addressing program challenges. The social profile of CHWs was not significantly associated with knowledge or

  16. A pilot study investigating of the nature of point-of-sale alcohol promotions in bottle shops in a large Australian regional city. (United States)

    Jones, Sandra C; Lynch, Melissa


    The promotion of alcohol by retailers and media can contribute to a culture of excessive alcohol consumption, but the effect of non-advertising alcohol promotions has largely been neglected. This study sought to gather initial data on this important area. An observational study of alcohol point-of-sale promotions in the Wollongong CBD area, conducted in July-August 2005. We identified 17 different promotions in three categories: gift with purchase; competitions; and buy some, get some free. Given previous research demonstrating the relationship between increased alcohol consumption and both ownership of alcohol-related merchandise and reduced per unit price, it appears that point-of-sale promotions may have the potential to further increase alcohol consumption among young people. Only when the extent and impact of such promotions is demonstrated will we be in a position to effectively advocate for appropriate regulations to ensure young people are not exposed to marketing strategies that further increase their exposure to alcohol-related harms.

  17. HDAC inhibitors TSA and sodium butyrate enhanced the human IL-5 expression by altering histone acetylation status at its promoter region. (United States)

    Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu


    The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.

  18. Health Promotion Behaviours and Level of Activities of Daily Living and Instrumental Activities of Daily Living Among Elderly People in West Region of Tehran: A Cross-Sectional Survey

    Directory of Open Access Journals (Sweden)

    Aghil Habibi Sola


    Full Text Available Objectives: As individuals live longer, health promotion behaviors get even more important, particularly with regard to maintaining functional independence and improving quality of life. The purpose of this study was to explore the relationship between health promotion behaviors and level of Activities of Daily Living (ADL and Instrumental Activities of Daily Living (IADL among elderly people in west region of Tehran. Methods & Materials: This was a descriptive-correlational study. A multi-stage sample of 410 community residents who were over 60 years old were selected from west region of Tehran. Participants who consented to participate in the study were interviewed with a structured questionnaire. The questionnaire consisted of 2-part; Health Promotion Behavior Checklist and questions related to status of physical functioning, which includes activities of daily living (ADLs and instrumental activities of daily living (IADLs. Descriptive statistics and T-test were used to data analysis. Results: The results of the study showed that there were significant relations between ADLs and ' exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Furthermore there were significant relations between the IADLs and 'smoking cessation', 'alcohol abstinence', 'exercise or walking', 'drinking milk, eating dairy and meat', 'eating vegetables and fruits', 'low salt diet' and 'low fat diet' (P<0.05. Conclusion: Study showed, health promotion behaviors and level of ADL and IADL are related meaningfully. Health care professionals should enhance the physical functioning in elderly people by facilitating health promotion behaviors through formal health promotion programs which focus on regular diet, exercise, and regular physical check-ups which will maintain and increase a healthy and active life.

  19. Large-scale chromatin immunoprecipitation with promoter sequence microarray analysis of the interaction of the NSs protein of Rift Valley fever virus with regulatory DNA regions of the host genome. (United States)

    Benferhat, Rima; Josse, Thibaut; Albaud, Benoit; Gentien, David; Mansuroglu, Zeyni; Marcato, Vasco; Souès, Sylvie; Le Bonniec, Bernard; Bouloy, Michèle; Bonnefoy, Eliette


    Rift Valley fever virus (RVFV) is a highly pathogenic Phlebovirus that infects humans and ruminants. Initially confined to Africa, RVFV has spread outside Africa and presently represents a high risk to other geographic regions. It is responsible for high fatality rates in sheep and cattle. In humans, RVFV can induce hepatitis, encephalitis, retinitis, or fatal hemorrhagic fever. The nonstructural NSs protein that is the major virulence factor is found in the nuclei of infected cells where it associates with cellular transcription factors and cofactors. In previous work, we have shown that NSs interacts with the promoter region of the beta interferon gene abnormally maintaining the promoter in a repressed state. In this work, we performed a genome-wide analysis of the interactions between NSs and the host genome using a genome-wide chromatin immunoprecipitation combined with promoter sequence microarray, the ChIP-on-chip technique. Several cellular promoter regions were identified as significantly interacting with NSs, and the establishment of NSs interactions with these regions was often found linked to deregulation of expression of the corresponding genes. Among annotated NSs-interacting genes were present not only genes regulating innate immunity and inflammation but also genes regulating cellular pathways that have not yet been identified as targeted by RVFV. Several of these pathways, such as cell adhesion, axonal guidance, development, and coagulation were closely related to RVFV-induced disorders. In particular, we show in this work that NSs targeted and modified the expression of genes coding for coagulation factors, demonstrating for the first time that this hemorrhagic virus impairs the host coagulation cascade at the transcriptional level.

  20. The Effect of Point of Sale Promotions on the Alcohol Purchasing Behaviour of Young People in Metropolitan, Regional and Rural Australia (United States)

    Jones, Sandra C.; Smith, Kylie M.


    This study, part of a larger project examining marketing and alcohol, looked specifically at the effects of point of sale (POS) promotions on young people, with a view to providing evidence which could be used to inform policy and regulation in this area. A series of focus groups were conducted in three different locations with young people aged…

  1. A 200 bp region of the pea ENOD12 promoter is sufficient for nodule-specific and nod factor induced expression

    DEFF Research Database (Denmark)

    Vijn, I; Christiansen, H; Lauridsen, P


    previously described. The isolation and characterization of a PsENOD12A genomic clone is presented in this paper. By using a Vicia hirsuta-Agrobacterium rhizogenes transformation system it is shown that both genes have a similar expression pattern in transgenic V. hirsuta root nodules. Promoter analyses...

  2. Domains of apolipoprotein E contributing to triglyceride and cholesterol homeostasis in vivo. Carboxyl-terminal region 203-299 promotes hepatic very low density lipoprotein-triglyceride secretion

    NARCIS (Netherlands)

    Kypreos, K.E.; Dijk, K.W. van; Zee, A. van der; Havekes, L.M.; Zannis, V.I.


    Apolipoprotein (apo) E has been implicated in cholesterol and triglyceride homeostasis in humans. At physiological concentration apoE promotes efficient clearance of apoE-containing lipoprotein remnants. However, high apoE plasma levels correlate with high plasma triglyceride levels. We have used

  3. An allelic polymorphism within the human tumor necrosis factor alpha promoter region is strongly associated with HLA A1, B8, and DR3 alleles

    NARCIS (Netherlands)

    Wilson, A. G.; de Vries, N. [=Niek; Pociot, F.; di Giovine, F. S.; van der Putte, L. B.; Duff, G. W.


    The tumor necrosis factor (TNF) alpha gene lies within the class III region of the major histocompatibility complex (MHC), telomeric to the class II and centromeric to the class I region. We have recently described the first polymorphism within the human TNF-alpha locus. This is biallelic and lies

  4. Performance of health product risk management and surveillance conducted by health personnel at sub-district health promotion hospitals in the northeast region of Thailand


    Kanjanarach, Tipaporn; Jaisa-ard, Raksaworn; Poonaovarat, Nantawan


    Tipaporn Kanjanarach,1,2 Raksaworn Jaisa-ard,1,2 Nantawan Poonaovarat3 1Faculty of Pharmaceutical Sciences, Khon Kaen University, Khon Kaen, Thailand; 2Center for Research and Development of Herbal Health Products, Khon Kaen University, Khon Kaen, Thailand; 3Health Consumer Protection, Chaiyapum Health Provincial Office, Chaiyapum, Thailand Background: Health personnel at sub-district health promotion hospitals (SD-HPHs) are assigned to take responsibility for 15 activities related to health...

  5. An HDAC2-TET1 switch at distinct chromatin regions significantly promotes the maturation of pre-iPS to iPS cells (United States)

    Wei, Tingyi; Chen, Wen; Wang, Xiukun; Zhang, Man; Chen, Jiayu; Zhu, Songcheng; Chen, Long; Yang, Dandan; Wang, Guiying; Jia, Wenwen; Yu, Yangyang; Duan, Tao; Wu, Minjuan; Liu, Houqi; Gao, Shaorong; Kang, Jiuhong


    The maturation of induced pluripotent stem cells (iPS) is one of the limiting steps of somatic cell reprogramming, but the underlying mechanism is largely unknown. Here, we reported that knockdown of histone deacetylase 2 (HDAC2) specifically promoted the maturation of iPS cells. Further studies showed that HDAC2 knockdown significantly increased histone acetylation, facilitated TET1 binding and DNA demethylation at the promoters of iPS cell maturation-related genes during the transition of pre-iPS cells to a fully reprogrammed state. We also found that HDAC2 competed with TET1 in the binding of the RbAp46 protein at the promoters of maturation genes and knockdown of TET1 markedly prevented the activation of these genes. Collectively, our data not only demonstrated a novel intrinsic mechanism that the HDAC2-TET1 switch critically regulates iPS cell maturation, but also revealed an underlying mechanism of the interplay between histone acetylation and DNA demethylation in gene regulation. PMID:25934799

  6. Using the ANGELO model to develop the children's healthy living program multilevel intervention to promote obesity preventing behaviors for young children in the U.S.-affiliated Pacific Region. (United States)

    Braun, Kathryn L; Nigg, Claudio R; Fialkowski, Marie K; Butel, Jean; Hollyer, James R; Barber, L Robert; Bersamin, Andrea; Coleman, Patricia; Teo-Martin, Ursula; Vargo, Agnes M; Novotny, Rachel


    Almost 40% of children are overweight or obese by age 8 years in the US-Affiliated Pacific, inclusive of the five jurisdictions of Alaska, Hawaii, American Samoa, Guam, and the Commonwealth of the Northern Mariana Islands. This article describes how the Children's Healthy Living (CHL) Program used the ANGELO (Analysis Grid for Environments/Elements Linked to Obesity) model to design a regional intervention to increase fruit and vegetable intake, water consumption, physical activity, and sleep duration and decrease recreational screen time and sugar-sweetened beverage consumption in young children ages 2-8 years. Using the ANGELO model, CHL (1) engaged community to identify preferred intervention strategies, (2) reviewed scientific literature, (3) merged findings from community and literature, and (4) formulated the regional intervention. More than 900 community members across the Pacific helped identify intervention strategies on importance and feasibility. Nine common intervention strategies emerged. Participants supported the idea of a regional intervention while noting that cultural and resource differences would require flexibility in its implementation in the five jurisdictions. Community findings were merged with the effective obesity-reducing strategies identified in the literature, resulting in a regional intervention with four cross-cutting functions: (1) initiate or strengthen school wellness policies; (2) partner and advocate for environmental change; (3) promote CHL messages; and (4) train trainers to promote CHL behavioral objectives for children ages 2-8 years. These broad functions guided intervention activities and allowed communities to tailor activities to maximize intervention fit. Using the ANGELO model assured that the regional intervention was evidence based while recognizing jurisdiction context, which should increase effectiveness and sustainability.

  7. The Role of National Human Rights Institutions (NHRIs) and Regional Networks in Promoting Human Rights and Health related to Sexual Orientation and Gender Identity (SOGI) in Southeast Asia

    NARCIS (Netherlands)

    Holzhacker, Ronald

    The UN is increasingly a place where a critical discussion about human rights and sexual orientation and gender identity is taking place. An important institutional component of the UN system of protection of human rights is the creation of National Human Rights Institutions (NHRIs). The regional

  8. Early life adversity and serotonin transporter gene variation interact to affect DNA methylation of the corticotropin-releasing factor gene promoter region in the adult rat brain

    NARCIS (Netherlands)

    Doelen, R.H.A. van der; Arnoldussen, I.A.C.; Ghareh, H.; Och, L. van; Homberg, J.R.; Kozicz, L.T.


    The interaction between childhood maltreatment and the serotonin transporter (5-HTT) gene linked polymorphic region has been associated with increased risk to develop major depression. This Gene x Environment interaction has furthermore been linked with increased levels of anxiety and glucocorticoid

  9. Health disparities among the western, central and eastern rural regions of China after a decade of health promotion and disease prevention programming. (United States)

    Zhang, Xi-Fan; Tian, Xiang-Yang; Cheng, Yu-Lan; Feng, Zhan-Chun; Wang, Liang; Southerland, Jodi


    Health disparities between the western, central and eastern regions of rural China, and the impact of national health improvement policies and programming were assessed. A total of 400 counties were randomly sampled. ANOVA and Logistic regression modeling were employed to estimate differences in health outcomes and determinants. Significant differences were found between the western, central and eastern rural regions in community infrastructure and health outcomes. From 2000 to 2010, health indicators in rural China were improved significantly, and the infant mortality rate (IMR), maternal mortality rate (MMR) and under 5 mortality rate (U5MR) had fallen by 62.79%, 71.74% and 61.92%, respectively. Central rural China had the greatest decrease in IMR (65.05%); whereas, western rural China had the greatest reduction in MMR (72.99%) but smallest reduction in U5MR (57.36%). Despite these improvements, Logistic regression analysis showed regional differences in key health outcome indicators (odds ratios): IMR (central: 2.13; western: 5.31), U5MR (central: 2.25; western: 5.69), MMR (central: 1.94; western: 3.31), and prevalence of infectious diseases (central: 1.62; western: 3.58). The community infrastructure and health outcomes of the western and central rural regions of China have been improved markedly during the first decade of the 21st century. However, health disparities still exist across the three regions. National efforts to increase per capita income, community empowerment and mobilization, community infrastructure, capacity of rural health facilities, and health literacy would be effective policy options to attain health equity.

  10. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)]. (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P


    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  11. Geothermal development promotion survey report. No. 26. Akan region; 1988-1991 chinetsu kaihatsu sokushin chosa hokokusho. No. 26 Akan chiiki

    Energy Technology Data Exchange (ETDEWEB)



    The results of surveys conducted in the Akan region, Hokkaido, in fiscal 1988-1990 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, gravity prospecting, electromagnetic surveillance (simplified magnetotelluric method), electric prospecting (Schlumberger method), electric prospecting (mise-a-la-masse method), heat flow rate survey, test boring, geothermal water survey, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. Fractures running NE-SW are dominant, and those closely related to prominent geothermal signs are found in the Akan Seibu fault group in the western part of the Akan region. The test boring results show that there are high-temperature zones of 292.1 degrees C, 194.9 degrees C, and 245.9 degrees C. Geothermal fluids were discharged by well N2-AK-7 at a rate of 4.7-4.8 t/h in steam and 0.3-0.4 t/h in neutral SO{sub 4}-HCO{sub 3} type geothermal water. High-temperature steam-dominated geothermal resources are expected to exist deep in the ground in this region, and the area where the Akan Seibu fault group is distributed may be named as a location containing promising geothermal resources. (NEDO)

  12. Report of the researcher exchange promotion project on the environmental issues in the Asia-Pacific region; Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)



    Proposals have been made for the establishment of a network (ETERNET-APR) linking those involved in the research and development of environmental technology in the Asia-Pacific region in order to limit the environmental impact of industrial activity. By pursuing active exchanges of information and personnel, researchers in environmental technology in the Asia-Pacific region have been making serious efforts to establish such a network. This fiscal year, the Internet Web site of the ETERNET-APR has been created using the data collected to date. This database includes information on some 350 researchers and 200 research projects from seven countries. The first international symposium was successfully held at Environmental Research Institute of Chulalongkorn University in Thailand (ERIC), hosting 200 environmental researchers from 10 countries in the Asia-Pacific region. Tripartite sister laboratories ties among the National Institute for Resources and Environment (NIRE) and three Korean laboratories were forged. The sister laboratory project between ICETT and ERIC is also proving effective. These successes prove that intraregional joint research, the objective of ETERNET-APR, has begun to take shape in this year

  13. Single nucleotide polymorphisms in the promoter region of the IL1B gene influence outcome in multiple myeloma patients treated with high-dose chemotherapy independently of relapse treatment with thalidomide and bortezomib

    DEFF Research Database (Denmark)

    Vangsted, Annette J.; Klausen, Tobias W.; Abildgaard, Niels


    the impact on outcome of HDT, INF-α maintenance treatment, and treatment with thalidomide and bortezomib at relapse, in relation to the major identified functional polymorphisms in the promoter region of IL1B. The wild-type C-allele of IL1B C-3737T and non-carriage of the IL1B promoter haplotype TGT (−3737T...... carrying the wild-type C-allele of IL1B C-3737T (HR, 1.6 (1.1–2.4)). Furthermore, among INF-α treated patients, gene–gene interaction studies on IL1B C-3737T and NFКB1-94ins/del ATTG revealed a fourfold increase in TTF for homozygous carriers of wild-type alleles at both loci as compared to variant allele...... carriers at both loci. No relation to genotype and outcome was found for relapse patients treated with thalidomide or bortezomib. Our results indicate that a subpopulation of myeloma patients carrying the wild-type C-allele of IL1B C-3737T and non-carriers of the promoter haplotype TGT (−3737T, −1464G...

  14. An ethnographic action research study to investigate the experiences of Bindjareb women participating in the cooking and nutrition component of an Aboriginal health promotion programme in regional Western Australia. (United States)

    Nilson, Caroline; Kearing-Salmon, Karrie-Anne; Morrison, Paul; Fetherston, Catherine


    To investigate the experiences of women participating in a cooking and nutrition component of a health promotion research initiative in an Australian Aboriginal regional community. Weekly facilitated cooking and nutrition classes were conducted during school terms over 12 months. An ethnographic action research study was conducted for the programme duration with data gathered by participant and direct observation, four yarning groups and six individual yarning sessions. The aim was to determine the ways the cooking and nutrition component facilitated lifestyle change, enabled engagement, encouraged community ownership and influenced community action. Regional Bindjareb community in the Nyungar nation of Western Australia. A sample of seventeen Aboriginal women aged between 18 and 60 years from the two kinships in two towns in one shire took part in the study. The recruitment and consent process was managed by community Elders and leaders. Major themes emerged highlighting the development of participants and their recognition of the need for change: the impact of history on current nutritional health of Indigenous Australians; acknowledging shame; challenges of change around nutrition and healthy eating; the undermining effect of mistrust and limited resources; the importance of community control when developing health promotion programmes; finding life purpose through learning; and the need for planning and partnerships to achieve community determination. Suggested principles for developing cooking and nutrition interventions are: consideration of community needs; understanding the impact of historical factors on health; understanding family and community tensions; and the engagement of long-term partnerships to develop community determination.

  15. SRSF1-3 contributes to diversification of the immunoglobulin variable region gene by promoting accumulation of AID in the nucleus


    Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki


     Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this stu...

  16. Investigation of -308G>A and -1031T>C polymorphisms in the TNFA promoter region in Polish peptic ulcer patients. (United States)

    Sałagacka, Aleksandra; Żebrowska, Marta; Jeleń, Agnieszka; Mirowski, Marek; Balcerczak, Ewa


    Tumor necrosis factor α (TNF-α) encoded by TNFA is a key mediator in inflammation, a precursor condition for peptic ulceration. Promoter polymorphisms of TNFA that influence its transcriptional activity and TNF-α production are known. TNFA-308G>A (rs1800629) and TNFA-1031T>C (rs1799964), which are responsible for increased TNFA transcription, could influence the risk of peptic ulceration. This study aimed to investigate these polymorphisms and to evaluate their association with peptic ulcer disease and Helicobacter pylori infection in the Polish population. Gastric mucosa specimens obtained from 177 Polish peptic ulcer patients were used to conduct rapid urease tests and to assess the investigated polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. Genotyping data were compared with the results obtained from healthy individuals of Polish origin. There were no significant differences in genotype and allele frequency of the investigated polymorphisms between peptic ulcer patients and healthy individuals. No associations between the frequencies of particular genotypes and alleles for both single-nucleotide polymorphisms (SNPs) and the presence of H. pylori infection in peptic ulcer patients and in subgroups of men and women with peptic ulcer disease were found. The investigated SNPs are not risk factors for either peptic ulcer or H. pylori infection development in the Polish population. The results require verification in a larger cohort.

  17. Geothermal development promotion survey report. No. 25. Hishikari region; 1987-1989 chinetsu kaihatsu sokushin chosa hokokusho. No. 22 Hishikari chiiki

    Energy Technology Data Exchange (ETDEWEB)



    The results of surveys conducted in the Hishikari region, Kagoshima Prefecture, in fiscal 1987-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting, electromagnetic surveillance, gravity prospecting, heat flow rate survey, test boring, environmental impact survey, and so forth. The surveys resulted in conclusions mentioned below. According to the underground temperature distribution based on the results of the heat flow rate survey, test boring, and so forth, temperature is low at the western part of the Hishikari region where there is a low gravity anomaly and high in the zone in the ENE-WSW direction where there is a high gravity anomaly. The present ground temperature is lower than the fluid inclusion homogenization temperature by approximately 120-140 degrees C. It is deduced that the geothermal water reservoir lies in the Quatenary volcanic rocks or in a fracture zone that develops in the Shimanto supergroup. It is inferred that the geothermal water producing the hot spring water all originates in meteoric water staying long in the ground. It is also inferred that volcanic gas or the like contributes but a little to the formation of the geothermal system but that the contribution is great of the heat supplied from the magma pool. (NEDO)

  18. Geothermal development promotion survey report. No. 28. Eastern part of Obanazawa region; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 28 Obanazawa tobu chiiki

    Energy Technology Data Exchange (ETDEWEB)



    The results of surveys conducted in the eastern part of Obanazawa region, Yamagata Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electromagnetic surveillance (TDEM - time domain electromagnetic method), gravity prospecting (review of gravity data), electric prospecting (Schlumberger method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the water of the Ginzan hot spring of the neutral Cl-SO{sub 4} type originates in meteoric water in mountains high above the mean sea level in the western side and that the hot spring water is produced when water heated to approximately 170 degrees C at a depth (1,500-2,000 meters below mean sea level) in the Ginzan hot spring district, where the ground temperature is the highest in this region, is diluted by groundwater near the surface at its ultimate stage of ascent. The survey results disclose that possibilities are quite low that a high-temperature sector of 200 degrees C or higher is found at a level not deeper than 2,000 meters from the ground surface. Accordingly, no geothermal development by flash steam power generation is feasible at the present stage at any economically acceptable depth. (NEDO)

  19. Geothermal development promotion survey report. No. 29. Upper reach region of Oita river; 1988-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 29 Oitagawa joryu chiiki

    Energy Technology Data Exchange (ETDEWEB)



    The results of surveys conducted in the Oita river region, Oita Prefecture, in fiscal 1988-1989 are compiled in this report. Conducted were a geological/alteration zone survey, geochemical survey, electric prospecting (Schlumberger method), electromagnetic surveillance (simplified magnetotelluric method), electromagnetic surveillance (EMAP - Environmental Monitoring and Assessment Program method), heat flow rate survey, test boring, environmental impact survey, and so forth. Conclusions are mentioned below. It is inferred that the geothermal fluid results from groundwater originating in meteoric water, that the meteoric water takes many years to flow from the mountainous region into the ground where it is stored mainly in the Shonai stratum, that the stored water is warmed by heat from rocks in the neighborhood for development into a geothermal fluid, and that the geothermal fluid finally forms a hot spring water reservoir. Hot spring water reservoirs are found widely distributed in the basin of the Oita river. In view of the ground temperature distribution and the hot spring water geochemical temperature determined by structure boring, it is concluded that possibilities are quite low that there exists a high-temperature geothermal fluid usable for power generation. (NEDO)

  20. Serotonin transporter promoter region (5-HTTLPR) polymorphism is associated with the intravaginal ejaculation latency time in Dutch men with lifelong premature ejaculation. (United States)

    Janssen, Paddy K C; Bakker, Steven C; Réthelyi, Janos; Zwinderman, Aeilko H; Touw, Daan J; Olivier, Berend; Waldinger, Marcel D


    Lifelong premature ejaculation (LPE) is characterized by persistent intravaginal ejaculation latency times (IELTs) of less than 1 minute, and has been postulated as a neurobiological dysfunction with genetic vulnerability for the short IELTs, related to disturbances of central serotonin (5-hydroxytryptamine [5-HT]) neurotransmission and 5-HT receptor functioning. To investigate the relationship between 5-HT transporter gene-linked polymorphism (5-HTTLPR) and short IELTs in men with lifelong PE. A prospective study was conducted in 89 Dutch Caucasian men with lifelong PE. IELT during coitus was assessed by stopwatch over a 1-month period. Controls consisted of 92 Dutch Caucasian men. All men with LPE were genotyped for a 5-HTT-promoter polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of 5-HTTLPR polymorphism were compared between patients and controls. Association between LL, SL, and SS genotypes, and the natural logarithm of the IELT in men with LPE was investigated. IELT measured by stopwatch, 5-HTTLPR polymorphism. In men with lifelong PE, the geometric mean, median, and natural mean IELTs were 21, 26, and 32 seconds, respectively. There were no significant differences in the 5-HTT polymorphism alleles and genotypes between 89 Dutch Caucasian men with LPE (S 47%, L 53%/LL 29%, SL 48%, SS 22%) and 92 Dutch Caucasian controls (S 48%, L 52%/LL 29%, SL 45%, SS 26%). In men with lifelong PE there was a statistically significant difference between LL, SL, and SS genotypes in their geometric mean IELT (P IELTs than the SS and SL genotypes. The 5-HTTLPR polymorphism is associated with significant effects on the latency to ejaculate in men with lifelong PE. Men with SS and SL genotypes have 100% and 90% longer ejaculation time, respectively than men with LL genotypes.

  1. A Salmonella typhimurium-translocated Glycerophospholipid:Cholesterol Acyltransferase Promotes Virulence by Binding to the RhoA Protein Switch Regions

    Energy Technology Data Exchange (ETDEWEB)

    LaRock, Doris L.; Brzovic, Peter S.; Levin, Itay; Blanc, Marie-Pierre; Miller, Samuel I.


    Salmonella enterica serovar typhimurium translocates a glycerophospholipid: cholesterol acyltransferase (SseJ) into the host cytosol after its entry into mammalian cells. SseJ is recruited to the cytoplasmic face of the host cell phagosome membrane where it is activated upon binding the small GTPase, RhoA. SseJ is regulated similarly to cognate eukaryotic effectors, as only the GTP-bound form of RhoA family members stimulates enzymatic activity. Using NMR and biochemistry, this work demonstrates that SseJ competes effectively with Rhotekin, ROCK, and PKN1 in binding to a similar RhoA surface. The RhoA surface that binds SseJ includes the regulatory switch regions that control activation of mammalian effectors. These data were used to create RhoA mutants with altered SseJ binding and activation. This structure-function analysis supports a model in which SseJ activation occurs predominantly through binding to residues within switch region II. We further defined the nature of the interaction between SseJ and RhoA by constructing SseJ mutants in the RhoA binding surface. These data indicate that SseJ binding to RhoA is required for recruitment of SseJ to the endosomal network and for full Salmonella virulence for inbred susceptible mice, indicating that regulation of SseJ by small GTPases is an important virulence strategy of this bacterial pathogen. The dependence of a bacterial effector on regulation by a mammalian GTPase defines further how intimately host pathogen interactions have coevolved through similar and divergent evolutionary strategies.

  2. Health Promotion

    DEFF Research Database (Denmark)

    Povlsen, Lene; Borup, I.


    and Adolescent Health Promotion', Salutogenesis - from theory to practice' and Health, Stress and Coping'. More than half of all doctoral theses undertaken at NHV during these years had health promotion as their theme. As a derivative, the Nordic Health Promotion Research Network (NHPRN) was established in 2007......In 1953 when the Nordic School of Public Health was founded, the aim of public health programmes was disease prevention more than health promotion. This was not unusual, since at this time health usually was seen as the opposite of disease and illness. However, with the Ottawa Charter of 1986......, the World Health Organization made a crucial change to view health not as a goal in itself but as the means to a full life. In this way, health promotion became a first priority and fundamental action for the modern society. This insight eventually reached NHV and in 2002 - 50 years after the foundation...

  3. Sensitivity of MLL-rearranged AML cells to all-trans retinoic acid is associated with the level of H3K4me2 in the RARα promoter region

    International Nuclear Information System (INIS)

    Sakamoto, K; Imamura, T; Yano, M; Yoshida, H; Fujiki, A; Hirashima, Y; Hosoi, H


    All-trans retinoic acid (ATRA) is well established as differentiation therapy for acute promyelocytic leukemia (APL) in which the PML–RARα (promyelocytic leukemia-retinoic acid receptor α) fusion protein causes blockade of the retinoic acid (RA) pathway; however, in types of acute myeloid leukemia (AML) other than APL, the mechanism of RA pathway inactivation is not fully understood. This study revealed the potential mechanism of high ATRA sensitivity of mixed-lineage leukemia (MLL)-AF9-positive AML compared with MLL-AF4/5q31-positive AML. Treatment with ATRA induced significant myeloid differentiation accompanied by upregulation of RARα, C/EBPα, C/EBPε and PU.1 in MLL-AF9-positive but not in MLL-AF4/5q31-positive cells. Combining ATRA with cytarabine had a synergistic antileukemic effect in MLL-AF9-positive cells in vitro. The level of dimethyl histone H3 lysine 4 (H3K4me2) in the RARα gene-promoter region, PU.1 upstream regulatory region (URE) and RUNX1+24/+25 intronic enhancer was higher in MLL-AF9-positive cells than in MLL-AF4-positive cells, and inhibiting lysine-specific demethylase 1, which acts as a histone demethylase inhibitor, reactivated ATRA sensitivity in MLL-AF4-positive cells. These findings suggest that the level of H3K4me2 in the RARα gene-promoter region, PU.1 URE and RUNX1 intronic enhancer is determined by the MLL-fusion partner. Our findings provide insight into the mechanisms of ATRA sensitivity in AML and novel treatment strategies for ATRA-resistant AML

  4. Fish but Not Macroinvertebrates Promote Trophic Cascading Effects in High Density Submersed Plant Experimental Lake Food Webs in Two Contrasting Climate Regions

    Directory of Open Access Journals (Sweden)

    Carlos Iglesias


    Full Text Available Predators play a key role in the functioning of shallow lakes. Differences between the response of temperate and subtropical systems to fish predation have been proposed, but experimental evidence is scarce. To elucidate cascading effects produced by predators in contrasting climatic zones, we conducted a mesocosm experiment in three pairs of lakes in Uruguay and Denmark. We used two typical planktivorous-omnivorous fish species (Jenynsia multidentata + Cnesterodon decemmaculatus and Gasterosteus aculeatus + Perca fluviatilis and one littoral omnivorous-predatory macroinvertebrate (Palaemonetes argentinus and Gammarus lacustris, alone and combined, in numbers resembling natural densities. Fish predation on zooplankton increased phytoplankton biomass in both climate zones, whereas the effects of predatory macroinvertebrates on zooplankton and phytoplankton were not significant in either climate zone. Macroinvertebrates (that freely colonized the sampling devices were diminished by fish in both climate areas; however, periphyton biomass did not vary among treatments. Our experiments demonstrated that fish affected the structure of both planktonic and littoral herbivorous communities in both climate regions, with a visible positive cascading effect on phytoplankton biomass, but no effects on periphyton. Altogether, fish impacts appeared to be a strong driver of turbid water conditions in shallow lakes regardless of climatic zone by indirectly contributing to increasing phytoplankton biomass.

  5. Geothermal development promotion survey report. No. 22. Noboribetsu region; 1987-1990 chinetsu kaihatsu sokushin chosa hokokusho. No. 22 Noboribetsu chiiki

    Energy Technology Data Exchange (ETDEWEB)



    The results of surveys conducted in the Noboribetsu region, Hokkaido, in fiscal 1987-1989 are compiled in this report. Conducted in the surveys were a geological/alteration zone survey, geochemical survey, electromagnetic surveillance (simplified magnetotelluric method), electric prospecting (Schlumberger method), electric prospecting (mise-a-la-masse method), heat flow rate survey, structural boring, precision structural boring, environmental exploration well, geothermal water survey, environmental impact survey, and so forth. Conclusions reached on the basis of the survey results are described below. It is supposed that a horizon, positioned in the Osarugawa stratum in the Karls Noboribetsu zone or in a fissure system in the Omagarisawa stratum below the Osarugawa stratum, contains a geothermal reservoir. The hot water at the Noboribetsu hot spring originates in gas or geothermal water separated from the deep-seated geothermal water while that at the Karls hot spring or the like originates in meteoric water built up in higher places. Although an area abundant in geothermal fluids is supposed to exist in the Karls-Noboribetsu zone, yet a section located between the Karls-Noboribetsu zone and the Noboribetsu hot spring area also draws attention as a zone having a potential to store geothermal fluids. (NEDO)

  6. National promotional campaign

    Directory of Open Access Journals (Sweden)

    Pekevski Siniša


    Full Text Available Taking an attention to promotion as operational variable in marketing effort, author focused on so called ways of creating national images. As a case of very interesting activity paper discuss an experience of regional chamber of Croatia with activities in upgrading international recognition of national products as well as country as destination in such context.

  7. Report on fiscal 1995 project to promote an exchange of researchers on environmental problems in the Asia-Pacific region; 1995 nendo itakujigyo (Asia/Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho)

    Energy Technology Data Exchange (ETDEWEB)



    For the purpose of solving environmental problems caused in association with the increasing industrial activities in the Asia-Pacific region, the construction of a research network is being advanced aiming at promoting exchanges with researchers of other countries and activating information exchanges. Investigators were sent overseas to grasp the present situation, and researchers participated in a symposium on the APEC environmental technology cooperation for mutual understanding and personal interchange. In the overseas survey, visits were paid mainly to national research institutes and universities in India and Thailand. Positive approval was obtained on the construction of the ETERNET APR (Environmental Technology Research Network in the Asia-Pacific Region). In the symposium on the APEC environmental technology cooperation held in Nagoya, researchers participated mostly in the second session and made earnest discussions with researchers from other countries. The necessity and importance of the network was emphasized. Countries which participated the symposium have problems common to each, and it was greatly significant to meet together and discuss together. The environmental problem is on a global scale, and it is necessary to make close exchange/interchange of information/opinion on a long term basis and to tackle it in the whole Asia-Pacific region. 3 tabs.

  8. Achieve a Better Understanding of Cloud and Precipitation Processes for the Promotion of Water Security in Arid and Semi-Arid Regions (United States)

    Farrah, S.; Al Yazidi, O.


    has been recently replaced by a new drive to solve the technical obstacles impeding its potential. There is now a real prospect that this science will come of age and play its rightful part in boosting sustainable water supplies for people at risk in arid and semi-arid regions of the world.

  9. Regionalism, Regionalization and Regional Development

    Directory of Open Access Journals (Sweden)

    Liviu C. Andrei


    Full Text Available Sustained development is a concept associating other concepts, in its turn, in the EU practice, e.g. regionalism, regionalizing and afferent policies, here including structural policies. This below text, dedicated to integration concepts, will limit on the other hand to regionalizing, otherwise an aspect typical to Europe and to the EU. On the other hand, two aspects come up to strengthen this field of ideas, i.e. the region (al-regionalism-(regional development triplet has either its own history or precise individual outline of terms.

  10. In vitro binding of Sorghum bicolor transcription factors ABI4 and ABI5 to a conserved region of a GA 2-OXIDASE promoter: possible role of this interaction in the expression of seed dormancy. (United States)

    Cantoro, Renata; Crocco, Carlos Daniel; Benech-Arnold, Roberto Luis; Rodríguez, María Verónica


    The precise adjustment of the timing of dormancy release according to final grain usage is still a challenge for many cereal crops. Grain sorghum [Sorghum bicolor (L.) Moench] shows wide intraspecific variability in dormancy level and susceptibility to pre-harvest sprouting (PHS). Both embryo sensitivity to abscisic acid (ABA) and gibberellin (GA) metabolism play an important role in the expression of dormancy of the developing sorghum grain. In previous works, it was shown that, simultaneously with a greater embryo sensitivity to ABA and higher expression of SbABA-INSENSITIVE 4 (SbABI4) and SbABA-INSENSITIVE 5 (SbABI5), dormant grains accumulate less active GA4 due to a more active GA catabolism. In this work, it is demonstrated that the ABA signalling components SbABI4 and SbABI5 interact in vitro with a fragment of the SbGA 2-OXIDASE 3 (SbGA2ox3) promoter containing an ABA-responsive complex (ABRC). Both transcription factors were able to bind the promoter, although not simultaneously, suggesting that they might compete for the same cis-acting regulatory sequences. A biological role for these interactions in the expression of dormancy of sorghum grains is proposed: either SbABI4 and/or SbABI5 activate transcription of the SbGA2ox3 gene in vivo and promote SbGA2ox3 protein accumulation; this would result in active degradation of GA4, thus preventing germination of dormant grains. A comparative analysis of the 5'-regulatory region of GA2oxs from both monocots and dicots is also presented; conservation of the ABRC in closely related GA2oxs from Brachypodium distachyon and rice suggest that these species might share the same regulatory mechanism as proposed for grain sorghum.

  11. Role of heteroplasmic mutations in the mitochondrial genome and the ID4 gene promoter methylation region in the pathogenesis of chronic aplastic anemia in patients suffering from Kidney yin deficiency. (United States)

    Cui, Xing; Wang, Jing-Yi; Liu, Kui; Cui, Si-Yuan; Zhang, Jie; Luo, Ya-Qin; Wang, Xin


    To analyze changes in gene amplification in the mitochondrial genome and in the ID4 gene promoter methylation region in patients with chronic aplastic anemia (CAA) suffering from Kidney (Shen) yin deficiency or Kidney yang deficiency. Bone marrow and oral epithelium samples were collected from CAA patients with Kidney yin deficiency or Kidney yang deficiency (20 cases). Bone marrow samples were collected from 20 healthy volunteers. The mitochondrial genome was amplified by polymerase chain reaction (PCR), and PCR products were used for sequencing and analysis. Higher mutational rates were observed in the ND1-2, ND4-6, and CYTB genes in CAA patients suffering from Kidney yin deficiency. Moreover, the ID4 gene was unmethylated in bone marrow samples from healthy individuals, but was methylated in some CAA patients suffering from Kidney yin deficiency (positive rate, 60%) and Kidney yang deficiency (positive rate, 55%). These data supported that gene mutations can alter the expression of respiratory chain enzyme complexes in CAA patients, resulting in energy metabolism impairment and promoting the physiological and pathological processes of hematopoietic failure. Functional impairment of the mitochondrial respiration chain induced by gene mutation may be an important reason for hematopoietic failure in patients with CAA. This change is closely related to maternal inheritance and Kidney yin deficiency. Finally, these data supported the assertion that it is easy to treat disease in patients suffering from yang deficiency and difficult to treat disease in patients suffering from yin deficiency.

  12. Report on the project for spread/promotion of technology for the industrial waste optimized treatment in the Asian region (International Symposium `98); Asia chiiki sangyo haikibutsu tekiseika shori gijutsu nado fukyu sokushin jigyo (symposium kaisai) hokokusho

    Energy Technology Data Exchange (ETDEWEB)



    In Japan and Asian countries, the optimized treatment of industrial waste is the problem with the economic growth. Border-crossing movement of the waste for promotion of the renewable use is also a problem. Therefore, the International Symposium `98 on the industrial waste problem in the Asian region was held. China, Thailand, the Philippines and Korea were invited to Japan to give lectures. MITI of Japan reported on the present situation of Japan and the cooperation with Asian countries. The industrial circle reported on efforts for environmental protection measures to be taken, the industrial waste problem at companies which advanced into Asian countries, effects of the Basel Convention on recycling activities, Japan`s role in Asia, etc. In the panel discussion, promotion of cooperation for recycling technology and Japan`s support for formulating strategy on the industrial waste were requested to Japan, and the construction of an Asian area network was proposed. Concerning the cooperative system between governments and private companies, it was concluded that it was necessary to discuss it considering the actual state of each country. Importance of recycle and information exchange was realized again. 10 refs., 15 figs., 27 tabs.

  13. Opioid gene expression changes and post-translational histone modifications at promoter regions in the rat nucleus accumbens after acute and repeated 3,4-methylenedioxy-methamphetamine (MDMA) exposure. (United States)

    Caputi, Francesca Felicia; Palmisano, Martina; Carboni, Lucia; Candeletti, Sanzio; Romualdi, Patrizia


    The recreational drug of abuse 3,4-methylenedioxymethamphetamine (MDMA) has been shown to produce neurotoxic damage and long-lasting changes in several brain areas. In addition to the involvement of serotoninergic and dopaminergic systems, little information exists about the contribution of nociceptin/orphaninFQ (N/OFQ)-NOP and dynorphin (DYN)-KOP systems in neuronal adaptations evoked by MDMA. Here we investigated the behavioral and molecular effects induced by acute (8mg/kg) or repeated (8mg/kg twice daily for seven days) MDMA exposure. MDMA exposure affected body weight gain and induced hyperlocomotion; this latter effect progressively decreased after repeated administration. Gene expression analysis indicated a down-regulation of the N/OFQ system and an up-regulation of the DYN system in the nucleus accumbens (NAc), highlighting an opposite systems regulation in response to MDMA exposure. Since histone modifications have been strongly associated to the addiction-related maladaptive changes, we examined two permissive (acH3K9 and me3H3K4) and two repressive transcription marks (me3H3K27 and me2H3K9) at the pertinent opioid gene promoter regions. Chromatin immunoprecipitation assays revealed that acute MDMA increased me3H3K4 at the pN/OFQ, pDYN and NOP promoters. Following acute and repeated treatment a significant decrease of acH3K9 at the pN/OFQ promoter was observed, which correlated with gene expression results. Acute treatment caused an acH3K9 increase and a me2H3K9 decrease at the pDYN promoter which matched its mRNA up-regulation. Our data indicate that the activation of the DYNergic stress system together with the inactivation of the N/OFQergic anti-stress system contribute to the neuroadaptive actions of MDMA and offer novel epigenetic information associated with MDMA abuse. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Single amino acid changes in the 6K1-CI region can promote the alternative adaptation of Prunus- and Nicotiana-propagated Plum pox virus C isolates to either host. (United States)

    Calvo, María; Malinowski, Tadeusz; García, Juan Antonio


    Plum pox virus (PPV) C is one of the less common PPV strains and specifically infects cherry trees in nature. Making use of two PPV-C isolates that display different pathogenicity features, i.e., SwCMp, which had been adapted to Nicotiana species, and BY101, which had been isolated from cherry rootstock L2 (Prunus lannesiana) and propagated only in cherry species, we have generated two infective full-length cDNA clones in order to determine which viral factors are involved in the adaptation to each host. According to our results, the C-P3(PIPO)/6K1/N-CI (cylindrical inclusion) region contains overlapping but not coincident viral determinants involved in symptoms development, local viral amplification, and systemic movement capacity. Amino acid changes in this region promoting the adaptation to N. benthamiana or P. avium have trade-off effects in the alternative host. In both cases, adaptation can be achieved through single amino acid changes in the NIapro protease recognition motif between 6K1 and CI or in nearby sequences. Thus, we hypothesize that the potyvirus polyprotein processing could depend on specific host factors and the adaptation of PPV-C isolates to particular hosts relies on a fine regulation of the proteolytic cleavage of the 6K1-CI junction.

  15. Establishment of a non-governmental regional approach to La Plata River Basin integrated watershed management promoted throughout three international workshops supported by UN and Japanese agencies, led by ILEC (United States)

    Calcagno, Alberto; Yamashiki, Yosuke; Mugetti, Ana


    The La Plata River Basin is one of the largest international river basins in the world, with an area of about 3 million km2. It spreads across five countries (Argentina, Bolivia, Brazil, Paraguay and Uruguay), and its water resources are essential for their economic development. Together with reservoir development, extensive deforestation, intensive agriculture practices and large urban developments took place in the Paraná, Paraguay and Uruguay basins, affecting environmental conditions and raising important issues concerning water resources use and conservation. Therefore, the need to promote participatory and cooperative efforts among water resources stakeholders, as well as the systematic exchange of information and experiences on common regional problems among organizations and experts from throughout the basin who are devoted to water resources use and management, was reported by researchers and managers gathered at the First and Second International Workshops on Regional Approaches for Reservoir Development and Management in the La Plata River Basin (held in 1991 and 1994). As a concrete response to this need, the efforts of a number of organizations from various countries within the basin, with the support of international and national governmental organizations, resulted in the foundation of La Plata River Basin Environmental Research and Management Network (RIGA) in March 2001. This was within the framework of the Third International Workshop, which was precisely one of the short-term activities included in the RIGA Action Plan. During the preparatory processes for the RIGA Network, the presence of Japanese cooperation supporting the La Plata River Basin Workshops through a non-governmental international organization (ILEC) played an important role in stimulating such an organization-based joint approach in the basin. This outcome, although not originally planned, constituted a welcomed byproduct of its main specific interest in the region, which was the

  16. A Further Analysis of the Relationship between Yellow Ripe-Fruit Color and the Capsanthin-Capsorubin Synthase Gene in Pepper (Capsicum sp.) Indicated a New Mutant Variant in C. annuum and a Tandem Repeat Structure in Promoter Region (United States)

    Gui, Xiao-Ling; Chang, Xiao-Bei; Gong, Zhen-Hui


    Mature pepper (Capsicum sp.) fruits come in a variety of colors, including red, orange, yellow, brown, and white. To better understand the genetic and regulatory relationships between the yellow fruit phenotype and the capsanthin-capsorubin synthase gene (Ccs), we examined 156 Capsicum varieties, most of which were collected from Northwest Chinese landraces. A new ccs variant was identified in the yellow fruit cultivar CK7. Cluster analysis revealed that CK7, which belongs to the C. annuum species, has low genetic similarity to other yellow C. annuum varieties. In the coding sequence of this ccs allele, we detected a premature stop codon derived from a C to G change, as well as a downstream frame-shift caused by a 1-bp nucleotide deletion. In addition, the expression of the gene was detected in mature CK7 fruit. Furthermore, the promoter sequences of Ccs from some pepper varieties were examined, and we detected a 176-bp tandem repeat sequence in the promoter region. In all C. annuum varieties examined in this study, the repeat number was three, compared with four in two C. chinense accessions. The sequence similarity ranged from 84.8% to 97.7% among the four types of repeats, and some putative cis-elements were also found in every repeat. This suggests that the transcriptional regulation of Ccs expression is complex. Based on the analysis of the novel C. annuum mutation reported here, along with the studies of three mutation types in yellow C. annuum and C. chinense accessions, we suggest that the mechanism leading to the production of yellow color fruit may be not as complex as that leading to orange fruit production. PMID:23637942

  17. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Starska, Katarzyna, E-mail: [I Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Kopcinskiego 22, 90-153 Łódź (Poland); Krześlak, Anna; Forma, Ewa [Department of Cytobiochemistry, University of Łódź, Pomorska 142/143, 90-236 Łódź (Poland); Olszewski, Jurek [II Department of Otolaryngology and Laryngological Oncology, Medical University of Łódź, Żeromskiego 113, 90-549 Łódź (Poland); Morawiec-Sztandera, Alina [Department of Head and Neck Surgery, Medical University of Łódź, Paderewskiego 4, 93-509 Łódź (Poland); Aleksandrowicz, Paweł [Department of Otolaryngology and Laryngological Oncology, Medical University of Lublin, Jaczewskiego 8, 20-954 Lublin (Poland); Lewy-Trenda, Iwona [Department of Pathology, Medical University of Łódź, Pomorska 251, 92-213 Łódź (Poland); and others


    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels.

  18. The − 5 A/G single-nucleotide polymorphism in the core promoter region of MT2A and its effect on allele-specific gene expression and Cd, Zn and Cu levels in laryngeal cancer

    International Nuclear Information System (INIS)

    Starska, Katarzyna; Krześlak, Anna; Forma, Ewa; Olszewski, Jurek; Morawiec-Sztandera, Alina; Aleksandrowicz, Paweł; Lewy-Trenda, Iwona


    Metallothioneins (MTs) are low molecular weight, cysteine-rich heavy metal-binding proteins which participate in the mechanisms of Zn homeostasis, and protect against toxic metals. MTs contain metal-thiolate cluster groups and suppress metal toxicity by binding to them. The aim of this study was to determine the − 5 A/G (rs28366003) single-nucleotide polymorphism (SNP) in the core promoter region of the MT2A gene and to investigate its effect on allele-specific gene expression and Cd, Zn and Cu content in squamous cell laryngeal cancer (SCC) and non-cancerous laryngeal mucosa (NCM) as a control. The MT2A promoter region − 5 A/G SNP was determined by restriction fragment length polymorphism using 323 SCC and 116 NCM. MT2A gene analysis was performed by quantitative real-time PCR. The frequency of A allele carriage was 94.2% and 91.8% in SCC and NCM, respectively, while G allele carriage was detected in 5.8% and 8.2% of SCC and NCM samples, respectively. As a result, a significant association was identified between the − 5 A/G SNP in the MT2A gene with mRNA expression in both groups. Metal levels were analyzed by flame atomic absorption spectrometry. The significant differences were identified between A/A and both the A/G and G/G genotypes, with regard to the concentration of the contaminating metal. The Spearman rank correlation results showed that the MT2A expression and Cd, Zn, Cu levels were negatively correlated. Results obtained in this study suggest that − 5 A/G SNP in MT2A gene may have an effect on allele-specific gene expression and accumulation of metal levels in laryngeal cancer. - Highlights: • MT2A gene expression and metal content in laryngeal cancer tissues • Association between SNP (rs28366003) and expression of MT2A • Significant associations between the SNP and Cd, Zn and Cu levels • Negative correlation between MT2A gene expression and Cd, Zn and Cu levels

  19. Health promotion. (United States)

    Miyake, S; Lucas-Miyake, M


    This article will describe a marketing model for the development of a role for occupational therapy in the industrial market. Health promotion activities are used as a means to diversify existing revenue bases by establishing new referral sources in industry. The technique of need satisfaction -selling or marketing one's services to a customer based on needs expressed by the customer - is reviewed, and implementation of this approach is described from two settings, one in psychiatry and the other in rehabilitation.

  20. A new variation in the promoter region, the -604 C>T, and the Leu72Met polymorphism of the ghrelin gene are associated with protection to insulin resistance. (United States)

    Zavarella, S; Petrone, A; Zampetti, S; Gueorguiev, M; Spoletini, M; Mein, C A; Leto, G; Korbonits, M; Buzzetti, R


    Previous studies suggested that polymorphisms in the coding region of the preproghrelin were involved in the etiology of obesity and might modulate glucose-induced insulin secretion. We evaluated the association of a new variation, -604C>T, in the promoter region of the ghrelin gene, of Leu72Met (247C>A) and of Gln90Leu (265A>T), all haplotype-tagging single nucleotide polymorphisms (SNPs), with measures of insulin sensitivity in 1420 adult individuals. The three SNPs were genotyped using ABI PRISM 7900 HT Sequence Detection System. We used multiple linear regression analysis for quantitative traits and THESIAS software for haplotype analysis. We observed a protective effect exerted by Met72 variant of Leu72Met SNP on insulin resistance parameters; a significant decreasing trend from Leu/Leu to Leu/Met and to Met/Met homozygous subjects in triglycerides, fasting insulin levels and HOMA-IR index (P=0.02, 0.01 and 0.003, respectively), and, consistently, an increase in ghrelin levels (P=0.003) was found. A significant decrease from CC to TC and to TT genotypes in insulin levels and HOMA-IR index was also detected (P=0.00l for both), but only in subjects homozygous for Leu72, where the protective effect of Met72 was not present. The haplotype analysis results supported the data obtained by the evaluation of each single SNP, showing the highest value of insulin levels and HOMA-IR index in the -604(c)247(c) haplotype intermediate value in -604(T)247(C) and lowest value in -604(C)247(A). Our observations suggest a protective role of the Met72 variant and of -604 T allele in modulating insulin resistance. These SNPs or an unknown functional variant in linkage disequilibrium could increase ghrelin levels and probably insulin sensitivity.

  1. Decreased expression of lysyl hydroxylase 2 (LH2) in skin fibroblasts from three Ehlers-Danlos patients does not result from mutations in either the coding or proximal promoter region of the LH2 gene. (United States)

    Walker, L C; Teebi, A S; Marini, J C; De Paepe, A; Malfait, F; Atsawasuwan, P; Yamauchi, M; Yeowell, H N


    The Ehlers-Danlos syndromes (EDS) are a heterogeneous group of inherited connective tissue disorders characterized by tissue fragility, hyperelasticity of the skin and joint hypermobility. This phenotype, accompanied by kyphoscoliosis and/or ocular fragility, is present in patients with the autosomal recessive type VI form of EDS. These patients have significantly decreased levels of lysyl hydroxylase (LH) activity, due to mutations in the LH1 gene. LH hydroxylates specific lysine residues in the collagen molecule that are precursors for the formation of cross-links which provide collagen with its tensile strength. No disorder has been directly linked to decreased expression of LH2 and LH3, two other isoforms of LH. This study describes 3 patients with mixed phenotypes of EDS, who have significantly decreased mRNAs for LH2, but normal levels of LH1 and LH3 mRNAs, in their skin fibroblasts. In contrast to the effect of LH1 deficiency in EDS VI patients, the decreased expression of LH2 does not affect LH activity, bifunctional collagen cross-links (measured after reduction as dihydroxylysinonorleucine (DHLNL) and hydroxylysinonorleucine (HLNL)), or helical lysine hydroxylation in these cell lines. Sequence analysis of full length LH2 cDNAs and 1kb of the promoter region of LH2 does not show mutations that could explain the decreased expression of LH2. These results suggest that the deficiency of LH2 in these fibroblasts may be caused by changes in other factors required for the expression of LH2.

  2. Correlations of CTLA-4 exon-1 49 A/G and promoter region 318C/T polymorphisms with the therapeutic efficacy of 131 I radionuclide in graves' disease in Chinese Han population. (United States)

    Han, Xin-Rui; Wen, Xin; Wang, Shan; Fan, Shao-Hua; Zhuang, Juan; Wang, Yong-Jian; Zhang, Zi-Feng; Li, Meng-Qiu; Hu, Bin; Shan, Qun; Sun, Chun-Hui; Bao, Ya-Xing; Wu, Dong-Mei; Lu, Jun; Zheng, Yuan-Lin


    Graves' disease is an autoimmune process in which the thyroid gland is triggered by autoantibodies, resulting in hyperthyroidism. The purpose of the present study is to elucidate whether exon-1 49 A/G and promoter region 318C/T polymorphisms in the CTLA-4 gene. This study consisted of 653 eligible patients with Graves' disease. After receiving 131I radionuclide therapy, these patients were classified into the remission and non-remission groups. A logistic regression-based model was used to analyze independent factors affecting the patient response to 131I radionuclide therapy. The results showed that CTLA-4 49 A/G was closely related to the efficacy of 131 I treatment for Graves' disease (AG + GG vs. AA: OR = 6.543, 95%CI = 2.611 ∼ 16.40, P Graves' disease. Logistic regression analysis indicated that thyroid weight (OR = 0.963, 95%CI = 0.944 ∼ 0.982, P Graves' disease. These data indicated that CTLA-4 exon-1 49 A/G polymorphism may be associated with patient response to radionuclide 131 I therapy in Graves' disease. © 2017 Wiley Periodicals, Inc.

  3. [Effect of transcription activity regulated by VNTR-ZNF and -14C/T variants in the promoter region of ATP-binding cassette transporter 1 in HepG2 cells]. (United States)

    Gao, Shenxia; Zhao, Lili; Zhang, Ying; Mao, Yongmin


    To explore the effect of VNTR-ZNF and -14C/T variants of the promoter region of the ABCA1 gene on the transcription activity of genes in vitro. The recombinants were constructed by ligating DNA fragment containing VNTR-ZNF ACCCC inserted/deleted allele with or without -14C/T substitution fragments with a PGL2-basic vector containing luciferase reporter gene. The recombinants were then transfected into HepG2 cells using the cationic lipid method. After 48 h, transfected cells were collected and used to detect the luciferase activity. Luciferase activity of PGL2-ZNF-ACCCCDel was greater than that of PGL2-ZNF-ACCCCIns. Luciferase activity of PGL2-ZNFDel-14C was greater than that of PGL2-ZNFDel-14T, PGL2-ZNFIns-14C, PGL2-ZNFIns-14T. Compared with the insertion type, the ACCCC-deleted type of VNTR-ZNF can significantly enhance the transcription activity of ABCA1. And co-transfection of -14 C allele can further enhance this activity.

  4. Promoting industrialisation

    International Nuclear Information System (INIS)

    Hayfield, F.


    When the first nuclear power programme is decided upon, automatically the country has to initiate in parallel a programme to modify or add to its current industrial structure and resources. The extent of this new industrialisation depends upon many factors which both, the Government and the Industries have to consider. The Government has a vital role which includes the setting up of the background against which the industrial promotion should take place and in many cases may have also to play an active role all along this programme. Equally, the existing industries have an important role so as to achieve the most efficient participation in the nuclear programme. Invariably the industrial promotional programme will incur a certain degree of transfer of technology, the extent depending on the policies adopted. For this technology transfer to take place efficiently, both the donor and the receiver have to recognise each other's legitimate ambitions and fears. The transfer of technology is a process having a high human content and both donor and receiver have to take this into account. This can be further complicated when there is a difference in culture between them. Technology transfer is carried out within a contractual and organisational framework which will identify the donor (licensor) and the receiver (licensee). This framework may take various forms from a simple cooperative agreement, through a joint-venture organisation right to a standard contract between two separate entities. Each arrangement has its advantages and drawbacks and requires investment of different degrees. One of the keys to a successful industrial promotion is having it carried out in a timely fashion which will be parallel with the nuclear power programme. Experience in some countries has shown the problems when the industrialisation is out of phase with the programme whilst in other cases this industrialisation was at a level and scale unjustified. (author)

  5. Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia. (United States)

    Khan, Anis; Al Balwi, Mohammed A; Tanaka, Yasuhito; Hajeer, Ali; Sanai, Faisal M; Al Abdulkarim, Ibrahim; Al Ayyar, Latifah; Badri, Motasim; Saudi, Dib; Tamimi, Waleed; Mizokami, Masashi; Al Knawy, Bandar


    In this study, a cohort of 182 patients [55 hepatocellular carcinoma (HCC) and 127 non-HCC] infected with hepatitis B virus (HBV) in Saudi Arabia was investigated to study the relationship between sequence variation in the enhancer II (EnhII), basal core promoter (BCP) and precore regions of HBV genotype D (HBV/D) and the risk of HCC. HBV genotypes were determined by sequencing analysis and/or enzyme-linked immunosorbent assay. Variations in the EnhII, BCP and precore regions were compared between 107 non-HCC and 45 HCC patients infected with HBV/D, followed by age-matched analysis of 40 cases versus equal number of controls. Age and male gender were significantly associated with HCC (p = 0.0001 and p = 0.03, respectively). Serological markers such as aspartate aminotransferase, albumin and anti-HBe were significantly associated with HCC (p = 0.0001 for all), whereas HBeAg positivity was associated with non-HCC (p = 0.0001). The most prevalent HBV genotype was HBV/D (94%), followed by HBV/E (4%), HBV/A (1.6%) and HBV/C (0.5%). For HBV/D1, genomic mutations associated with HCC were T1673/G1679, G1727, C1741, C1761, A1757/T1764/G1766, T1773, T1773/G1775 and C1909. Age- and gender-adjusted stepwise logistic regression analysis indicated that mutations G1727 [odds ratio (OR) = 18.3; 95% confidence interval (CI) = 2.8-118.4; p = 0.002], A1757/T1764/G1766 (OR = 4.7; 95% CI = 1.3-17.2; p = 0.01) and T1773 (OR = 14.06; 95% CI = 2.3-84.8; p = 0.004) are independent predictors of HCC development. These results implicate novel individual and combination patterns of mutations in the X/precore region of HBV/D1 as predictors of HCC. Risk stratification based on these mutation complexes would be useful in determining high-risk patients and improving diagnostic and treatment strategies for HBV/D1. Copyright © 2013 UICC.

  6. Polymorphism rs189037C > T in the promoter region of the ATM gene may associate with reduced risk of T2DM in older adults in China: a case control study. (United States)

    Ding, Xiang; Hao, Qiukui; Yang, Ming; Chen, Tie; Chen, Shanping; Yue, Jirong; Leng, Sean X; Dong, Birong


    Recent evidence indicates that ataxia telangiectasia mutated (ATM) is a cytoplasmic protein that involves in insulin signaling pathways. When ATM gene is mutated, this event appears to contribute to the development of insulin resistance and type 2 diabetes mellitus (T2DM). Up to date, little information about the relationship between ATM gene polymorphism and T2DM is available. This study aimed to explore potential association between a genetic variant [single nucleotide polymorphism (SNP), i.e. rs189037C > T] in the ATM promoter region and T2DM in older adults in China. We conducted a 1:1 age- and sex-matched case-control study. It enrolled 160 patients including 80 type 2 diabetic and 80 nondiabetic patients who were aged 60 years and above. Genotyping of the polymorphism rs189037 in the promoter of the ATM gene was performed using polymerase chain reaction-restriction fragment length polymorphism. Chi-square test or Fisher's exact test (when an expected cell count was ATM rs189037 polymorphism and T2DM (P = 0.037). The frequency of CT genotype is much higher in patients without T2DM than in diabetics (60.0% versus 40.0%, P = 0.012). After adjustment of the major confounding factors, such difference remained significant (OR for non-T2DM is 2.62, 95%CI = 1.05-6.53, P = 0.038). Similar effect of CT genotype on T2DM was observed in male population (adjusted: OR = 0.27, 95%CI = 0.09-0.84, P = 0.024). In addition, the percentage of TT genotype in diabetics with coronary artery disease (CAD) was considerably lower than in those without CAD (17.9% versus 61.5%, P = 0.004). Our study suggests that the ATM rs189037 polymorphism is associated with reduced risk of T2DM in older adult population in China. Specifically, CT heterozygote seems to be associated with a lower risk of T2DM than CC or TT genotype, especially in male older adults. Moreover, TT genotype may reduce the risk of CAD in diabetic patients.

  7. AGRIEMAS project. Pilot project for promotion of environmental management system in the small and medium industries alimentary of region Abruzzo (Italy); Il progetto AGRIEMAS: un progetto pilota per la promozione di un sistema comunitario di ecogestione e audit nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo

    Energy Technology Data Exchange (ETDEWEB)

    Luciani, R.; Andriola, L.; Brunetti, N. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Ambiente; Vignati, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Energia; Paci, S. [ENEA Centro Ricerche Casaccia, S. Maria di Galeria, RM (Italy). Dipt. Innovazione; Iacoboni, S.; Bonfitto, E. [ARSAA - Agenzia Regionale per i Servizi di Sviluppo Agricolo (Italy)


    The topic discussed in this report can be inserted within the context of case studies carried out by ENEA (National Agency for New Technology, Energy and the Environment) in the promotion of environmental management systems (EMAS - ISO14000). EMAS has a voluntary character; it intends to replace conflicting relations between control authority and firm with relations centred on a dialogue and action agreed upon by the parties, on the basis of impartial and reliable information. The report about AGRIEMAS pilot project illustrates the procedure for applying this regulation to the small and medium food industries of Region Abruzzo. [Italian] L'argomento del rappprto si inserisce nel contesto degli studi effettuati dall'ENEA nell'ambito della promozione dei sistemi di gestione ambientale (EMAS-ISO14000). Lo strumento EMAS, che ha carattere di volontarieta', intende sostituire un rapporto di tipo conflittuale fra autorita' di controllo e impresa con un rapporto centrato su un dialogo ed un'azione concertata tra le parti, sulle basi di un'informativa obiettiva ed affidabile. Il rapporto sul progetto pilota AGRIEMAS illustra il percorso per l'applicazione del regolamento EMAS nelle piccole e medie imprese del settore agroindustriale della regione Abruzzo.

  8. Single nucleotide polymorphisms (SNPs at CDH1 promoter region in familial gastric cancer Polimorfismos de nucleótido único (SNPs en la región promotora CDH1 en cáncer gástrico familiar

    Directory of Open Access Journals (Sweden)

    A. Ramos-de la Medina


    Full Text Available Introduction: gastric cancer is the most frequent gastrointestinal malignancy in Mexico and the proportion of patients younger than 40 years is one of the highest reported in the world literature. Recently several families with familial diffuse gastric cancer have been identified at the National Institute of Medical Sciences and Nutrition. Germline mutations in the E-cadherin gene (CHD1 have been described that result in the development of diffuse hereditary gastric cancer in young patients. Methods: the complete coding sequence at exons 1 to 16 and the promoter region of CDH1 was amplified by polymerase chain reaction in peripheral blood samples of two patients with early onset familial diffuse gastric cancer. Results: no germline inactivating mutations of CHD1 were found on either patient. Single nucleotide polymorphisms -160 C→A were detected in the promoter region of CDH1 in both patients. Conclusions: the polymorphism -160 C→A theoretically confers an increased risk of developing diffuse gastric cancer. The relatives of these patients may an increased risk of gastric cancer among other tumors. There is presently not enough evidence to consider the -160 C→A polymorphism an etiologic factor of diffuse gastric cancer in these patients since the frequency and type of genetic alterations of CDH1 are largely unknown in the Mexican population. It will be necessary to conduct epidemiologic studies in the Mexican population to determine the influence that genetic alterations have on the genesis of diffuse gastric carcinoma.Introducción: el cáncer gástrico es la neoplasia más frecuente del tracto gastrointestinal en México y la proporción de pacientes menores de 40 años es una de las más altas reportadas en la literatura mundial. Recientemente se han identificado en el Instituto Nacional de Ciencias Médicas y Nutrición varias familias con cáncer gástrico difuso familiar. Múltiples mutaciones germinales del gene de E-cadherina (CHD1

  9. Long-term exposure to PM2.5 lowers influenza virus resistance via down-regulating pulmonary macrophage Kdm6a and mediates histones modification in IL-6 and IFN-β promoter regions. (United States)

    Ma, Jing-Hui; Song, Shao-Hua; Guo, Meng; Zhou, Ji; Liu, Fang; Peng, Li; Fu, Zhi-Ren


    Atmospheric particulates, especially PM2.5, not only damage the respiratory system, but also play important roles in pulmonary immunity. China is influenced by atmospheric diffusion conditions, industrial manufacturers, and heating and discharging. PM2.5 levels in the air rise substantially in the winter, which is also a period of flu high-incidence. Although an epidemiological link exists between PM2.5 and flu, we do not understand how long-term PM2.5 inhalation affects pulmonary immunity and the influenza virus response. Our study has prepared an in vivo PM2.5 mouse pharyngeal wall drop-in model and has found that PM2.5 exposure leads to mouse inflammatory injuries and furthers influenza A infection. Our results suggest that short-term exposure to PM2.5 significantly enhances the survival rate of influenza A-contaminated mice, while long-term PM2.5 inhalation lowers the capacity of pulmonary macrophages to secrete IL-6 and IFN-β. A disorder in the pulmonary innate defense system results in increased death rates following influenza infection. On a macromolecular level, this mechamism involves Kdm6a down-regulation after long-term exposure to PM 2.5 and a resultant increase in H3K4 and H3K9 methylation in IL-6 and IFN-β promoter regions. In summary, PM2.5 causes injuries of lung tissue cells and downregulates immune defense mechanisms in the lung. Copyright © 2017. Published by Elsevier Inc.

  10. Twitter as a Potential Disaster Risk Reduction Tool. Part III: Evaluating Variables that Promoted Regional Twitter Use for At-risk Populations During the 2013 Hattiesburg F4 Tornado. (United States)

    Cooper, Guy Paul; Yeager, Violet; Burkle, Frederick M; Subbarao, Italo


    Study goals attempt to identify the variables most commonly associated with successful tweeted messages and determine which variables have the most influence in promoting exponential dissemination of information (viral spreading of the message) and trending (becoming popular) in the given disaster affected region. Part II describes the detailed extraction and triangulation filtration methodological approach to acquiring twitter data for the 2013 Hattiesburg Tornado. The data was then divided into two 48 hour windows before and after the tornado impact with a 2 hour pre-tornado buffer to capture tweets just prior to impact. Criteria-based analysis was completed for Tweets and users. The top 100 pre-Tornado and post-Tornado retweeted users were compared to establish the variability among the top retweeted users during the 4 day span.  Pre-Tornado variables that were correlated to higher retweeted rates include total user tweets (0.324), and total times message retweeted (0.530).  Post-Tornado variables that were correlated to higher retweeted rates include total hashtags in a retweet (0.538) and hashtags #Tornado (0.378) and #Hattiesburg (0.254). Overall hashtags usage significantly increased during the storm. Pre-storm there were 5,763 tweets with a hashtag and post-storm there was 13,598 using hashtags. Twitter's unique features allow it to be considered a unique social media tool applicable for emergency managers and public health officials for rapid and accurate two way communication.  Additionally, understanding how variables can be properly manipulated plays a key role in understanding how to use this social media platform for effective, accurate, and rapid mass information communication.

  11. Mycobacterium leprae specific genomic target in the promoter region of probable 4-alpha-glucanotransferase (ML1545) gene with potential sensitivity for polymerase chain reaction based diagnosis of leprosy. (United States)

    Sundeep Chaitanya, V; Das, Madhusmita; Eisenbach, Tiffany L; Amoako, Angela; Rajan, Lakshmi; Horo, Ilse; Ebenezer, Mannam


    With the absence of an effective diagnostic tool for leprosy, cases with negative bacteriological index and limited clinical manifestations often pose diagnostic challenges. In this study, we investigated the utility of a novel Mycobacterium leprae specific 112-bp DNA sequence in the promoter region of probable 4-alpha-glucanotransferase (pseudogene, ML1545) for polymerase chain reaction (PCR) based diagnosis of leprosy in comparison to that of the RLEP gene. DNA was extracted from slit skin scrapings of 180 newly diagnosed untreated leprosy cases that were classified as per Ridley Jopling classifications and bacteriological index (BI). Primers were designed using Primer Blast 3.0 and PCR was performed with annealing temperatures of 61°C for ML1545 and 58°C for the RLEP gene using conventional gradient PCR. The results indicated a significant increase in PCR positivity of ML1545 when compared to RLEP across the study groups (164/180 [91.11%] were positive for ML1545 whereas 114/180 (63.33%) were positive for RLEP [pleprosy cases with negative BI, 28 (48.28%) were positive for RLEP and 48 (82.76%) were positive for ML1545 (p=.0001, z=3.8). Of the 42 borderline tuberculoid leprosy cases, 23 (54.76%) were positive for RLEP whereas 37 (88.09%) were positive for ML1545 (pleprosy and BI-positive groups. ML1545 can be a potential gene target for PCR-based diagnosis of leprosy especially in cases where clinical manifestations were minimal. Copyright © 2016 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  12. Comprehensive analysis of the MLH1 promoter region in 480 patients with colorectal cancer and 1150 controls reveals new variants including one with a heritable constitutional MLH1 epimutation. (United States)

    Morak, Monika; Ibisler, Ayseguel; Keller, Gisela; Jessen, Ellen; Laner, Andreas; Gonzales-Fassrainer, Daniela; Locher, Melanie; Massdorf, Trisari; Nissen, Anke M; Benet-Pagès, Anna; Holinski-Feder, Elke


    Germline defects in MLH1 , MSH2 , MSH6 and PMS2 predisposing for Lynch syndrome (LS) are mainly based on sequence changes, whereas a constitutional epimutation of MLH1 (CEM) is exceptionally rare. This abnormal MLH1 promoter methylation is not hereditary when arising de novo, whereas a stably heritable and variant-induced CEM was described for one single allele. We searched for MLH1 promoter variants causing a germline or somatic methylation induction or transcriptional repression. We analysed the MLH1 promoter sequence in five different patient groups with colorectal cancer (CRC) (n=480) composed of patients with i) CEM (n=16), ii) unsolved loss of MLH1 expression in CRC (n=37), iii) CpG-island methylator-phenotype CRC (n=102), iv) patients with LS (n=83) and v) MLH1-proficient CRC (n=242) as controls. 1150 patients with non-LS tumours also served as controls to correctly judge the results. We detected 10 rare MLH1 promoter variants. One novel, complex MLH1 variant c.-63_-58delins18 is present in a patient with CRC with CEM and his sister, both showing a complete allele-specific promoter methylation and transcriptional silencing. The other nine promoter variants detected in 17 individuals were not associated with methylation. For four of these, a normal, biallelic MLH1 expression was found in the patients' cDNA. We report the second promoter variant stably inducing a hereditary CEM. Concerning the classification of promoter variants, we discuss contradictory results from the literature for two variants, describe classification discrepancies between existing rules for five variants, suggest the (re-)classification of five promoter variants to (likely) benign and regard four variants as functionally unclear. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  13. Compilation and analysis of Escherichia coli promoter DNA sequences.


    Hawley, D K; McClure, W R


    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  14. Engineered Promoters for Potent Transient Overexpression.

    Directory of Open Access Journals (Sweden)

    Dan Y Even

    Full Text Available The core promoter, which is generally defined as the region to which RNA Polymerase II is recruited to initiate transcription, plays a pivotal role in the regulation of gene expression. The core promoter consists of different combinations of several short DNA sequences, termed core promoter elements or motifs, which confer specific functional properties to each promoter. Earlier studies that examined the ability to modulate gene expression levels via the core promoter, led to the design of strong synthetic core promoters, which combine different core elements into a single core promoter. Here, we designed a new core promoter, termed super core promoter 3 (SCP3, which combines four core promoter elements (the TATA box, Inr, MTE and DPE into a single promoter that drives prolonged and potent gene expression. We analyzed the effect of core promoter architecture on the temporal dynamics of reporter gene expression by engineering EGFP expression vectors that are driven by distinct core promoters. We used live cell imaging and flow cytometric analyses in different human cell lines to demonstrate that SCPs, particularly the novel SCP3, drive unusually strong long-term EGFP expression. Importantly, this is the first demonstration of long-term expression in transiently transfected mammalian cells, indicating that engineered core promoters can provide a novel non-viral strategy for biotechnological as well as gene-therapy-related applications that require potent expression for extended time periods.

  15. Fiscal 2000 survey report on Asia/Pacific Regional Environment Problems Researcher Exchange Promotion Projects. Construction of Environmental Technology Research Network in the Asia/Pacific Region; 2000 nendo Asia Taiheiyo chiiki kankyo mondai kenkyusha koryu sokushin jigyo hokokusho. Asia/Taiheiyo chiiki kankyo gijutsu kenkyu kaihatsu network kochiku chosa

    Energy Technology Data Exchange (ETDEWEB)



    For the purpose of developing and popularizing environment conservation technologies in the Asia/Pacific region, activities were conducted for Environmental Technology Research Network in the Asia/Pacific Area (ETERNET-APR). In this fiscal year, under the motto of Expansion of International Collaborative Researches on Environmental Technology, a 7th international workshop was held in Yokkaichi City, Mie Prefecture, with the attendance of approximately 60 people in Japan and from abroad. Researchers from overseas, in addition, attended a 10-day training program at the National Institute for Resources and Development and others in preparation for the embodiment of international collaborative research. A survey was conducted overseas for the promotion of database utilization and registration and for grasping the problems intrinsic to the respective research institutes and problems to occur at every stage of development. People's Republic of China was visited, where a miniscale workshop was held, study tours were made, and opinions were exchanged. It was actually felt, at the places that were visited, that ETERNET-APR was certainly in function in various fields. (NEDO)

  16. Regional Innovation Policies in MERCOSUR : Obstacles and ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... review existing regional cooperation initiatives, identify sectors with strong potential for regional cooperation, review other experiences in regional cooperation for innovation (European Union - EU, North American Free Trade Agreement - NAFTA), and propose institutional arrangements for promoting innovation among ...

  17. Rs4705342 polymorphism is involved in the tumorigenesis of HBV positive HCC by altering the binding affinity of HBV induced NF-kB with the promoter region of microRNA-143. (United States)

    Yin, Xiuli; Sun, Shiying; Zhao, Junyan; Yang, Jing; Lei, Xiaofei; Xu, Changqing; Li, Kun


    The objective of this study was to explore the role of rs4705342 located in the miR-143 promoter in relation to the control of HBV positive HCC and the underlying molecular mechanism. A luciferase assay was performed to explore the factors which influenced miR-143 transcription activity and the target gene of miR-143. This would further be confirmed by ChIP assay. Western blot and real-time PCR were performed to identify the relationship between miR-143 and ORP8. Luciferase activity of miR-143 SNP was increased with the presence of C allele. The presence of T allele partially restored the transcription ability. NF-κB displayed a much higher degree of luciferase activity in relation to the cells transfected with vectors containing either T or C allele rather than control cells with a greater extent in C allele group than T allele group. At the same time, ChIP assay indicated that the affinity of NF-ΚB in the miR-143 promoter was higher in C/C cells. The over-expression of HBX promotes NF-kB expression thus increasing the extent of binding of NF-kB on the CC allele of the miR-143 promoter. The binding is also abolished by NF-kB siRNA. ORP8 was proven to be a target gene of miR-143 using bioinformatics algorithm analysis. It was further confirmed by the luciferase assay that miR-143 substantially inhibited luciferase activities of wild-type ORP8. However, it did not affect the mutant ORP8. HBx induced by HBV infection up-regulated miR-143 expression. NF- kB can partially abolish the promotion effect of HBx on the miR-143 level in cells genotyped as CC but not in cells genotyped as TT. Tissues derived from participants genotyped as CC exhibited a higher level of miR-143, but a lower level of ORP8. The presence of the minor allele of rs4705342 in the promoter of miR-143 attenuated the transcription ability. This promoted ORP8 expression and could be a factor contributing to the oncogenesis in HBV positive HCC. © 2017 Wiley Periodicals, Inc.

  18. South Asia's health promotion kaleidoscope. (United States)

    Mukhopadhyay, Alok


    South Asia has 22 percent of the world's population but only 1.3 percent of the global income. Consequently 40 percent of the population is living in absolute poverty. However the health transition in some of its countries including India and Sri Lanka is a testimony to the fact that there are proven solutions to the problems of health and development within the region. The countries of the region have much in common, including a democratic political system, four major religions, a vibrant and living tradition of voluntarism and an extensive health infrastructure which is operating well below par. Despite the underlying unity, South Asia enjoys enormous cultural, linguistic and ethnic diversity. In this large, complex and vibrant region, health promotion is a challenging task, but it also holds the key to a dramatic change in the global health situation. Many of these solutions lie in wider areas of socio-political action. There are much needed shifts in the health promotion and development efforts, particularly in the area of poverty and social justice; gender inequity; population stabilisation; health and environment; control of communicable and non-communicable diseases; and urban health strategies. The principle of cooperation, partnership and intersectoral collaboration for health will be explored. Developing an appropriate, sustainable and people centred health and development strategy in the coming decades is an enormous challenge. There has been an attempt to focus on the emerging needs of the region, which call for health promotion, and involvement of civil society, private sector and the governments bestowed with the increased responsibility of ensuring health security for people. Strengthening the existing health systems, allocating adequate resources for health development and ensuring community participation are all prerequisites to the success of health promotion in the region.

  19. What Is a Promotion? (United States)

    Pergamit, Michael R.; Veum, Jonathan R.


    For a sample of young workers, "promotion" involved no change in position or duties; promotion was more likely for males than females and Whites than Blacks or Hispanics. Company training and prior promotions were important predictors. Promotion did not appear to have a direct impact on job satisfaction. (SK)

  20. 3. Promotion of environment protection of sea and near-sea region. Swinoujscie 12-14 October 1994; 3. Promocja nauki i techniki ochrony srodowiska morza i przymorza. Swinoujscie 12-14 pazdziernik 1994

    Energy Technology Data Exchange (ETDEWEB)



    The great number of problems connected with environment protection near shore marine zone, beach protection, effluent transport in ground and surface waters in region of North Port of Poland as well as technical solutions of water purification and legal problems have been discussed during the conference. All observations and experimental works have been carried out in that region. Among reported works two of them have been devoted to application of nuclear methods in interesting merit.

  1. Perceptions of health promoters about health promotion ...

    African Journals Online (AJOL)


    Feb 11, 2013 ... regarding a health promotion programme for families with ... to contribute to high rates of not going to school (ibid. ... sector in order, amongst other objectives, to prevent health ... exercise and mental health promotion must be incorporated ..... (2009:141) identified ignorance and misconception about the.

  2. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.


    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  3. Health Promotion Education

    DEFF Research Database (Denmark)

    Lehn-Christiansen, Sine

    The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills are concei......The paper discusses the implications of health promotion in education. The paper is based on my PhD project entitled “Health promotion education seen through a power/knowledge and subjectification perspective” (in prep). The PhD project explores how professional health promotion skills...

  4. Fiscal 1999 geothermal development promotion survey report. Data processing (No. B-5 - Musadake region - Phase 3); 1999 nendo chinetsu kaihatsu sokushin chosa data shori hokokusho. No. B-5 Musadake chiiki (Dai 3 ji)

    Energy Technology Data Exchange (ETDEWEB)



    A comprehensive analysis was conducted into the results of a survey on the state of existence of geothermal energy resources in the Musadake region, Shibetsu-gun, Hokkaido. The region was volcanically active in the period from the Neogene period into the quaternary, with some volcanos still active even today. The geological structure on the whole is characterized by the Musadake/Mt. Shitabanupuri fault which is the major structure running NNE-SSW and having a folding structure. It is inferred that Musadake is the heat source responsible for the underground temperature distribution in this region. The maximum temperature of 274 degrees C is recorded at borehole N11-MD-3 in the northeastern part of Musadake, and the temperature falls rapidly as the distance from the borehole increases. Ejection of geothermal fluids is observed at boreholes N11-MD-3 and N11-MD-4. It is inferred that the deep-seated geothermal water is of the neutral Cl type with Cl concentration estimated at approximately 12,000 mg/liter. Steam composition is characterized by a gas concentration level that is as high as 3-4 vol.%. The gas is composedly mainly of CO2 and contains some hydrocarbons. Fluids in this region are classified into water mixing into deep-seated geothermal water and groundwater originating in meteoric water. (NEDO)

  5. Social defeat promotes a reactive endothelium in a brain region-dependent manner with increased expression of key adhesion molecules, selectins and chemokines associated with the recruitment of myeloid cells to the brain. (United States)

    Sawicki, C M; McKim, D B; Wohleb, E S; Jarrett, B L; Reader, B F; Norden, D M; Godbout, J P; Sheridan, J F


    Repeated social defeat (RSD) in mice causes myeloid cell trafficking to the brain that contributes to the development of prolonged anxiety-like behavior. Myeloid cell recruitment following RSD occurs in regions where neuronal and microglia activation is observed. Thus, we hypothesized that crosstalk between neurons, microglia, and endothelial cells contributes to brain myeloid cell trafficking via chemokine signaling and vascular adhesion molecules. Here we show that social defeat caused an exposure- and brain region-dependent increase in several key adhesion molecules and chemokines involved in the recruitment of myeloid cells. For example, RSD induced distinct patterns of adhesion molecule expression that may explain brain region-dependent myeloid cell trafficking. VCAM-1 and ICAM-1 mRNA expression were increased in an exposure-dependent manner. Furthermore, RSD-induced VCAM-1 and ICAM-1 protein expression were localized to the vasculature of brain regions implicated in fear and anxiety responses, which spatially corresponded to previously reported patterns of myeloid cell trafficking. Next, mRNA expression of additional adhesion molecules (E- and P-selectin, PECAM-1) and chemokines (CXCL1, CXCL2, CXCL12, CCL2) were determined in the brain. Social defeat induced an exposure-dependent increase in mRNA levels of E-selectin, CXCL1, and CXCL2 that increased with additional days of social defeat. While CXCL12 was unaffected by RSD, CCL2 expression was increased by six days of social defeat. Last, comparison between enriched CD11b(+) cells (microglia/macrophages) and enriched GLAST-1(+)/CD11b(-) cells (astrocytes) revealed RSD increased mRNA expression of IL-1β, CCL2, and CXCL2 in microglia/macrophages but not in astrocytes. Collectively, these data indicate that key mediators of leukocyte recruitment were increased in the brain vasculature following RSD in an exposure- and brain region-dependent manner. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights

  6. Mexico's four economies reflect regional differences, challenges


    Canas, Jesus; Gutierrez, Emily


    The economic potential of Mexico’s four regions is defined by their industrial makeup, income per capita and how much of the labor force operates outside the formal economy. Recent government reforms could promote growth and reduce regional inequality.

  7. A single-copy galK promoter cloning vector suitable for cloning strong promoters

    DEFF Research Database (Denmark)

    Dandanell, Gert; Court, Donald L.; Hammer, Karin


    We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...

  8. Specific DNA Binding of a Potential Transcriptional Regulator, Inosine 5′-Monophosphate Dehydrogenase-Related Protein VII, to the Promoter Region of a Methyl Coenzyme M Reductase I-Encoding Operon Retrieved from Methanothermobacter thermautotrophicus Strain ΔH▿


    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus ΔH are expressed in response to H2 availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cul...

  9. Promoting preschool reading


    Istenič, Vesna


    The thesis titled Promoting preschool reading consists of a theoretiral and an empirical part. In the theoretical part I wrote about reading, the importance of reading, types of reading, about reading motivation, promoting reading motivation, internal and external motivation, influence of reading motivation on the child's reading activity, reading and familial literacy, the role of adults in promotion reading literacy, reading to a child and promoting reading in pre-school years, where I ...

  10. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH. (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi


    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  11. Report on the project for spread/promotion of technology for the industrial waste optimized treatment in the Asian region; Asia chiiki sangyo haikibutsu tekiseika shori gijutsu nado fukyu sokushin jigyo hokokusho

    Energy Technology Data Exchange (ETDEWEB)



    The International Symposium `98 on the industrial waste problem in the Asian region was held in Tokyo on February 18, 1998. MITI commented on the present situation of the industrial waste problem in Japan and Japan`s environmental tackling toward the Asian region, and also Asian countries (China, the Philippines, Thailand and Korea) made reports. Japan reported on environmental preservation measures taken in the industrial circle, the industrial waste problem at companies which advanced into Asian countries, effects of the Basel Convention (which restricts border-crossing movement of harmful wastes) on recycle activities, Japan`s role in Asia, etc. In the panel discussion, discussions were made on human interchange in the informatization, recycling technology, shortage of personnel concerned with environmental protection, construction of a network in the Asian region and Japan` s role, etc. As to the treatment system for waste, the necessity was recognized of studying systems which meet with actual states of each country. It is also necessary to go on with discussing how the system should be for cooperation between governments and private companies. Importance of the recycle and information exchange was emphasized. 10 refs., 14 figs., 27 tabs.

  12. What do health-promoting schools promote?

    DEFF Research Database (Denmark)

    Simovska, Venka


    -promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

  13. Radiation promotive concept

    International Nuclear Information System (INIS)

    Shebaita, M.K.


    The concept of radiation promotion was proposed in this study. The proposal of this concept was dependent upon stimulation in growth weight of survived chicks when fertile eggs were exposed to 60 Co gamma radiation. It was found that female chick (Promotive Sex) responded to this proposal concept rather than the male. Moreover, the dose level of 640 rads was found to be the Promotive Dose. It is important before applying ionizing radiation as a growth promotive to take into consideration whether you want increasing egg or meat production, as meat promotion in layers breed is bound to decrease egg production. (orig.) [de

  14. Dioxin activation of CYP1A5 promoter/enhancer regions from two avian species, common cormorant (Phalacrocorax carbo) and chicken (Gallus gallus): Association with aryl hydrocarbon receptor 1 and 2 isoforms

    International Nuclear Information System (INIS)

    Lee, Jin-Seon; Kim, Eun-Young; Iwata, Hisato


    The present study focuses on the molecular mechanism and interspecies differences in susceptibility of avian aryl hydrocarbon receptor (AHR)-cytochrome P4501A (CYP1A) signaling pathway. By the cloning of 5'-flanking regions of CYP1A5 gene from common cormorant (Phalacrocorax carbo) and chicken (Gallus gallus), seven putative xenobiotic response elements (XREs) were identified within 2.7 kb upstream region of common cormorant CYP1A5 (ccCYP1A5), and six XREs were found within 0.9 kb of chicken CYP1A5 (ckCYP1A5). Analysis of sequential deletion and mutagenesis of the binding sites in avian CYP1A5 genes by in vitro reporter gene assays revealed that two XREs at -613 bp and -1585 bp in ccCYP1A5, and one XRE at -262 bp in ckCYP1A5 conferred TCDD-responsiveness. The binding of AHR1 with AHR nuclear translocator 1 (ARNT1) to the functional XRE in a TCDD-dependent manner was verified with gel shift assays, suggesting that avian CYP1A5 is induced by TCDD through AHR1/ARNT1 signaling pathway as well as mammalian CYP1A1 but through a distinct pathway from mammalian CYP1A2, an ortholog of the CYP1A5. TCDD-EC 50 for the transcriptional activity in both cormorant AHR1- and AHR2-ccCYP1A5 reporter construct was 10-fold higher than that in chicken AHR1-ckCYP1A5 reporter construct. In contrast, chicken AHR2 showed no TCDD-dependent response. The TCDD-EC 50 for CYP1A5 transactivation was altered by switching AHR1 between the two avian species, irrespective of the species from which the regulatory region of CYP1A5 gene originates. Therefore, the structural difference in AHR, not the CYP1A5 regulatory region may be a major factor to account for the dioxin susceptibility in avian species

  15. Fiscal 2000 survey report on project for promoting international cooperation. Survey on coal utilization in APEC region (Coal note); 2000 nendo kokusai kyoryoku suishin jigyo chosa hokokusho. APEC iki nai ni okeru sekitan riyo jokyo tou chosa (Koru note)

    Energy Technology Data Exchange (ETDEWEB)



    With the purpose of contributing to the infrastructure for promoting clean coal technology (CCT), there were compiled as the 'coal note' various kinds of coal-related information in China, Indonesia, Philippine, Thailand and Vietnam among APEC countries. Concerning China, for example, economic growth and energy supply/demand in the category of the energy outline were described in detail; as were the guiding principle. individual guidance plan, and specific energy policy of the 10th five year plan, in the category of the energy policy; coal deposits, geological summary, coal quality in each coal forming period, and the status quo of development, in the category of the coal mines and development; coal supply/demand, production, consumption, and export, in the category of the present status of the coal industry; producers, sales, quality of product coal, distribution, and price, in the category of the domestic supply; present state of environmental problems relating to coal, and environmental measures intended for coal, in the category of the coal-related environmental issues; and development, production, coal cleaning, quality control, safety control, and utilization (combustion, liquefaction and gasification), in the category of coal utilization technology, respectively. (NEDO)

  16. Fiscal 1999 geothermal development promotion survey report. Structural boring survey work and analysis (No. B-5 - Musadake region); 1999 nendo chinetsu kaihatsu sokushin chosa. Kozo shisui chosa koji oyobi kaiseki hokokusho - No. B-5 Musadake chiiki

    Energy Technology Data Exchange (ETDEWEB)



    For geothermal development in the Musadake region, Shibetsu-gun, Hokkaido, structural boring was carried out and boreholes were inspected. In the structural boring survey, borehole N11-MD-3 was drilled as deep as 2,001.18 m, and borehole N11-MD-4 2001.44 m. Performed or tested for each of the two boreholes were temperature logging, electrical logging, temperature recovery, reinjection, core cutting examination, and so forth. The result of the temperature logging shows that temperature rise is slower at levels deeper than 1280 m in borehole N11-MD-3, with the maximum temperature marking 274 degrees C, and, in borehole N11-MD-4, the maximum temperature is 198 degrees C. No reinjection test is carried out because the ground pressure is too high to allow the replacement of the borehole content with fresh water. Analysis results lead to a conclusion that the hot fluid in this region originates in fossil seawater and in meteoric water, the latter arriving after a long-term permeation process, heated by thermal conduction to 270 degrees C or higher. It is inferred that the geothermal fluid flows in a fissure in the vicinity of the Musadake/Mt. Shitabanupuri fault and a fault orthogonally crossing the said fault for the formation of a high-temperature geothermal storage. (NEDO)

  17. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  18. Comparative analyses of bidirectional promoters in vertebrates

    Directory of Open Access Journals (Sweden)

    Taylor James


    Full Text Available Abstract Background Orthologous genes with deep phylogenetic histories are likely to retain similar regulatory features. In this report we utilize orthology assignments for pairs of genes co-regulated by bidirectional promoters to map the ancestral history of the promoter regions. Results Our mapping of bidirectional promoters from humans to fish shows that many such promoters emerged after the divergence of chickens and fish. Furthermore, annotations of promoters in deep phylogenies enable detection of missing data or assembly problems present in higher vertebrates. The functional importance of bidirectional promoters is indicated by selective pressure to maintain the arrangement of genes regulated by the promoter over long evolutionary time spans. Characteristics unique to bidirectional promoters are further elucidated using a technique for unsupervised classification, known as ESPERR. Conclusion Results of these analyses will aid in our understanding of the evolution of bidirectional promoters, including whether the regulation of two genes evolved as a consequence of their proximity or if function dictated their co-regulation.

  19. Regions Matter

    DEFF Research Database (Denmark)

    Laursen, Keld; Masciarelli, Francesca; Prencipe, Andrea


    capital at the regional level, with a large-scale data set of the innovative activities of a representative sample of 2,413 Italian manufacturing firms from 21 regions, and controlling for a large set of firm and regional characteristics, we find that being located in a region characterized by a high...

  20. Tourism of Khmelnytskyi region

    Directory of Open Access Journals (Sweden)

    Інна Шоробура


    Full Text Available The peculiarities of tourism in Khmelnytskyi region, its priority areas, types, including cultural-educational, environmental, sportrecreative and others have been revealed in the article. The basic tasks of tourism development in the region, aimed at the formation and protection of the tourism-recreational sector, market of competitive services, attraction of maximum number of tourists to the region, etc. have been cleared out. The attention is focused on the main tourist potential of Khmelnytskyi region, including National Nature Park «Podilski Tovtry», National historical-cultural nature reserve «Kamianets», «Samchyky», Medzhybizh regional historical-ethnographic museum-fortress, sanatorium-resort facilities based on mineral waters and others. The attention is paid to the increase in income from tourism. Traditional hospitality of the population of the region, especially in rural areas, provides the possibility to combine tourists’ accommodation with the study of rural customs and traditions directly in the villages. Tourism in Khmelnytskyi region will be attractive to all tourists who want to eat healthy food, to stay outdoors and enjoy the beauty of the region. Also the article tells us about the development of other directions and familiarizes tourists with other enticements of Khmelnytskyi region using the positive brand of Kamianets-Podilskyi. All three potential areas of tourism development (historical tourism in Kamianets-Podilskyi, recreational tourism on rivers, lakes and in the forests, as well as rural tourism can be combined within the global promotion of nature and traditions of the region. It is indicated that Khmelnytskyi is a promising tourist region of Ukraine. The main problems of the region are inadequate tourism infrastructure, accommodation facilities, food and roads. The experience of the tourism cluster «Oberih» (Protective Charm proves the perspectives of agritourism. Developing these two areas together, we

  1. A functional polymorphism in the promoter region of microRNA-146a is associated with the risk of Alzheimer disease and the rate of cognitive decline in patients.

    Directory of Open Access Journals (Sweden)

    Lili Cui

    Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.


    Directory of Open Access Journals (Sweden)

    Alexandru Lucian MIHAI


    Full Text Available In sport marketing, the word promotion covers a range of interrelated activities. All of these activities are designed to attract attention, stimulate the interest and awareness of consumers, and of course, encourage them to purchase a sport product. Promotion is about communicating with and educating consumers. The purpose of a sport promotional strategy is to build brand loyalty and product credibility, develop image, and position the brand. A promotional strategy is similar to a marketing strategy, but the promotional strategy seeks short-term objectives, both direct and indirect. Promotional objectives usually include increased sales, stimulate impulse buying, raise customer traffic, and present and reinforce image. It also provides information about products and services, publicizes new stores or websites, and creates and enhances customer satisfaction.

  3. Regional development and regional policy


    Šabić, Dejan; Vujadinović, Snežana


    Economic polarization is a process that is present at global, national and regional level. Economic activity is extremely spatially concentrated. Cities and developed regions use the agglomeration effect to attract labor and capital, thus achieving more favorable economic conditions than the agrarian region. Scientific research and European experiences over the past decades have contributed to the discrepancy among theorists about the causes and consequences of regional inequalities. Regional...

  4. Deletion analysis of susy-sl promoter for the identification of optimal promoter sequence

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bshir, A.


    The promoter region of sucrose synthase (susy-Sl) was identified and isolated from tomato. The 5? deletion analysis was carried out for the identification of minimum optimal promoter. Transgenic lines of Arabidopsis thaliana were developed by floral dip method incorporating various promoter deletion cassettes controlling GUS reporter gene. GUS assay of transgenic tissues indicated that full length susy-Sl promoter and its deletion mutants were constitutively expressed in vegetative and floral tissues of A. thaliana. The expression was observed in roots, shoots and flowers of A. thaliana. Analysis of 5? deletion series of susy-Sl promoter showed that a minimum of 679 bp fragment of the promoter was sufficient to drive expression of GUS reporter gene in the major tissues of transgenic A. thaliana. (author)

  5. Health promotion in globalization

    Directory of Open Access Journals (Sweden)

    Álvaro Franco-Giraldo


    Full Text Available Objective: to unravel some theoretical and factual elements required to implement more effective health promotion strategies and practices in the field of health services whilst following the great challenges that globalization has imposed on the health systems, which are inevitably expressed in the local context (glocalization. Methodology: a narrative review taking into account the concepts of globalization and health promotion in relation to health determinants. The authors approach some courses of action and strategies for health promotion based on the social principles and universal values that guide health promotion, health service reorientation and primary healthcare, empowerment, social participation, and inter-sectoral and social mobilization. Discussion: the discussion focuses on the redirection of health promotion services in relation to the wave of health reforms that has spread throughout the world under the neoliberal rule. The author also discusses health promotion, its ineffectiveness, and the quest for renewal. Likewise, the author sets priorities for health promotion in relation to social determinants. Conclusion: the current global order, in terms of international relations, is not consistent with the ethical principles of health promotion. In this paper, the author advocates for the implementation of actions to change the social and physical life conditions of people based on changes in the use of power in society and the appropriate practice of politics in the context of globalization in order to achieve the effectiveness of the actions of health promotion.

  6. Fiscal 1998 survey for geothermal energy development promotion. Environmental impact survey report (No. B-7 Kuwanosawa region); 1998 nendo chinetsu kaihatsu sokushin chosa. Kankyo eikyo chosa hokokusho (No.B-7 Kuwanosawa chiiki)

    Energy Technology Data Exchange (ETDEWEB)



    This survey aims to learn the current states of environmental factors required for the comprehension of the impacts on surroundings of a structural boring for geothermal energy exploration. The target site is an approximately 10km{sup 2}-large area located among the mountains 20km south-south-east of Yuzawa City, Akita Prefecture. It is found that numerous animals and vegetables inhabit the Kuwanosawa region and its vicinity. They are 19 species of mammals in 10 families under 5 orders; 73 species of birds in 25 families under 10 orders; 6 species of reptiles in 13 families; 9 species of amphibians in 6 families under 2 orders; and 719 species of insects in 179 families under 17 orders. Valuable animals include flying squirrels, mandarin ducks, black salamanders, and small Gifu butterflies. There are 670 species of vegetables in 132 families. Valuable vegetables are Iinuma bulblets, wild rhubarb roots, and Amur adonises. Floras found in existence are a natural flora in the beech class area, compensatory flora in the beech class area, afforested area, and a flora in the crop land. No remarkable fluctuation was observed in the Takamatsu spa throughout the survey period. Fluctuations were observed in all the survey items at the Doroyu-Okuyama inn. (NEDO)

  7. Regional planning and urban infrastructure development in the ...

    African Journals Online (AJOL)

    Regional planning and urban infrastructure development in the Gongola region, ... PROMOTING ACCESS TO AFRICAN RESEARCH ... In North-eastern Nigeria, the Gongola region has been one of the least developed since independence.

  8. In planta processing and glycosylation of a nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-like effector and its interaction with a host CLAVATA2-like receptor to promote parasitism. (United States)

    Chen, Shiyan; Lang, Ping; Chronis, Demosthenis; Zhang, Sheng; De Jong, Walter S; Mitchum, Melissa G; Wang, Xiaohong


    Like other biotrophic plant pathogens, plant-parasitic nematodes secrete effector proteins into host cells to facilitate infection. Effector proteins that mimic plant CLAVATA3/ENDOSPERM SURROUNDING REGION-related (CLE) proteins have been identified in several cyst nematodes, including the potato cyst nematode (PCN); however, the mechanistic details of this cross-kingdom mimicry are poorly understood. Plant CLEs are posttranslationally modified and proteolytically processed to function as bioactive ligands critical to various aspects of plant development. Using ectopic expression coupled with nanoliquid chromatography-tandem mass spectrometry analysis, we show that the in planta mature form of proGrCLE1, a multidomain CLE effector secreted by PCN during infection, is a 12-amino acid arabinosylated glycopeptide (named GrCLE1-1Hyp4,7g) with striking structural similarity to mature plant CLE peptides. This glycopeptide is more resistant to hydrolytic degradation and binds with higher affinity to a CLAVATA2-like receptor (StCLV2) from potato (Solanum tuberosum) than its nonglycosylated forms. We further show that StCLV2 is highly up-regulated at nematode infection sites and that transgenic potatoes with reduced StCLV2 expression are less susceptible to PCN infection, indicating that interference of the CLV2-mediated signaling pathway confers nematode resistance in crop plants. These results strongly suggest that phytonematodes have evolved to utilize host cellular posttranslational modification and processing machinery for the activation of CLE effectors following secretion into plant cells and highlight the significance of arabinosylation in regulating nematode CLE effector activity. Our finding also provides evidence that multidomain CLEs are modified and processed similarly to single-domain CLEs, adding new insight into CLE maturation in plants. © 2015 American Society of Plant Biologists. All Rights Reserved.

  9. In Planta Processing and Glycosylation of a Nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-Like Effector and Its Interaction with a Host CLAVATA2-Like Receptor to Promote Parasitism1[OPEN (United States)

    Chen, Shiyan; Lang, Ping; Chronis, Demosthenis; Zhang, Sheng; De Jong, Walter S.; Mitchum, Melissa G.


    Like other biotrophic plant pathogens, plant-parasitic nematodes secrete effector proteins into host cells to facilitate infection. Effector proteins that mimic plant CLAVATA3/ENDOSPERM SURROUNDING REGION-related (CLE) proteins have been identified in several cyst nematodes, including the potato cyst nematode (PCN); however, the mechanistic details of this cross-kingdom mimicry are poorly understood. Plant CLEs are posttranslationally modified and proteolytically processed to function as bioactive ligands critical to various aspects of plant development. Using ectopic expression coupled with nanoliquid chromatography-tandem mass spectrometry analysis, we show that the in planta mature form of proGrCLE1, a multidomain CLE effector secreted by PCN during infection, is a 12-amino acid arabinosylated glycopeptide (named GrCLE1-1Hyp4,7g) with striking structural similarity to mature plant CLE peptides. This glycopeptide is more resistant to hydrolytic degradation and binds with higher affinity to a CLAVATA2-like receptor (StCLV2) from potato (Solanum tuberosum) than its nonglycosylated forms. We further show that StCLV2 is highly up-regulated at nematode infection sites and that transgenic potatoes with reduced StCLV2 expression are less susceptible to PCN infection, indicating that interference of the CLV2-mediated signaling pathway confers nematode resistance in crop plants. These results strongly suggest that phytonematodes have evolved to utilize host cellular posttranslational modification and processing machinery for the activation of CLE effectors following secretion into plant cells and highlight the significance of arabinosylation in regulating nematode CLE effector activity. Our finding also provides evidence that multidomain CLEs are modified and processed similarly to single-domain CLEs, adding new insight into CLE maturation in plants. PMID:25416475

  10. Structural region

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Structural region. The two groups had 4 substitutions similar to Yawat strain. The Yawat strain had 5 unique mutations. 3 in the E2 region and 2 in the E1 region. The mutation, I702V (E2), though different from all the recent Indian and Reunion sequences was similar ...

  11. Promoter reuse in prokaryotes

    NARCIS (Netherlands)

    Nijveen, H.; Matus-Garcia, M.; Passel, van M.W.J.


    Anecdotal evidence shows promoters being reused separate from their downstream gene, thus providing a mechanism for the efficient and rapid rewiring of a gene’s transcriptional regulation. We have identified over 4000 groups of highly similar promoters using a conservative sequence similarity search

  12. Health promotion in context:

    DEFF Research Database (Denmark)

    Liveng, Anne; Andersen, Heidi Myglegård; Lehn Christiansen, Sine


    Health promotion constitutes a complex field of study, as it addresses multifaceted problems and involves a range of methods and theories. Students in the field of health promotion can find this challenging. To raise their level of reflexivity and support learning we have developed the “context m...

  13. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)


    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  14. Health-promoting schools

    DEFF Research Database (Denmark)

    Kwan, Stella Y L; Petersen, Poul Erik; Pine, Cynthia M


    Schools provide an important setting for promoting health, as they reach over 1 billion children worldwide and, through them, the school staff, families and the community as a whole. Health promotion messages can be reinforced throughout the most influential stages of children's lives, enabling...... them to develop lifelong sustainable attitudes and skills. Poor oral health can have a detrimental effect on children's quality of life, their performance at school and their success in later life. This paper examines the global need for promoting oral health through schools. The WHO Global School...... Health Initiative and the potential for setting up oral health programmes in schools using the health-promoting school framework are discussed. The challenges faced in promoting oral health in schools in both developed and developing countries are highlighted. The importance of using a validated...

  15. Localization and regulation of bacteriophage Mu promoters

    International Nuclear Information System (INIS)

    Stoddard, S.F.; Howe, M.M.


    Mu promoters active during the lytic cycle were located by isolating RNA at various times after induction of Mu prophages, radiolabeling it by capping in vitro, and hybridizing it to Mu DNA fragments on Southern blots. Signals were detected from four new promoters in addition to the previously characterized P e (early), P cM (repressor), and P mom (late) promoters. A major signal upstream of C was first observed at 12 min and intensified thereafter with RNA from cts and C amber but not replication-defective prophages; these characteristics indicate that this signal arises from a middle promoter, which we designate P m . With 20- and 40-min RNA, four additional major signals originated in the C-lys, F-G-I, N-P, and com-mom regions. These signals were missing with RNA from C amber and replication-defective prophages and therefore reflected the activity of late promoters, one of which we presume was P mom . Uninduced lysogens showed weak signals from five regions, one from the early regulatory region, three between genes B and lys, and one near the late genes K, L, and M. The first of these probably resulted from P cM activity; the others remain to be identified

  16. Insulators form gene loops by interacting with promoters in Drosophila. (United States)

    Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya


    Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

  17. Health Promoting Schools: Consensus, Strategies, and Potential (United States)

    Macnab, Andrew J.; Gagnon, Faith A.; Stewart, Donald


    Purpose: The purpose of this paper is to summarize a consensus statement generated on the current challenges, strategies, and potential of health promoting schools (HPS) at a 2011 colloquium at the Stellenbosch Institute for Advanced Study where 40 people from five continents came together to share their global and regional experience surrounding…

  18. BEYOND ZERO HARM: Promoting effective community participation ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    It does so through the co-production of consistent and meaningful local data on community well-being, the promotion of more transparent and inclusive local governance, and regional knowledge-sharing on development best practices in mining areas. Led by the World University Service of Canada (WUSC), with the ...

  19. Shifting Cultivation : Promoting Innovative Policy and Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Shifting Cultivation : Promoting Innovative Policy and Development Options in the Eastern Himalayas. Shifting ... pressure and market forces. The idea is to share good policies and practices related to shifting cultivation and alternative options through regional exchange. ... Les chaînes de valeur comme leviers stratégiques.

  20. Health promotion capacity building in South Africa. (United States)

    Wills, Jane; Rudolph, Michael


    Health promotion in South Africa is in its early stages and while there is some institutional development and capacity building for managers, there has been relative disregard and lack of attention of the wider health promotion workforce who carry out community-based health promotion activities. This article describes one regional education and training programme for health promoters as well as the limited available evidence on the impact of the project on learners and organizations. Marked differences before and after the implementation of the training activities were reported in relation to behaviour change communication and project planning, in addition to self-reported positive change in knowledge, confidence and a high level of participant satisfaction. Investment in individual skills development needs to be accompanied by wider workforce development with organizational/institutional development and recognised competencies frameworks.

  1. Core Promoter Structure in the Oomycete Phytophthora infestans (United States)

    McLeod, Adele; Smart, Christine D.; Fry, William E.


    We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940


    Directory of Open Access Journals (Sweden)

    Costel Iliuta Negricea


    Full Text Available The promotion as one of the components of the marketing mix, laying stress, în this regard,on its role în the deployment of the tourism companies’ activity, the structure of the promotional activity în thetouristic sector as well as the use of the promotional strategies în the attainment of the development targets ofthe tourism companies.So, în the paper there have been mentioned the three levels at which it is made the touristic promotionîn Romania, respectively nationally, by the Ministry of the Tourism, under whose subordination it is theTourism National Authority, the second level is the regional/local one, concerning the activity carried out bythe Centers/Offices of Touristic Information from a series of localities, and the last level refers to the microone, respectively at the level of the tourism companies, which promote their offer individually (the most often.The important role of the promotion în the deployment of the activity of the tourism companies isbeing highlighted by the fact that this makes the connection between the activity of an organization and itscustomers (effective or potential, and, în the touristic field, the content of the promotional activity is stronglystressed by the features of this type of services and of the system of creation and delivery, as well as of thepurchasing behaviour.

  3. RCA's regional industrial project

    International Nuclear Information System (INIS)

    Ali, A.T.


    The Regional Cooperation Agreement (RCA) for Research Development and Training Related to Nuclear Science and Technology, formulated under the auspices of the International Atomic Energy Agency (IAEA), came into force in June 1972. The overall objective of RCA is to promote technical cooperation among the developing and developed countries in the Asia Pacific region in the peaceful uses of nuclear energy and related technology. Currently, the biggest project under RCA is the Regional Project on the Industrial Applications of Isotopes and Radiation Technology for Asia and the Pacific. The project was established in 1982 for a period of five years and was completed in December 1986. The first phase of the project has generated a high degree of awareness on the industrial potential of isotopes and radiation technology throughout the region; produced a cadre of trained manpower in all areas covered by the project; identified the expertise available in the region; and developed in the region, a unique network of people and institutions involved with the utilization of isotope and radiation technology. A Phase II of the project, which cover all but one of the sub-projects under Phase I, was approved in early 1987 for another five years until 1991. (Nogami, K.)

  4. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    Parera, María Delia


    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [es

  5. Promoting Your Web Site. (United States)

    Raeder, Aggi


    Discussion of ways to promote sites on the World Wide Web focuses on how search engines work and how they retrieve and identify sites. Appropriate Web links for submitting new sites and for Internet marketing are included. (LRW)

  6. Researching health promotion

    National Research Council Canada - National Science Library

    Platt, Stephen David; Watson, Jonathan


    ... the progress towards developing and implementing health promotion interventions that: * * * * are theoretically grounded, socio-culturally appropriate and sustainable involve the redistribution of resources towards those most in need reflect the principles of equity, participation and empowerment incorporate rigorous, methodologically ...

  7. Regional Externalities

    NARCIS (Netherlands)

    Heijman, W.J.M.


    The book offers practical and theoretical insights in regional externalities. Regional externalities are a specific subset of externalities that can be defined as externalities where space plays a dominant role. This class of externalities can be divided into three categories: (1) externalities

  8. Promoting Global Health

    Directory of Open Access Journals (Sweden)

    Margaret A. Winker, MD


    Full Text Available The Editor-in-Chief of the International Journal of MCH and AIDS (IJMA is a member of the World Association of Medical Editors (WAME. The Editorial Board of IJMA believes it is important that the statement on promoting global health and this accompanying editorial is brought to the attention of our readers. Medical journal editors have a social responsibility to promote global health by publishing, whenever possible, research that furthers health worldwide.

  9. Promoting renewable energy technologies

    DEFF Research Database (Denmark)

    Olsen, O.J.; Skytte, K.


    % of its annual electricity production. In this paper, we present and discuss the Danish experience as a case of promoting renewable energy technologies. The development path of the two technologies has been very different. Wind power is considered an outright success with fast deployment to decreasing...... technology and its particular context, it is possible to formulate some general principles that can help to create an effective and efficient policy for promoting new renewable energy technologies....

  10. Genome-wide analysis of promoter architecture in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.


    Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

  11. Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome. (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K


    Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

  12. Regions and the Territorial Cohesion

    Directory of Open Access Journals (Sweden)

    Ioan Ianos


    Full Text Available Territorial cohesion is an important target of European Union, constantly promoted by its institutions and their representatives. In the context of the Europe 2020 strategy, one of the most important support documents, the region represents a very important issue, being considered to be the key to its successfulness. The region is seen as a support for the smart growth and all the operational policy concepts try to make use of the spatial potential, by taking better account of the territorial specificities. Two main questions play attention: the need to transform the present-day developmental regions into administrative ones is a priority? What kind of regionalization it must to be promoted? Correlating these issues with already defined territorial cohesion, the administrative region is a real tool for the future territorial development. The experience of the last 14 years asks urgently the building of a new territorial administrative reform, giving competences to regions. For instant, each development region is a construction resulted from a free association of the counties. Their role in the regional development is much reduced one, because their regional councils are not elected; decisions taken at this level are consultative for the social, economical, cultural or political actors.

  13. DNA methylation of PTEN gene promoter region is not correlated ...

    African Journals Online (AJOL)



    Feb 23, 2012 ... of Shandong, Qingdao Agricultural University, Qingdao, 266109, China. 2Daping ... (Kang et al., 2002), glioblastoma (Baeza et al., 2003), breast cancer ... DNA isolation by using micro DNA isolation kit (Tiangen, Beijing,. China) .... Asano T, Yao Y, Zhu J, Li D, Abbruzzese JL, Reddy SA (2004). The PI.

  14. Research Article Polymorphism detection of promoter region of IFN ...

    Indian Academy of Sciences (India)

    MRT Pack 24 DVDs

    Introduction. Improving animal health is considered to be the basic goal of the animal breeding industry ... agriculture sector for providing the invaluable supply of proteins, fats, minerals and vitamins as well as ..... 2011 MyD88 deficiency leads.

  15. Research Article Polymorphism detection of promoter region of IFN ...

    Indian Academy of Sciences (India)

    MRT Pack 24 DVDs

    Improving animal health is considered to be the basic goal of the animal breeding ..... Additionally, cytokines including TGF-β, IFN-y and TNF-α, IL-1α, IL- .... of lipopolysaccharide-binding protein in protection of mice against a ... Humoral Immune Response to Killed H5N1 HPAI Vaccine in a Red Jungle fowl Population.

  16. Regional Cooperation for the Promotion of Nuclear Power Business

    International Nuclear Information System (INIS)

    Kim, Jong Sok


    In the early year of nuclear power business in Korea, it was proceeded smoothly under the good situation in general. But in mid-1987 on the way of democratization in the country, mass demonstration of residents around the nuclear power plant and unfavorable groundless attitude to nuclear power plant presented US great deal of adversities. Upon this historical turning point KEPCO and government could provide the law on support for areas surrounding power plant and we recognized that the nuclear power business is only possible under the good-established, mutual cooperation between the utility and the surrounding communities and the enhancement of public understanding is inevitable than before. In order to secure these goals with the present recognition heartily, we firstly have to operate the plant safely to lay up the trust foundation and secondly to enhance the common understanding by giving more information of nuclear power especially contribution on national economic growth and environment preservation and, thirdly to do our best for the establishment of new era of co-prosperity between the utility and surrounding communities by strengthening the rational supports. By implementing all of these without any problems, the communities become more affluent than before and the conversion of the image of our corporation as a national entity will become widespread, so that it will be easy to find the necessary construction sites, as well as to operate existing plants, smoothly. Eventually we, as the public corporation, could carryout he social responsibility and contribute to the national economic growth, which leads to the final goal of community cooperation

  17. Promotion of renewable energy in some MENA region countries (United States)

    Abdeladim, K.; Bouchakour, S.; Arab, A. Hadj; Ould Amrouche, S.; Yassaa, N.


    In recent years Middle East and North African (MENA) countries, are showing efforts about the integration of renewable electricity into their power markets. Indeed, installations were already achieved and renewable energy programs were launched. The Algerian program remains one of the most ambitious with its installation capacity up to 22GW of power generating to be installed by 2030. More than 60 % of the total capacity is planned to be solar photovoltaic (PV). Like Algeria, Morocco has integrated development project with a target to develop by 2020 a 2000 MW capacity of electricity production from solar energy. The Tunisian government has launched its first phase of the renewable power generation program, with an objective to install 1,000 MW of renewable power capacity over the 2017-2020 periods, where 650 MW of the total capacity is planned to be solar and 350 MW wind. One of the leading Arab country in wind energy, these recent years is Egypt, with its more than 700 megawatt of operational power generation plants and has launched significant projects development in solar energy. Regarding Jordan, the government has taken different steps in this field of energy with a Strategy plan 2007-2020, by implementing a large scale of projects on renewable energy sources, with an objective to cover 10% of the country’s energy supply, from renewable sources by the year 2020. Concerning Lebanon, the country is looking to attain an integration of 12 % by 2020.

  18. 76 FR 68067 - United States-Peru Trade Promotion Agreement (United States)


    ... between the Parties and promoting regional economic integration; promoting broad-based economic development in order to reduce poverty and generate opportunities for sustainable economic alternatives to... rule. CBP also invites comments that relate to the economic, environmental, or federalism effects that...

  19. La educación literaria y su tarea pendiente: promoción de la literatura local y regional en el contexto de construcción curricular | Literary education and its ongoing task: promotion of local and regional literature in the context of curriculum construction

    Directory of Open Access Journals (Sweden)

    Wilfredo Illas Ramírez


    Full Text Available En momentos de construcción curricular y de evaluación del sistema educativo venezolano, resulta a propósito pensar el lugar de una educación literaria sustentada en: equilibrio, flexibilización y dinamismo del canon oficial. El desarrollo de la competencia literaria y la promoción de la literatura local y regional, como ámbito propicio para suscitar un aprendizaje significativo que proyecte como valor agregado un sentir de identidad y pertenencia, es un espíritu inaplazable ante las amenazas de un mundo globalizado. La presente investigación se estructura en cinco ámbitos: crítico, teórico, metodológico, reflexivo y concluyente. El sustento teórico deriva de los aportes de Teresa Colomer y el metodológico de la hermenéutica propuesta por Dilthey, Gadamer y Ricoeur. La investigación siguió un enfoque cualitativo en el que se esboza una hermenéutica-dialéctica. Las técnicas e instrumentos estuvieron constituidos por entrevista a profundidad y observación participante; a estas dos instancias se sumó la teoría emergente y de esta forma se procedió a sistematizar la información en un proceso de triangulación. Tres hallazgos fundamentales cierran el circuito investigativo: a transformar la educación literaria aprovechando el contexto de la construcción curricular, b pensar en la valía de la literatura local y regional para el desarrollo de la competencia literaria; y, c apostar por un aprendizaje significativo que enriquezca el espíritu y promueva valores culturales.

  20. Regional Prosperity to Benefit from Efforts

    Institute of Scientific and Technical Information of China (English)


    China will continue to promote friendship and partnership with its neighbours and work together with other Asia-Pacific countries to create a peaceful, co-operative and harmonious regional environment.


    Directory of Open Access Journals (Sweden)

    Fotache Lacramioara


    Full Text Available The paper is an effort to unknown areas identity affirmation, through collaborative development of advertising mix, with an emphasis on virtual platforms as admissible solution for increasing visibility. Based upon comparative effective analysis of categories of communication particularities, it is suggested a positioning strategic solution, via virtual advertising platform as unique, integrated, complex and very attractive tourism product promotion, fitted for the internal and international tourism circuit. The active promotion of the specified territorial identity will launch a brand with an impact among tourists by using marketing techniques and innovating technical means and prioritizing tourism as a principal vector of local and regional development.

  2. Direct and indirect effects in the regulation of overlapping promoters

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Erdossy, Janos; Csiszovski, Zsolt


    promoter database we found that ~14% of the identified 'forward' promoters overlap with a promoter oriented in the opposite direction. In this article we combine a mathematical model with experimental analysis of synthetic regulatory regions to investigate interference of overlapping promoters. We find...... that promoter interference depends on the characteristics of overlapping promoters. The model predicts that promoter strength and interference can be regulated separately, which provides unique opportunities for regulation. Our experimental data suggest that in principle any DNA binding protein can be used......Optimal response to environmental stimuli often requires activation of certain genes and repression of others. Dual function regulatory proteins play a key role in the differential regulation of gene expression. While repression can be achieved by any DNA binding protein through steric occlusion...

  3. Guarded Type Promotion

    DEFF Research Database (Denmark)

    Winther, Johnni


    conditional using the instanceof operator and thus the cast type is redundantly mentioned twice. We propose a new typing rule for Java called Guarded Type Promotion aimed at eliminating the need for the explicit casts when guarded. This new typing rule is backward compatible and has been fully implemented...... in a Java 6 compiler. Through our extensive testing of real-life code we show that guarded casts account for approximately one fourth of all casts and that Guarded Type Promotion can eliminate the need for 95 percent of these guarded casts....


    Directory of Open Access Journals (Sweden)

    Alexandru-Mircea NEDELEA


    Full Text Available The tourism industry is unlike any other because, instead of a product, you are selling a place and all the things it has to offer. You are competing with the entire world every time you promote tourism in a given destination, and this high level of competition demands a creative and unique approach. To be successful, your marketing should constantly put forth the best possible image of your destination, while creating interest on a broad scale in as many ways as possible. Romania has to conceive an efficient promotional mix in order to attract more tourists.

  5. Characterization and sequence analysis of the F2 promoter from corynephage BFK20

    International Nuclear Information System (INIS)

    Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.


    F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

  6. Buying time promotes happiness

    NARCIS (Netherlands)

    Whillans, Ashley; Dunn, Elizabeth; Smeets, Paul M.; Bekkers, R.H.F.P.; Norton, M.I.


    Around the world, increases in wealth have produced an unintended consequence: a rising sense of time scarcity. We provide evidence that using money to buy time can provide a buffer against this time famine, thereby promoting happiness. Using large, diverse samples from the United States, Canada,

  7. 50 Practical Promotion Ideas. (United States)

    Madeyski, Tom


    Includes 50 cost-effective ideas for promoting camp in the areas of recruiting new campers, encouraging returning campers, advertising strategies, printing brochures and other written materials, using photographs, targeting groups for camp facility rental, and effectively using the media. (LP)

  8. Health and health promotion

    NARCIS (Netherlands)

    Kingma, E.M.


    Much of our social and political effort, including a portion of the research in this university, is directed towards the promotion of one goal: health. But what is health? Or rather, how should we define health so that it is an identifiable goalpost for our social policies and technological

  9. Promoting tourism destination image

    NARCIS (Netherlands)

    R. Govers (Robert); F.M. Go (Frank); K. Kumar (Kuldeep)


    textabstractThis article examines the role of tourism promotion as a component of destination image formation. It reports the findings of a study in which 1,100 respondents from around the globe described their previsit perceived image of seven sample destinations, as well as the information sources

  10. Promoting Continuing Education Programs. (United States)

    Hendrickson, Gayle A.

    This handbook is intended for use by institutions in marketing their continuing education programs. A section on "Devising Your Strategy" looks at identifying a target audience, determining the marketing approach, and developing a marketing plan and promotional techniques. A discussion of media options looks at the advantages and…

  11. Promoting La Cultura Hispana (United States)

    Pluviose, David


    Launched in 1985 at Arizona State University, the Hispanic Research Center's (HRC) efforts to promote Latino and Chicano art and issues have flourished in recent years. In 2004, the HRC hosted the Arizona International Latina/o Arts Festival in collaboration with the Mesa Southwest Museum. The HRC has also founded a mentoring institute for…

  12. Fiscal 2000 project for promoting international cooperation. Survey report on preparation of technological information in APEC region (Upstream area: preparation of video for training); 2000 nendo kokusai kyoryoku suishin jigyo chosa hokokusho. APEC iki nai ni okeru gijutsu joho seibi ni kakawaru chosa (Joryu bunya - kenshu you video sakusei)

    Energy Technology Data Exchange (ETDEWEB)



    With the purpose of spreading and promoting clean coal technology (CCT) in coal producing countries in the APEC region, videos for training use were prepared so as to contribute to the reduction in environmental problems through the introduction of the coal cleaning and wastewater treatment technologies used in Japanese mines. In the video, comparison is made between the untreated wastewater and cleaned water flowing in and out of a present coal-cleaning plant, with the purification ratio determined, recognisably showing the effect by the cleaning facilities, and introducing the type of equipment required to satisfy the standard under the regulation. Also introduced is a technology for utilizing sludge collected in a sedimentation pond and fly ash scavenged in a private power plant. The videotape was prepared for 40 reels in English, 40 in Chinese, and 20 in Indonesian. The video title is 'Environmental safeguard of coal cleaning plant', and the contents are the importance of wastewater treatment and measures against water pollution, wastewater treatment technology in Taiheiyo coal mines, and wastewater treatment technology in Ikeshima coal mines. (NEDO)


    African Journals Online (AJOL)

    This study investigates the contribution of school curriculum committee in facilitating and coordinating ... schools of Amhara Region' ln undertaking the study the descriptive survey method was used. .... pupil and the teacher are available. ... prepared for each level and grade has ..... the principals have the opinion that the.

  14. Atlantic Region

    NARCIS (Netherlands)

    Elands, B.H.M.; Bell, S.; Blok, J.


    Chapter 2 explores recreation and tourism practices in forest areas in the Atlantic region, which refers to the geographical area close to the North Sea and the Atlantic Ocean. The Atlantic countries described in this section are Belgium (Flanders and Wallonia), Denmark, Iceland, Ireland, the

  15. Promoters of Escherichia coli versus promoter islands: function and structure comparison.

    Directory of Open Access Journals (Sweden)

    Valeriy V Panyukov

    Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

  16. Synthetic promoter libraries for Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Rytter, Jakob Vang; Helmark, Søren; Chen, Jun


    The ability to modulate gene expression is an important genetic tool in systems biology and biotechnology. Here, we demonstrate that a previously published easy and fast PCR-based method for modulating gene expression in lactic acid bacteria is also applicable to Corynebacterium glutamicum. We co...... promoter library (SPL) technology is convenient for modulating gene expression in C. glutamicum and should have many future applications, within basic research as well as for optimizing industrial production organisms....... constructed constitutive promoter libraries based on various combinations of a previously reported C. glutamicum -10 consensus sequence (gngnTA(c/t)aaTgg) and the Escherichia coli -35 consensus, either with or without an AT-rich region upstream. A promoter library based on consensus sequences frequently found...... in low-GC Gram-positive microorganisms was also included. The strongest promoters were found in the library with a -35 region and a C. glutamicum -10 consensus, and this library also represents the largest activity span. Using the alternative -10 consensus TATAAT, which can be found in many other...

  17. [Promoting the code of ethics for nurses]. (United States)

    Chamboredon, Patrick; Lecointre, Brigitte


    The publication of the code of ethics for nurses requires the French National Order of Nurses' structures to undertake initiatives with the aim of promoting it as well as implementing the public service missions which have now been attributed to the Order. Each regional and departmental body has its role to play in raising awareness of this code and its application in the field. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Advancement & Promotion Review: 2003

    CERN Multimedia


    Advancement, exceptional advancement and promotion decisions were made at the end of June, following the procedures published in Weekly Bulletin No. 13/2003. These decisions were included, where applicable, in the salaries for the month of July 2003. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions are now published on the HR Division website and are accessible for consultation only at the following address: It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2003. Final decisions will be applied retroactively to 1 July 2003. Human Resources Division Tel:...

  19. Examples of sales promotion

    Energy Technology Data Exchange (ETDEWEB)

    Winkel, L.

    The Gas, Electricity and Water Works Cologne (GEW) supplies 4,115 objects with district heat. The connected load totals 830,000 kJ/s, which over the last 10 years has been expanded by an average of 5.3% annually and is currently 2.2% above the national average. The extension of district heat supply has been accomplished without subsidies from the two ZIP programmes. The major objects in Cologne city are to a large extent linked to the GEW district heating network. The goal now is to win more smaller objects in the supply area. To achieve notable new connected load increases in the future, the GEW is conducting a sales promotion drive together with Cologne heating construction firms. The promotion is running under the slogan 'Magically Simple: Heating with District Heat'. Its strategy and execution are described here by the author.

  20. Promoting renewable energy technologies

    International Nuclear Information System (INIS)

    Grenaa Jensen, S.


    Technologies using renewable energy sources are receiving increasing interest from both public authorities and power producing companies, mainly because of the environmental advantages they procure in comparison with conventional energy sources. These technologies can be substitution for conventional energy sources and limit damage to the environment. Furthermore, several of the renewable energy technologies satisfy an increasing political goal of self-sufficiency within energy production. The subject of this thesis is promotion of renewable technologies. The primary goal is to increase understanding on how technological development takes place, and establish a theoretical framework that can assist in the construction of policy strategies including instruments for promotion of renewable energy technologies. Technological development is analysed by through quantitative and qualitative methods. (BA)


    CERN Multimedia


    Advancement, exceptional advancement and promotion decisions were made at the beginning of July, under the new career structure scheme and following the procedures published in Weekly Bulletin No. 11/2002. These decisions were included, where applicable, in the salaries for the month of July 2002. The award of the periodic step was communicated to staff by the salary shown on the July salary slip. All other decisions are communicated by separate notification. The names of staff receiving exceptional advancements or promotions will be published this year on the HR Division website and are accessible for consultation only at the following address : It is recalled that change of career path proposals submitted to the Technical Engineers and Administrative Careers Committee (TEACC) or to Human Resources Division are being examined with a view to preparing the latters' recommendations by the end of September 2002. Final decisions will be applied retroactivel...

  2. Governmentality in health promotion

    DEFF Research Database (Denmark)

    Jelsøe, Erling; Land, Birgit; Pedersen, Kirsten Bransholm

    Objectives: Issues of governance in health promotion during the last 3-4 decades has increasingly been seen as characterized by health interventions and campaigns aimed at influencing the citizens to exhibit a certain desired behavior, that is an orientation towards generating self...... is not sufficient to ensure healthy behaviour. Such measures are used in the public as well as the private sector. In this paper we will give a number of examples of this development and a preliminary analysis of the social framework for its emergence. Methods: The paper will present a theoretical discussion...... was conducted as a case oriented search in relevant media and available documents illustrating the tendency towards using coercive measures to promote healthy behaviour. This was followed up through semi-structured interviews with actors from public authorities, organizations and companies with experience...

  3. : Healthy lifestyles’ promotion


    Fernández Gómez, Erika; Díaz-Campo, Jesús


    International audience; The goal of this research was to analyse the advertising of food broadcast by the two Spanish private thematic channels aimed at children with more audience in Spain (Neox and Boing). A content analysis was made in order to study the commercials showed during the hours of children’s enhanced protection established by the normative of this country. The paper presents the increasing concern about kids´ obesity and the role of food industry. Healthy lifestyles are promote...

  4. Promoting Health, Producing Moralisms?

    DEFF Research Database (Denmark)

    Brogaard Kristensen, Dorthe; Askegaard, Søren; Hauge Jeppesen, Lene


    Based on an ethnographic study of 25 Danish consumers, the aim of this paper is threefold. Firstly, based on a critique of traditional approaches to consumer health campaigning, it argues for a more socially diversified approach for understanding consumer construction and pursuit of healthy...... behaviour. Secondly, it presents a typology of discourses that are employed by consumers in constructing their (health oriented) food consumption. Thirdly, it addresses certain social and moral dilemmas inherent in consumer health promotional campaigns....

  5. Electrochemical promotion of sulfur dioxide catalytic oxidation

    DEFF Research Database (Denmark)

    Petrushina, Irina; Bandur, Viktor; Cappeln, Frederik Vilhelm


    investigation was to study a possible non-Faradaic electrochemical promotion of the liquid-phase catalytic reaction. It has been shown that there are two negative potential promotion areas with maximum effects at approximately -0.1 and -0.2 V, and one positive potential promotion area with the maximum effect...... between 0.1 and 0.3 V. There were no Faradaic reactions in the negative polarization region, and there was an anodic current which was less than 16% of the theoretical value for an exclusively Faradaic SO2 oxidation. Therefore the promotion effects at negative polarization are completely non-Faradaic. All...... the promotion effects have been explained as mainly due to charging of the electric double layer at the gold electrode. The effect at -0.2 V also depends on the V2O5 concentration and is more pronounced at higher V2O5 concentrations. This has been ascribed to a destruction of the vanadium polymeric chains...

  6. Promoter Motifs in NCLDVs: An Evolutionary Perspective (United States)

    Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos


    For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

  7. Promoter Motifs in NCLDVs: An Evolutionary Perspective

    Directory of Open Access Journals (Sweden)

    Graziele Pereira Oliveira


    Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

  8. Dynamic usage of transcription start sites within core promoters

    DEFF Research Database (Denmark)

    Kawaji, Hideya; Frith, Martin C; Katayama, Shintaro


    BACKGROUND: Mammalian promoters do not initiate transcription at single, well defined base pairs, but rather at multiple, alternative start sites spread across a region. We previously characterized the static structures of transcription start site usage within promoters at the base pair level......, based on large-scale sequencing of transcript 5' ends. RESULTS: In the present study we begin to explore the internal dynamics of mammalian promoters, and demonstrate that start site selection within many mouse core promoters varies among tissues. We also show that this dynamic usage of start sites...... is associated with CpG islands, broad and multimodal promoter structures, and imprinting. CONCLUSION: Our results reveal a new level of biologic complexity within promoters--fine-scale regulation of transcription starting events at the base pair level. These events are likely to be related to epigenetic...

  9. Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

    Directory of Open Access Journals (Sweden)

    Stephanie E Hesselson


    Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

  10. Regionalism in Services : A Study of ASEAN


    Gootiiz, Batshur; Mattoo, Aaditya


    Can regionalism do what multilateralism has so far failed to do—promote greater openness of services markets? Although previous research has pointed to the wider and deeper legal commitments under regional agreements as proof that it can, no previous study has assessed the impact of such agreements on applied policies. This paper focuses on the Association of Southeast Asian Nations (ASEAN), where ...

  11. Interaction region

    International Nuclear Information System (INIS)



    The Interaction Region Group addressed the basic questions of how to collide the SLC beams, how to maximize and monitor the luminosity, and how to minimize the detector backgrounds at the interaction region. In practice, five subgroups evolved to study these questions. The final focus group provided three alternative designs to acheive the 1 to 2 micron beam spot size required by the SLC, as well as studying other problems including: eta, eta' matching from the collider arcs, the implementation of soft bends near the interaction region, beam emittance growth, and magnet tolerances in the final focus. The beam position monitor group proposed two devices, a strip line monitor, and a beamstrahlung monitor, to bring the beams into collision. The luminosity monitor group reviewed the possible QED processes that would be insensitive to weak interaction (Z 0 ) effects. The beam dumping group proposed locations for kicker and septum magnets in the final focus that would achieve a high dumping efficiency and would meet the desired beam tolerances at the Moller scattering target in the beam dump line. Working with the Polarization Group, the Moller experiment was designed into the beam dump beam line. A beam dump was proposed that would maintain radiation backgrounds (penetrating muons) at acceptible levels. The detector backgrounds group proposed soft-bend and masking configurations to shield the detector from synchrotron radiation from the hard/soft bends and from the final focus quadrupoles and evaluated the effectiveness of these designs for the three final focus optics designs. Backgrounds were also estimated from: large angle synchrotron radiation, local and distant beam-gas interactions, 2-photon interactions, and from neutrons and backscattered photons from the beamstrahlung dump

  12. Transition region

    International Nuclear Information System (INIS)

    Jordan, C.


    The Glossary is designed to be a technical dictionary that will provide solar workers of various specialties, students, other astronomers and theoreticians with concise information on the nature and the properties of phenomena of solar and solar-terrestrial physics. Each term, or group of related terms, is given a concise phenomenological and quantitative description, including the relationship to other phenomena and an interpretation in terms of physical processes. The references are intended to lead the non-specialist reader into the literature. This section deals with: transition region; di-electronic recombination; intersystem or intercombination lines; satellite lines; grazing-incidence optics; and crystal spectrometers. (B.R.H.)

  13. The study on Egr-1 promoter which is radioactive promoter

    International Nuclear Information System (INIS)

    Zhang Chunzhi; Guo Yang; Lv Zhonghong


    Radiogenetic therapy is a heated reaseach on oncotherapy. Early growth response gene-1 (Egr-1) gene promoter is a probably means in radiogenetic therapy. The article review studying on Egr-1 gene promoter and constructing regulating gene expressing system by radiation-inducible Egr-1 gene promoter. (authors)

  14. 7 CFR 1205.319 - Cotton-producing region. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Cotton-producing region. 1205.319 Section 1205.319... Cotton Research and Promotion Order Definitions § 1205.319 Cotton-producing region. Cotton-producing region means each of the following groups of cotton-producing States: (a) Southeast Region: Alabama...

  15. Renewable energy sources (promotion)

    International Nuclear Information System (INIS)

    Cook, F.


    Permission to present a Bill to establish an independent commission directly responsible for the research, development and demonstration of clean, renewable, alternative sources of energy (to nuclear energy) is requested. The paragraphs of the preamble to the Bill are summarized by the Member seeking permission. The main reason for promoting renewable energy sources is opposition to the nuclear industry. One objection was raised. However, permission was granted to present the Bill and it was read for the first time with a second reading ordered for 7 March 1986. The Bill itself is not reprinted but the permission and question are reported verbatim. (U.K.)

  16. The Promoted Sibling

    DEFF Research Database (Denmark)

    Visholm, Steen

    to understand challenges to leaders in postmodern organisations. Theories about leadership has until now been occupied with the vertical relations in the organisations. To lead a team of creative people the leader has to pay attention both to the relations between leader and followers and to the relations...... to the psychodynamic understanding of families, groups and organisations. With a point of departure in a study of self-governing groups in a factory the paper introduces the concept: ‘the promoted sibling’ which provide quite some understanding of the middle managers challenges in his or her role and the challenges...

  17. Leadership Styles Promote Teamwork

    Directory of Open Access Journals (Sweden)

    Khater Aldoshan


    Full Text Available This paper will evaluate the importance of learning leadership styles and the explanation of when and how each one is used in the workforce. In this paper many experts have been cited that are well-known in the field of leadership. Also this paper will concentrate on the importance of teamwork in the workforce and there are many examples of how teamwork is effective for creating the best possible outcomes for creativity and productivity. In the television industry creativity is an essential component of the job description and inspirational leadership that promotes teamwork is essential.

  18. [Promoting Research Integrity]. (United States)

    Suzuki, Hiromichi


     Japan Agency for Medical Research and Development (AMED) was launched in April 2015 to promote integrated medical research and development (R&D) ranging from basic research to practical applications, in order to smoothly achieve the nationwide application of research outcomes, and to establish an environment therefor. AMED consolidates budgets for R&D expenses, which had previously been allocated from different sources, such as the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labour and Welfare, and the Ministry of Economy, Trade and Industry. It provides funds strategically to universities, research institutions, etc. By promoting medical R&D, AMED aims to achieve the world's highest level of medical care/services to contribute to a society in which people live long and healthy lives. To achieve this mission, it is imperative that R&D funded by AMED is widely understood and supported. Maintaining and improving research integrity is a prerequisite to this end. AMED is taking various measures to ensure fair and appropriate R&D. It is asking researchers to participate in its responsible conduct in research (RCR) education program and to comply with its rules for managing conflicts of interest (COI). In addition, AMED also conducts a grant program to create and distribute a variety of educational materials on RCR and other matters. Further, AMED is establishing a platform that allows researchers to exchange information about research integrity, and it is undertaking additional measures, such as holding meetings and international symposia on research integrity.

  19. The promotion of happiness. (United States)

    Klamut, Marian Kazimierz


    The human mind is capable of creating an internal world--the psychic sphere--including the phenomena characteristic of human nature, such as selfconsciousness, conscious experiences, conceptual thinking, symbolic language, dreams, art, creation of culture, sense of values, interest in the distant past and care about the distant future. According to the exceptionally concordant opinions of the sages and scholars of the East and the West it is just within this internal world that human happiness dwells. Happiness is a state of the spirit which consists in: internal peace, satisfaction with one's life, the joy of life, benevolence and cordiality towards oneself and towards others; sensitivity to the beauty of nature, culture and art; harmonious co-existence with the surroundings. The achievement and experiencing of the states of thus understood happiness depend mainly on ourselves and, similarly to the project of health promotion, require knowledge, willingness and possibilities. Happiness Promotion denotes the commendation and popularizing of a certain definite way of thinking and acting--showing the road which leads to the frequent experiencing of happy moments.

  20. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P


    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  1. Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

    KAUST Repository

    Umarov, Ramzan


    Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize Convolutional Neural Networks (CNN) to analyze sequence characteristics of prokaryotic and eukaryotic promoters and build their predictive models. We trained a similar CNN architecture on promoters of five distant organisms: human, mouse, plant (Arabidopsis), and two bacteria (Escherichia coli and Bacillus subtilis). We found that CNN trained on sigma70 subclass of Escherichia coli promoter gives an excellent classification of promoters and non-promoter sequences (Sn = 0.90, Sp = 0.96, CC = 0.84). The Bacillus subtilis promoters identification CNN model achieves Sn = 0.91, Sp = 0.95, and CC = 0.86. For human, mouse and Arabidopsis promoters we employed CNNs for identification of two well-known promoter classes (TATA and non-TATA promoters). CNN models nicely recognize these complex functional regions. For human promoters Sn/Sp/CC accuracy of prediction reached 0.95/0.98/0,90 on TATA and 0.90/0.98/0.89 for non-TATA promoter sequences, respectively. For Arabidopsis we observed Sn/Sp/CC 0.95/0.97/0.91 (TATA) and 0.94/0.94/0.86 (non-TATA) promoters. Thus, the developed CNN models, implemented in CNNProm program, demonstrated the ability of deep learning approach to grasp complex promoter sequence characteristics and achieve significantly higher accuracy compared to the previously developed promoter prediction programs. We also propose random substitution procedure to discover positionally conserved promoter functional elements. As the suggested approach does not require knowledge of any specific promoter features, it can be easily extended to identify promoters and other complex functional regions in sequences of many other and especially newly sequenced genomes. The CNNProm program is available to run at web server

  2. 75 FR 16739 - EDA Participation in the Energy Efficient Building Systems Regional Innovation Cluster Initiative (United States)


    ...: Promote regional development; Accelerate innovation, technology transfer, and entrepreneurship to create... priorities, which are: Collaborative Regional Innovation. Initiatives that support the development and growth... Participation in the Energy Efficient Building Systems Regional Innovation Cluster Initiative AGENCY: Economic...


    Directory of Open Access Journals (Sweden)

    Laura eSteenbergen


    Full Text Available The link between serotonin (5-HT and one of the most important elements of prosocial behavior, charity, has remained largely uninvestigated. In the present study, we tested whether charitable donating can be promoted by administering the food supplement L-Tryptophan (TRP, the biochemical precursor of 5-HT. Participants were compared with respect to the amount of money they donated when given the opportunity to make a charitable donation. As expected, compared to a neutral placebo, TRP appears to increase the participants’ willingness to donate money to a charity. This result supports the idea that the food we eat may act as a cognitive enhancer modulating the way we think and perceive the world and others.

  4. Anger Promotes Economic Conservatism. (United States)

    Kettle, Keri L; Salerno, Anthony


    Research suggests that certain facets of people's political ideals can be motivated by different goals. Although it is widely accepted that emotions motivate goal-directed behavior, less is known about how emotion-specific goals may influence different facets of ideology. In this research, we examine how anger affects political ideology and through what mechanisms such effects occur. Drawing on the dual-process motivational model of ideology and the functionalist perspective of emotion, we propose that anger leads people to support conservative economic ideals, which promote economic independence and discourage societal resource sharing. Four studies support our hypothesis that anger can enhance support for an election candidate espousing conservative economic ideals. We find that anger shifts people toward economic conservatism by orienting them toward competition for resources. Implications and future research on the relationship between emotions and political ideology are discussed.

  5. Buying time promotes happiness. (United States)

    Whillans, Ashley V; Dunn, Elizabeth W; Smeets, Paul; Bekkers, Rene; Norton, Michael I


    Around the world, increases in wealth have produced an unintended consequence: a rising sense of time scarcity. We provide evidence that using money to buy time can provide a buffer against this time famine, thereby promoting happiness. Using large, diverse samples from the United States, Canada, Denmark, and The Netherlands ( n = 6,271), we show that individuals who spend money on time-saving services report greater life satisfaction. A field experiment provides causal evidence that working adults report greater happiness after spending money on a time-saving purchase than on a material purchase. Together, these results suggest that using money to buy time can protect people from the detrimental effects of time pressure on life satisfaction.

  6. Ambient oxygen promotes tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Ho Joong Sung


    Full Text Available Oxygen serves as an essential factor for oxidative stress, and it has been shown to be a mutagen in bacteria. While it is well established that ambient oxygen can also cause genomic instability in cultured mammalian cells, its effect on de novo tumorigenesis at the organismal level is unclear. Herein, by decreasing ambient oxygen exposure, we report a ∼50% increase in the median tumor-free survival time of p53-/- mice. In the thymus, reducing oxygen exposure decreased the levels of oxidative DNA damage and RAG recombinase, both of which are known to promote lymphomagenesis in p53-/- mice. Oxygen is further shown to be associated with genomic instability in two additional cancer models involving the APC tumor suppressor gene and chemical carcinogenesis. Together, these observations represent the first report directly testing the effect of ambient oxygen on de novo tumorigenesis and provide important physiologic evidence demonstrating its critical role in increasing genomic instability in vivo.

  7. Promoting household energy conservation

    International Nuclear Information System (INIS)

    Steg, Linda


    It is commonly assumed that households must change their behaviour to reduce the problems caused by increasing levels of fossil energy use. Strategies for behaviour change will be more effective if they target the most important causes of the behaviour in question. Therefore, this paper first discusses the factors influencing household energy use. Three barriers to fossil fuel energy conservation are discussed: insufficient knowledge of effective ways to reduce household energy use, the low priority and high costs of energy savings, and the lack of feasible alternatives. Next, the paper elaborates on the effectiveness and acceptability of strategies aimed to promote household energy savings. Informational strategies aimed at changing individuals' knowledge, perceptions, cognitions, motivations and norms, as well as structural strategies aimed at changing the context in which decisions are made, are discussed. This paper focuses on the psychological literature on household energy conservation, which mostly examined the effects of informational strategies. Finally, this paper lists important topics for future research

  8. Hyaluronan Oligosaccharides for the Promotion of Remyelination (Revised) (United States)


    would be both safe and efficacious as a therapy or co- therapy to promote remyelination. REFERENCES Botzki  A,  Rigden  DJ,  Braun...with reduced brightness and contrast, demonstrating the morphology within lesions. Arrows in C and D indicate regions of persistent lyso- lecithin ... therapies for the promotion of remyelination. Acknowledgment This work was supported by NIH (NINDS) grants NS056234 (L.S.S.), NS054044, and NS045737-06S1

  9. Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

    Directory of Open Access Journals (Sweden)

    Steven E Weicksel

    Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

  10. Flow around turbulence promoters in parallel channel, 1

    International Nuclear Information System (INIS)

    Shiina, Yasuaki; Takizuka, Takakazu; Okamoto, Yoshizo


    Flow characteristics in relation to heat transfer characteristics in parallel channel with turbulence promoters were studied experimentally. Flow visualization experiments were made in paralle channel with one or two turbulence promoters for Reynolds number region of 100 lt = Resub(w) lt = 3,600. The vortex patterns behind one promoter were that a steady vortex was formed for low Reynolds number and vortex was shed for high Reynolds number,. For higher Reynolds number, it was observed that shedding vortex caused other vortices or disappeared itself randomly. The results indicate that the shedding vortices will augment heat transfer, whereas the steady vortex will give rise to deterioration in heat transfer. This inference agrees with the experimental results of Hishida et al. The results of two promoters experiment showed that the maximum performance of promoter would be attained at p/d -- 7. This agrees with the results formerly studied by other investigators. (author)

  11. Identiifcation and validation of root-speciifc promoters in rice

    Institute of Scientific and Technical Information of China (English)

    HUANG Li-yu; ZHANG Fan; QIN Qiao; WANG Wen-sheng; ZHANG Ting; FU Bin-ying


    Novel promoters that confer root-speciifc expression would be useful for engineering resistance against problems of nutrient and water absorption by roots. In this study, the reverse transcriptase polymerase chain reaction was used to identify seven genes with root-speciifc expression in rice. The isolation and characterization of upstream promoter regions of ifve selected genes rice root-speciifc promoter (rRSP) 1 to 5 (rRSP1-rRSP5) and A2P (the promoter ofOsAct2) revealed that rRSP1, rRSP3, and rRSP5 are particularly important with respect to root-speciifc activities. Furthermore, rRSP1, rRSP3, and rRSP5 were observed to make different contributions to root activities in various species. These three promoters could be used for root-speciifc enhancement of target gene(s).

  12. Regional Courts as Judicial Brakes?

    Directory of Open Access Journals (Sweden)

    Metcalf Katrin Nyman


    Full Text Available The article examines how regional integration courts can act as judicial brakes, at a time when “constitutional coups” – leaders staying in power past constitutional time limits or other forms of actions against the spirit if not always the letter of the constitution – are alarmingly common. The article discusses how regional courts can be used to modify or protect national rule of law and the constitutional order from the outside (i.e. from the regional integration aspect and the extent to which this can be valid particularly to promote a uniform interpretation and application of human rights. Although this trend is visible in Europe, it is more striking, because less expected, on other continents, in particular Africa and the Americas, where the developments take place in less than perfect democratic environments. The article contains evidence from cases dealt with in the various regional courts, supporting that a system of political and judicial oversight, especially in regions with weak or fragile democratic systems, can be a useful addition to national judicial or other mechanisms of protection of rule of law and control of the executive. Action by regional courts helps defeat perceptions of majoritarian politics, which in many countries allow for the winner to take all. Under a system of regional oversight, states become aware of the limits they themselves have set and citizens become aware of their possibilities to challenge political power.

  13. Regional Branding: Building Brand Value

    Directory of Open Access Journals (Sweden)

    Klára Margarisová


    Full Text Available Regional branding is one of several ways to promote rural regions and support development of socially, culturally and environmentally oriented economies in areas that are interesting due to their natural and cultural heritage. The article attempts to review the conceptual and theoretical underpinnings of branding as conveyed by leading authors in the marketing field. The aim of this paper is to define brand as a broad complex of variables, which are used in building of its identity as a basis for creating value proposition and the position of a brand. Article briefly describes the most comprehensive labeling system for regional products at the micro-regional level is the one guaranteed by Association of Regional Brands (ARB. The main contribution of this article is a theoretical model of strategic management of a regional brand, which captures the interdependence of the individual steps of brand building as well as stakeholders. The starting point for building of brand value is a strategic analysis of the brand, including analysis of customer and competitors. The analysis of external factors is followed by analysis of the brand itself. The resulting relationship between the brand and the customer is based on value proposition representing benefits (functional, emotional, self‑expression. The concept of total product is connected with the concept of total brand and it is offered to the customer as a regional product. Finally it suggests possibilities for further research.

  14. Promoters active in interphase are bookmarked during mitosis by ubiquitination (United States)

    Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.


    We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662

  15. Ethnopoly promotes tolerance

    CERN Document Server

    CERN Bulletin


    On Friday 23 April, 225 primary school children from the eight schools in Meyrin-Cointrin and their accompanying adults took part in a big game of Ethnopoly. Private individuals, associations, administrations, shopkeepers and CERN all opened their doors to them to talk about their countries, their customs and what they are doing to promote tolerance and integration.   The CERN stand set up at ForumMeyrin for the Ethnopoly game. Scurrying from one place to another, the 10 and 11 year olds were made aware of the rich cultural diversity of their commune, which is home to 130 different nationalities. Physicists and engineers from CERN took up residence in the Forum Meyrin for the day in order to talk to the children about the advantages of international collaboration, a subject dear to the Organization's heart. They welcomed around fifty children in the course of the day, conveying to them a message of tolerance: despite their differences, the 10,000 scientists and other members of the CERN...

  16. What promotes longevity?

    Directory of Open Access Journals (Sweden)

    Agnieszka Kujawska


    Full Text Available Introduction Scientists try to answer on the need of a long life with a full physical capability Nonagenarians, centenarians and their closest family members are characterized by a survival benefit throughout life. Moreover, twin studies of longevity suggest that around 25% of the variation in lifespan in developed countries may be inherited. It is therefore worth to examine the role of inter-relationship between nature vs nurture in longevity increment. Material and methods Articles in the EBSCO database have been analyzed using keywords: longevity, gene, behavior, environment. The available literature was subjectively selected. Then, the newest version of every paper was searched for. Results Restriction of calories as well as intake of desirable nutrients can promote adequate control of metabolic pathways and gene expression. APOE, DRD4, Paraoxonase 1, SIRT 3 and SIRT 5 genes can play an important role in longevity. Conclusions Genetic profile and environmental factors seems to both influence on the longevity. Relationships between genetic profile, behavior pattern, quality of life, years spent free from activity limitations and longevity should be examined, to be able to give a recipe on living a long and happy life.

  17. Promotion and Fast Food Demand


    Timothy J. Richards; Luis Padilla


    Many believe that fast food promotion is a significant cause of the obesity epidemic in North America. Industry members argue that promotion only reallocates brand shares and does not increase overall demand. We study the effect of fast food promotion on market share and total demand by estimating a discrete / continuous model of fast food restaurant choice and food expenditure that explicitly accounts for both spatial and temporal determinants of demand. Estimates are obtained using a unique...

  18. Health promotion in the workplace


    Sultan T Al-Otaibi


    The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiv...

  19. Sales promotions and food consumption. (United States)

    Hawkes, Corinna


    Sales promotions are widely used to market food to adults, children, and youth. Yet, in contrast to advertising, practically no attention has been paid to their impacts on dietary behaviors, or to how they may be used more effectively to promote healthy eating. This review explores the available literature on the subject. The objective is to identify if and what literature exists, examine the nature of this literature, and analyze what can be learned from it about the effects of sales promotions on food consumption. The review finds that while sales promotions lead to significant sales increases over the short-term, this does not necessarily lead to changes in food-consumption patterns. Nevertheless, there is evidence from econometric modeling studies indicating that sales promotions can influence consumption patterns by influencing the purchasing choices of consumers and encouraging them to eat more. These effects depend on the characteristics of the food product, sales promotion, and consumer. The complexity of the effects means that sales promotions aiming to encourage consumption of nutritious foods need to be carefully designed. These conclusions are based on studies that use mainly sales data as a proxy for dietary intake. The nutrition (and economics) research communities should add to this existing body of research to provide evidence on the impact of sales promotions on dietary intake and related behaviors. This would help support the development of a sales promotion environment conducive to healthy eating.


    Directory of Open Access Journals (Sweden)



    Full Text Available Regional development is a complex process which supports each territory in building its future on the basis of its own territorial capital and, thus, contributing to reducing disparities between different geographical areas. Regional development policy is a set of planned measures, promoted by local and central public administration authorities, in partnership with different actors (private, public, volunteers used to ensure dynamic and sustainable economic growth by efficiently using regional and local potential to improve living conditions. The main areas of interest of regional policies are: enterprise development, labor market, attracting investment, technology transfer, SME sector development, infrastructure improvement, environmental quality, rural development, health, education, culture.

  1. Biofilms promote altruism. (United States)

    Kreft, Jan-Ulrich


    The origin of altruism is a fundamental problem in evolution, and the maintenance of biodiversity is a fundamental problem in ecology. These two problems combine with the fundamental microbiological question of whether it is always advantageous for a unicellular organism to grow as fast as possible. The common basis for these three themes is a trade-off between growth rate and growth yield, which in turn is based on irreversible thermodynamics. The trade-off creates an evolutionary alternative between two strategies: high growth yield at low growth rate versus high growth rate at low growth yield. High growth yield at low growth rate is a case of an altruistic strategy because it increases the fitness of the group by using resources economically at the cost of decreased fitness, or growth rate, of the individual. The group-beneficial behaviour is advantageous in the long term, whereas the high growth rate strategy is advantageous in the short term. Coexistence of species requires differences between their niches, and niche space is typically divided into four 'axes' (time, space, resources, predators). This neglects survival strategies based on cooperation, which extend the possibilities of coexistence, arguing for the inclusion of cooperation as the fifth 'axis'. Here, individual-based model simulations show that spatial structure, as in, for example, biofilms, is necessary for the origin and maintenance of this 'primitive' altruistic strategy and that the common belief that growth rate but not yield decides the outcome of competition is based on chemostat models and experiments. This evolutionary perspective on life in biofilms can explain long-known biofilm characteristics, such as the structural organization into microcolonies, the often-observed lack of mixing among microcolonies, and the shedding of single cells, as promoting the origin and maintenance of the altruistic strategy. Whereas biofilms enrich altruists, enrichment cultures, microbiology's paradigm

  2. Health promoting outdoor environments

    DEFF Research Database (Denmark)

    Stigsdotter, Anna Ulrika Karlsson; Ekholm, Ola; Schipperijn, Jasper


    AIMS: To investigate the associations between green space and health, health-related quality of life and stress, respectively. METHODS: Data were derived from the 2005 Danish Health Interview Survey and are based on a region-stratified random sample of 21,832 adults. Data were collected via face......-to-face interviews followed by a self-administered questionnaire, including the SF-36, which measures eight dimensions of health and the Perceived Stress Scale, which measures self-reported stress. A total of 11,238 respondents completed the interview and returned the questionnaire. Multiple logistic regression...... analyses were performed to investigate the association between distance to green space and self-perceived stress. RESULTS: Danes living more than 1 km away from the nearest green space report poorer health and health-related quality of life, i.e. lower mean scores on all eight SF-36 dimensions of health...

  3. Cinema ed enogastronomia nel portale turistico della Regione Toscana / Cinema and enogastronomy in the tourism portal of the Toscana Region

    Directory of Open Access Journals (Sweden)

    Gian Luigi Corinto


    The paper analyzes the case study of the Tuscan Region which in 2007 has charged the Sistema Toscana Foundation to strategically control all the territorial marketing activities, even including those of the regional film commission and the promotional tourist web site. The aim is to analyze the specific promotional model for enogastronomy and film tourism, as in the peculiar combination of the Tuscan case. The findings are that enongatronomy and tourism have been promoted in combination but only referring to 'minor' tuscan destinations, different from the crowded regional capital or other cultural sites. This choice has been determined by the strategic market positioning of the entire regional tourism supply, effectively integrating local vocations in the web communications. The task of the Foundation in promoting the whole territory and even the minor destinations must be considered as substantially successful, mainly because it has increased the visibility of the Tuscan region by conveniently using all the old and new media tools.


    Directory of Open Access Journals (Sweden)

    O. I. Kit


    Full Text Available Aberrant methylation of gene promoter regions is the main epigenetic change characterizing colorectal cancer. Methylation levels of 42 CpG-sites of promoter regions of the MGMT, APC and CDH13 genes in colorectal cancer were studied in comparison with methylation levels of the adjacent normal tissue in 25 patients. Pyrosequencing showed an increase in methylation levels of promoter regions of the MGMT, APC and CDH13 genes in tumor samples by 3 to 5 times. These tumor samples were screened for activating SNP-mutations in the KRAS (40 %, NRAS (0 % and BRAF (0 % oncogenes. SNP-mutations in the KRAS gene were accompanied by hypermethylation of one or more promoters of the studied genes. Association of this epigenetic index with tumor metastasis was proved. The data on an increase in methylation of the promoter regions of oncosupressor genes can be used as sensitive prognostic markers of progression and metastasis of colorectal cancer.

  5. Promotion mix and industrial marketing

    Directory of Open Access Journals (Sweden)

    Jovičić Dragoljub


    Full Text Available Promotion activities are very important and irreplaceable marketing instrument in placement of production goods. In contrast to final consumption goods, where advertising has an absolute priority compared to another promotion activities, personal sale and development of sale dominate during placement of production goods.

  6. Promotion mix and industrial marketing


    Jovičić Dragoljub


    Promotion activities are very important and irreplaceable marketing instrument in placement of production goods. In contrast to final consumption goods, where advertising has an absolute priority compared to another promotion activities, personal sale and development of sale dominate during placement of production goods.


    Directory of Open Access Journals (Sweden)

    Ştefan MATEI


    Full Text Available Marketing has proven to be very useful instrument in the wine industry, in fostering comprehensive, cohesive and effective strategies which wineries require to effectively compete in today’s almost saturated wine market. But within wine marketing, the promotion strategy, from our point of view, is the most important component of the winery that can ensure the success in the market or can shorten the life cycle of the product. This being said, the aim of the paper is twofold. Firstly, to determine and analyze the steps that are required to create a promotion strategy in the wine industry, by comparing different approaches. Secondly, to identify the instruments of the promotional mix that helps a winery to implement its promotional strategy. Bearing that in mind, the paper starts with some theoretical aspects regarding the promotion strategy and ends by providing a brief overview of the main findings.

  8. Literature promotion in Public Libraries

    DEFF Research Database (Denmark)

    Kann-Christensen, Nanna; Balling, Gitte


    This article discusses a model that can be used in order to analyse notions on literature promotion in public libraries. The model integrates different issues which interact with how literature promotion is understood and thought of in public libraries. Besides cultural policy we regard the logics...... of new public management (NPM) and professional logics in the field of public libraries. Cultural policy along with the identification of underlying logics present among politicians, government officials, managers and librarians/promoters of literature, play an important part in creating an understanding...... of literature promotion in Danish libraries. Thus the basic premise for the development of the model is that cultural policy (Policy) has an important influence on notions on literature promotion and other activities in public libraries, but that cultural policy must be seen in some kind of interaction...

  9. Regional cooperative agreement for the Asia and Pacific region

    International Nuclear Information System (INIS)



    Among the means available to the International Atomic Energy Agency to promote cooperative efforts in the nuclear field is the Regional Cooperative Agreement (RCA) for Research, Development, and Training related to Nuclear Science and Technology for the Asia and Pacific Region. Under the terms of this agreement, which came into force on June 12, 1972, participating countries aim to promote and coordinate research, development, and training projects in nuclear fields through collaborative efforts among relevant national institutions in the region. The Agency's role is to provide organizational, administrative, advisory, technical, and financial assistance when needed to secure successful execution of the projects undertaken within the framework of the RCA. Although this presentation deals primarily with the benefits of regional cooperation under the agreement, a review of the RCA would be somewhat imbalanced without a mention of its shortcomings. One of the principal impediments to more rapid progress, as is the case in many other areas, is financing. There is no stable source of funding outside the research contract program and, the likelihood of large-scale UNDP support notwithstanding, a greater willingness on the part of participating Member States to support the program along with the development of a greater sense of common purpose are called for. In this connection serious consideration is being given to the possibility of establishing an Asian Centre for Research and Training, an institute that would bring together scientists from the region to collaborate on problems common to the RCA countries. A study group has already been convened to investigate the feasibility of this proposal

  10. MCH promotes family planning. (United States)

    Duan, Y


    Family planning (FP) has been promoted in China through improvements in maternal and child health (MCH) which have affected people's attitude toward childbearing. A case study of FP in Taicang County of Jiangsu Province, China is given. Total population is 446,620; natural increase is 10/1000. 99% of births have been planned in recent years. Contraceptive prevalence has reached 92.71%. Contraceptive awareness has opened people up to health education in general. The community participates in management of human wastes, improvement of water supplies, and parasite control in rural areas. MCH was begun in the early 1980s with premarital examinations, prenatal examinations, postnatal visits, and physical checkups. A systematic program has established in 1983. A pilot program integrating FP, MCH, and parasite control operated between 1984 and 1986, in 7 townships was established and MCH was institutionalized. Increases occurred in comprehensive care for women from 49.1% in 1984 to 78.3% in 1986. Children's coverage rose from 78.2% to 85.9%. Perinatal mortality dropped from 30.2/1000 to 20.8/1000. Neonatal mortality declined from 21.3/1000 to 17.3/1000. Infant mortality also decreased from 31.6/1000 to 21.5/1000. Integration of programs throughout the county was achieved after 1987. 99% of women used the MCH handbook. Between 1987 and 1990, the perinatal, neonatal, and infant mortality rate dropped to 12.9/1000, 9.5/1000, and 14.7/1000, respectively. MCH achievements are attributed to a strengthening of the MCH network to improve access and improve MCH workers' level of professional skill, to the availability of premarriage and couples of reproductive age services and child care, and to the contribution of research. Careful monitoring during pregnancy helped reduce the incidence of difficult labors for high risk women from 17.55 in 1984 to 11-15% in recent years. 99.9% deliver in hospitals. There were no maternal deaths in 1989 or 1990. Neonatal tetanus has been

  11. Mice and men: their promoter properties.

    Directory of Open Access Journals (Sweden)


    Full Text Available Using the two largest collections of Mus musculus and Homo sapiens transcription start sites (TSSs determined based on CAGE tags, ditags, full-length cDNAs, and other transcript data, we describe the compositional landscape surrounding TSSs with the aim of gaining better insight into the properties of mammalian promoters. We classified TSSs into four types based on compositional properties of regions immediately surrounding them. These properties highlighted distinctive features in the extended core promoters that helped us delineate boundaries of the transcription initiation domain space for both species. The TSS types were analyzed for associations with initiating dinucleotides, CpG islands, TATA boxes, and an extensive collection of statistically significant cis-elements in mouse and human. We found that different TSS types show preferences for different sets of initiating dinucleotides and cis-elements. Through Gene Ontology and eVOC categories and tissue expression libraries we linked TSS characteristics to expression. Moreover, we show a link of TSS characteristics to very specific genomic organization in an example of immune-response-related genes (GO:0006955. Our results shed light on the global properties of the two transcriptomes not revealed before and therefore provide the framework for better understanding of the transcriptional mechanisms in the two species, as well as a framework for development of new and more efficient promoter- and gene-finding tools.


    Directory of Open Access Journals (Sweden)

    Putu Ratna Juwita Sari


    Full Text Available Tourism in the district of Buleleng, North Bali, is in a process of development so that it is expected to be able produce products of tourism as rapidly developing as the South Bali. The government of Buleleng district has launched an intensive campaign with an aim to develop object of tourism and also holding festivals expected to be able to attract tourist to come. One of the festival is the Lovina Festival which aims to promote the tourism of Buleleng District to improve the economy of Buleleng citizen and increasing the locally-generated revenue. The objective of this research is to learn the precise and effective promotion to implement to attract the interest of tourist to spend their vacation in Buleleng regency especially on the Lovina region. The research method which will be used in this research is the method of qualitative using data gathering technique, observation, interviews and documentation. The result of this research shows the inadequacy of promotional media in use, which resulted in less enthusiasm from visiting tourists.

  13. Returning "Region" to World Regional Geography (United States)

    Rees, Peter W.; Legates, Margaret


    World regional geography textbooks rarely focus on the process of region formation, despite frequent calls to reincorporate a regional approach to teaching global geography. An instructional strategy using problem-based learning in a small honors section of a large world regional geography course is described. Using a hypothetical scenario…

  14. Regional insertion: an emergent approach; Insercao regional: uma abordagem emergente

    Energy Technology Data Exchange (ETDEWEB)

    Serra, M T.F.; Nascimento Teixeira, P do [ELETROBRAS, Rio de Janeiro, RJ (Brazil). Dept. de Meio Ambiente


    The Brazilian Electrical Sector incorporates new variables that expressing the extensive spectrum of environmental impacts in the take of decisions, referring to the viability of realizing a electrical undertaking, attends the several restrictions that are important by the sector and by the society in the environment area and promotes the adequate generation of liquid benefits, consequential of the electrical undertaking. Due to these factors, the Electrical Sector is improving the concept of regional insertion, with the sectorial expansion in long-dated and the created demand in the environmental and social area, focalizing the solution for these questions. (C.G.C.). 1 fig, 2 tabs.


    Directory of Open Access Journals (Sweden)

    Dragoi Ionut


    Full Text Available The regional development should aim to correlate and integrate tourism among the other integrative parts of the regional and local development, taking into account the fact that a region’s prosperity as effect of tourism development may be shown clearly in several stages: on the spot (as a result of direct consumption of the tourist product, on short term (through continuous absorption of the work-force and encouraging the welcoming commerce and in the long run (concentrating capital for investment in the general infrastructure and the one of tourism, in structures of reception for tourism and in the development of urban services. The analysis of intra-regional disparities as part of the economic growth at the level of Region West starts off with the idea that each component county has a different landscape, which favored or inhibited their economic growth; in the same time, each component county has its own specific, which can be promoted through tourism, inducing in time a regional income, and respectively, a social-economic and cultural growth of less developed areas.

  16. Health promotion in the workplace

    Directory of Open Access Journals (Sweden)

    Sultan T Al-Otaibi


    Full Text Available The objective of this review was to describe the scientific evidence for coordinating health promotion at the workplace and to discuss the required future research in this field. Literature review from March 1990 to November 2014 was performed. Using the keywords ′health, promotion, worksite and workplace′, literature was searched in the following databases: Medline, PubMed and Google Scholar; with no time limit. There is emerging evidence that workplace health promotion enhances the effectiveness of effort to promote and protect workers′ health. It proves both cost-effective and cost-beneficial to health promotion at the worksite and subsequently further reduces absenteeism. However, future research is needed to identify the impact of other factors such as age, gender and race on workers′ exposure. There is also a need to develop valid tests to measure the outcome of these programmes at the workplace. Health promotion should be central to workplace planning and should be recognised as an integral part of proactive occupational health. Indeed, the workplace is viewed as one of the most popular venues for promoting health and preventing diseases among employees.

  17. Information technology in health promotion. (United States)

    Lintonen, T P; Konu, A I; Seedhouse, D


    eHealth, the use of information technology to improve or enable health and health care, has recently been high on the health care development agenda. Given the vivid interest in eHealth, little reference has been made to the use of these technologies in the promotion of health. The aim of this present study was to conduct a review on recent uses of information technology in health promotion through looking at research articles published in peer-reviewed journals. Fifteen relevant journals with issues published between 2003 and June 2005 yielded altogether 1352 articles, 56 of which contained content related to the use of information technology in the context of health promotion. As reflected by this rather small proportion, research on the role of information technology is only starting to emerge. Four broad thematic application areas within health promotion were identified: use of information technology as an intervention medium, use of information technology as a research focus, use of information technology as a research instrument and use of information technology for professional development. In line with this rather instrumental focus, the concepts 'ePromotion of Health' or 'Health ePromotion' would come close to describing the role of information technology in health promotion.

  18. Promoting mental health as an essential aspect of health promotion. (United States)

    Sturgeon, Shona


    This paper advocates that mental health promotion receive appropriate attention within health promotion. It is of great concern that, in practice, mental health promotion is frequently overlooked in health promotion programmes although the WHO definitions of health and the Ottawa Charter describe mental health as an integral part of health. It is suggested that more attention be given to addressing the determinants of mental health in terms of protective and risk factors for both physical and mental conditions, particularly in developing countries. Examples of evidence-based mental health programmes operating in widely diverse settings are presented to demonstrate that well designed interventions can contribute to the well-being of populations. It is advocated that particular attention be given to the intersectorial cooperation needed for this work.

  19. Analysis of the promoters involved in enterocin AS-48 expression. (United States)

    Cebrián, Rubén; Rodríguez-Ruano, Sonia; Martínez-Bueno, Manuel; Valdivia, Eva; Maqueda, Mercedes; Montalbán-López, Manuel


    The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene) and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2) and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2) promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2) promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

  20. Analysis of the promoters involved in enterocin AS-48 expression.

    Directory of Open Access Journals (Sweden)

    Rubén Cebrián

    Full Text Available The enterocin AS-48 is the best characterized antibacterial circular protein in prokaryotes. It is a hydrophobic and cationic bacteriocin, which is ribosomally synthesized by enterococcal cells and post-translationally cyclized by a head-to-tail peptide bond. The production of and immunity towards AS-48 depend upon the coordinated expression of ten genes organized in two operons, as-48ABC (where genes encoding enzymes with processing, secretion, and immunity functions are adjacent to the structural as-48A gene and as-48C1DD1EFGH. The current study describes the identification of the promoters involved in AS-48 expression. Seven putative promoters have been here amplified, and separately inserted into the promoter-probe vector pTLR1, to create transcriptional fusions with the mCherry gene used as a reporter. The activity of these promoter regions was assessed measuring the expression of the fluorescent mCherry protein using the constitutive pneumococcal promoter PX as a reference. Our results revealed that only three promoters PA, P2(2 and PD1 were recognized in Enterococcus faecalis, Lactococcus lactis and Escherichia coli, in the conditions tested. The maximal fluorescence was obtained with PX in all the strains, followed by the P2(2 promoter, which level of fluorescence was 2-fold compared to PA and 4-fold compared to PD1. Analysis of putative factors influencing the promoter activity in single and double transformants in E. faecalis JH2-2 demonstrated that, in general, a better expression was achieved in presence of pAM401-81. In addition, the P2(2 promoter could be regulated in a negative fashion by genes existing in the native pMB-2 plasmid other than those of the as-48 cluster, while the pH seems to affect differently the as-48 promoter expression.

  1. Health promotion: an ethical analysis. (United States)

    Carter, Stacy M


    Thinking and practising ethically requires reasoning systematically about the right thing to do. Health promotion ethics - a form of applied ethics - includes analysis of health promotion practice and how this can be ethically justified. Existing frameworks can assist in such evaluation. These acknowledge the moral value of delivering benefits. But benefits need to be weighed against burdens, harms or wrongs, and these should be minimised: they include invading privacy, breaking confidentiality, restraining liberty, undermining self-determination or people's own values, or perpetuating injustice. Thinking about the ethics of health promotion also means recognising health promotion as a normative ideal: a vision of the good society. This ideal society values health, sees citizens as active and includes them in decisions that affect them, and makes the state responsible for providing all of its citizens, no matter how advantaged or disadvantaged, with the conditions and resources they need to be healthy. Ethicists writing about health promotion have focused on this relationship between the citizen and the state. Comparing existing frameworks, theories and the expressed values of practitioners themselves, we can see common patterns. All oppose pursuing an instrumental, individualistic, health-at-all-costs vision of health promotion. And all defend the moral significance of just processes: those that engage with citizens in a transparent, inclusive and open way. In recent years, some Australian governments have sought to delegitimise health promotion, defining it as extraneous to the role of the state. Good evidence is not enough to counter this trend, because it is founded in competing visions of a good society. For this reason, the most pressing agenda for health promotion ethics is to engage with communities, in a procedurally just way, about the role and responsibilities of the citizen and the state in promoting and maintaining good health.

  2. Evolution of the leukotoxin promoter in genus Mannheimia

    DEFF Research Database (Denmark)

    Larsen, Jesper; Pedersen, Anders Gorm; Davies, Robert L


    of the leukotoxin promoter among representatives of the five species within genus Mannheimia. We also consider how the evolution of the leukotoxin operon fits with the evolution and maintenance of virulence. Results: The alignment of the intergenic regions upstream of the leukotoxin genes showed significant...

  3. Nucleosome structure of the yeast CHA1 promoter

    DEFF Research Database (Denmark)

    Moreira, José Manuel Alfonso; Holmberg, S


    conditions. Five yeast TBP mutants defective in different steps in activated transcription abolished CHA1 expression, but failed to affect induction-dependent chromatin rearrangement of the promoter region. Progressive truncations of the RNA polymerase II C-terminal domain caused a progressive reduction...

  4. Modeling promoter grammars with evolving hidden Markov models

    DEFF Research Database (Denmark)

    Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben


    MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...

  5. A Declining Region: Provincial Renaissance Revisited (Case of Volgograd Region

    Directory of Open Access Journals (Sweden)

    Drozdova Yuliya


    context the author suggests changing the trajectory of development, building a positive image of the Volgograd region, enhancing the investment attractiveness of the region, improving the quality of life, building on the advantageous geographic and historical situation (the region’s past, natural and climatic conditions, natural resources, economic and geographic situation, agrarian conditions, prestigious universities, building trust in the authorities due to the efforts on the part of regional and municipal administration and improving the reputation of public servants, which would promote the strategy of adjusting inter-regional inequality and a renaissance of a provincial region.

  6. Photovoltaic module with adhesion promoter (United States)

    Xavier, Grace


    Photovoltaic modules with adhesion promoters and methods for fabricating photovoltaic modules with adhesion promoters are described. A photovoltaic module includes a solar cell including a first surface and a second surface, the second surface including a plurality of interspaced back-side contacts. A first glass layer is coupled to the first surface by a first encapsulating layer. A second glass layer is coupled to the second surface by a second encapsulating layer. At least a portion of the second encapsulating layer is bonded directly to the plurality of interspaced back-side contacts by an adhesion promoter.

  7. Stress Managment and Health Promotion

    Directory of Open Access Journals (Sweden)

    Asghar Dadkhah


    Full Text Available Health promotion approach is utilized to address the prevention, management and early intervention for stress management and also to promote positive mental and psychological health. Stress affects everyone and must be managed effectively to reduce its chronic and deleterious effects this study consists of two sections: in first section the principals of health promotion in different human existence levels, prevention of disease related to stress, the effect of stress on human well-being, and stress management were discussed. In second section the role of rehabilitation specialists (Medical technologist, nurses, occupational therapists, physiotherapists, respiratory therapists, and social workers in stress management were counted.

  8. HOX Gene Promoter Prediction and Inter-genomic Comparison: An Evo-Devo Study

    Directory of Open Access Journals (Sweden)

    Marla A. Endriga


    Full Text Available Homeobox genes direct the anterior-posterior axis of the body plan in eukaryotic organisms. Promoter regions upstream of the Hox genes jumpstart the transcription process. CpG islands found within the promoter regions can cause silencing of these promoters. The locations of the promoter regions and the CpG islands of Homeo sapiens sapiens (human, Pan troglodytes (chimpanzee, Mus musculus (mouse, and Rattus norvegicus (brown rat are compared and related to the possible influence on the specification of the mammalian body plan. The sequence of each gene in Hox clusters A-D of the mammals considered were retrieved from Ensembl and locations of promoter regions and CpG islands predicted using Exon Finder. The predicted promoter sequences were confirmed via BLAST and verified against the Eukaryotic Promoter Database. The significance of the locations was determined using the Kruskal-Wallis test. Among the four clusters, only promoter locations in cluster B showed significant difference. HOX B genes have been linked with the control of genes that direct the development of axial morphology, particularly of the vertebral column bones. The magnitude of variation among the body plans of closely-related species can thus be partially attributed to the promoter kind, location and number, and gene inactivation via CpG methylation.

  9. Regional insertion: an emergent approach

    International Nuclear Information System (INIS)

    Serra, M.T.F.; Nascimento Teixeira, P. do


    The Brazilian Electrical Sector incorporates new variables that expressing the extensive spectrum of environmental impacts in the take of decisions, referring to the viability of realizing a electrical undertaking, attends the several restrictions that are important by the sector and by the society in the environment area and promotes the adequate generation of liquid benefits, consequential of the electrical undertaking. Due to these factors, the Electrical Sector is improving the concept of regional insertion, with the sectorial expansion in long-dated and the created demand in the environmental and social area, focalizing the solution for these questions. (C.G.C.). 1 fig, 2 tabs

  10. Obesity and Regional Immigrant Density. (United States)

    Emerson, Scott D; Carbert, Nicole S


    Canada has an increasingly large immigrant population. Areas of higher immigrant density, may relate to immigrants' health through reduced acculturation to Western foods, greater access to cultural foods, and/or promotion of salubrious values/practices. It is unclear, however, whether an association exists between Canada-wide regional immigrant density and obesity among immigrants. Thus, we examined whether regional immigrant density was related to obesity, among immigrants. Adult immigrant respondents (n = 15,595) to a national population-level health survey were merged with region-level immigrant density data. Multi-level logistic regression was used to model the odds of obesity associated with increased immigrant density. The prevalence of obesity among the analytic sample was 16%. Increasing regional immigrant density was associated with lower odds of obesity among minority immigrants and long-term white immigrants. Immigrant density at the region-level in Canada may be an important contextual factor to consider when examining obesity among immigrants.

  11. 7 CFR 1209.18 - Region. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Region. 1209.18 Section 1209.18 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

  12. Does Labor Diversity Promote Entrepreneurship?

    DEFF Research Database (Denmark)

    Marino, Marianna; Parrotta, Pierpaolo; Pozzoli, Dario

    We find evidence that workforce educational diversity promotes entrepreneurial behavior of employees as well as the formation of new firms, whereas diversity in demographics hinders transitions to selfemployment. Ethnic diversity favors entrepreneurship in financial and business services....

  13. Local wisdom and health promotion

    DEFF Research Database (Denmark)

    Demaio, Alessandro Rhyll


    The respectful, appropriate use of local wisdom (LW) in health promotion increases penetration and longevity of positive behavior change. Collaborations based on mutual respect, flexibility and trust between health program organizers, traditional and local practitioners, and the communities being...... served are the goal for public health physicians in our modern, globalized world. This meta-analysis reviewed literature from the past 18 years drawn from a wide range of sources. This investigations proposes a grassroots, material shift toward regarding health promotion interventions as partnerships...... when planning, executing, and evaluating health promotion projects. This holistic approach would be based on the premise that LW is equal to expert opinion. This article endorses the integration of LW at every stage of the health promotion process concluding that it is through empowerment...

  14. Nutritional Recommendation Should Promote Sustainability. (United States)

    Reber, Robert J.


    Any process or event that disrupts the flow of nutrients and energy becomes a nutrition problem. Nutritionists should promote practices that protect the integrity, stability, and beauty of the land community (soil, water, air, all biological species). (Author)

  15. Social Promotion: Problem or Solution? (United States)

    Cunningham, William G.; Owens, Ray C.


    Social promotion is accomplishing what it was intended to do; it is relieving the various grades of over-age, floundering students. If we are to help these potential failures, we must devise new educational systems. (Editor)

  16. School health education and promotion

    DEFF Research Database (Denmark)

    Leahy, Deana; Simovska, Venka


    Purpose - This Special Issue is the second in a series that aims to place the spotlight on educational research and its contribution to the field of school-based health and wellbeing promotion. The purpose of both special issues is to bring together scholars from across the world to consider...... current developments in research on curricula, interventions, policies and practices concerning health education and promotion and related professional development of teachers. Design/methodology/approach – As in the first Special Issue published in 2017 (School health education and promotion: Health...... and wellbeing promotion. Additionally, an open call for papers was published on the Health Education website and on the EERA website. There was considerable interest from those such as researchers, scholars and practitioners, and as a result, we have been able to publish a second Special Issue. Findings...


    Directory of Open Access Journals (Sweden)

    Юрий Владимирович Тарасов


    Full Text Available Pharmaceutical products market is one of the most saturated consumers’ markets. Characteristic features of it are: high competition, fierce struggle for the customer, specific technologies of promotion. In conditions of globalization and increase in competition both in world pharmaceutical market and in the market of medicines and goods of medical purpose in Russia modern marketing techniques of promotion of the products to the end consumers are the key tools for strengthening market positions – both of producers of pharmaceutical goods and their suppliers, distributors, big whole-sale companies. Among main tools of promotion are: advertising, public relations, stimulation of sales on the market of medicines, personal sales, computer technologies. The article describes different technologies of promotion of medicines: indoor-advertising, hot lines, pharmaceutical exhibitions, packing. DOI:

  18. Viral Vector-Based Dissection of Marmoset GFAP Promoter in Mouse and Marmoset Brains.

    Directory of Open Access Journals (Sweden)

    Yoichiro Shinohara

    Full Text Available Adeno-associated virus (AAV vectors are small in diameter, diffuse easily in the brain, and represent a highly efficient means by which to transfer a transgene to the brain of a large animal. A major demerit of AAV vectors is their limited accommodation capacity for transgenes. Thus, a compact promoter is useful when delivering large transgenes via AAV vectors. In the present study, we aimed to identify the shortest astrocyte-specific GFAP promoter region that could be used for AAV-vector-mediated transgene expression in the marmoset brain. The 2.0-kb promoter region upstream of the GFAP gene was cloned from the marmoset genome, and short promoters (1.6 kb, 1.4 kb, 0.6 kb, 0.3 kb and 0.2 kb were obtained by progressively deleting the original 2.0-kb promoter from the 5' end. The short promoters were screened in the mouse cerebellum in terms of their strength and astrocyte specificity. We found that the 0.3-kb promoter maintained 40% of the strength of the original 2.0-kb promoter, and approximately 90% of its astrocyte specificity. These properties were superior to those of the 1.4-kb, 0.6-kb (20% promoter strength and 0.2-kb (70% astrocyte specificity promoters. Then, we verified whether the 0.3-kb GFAP promoter retained astrocyte specificity in the marmoset cerebral cortex. Injection of viral vectors carrying the 0.3-kb marmoset GFAP promoter specifically transduced astrocytes in both the cerebral cortex and cerebellar cortex of the marmoset. These results suggest that the compact 0.3-kb promoter region serves as an astrocyte-specific promoter in the marmoset brain, which permits us to express a large gene by AAV vectors that have a limited accommodation capacity.

  19. Promotional Chat on the Internet


    Dina Mayzlin


    Chat rooms, recommendation sites, and customer review sections allow consumers to overcome geographic boundaries and to communicate based on mutual interests. However, marketers also have incentives to supply promotional chat or reviews in order to influence the consumers' evaluation of their products. Moreover, firms can disguise their promotion as consumer recommendations due to the anonymity afforded by online communities. We explore this new setting where advertising and word of mouth bec...

  20. Healthy Cities in a global and regional context


    Lawrence, Roderick J.; Fudge, Colin


    Since the beginning of the WHO European Healthy Cities Network in 1987, the global and regional contexts for the promotion of health and well-being have changed in many ways. First, in 2000, the United Nations Millennium Goals explicitly and implicitly addressed health promotion and prevention at the global and regional levels. Second, the concern for sustainable development at the Rio Conference in 1992 was confirmed at the World Summit in Johannesburg in 2002. During the same period, in man...

  1. Social deprivation and exposure to health promotion. A study of the distribution of health promotion resources to schools in England

    Directory of Open Access Journals (Sweden)

    Reidpath Daniel D


    Full Text Available Abstract Background Area deprivation is a known determinant of health. It is also known that area deprivation is associated with lower impact health promotion. It is less well known, however, whether deprived areas are less responsive to health promotion, or whether they are less exposed. Using data from a national, school-based campaign to promote vaccination against the human papilloma virus (HPV, the relationship between area deprivation and exposure was examined. Methods Taking advantage of a health promotion campaign to provide information to schools about HPV vaccination, a cross sectional study was conducted to examine the relationship between area level, social deprivation, and take-up of (i.e., exposure to available health promotion material. The sample was 4,750 schools across England, including government maintained and independent schools. The relationship between area deprivation and exposure was examined using bi- and multivariate logistic regression. Results It was found that schools in the least deprived quintile had 1.32 times the odds of requesting health promotion materials than schools in the most deprived areas (p = .01. This effect was independent of the school size, the type of school, and the geographic region. Conclusion The relationship between area deprivation and the impact of health promotion may be due, at least in part, to differential levels of exposure. The study was limited in scope, pointing to the need for more research, but also points to potentially important policy implications.

  2. Social deprivation and exposure to health promotion. A study of the distribution of health promotion resources to schools in England. (United States)

    Chivu, Corina M; Reidpath, Daniel D


    Area deprivation is a known determinant of health. It is also known that area deprivation is associated with lower impact health promotion. It is less well known, however, whether deprived areas are less responsive to health promotion, or whether they are less exposed. Using data from a national, school-based campaign to promote vaccination against the human papilloma virus (HPV), the relationship between area deprivation and exposure was examined. Taking advantage of a health promotion campaign to provide information to schools about HPV vaccination, a cross sectional study was conducted to examine the relationship between area level, social deprivation, and take-up of (i.e., exposure to) available health promotion material. The sample was 4,750 schools across England, including government maintained and independent schools. The relationship between area deprivation and exposure was examined using bi- and multivariate logistic regression. It was found that schools in the least deprived quintile had 1.32 times the odds of requesting health promotion materials than schools in the most deprived areas (p = .01). This effect was independent of the school size, the type of school, and the geographic region. The relationship between area deprivation and the impact of health promotion may be due, at least in part, to differential levels of exposure. The study was limited in scope, pointing to the need for more research, but also points to potentially important policy implications.

  3. Promotion of development and introduction

    Energy Technology Data Exchange (ETDEWEB)



    In order to promote effectively and smoothly development and introduction of oil substituting energies, comprehensive investigations for improving the energy demand and supply structures and investigations on development infrastructures will be conducted. Investigations will also be given on promoting improvements in overseas coal import base infrastructures, and demand/supply improvement, development and utilization of overseas energies. Investigations and guidance will be given on forming visions to improve demand/supply structures and to introduce and promote technologies thereof. In order to deepen further the understanding and recognition by the nation on oil substituting energies, such publicity activities will be carried out as provision of information, and promotion on popularization and education of energy demand/supply improving systems. For the purpose of promoting international exchanges, information exchange will be promoted on improving the energy demand/supply structures, so is on international information exchange. International cooperative operations on coal utilization, international cooperation on alcohol utilization technologies, and assistance to holding the world energy conferences will be carried out, and an Asia-Pacific Coal Demand and Supply Seminar will be held. In addition, training operations for coal engineers will be performed.

  4. [Five paradoxes in health promotion]. (United States)

    López-Dicastillo, Olga; Canga-Armayor, Navidad; Mujika, Agurtzane; Pardavila-Belio, Miren Idoia; Belintxon, Maider; Serrano-Monzó, Inmaculada; Pumar-Méndez, María J

    The World Health Organization states that health promotion is a key strategy to improve health, and it is conceived as a global process of enabling people to increase control over, and to improve, their health. Health promotion does not focus solely on empowering individuals dealing with their knowledge, attitudes and skills, but it also takes political, social, economic and environmental aspects influencing health and wellbeing into account. The complexity of applying these concepts is reflected in the five paradoxes in health promotion; these arise in between the rhetoric in health promotion and implementation. The detected paradoxes which are described herein involve the patient versus the person, the individual versus the group, disease professionals versus health professionals, disease indicators versus health indicators, and health as an expense versus health as an investment. Making these contradictions explicit can help determine why it is so complex to put the concepts related to health promotion into practice. It can also help to put forward aspects that need further work if health promotion is to put into practice. Copyright © 2017 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Drug promotion practices: A review. (United States)

    Jacob, Nilan T


    Over the years, the pharmaceutical industry has been at the forefront of research and innovation in drug discovery and development. The process of drug discovery extending from preclinical studies to multicentric clinical trials and postmarketing phase is a costly affair running into billions of dollars. On the flip side, not all investigational molecules clear the trial phases and get approved, which puts pressure on the manufacturers to maximize the profit from approved drugs. It is in this key area that the practice of drug promotion plays its role. The World Health Organization defines drug promotion as "all informational and persuasive activities by manufacturers and distributors, the effect of which is to influence the prescription, supply, purchase or use of medicinal drugs". With its humble intent of creating awareness among healthcare professionals and updating their knowledge on recent advances in treatment options, drug promotion has been an important tool, but gradually it has evolved to embrace aggressive marketing strategies and sometimes unethical business and scientific practices where the need for profit-making eclipses commitment to patient care and scientific exploration. In this review, we discuss the evolution of drug promotion practices, the various types, its merits and demerits, the influence of drug promotion on physician prescribing behaviour, the role of regulatory bodies, unethical promotional practices and finally summarize with future directions. © 2018 The British Pharmacological Society.

  6. Regional alternative transportation evaluation report - Region 4 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 4, which is comprised of Alabama, Arkansas, Florida, Geor...

  7. Regional alternative transportation evaluation report - region 2 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...

  8. Regional alternative transportation evaluation report - region 5 (United States)


    The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 3, which is comprised of Illinois, Indiana, Iowa, Michiga...

  9. 7 CFR 1150.114 - Promotion. (United States)


    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.114 Promotion. Promotion means actions such as paid advertising, sales... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion. 1150.114 Section 1150.114 Agriculture...

  10. 7 CFR 1210.312 - Promotion. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1210.312 Section 1210.312 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE WATERMELON RESEARCH AND PROMOTION PLAN Watermelon Research and Promotion Plan Definitions § 1210.312 Promotion. Promotion means any...

  11. 7 CFR 1216.23 - Promotion. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1216.23 Section 1216.23 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PEANUT PROMOTION, RESEARCH, AND INFORMATION ORDER Peanut Promotion, Research, and Information Order Definitions § 1216.23 Promotion. Promotion...

  12. 77 FR 56552 - Holiday Mobile Shopping Promotion (United States)


    ... POSTAL SERVICE 39 CFR Part 111 Holiday Mobile Shopping Promotion AGENCY: Postal Service \\TM... Postal Service, Domestic Mail Manual (DMM[supreg]) 709.3 to add a new temporary promotion during November... Promotion (``Promotion''), which will take place between November 7, 2012 and November 21, 2012 (``promotion...

  13. 7 CFR 1250.310 - Promotion. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1250.310 Section 1250.310 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE EGG RESEARCH AND PROMOTION Egg Research and Promotion Order Definitions § 1250.310 Promotion. Promotion means any action, including paid...

  14. 7 CFR 1260.122 - Promotion. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1260.122 Section 1260.122 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Definitions § 1260.122 Promotion. Promotion means any action, including paid...

  15. 29 CFR 541.503 - Promotion work. (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false Promotion work. 541.503 Section 541.503 Labor Regulations... Outside Sales Employees § 541.503 Promotion work. (a) Promotion work is one type of activity often.... Promotion activities directed toward consummation of the employee's own sales are exempt. Promotional...

  16. Fiscal 1995 coal production/utilization technology promotion subsidy/clean coal technology promotion business/regional model survey. Study report on `Environmental load reduction measures: feasibility study of a coal utilization eco/energy supply system` (interim report); 1995 nendo sekitan seisan riyo gijutsu shinkohi hojokin clean coal technology suishin jigyo chiiki model chosa. `Kankyo fuka teigen taisaku: sekitan riyo eko energy kyokyu system no kanosei chosa` chosa hokokusho (chukan hokoku)

    Energy Technology Data Exchange (ETDEWEB)



    The coal utilization is expected to make substantial growth according to the long-term energy supply/demand plan. To further expand the future coal utilization, however, it is indispensable to reduce environmental loads in its total use with other energies, based on the coal use. In this survey, a regional model survey was conducted as environmental load reduction measures using highly cleaned coal which were taken in fiscal 1993 and 1994. Concretely, a model system was assumed which combined facilities for mixed combustion with coal and other energy (hull, bagasse, waste, etc.) and facilities for effective use of burned ash, and potential reduction in environmental loads of the model system was studied. The technology of mixed combustion between coal and other energy is still in a developmental stage with no novelties in the country. Therefore, the mixed combustion technology between coal and other energy is an important field which is very useful for the future energy supply/demand and environmental issues. 34 refs., 27 figs., 48 tabs.

  17. Fiscal 1996 coal production/utilization technology promotion subsidy/clean coal technology promotion business/regional model survey. Study report on `Environmental load reduction measures: feasibility study of a coal utilization eco/energy supply system`; 1996 nendo sekitan seisan riyo gijutsu shinkohi hojokin clean coal technology suishin jigyo chiiki model chosa. `Kankyo fuka teigen taisaku sekitan riyo eko energy kyokyu system no kanosei chosa` chosa hokokusho

    Energy Technology Data Exchange (ETDEWEB)



    Oil demand is expected to substantially grow in the future, and the use of oil with combustibles such as hull, baggase and waste is considered from an effective use of energy. A regional model survey was conducted as measures to reduce environmental loads where the fuel mixing combustion with coal and other energy is made the core. The domestic production amount of hull is 2.4-3.0 tons/year, which have a heating value of 3,500 kcal/kg. If hull can be formed into the one storable for a the long term (the one mixed with low grade coal, etc.), it can be a fuel for stable supply. Bagasse is produced 100 million tons/year, which have a heating value of 2,500 kcal/kg. Among wastes, waste tire, plastics, waste, sludge, etc. have a lot of problems in terms of price and environment, but each of them has a heating value during 3,000-10,000 kcal/kg. As to the coal combustion, the pollutional regulation on it is strict, and much higher processing technology is needed. The technology of coal fuel mixing combustion with other energy has not risen higher than the developmental level. Though the technology is a little bit higher in price than the coal fuel single combustion, it is viable. 38 refs., 32 figs., 65 tabs.

  18. Internal and external dynamics of regional cooperation in Central Asia

    Directory of Open Access Journals (Sweden)

    Mirzokhid Rakhimov


    Challenges of the 21-century require a broader partnership and cooperation. Future prospects of multilateral regional and international cooperation in Central Asia will depend on correlations of national, regional and global interests. It is necessary first of all strong dialogs between Central Asian republics itself. Central Asian geopolitical, economic and security challenges are connected and solution could come jointly. Future regional cooperation, strong international partnership would promote more stability, economic reforms and democratization to region and beyond.

  19. Una alternative estratégica en el desarrollo regional


    Molina , Rubén; Vázquez, Glafira


    Faced to the globalization process, regional development in Mexico shall address new challenges, particularly when referring to the competitiveness of the regions and social survival. Given that in this a country a high percentage of companies are small and medium sized, it is essential to promote their installation in different regions of this country. With the creation of new companies, economic, social,environmental, and territorial development is acquired in many regions. In this sense, t...

  20. Intrinsically bent DNA in replication origins and gene promoters. (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A


    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  1. Regulation of ALF promoter activity in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dan Li

    Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

  2. Why has the health promoting prison concept failed to translate to the US?


    Woodall, JR


    Two decades since the World Health Organization Regional Office for Europe published a report on health promotion in prison that stimulated further debate on the concept of the “health-promoting prison,” this article discusses the extent to which the concept has translated to the United States. One predicted indicator of success for the health-promoting prison movement was the expansion of activity beyond European borders; yet 2 decades since the European model was put forward, there has been...

  3. Epigenetic Methylation of Parathyroid CaR and VDR Promoters in Experimental Secondary Hyperparathyroidism

    DEFF Research Database (Denmark)

    Hofman-Bang, Jacob; Gravesen, Eva; Olgaard, Klaus


    R in parathyroid cultures decreases rapidly. Methylation of promoter regions is often detected during epigenetic downregulation of gene expression. Therefore, using an experimental rat model, we examined changes in methylation levels of parathyroid CaR and VDR promoters in vivo and in vitro. Methods. Uremia...... of parathyroid CaR and VDR genes were found. Thus, epigenetic methylation of these promoters does not explain decreased parathyroid expression of CaR and VDR genes in uremic s-HPT....

  4. Una red para promover sistemas de salud basados en la atención primaria de salud en la Región de las Américas A network to promote health systems based on primary health care in the Region of the Americas

    Directory of Open Access Journals (Sweden)

    María Magdalena Herrera Vázquez


    ón identificados pueden favorecer la cooperación internacional en el desarrollo de sistemas de salud basados en la APS, una vez que la OPS formule estrategias de implementación claras y tome el liderazgo para movilizar recursos financieros y generar vínculos de acción informal e interpersonal.OBJECTIVES: To identify the relational components of an international network of organizations that provide technical and financial assistance to promote the development of health systems based on primary health care in the countries of the Region of the Americas; to analyze the linkages that would allow the collaborating partners of the Pan American Health Organization (PAHO to work together on health issues; and to determine the basic theoretical elements that can help to develop action strategies that support advocacy efforts by a network. METHODS: This was a qualitative and quantitative cross-sectional study based on identifying key informants and on analyzing social networks. Ethnographic and relational information from 46 international organizations was collected through a self-administered semistructured questionnaire. From 46 international health cooperation organizations, 29 decisionmakers from 29 organizations participated (63.0% response rate. The structure and the strength of the network was evaluated in terms of density, closeness, clustering, and centralization. The statistical analysis was done using computer programs that included UCINET, Pajek, and Microsoft Access. RESULTS: We found a structurally centralized theoretical network, whose nodes were clustered into four central subgroups linked by a shared vision. The leadership, influence, and political interests reflected the formal and technical-cooperation linkages, the formal support for health systems based on primary health care, and the flow of resources being more often technical ones than financial ones. CONCLUSIONS: The interorganizational relational components and the social-action ties that were identified could

  5. Functional dissection of a napin gene promoter: identification of promoter elements required for embryo and endosperm-specific transcription. (United States)

    Ellerström, M; Stålberg, K; Ezcurra, I; Rask, L


    The promoter region (-309 to +44) of the Brassica napus storage protein gene napA was studied in transgenic tobacco by successive 5' as well as internal deletions fused to the reporter gene GUS (beta-glucuronidase). The expression in the two main tissues of the seed, the endosperm and the embryo, was shown to be differentially regulated. This tissue-specific regulation within the seed was found to affect the developmental expression during seed development. The region between -309 to -152, which has a large effect on quantitative expression, was shown to harbour four elements regulating embryo and one regulating endosperm expression. This region also displayed enhancer activity. Deletion of eight bp from position -152 to position -144 totally abolished the activity of the napA promoter. This deletion disrupted a cis element with similarity to an ABA-responsive element (ABRE) overlapping with an E-box, demonstrating its crucial importance for quantitative expression. An internal deletion of the region -133 to -120, resulted in increased activity in both leaves and endosperm and a decreased activity in the embryo. Within this region, a cis element similar to the (CA)n element, found in other storage protein promoters, was identified. This suggest that the (CA)n element is important for conferring seed specificity by serving both as an activator and a repressor element.

  6. Sport promotion in USA and Europe

    Directory of Open Access Journals (Sweden)

    Ognjenov Gajina


    Full Text Available Promotion as most viewable marketing activity is in sports for years. Many companies invest lots of funds for promotion of sport. Investing funds in sports they can promote their companies. This is called sponsorship.

  7. Expression analysis of four flower-specific promoters of Brassica spp ...

    African Journals Online (AJOL)



    Oct 19, 2009 ... power of the promoter. Besides, several enhancer and suppressor regions were also identified in the ... of the target gene and decrement of the burden of plant growth and ..... Meyerowitz's ABC model of flower development.

  8. Recognition of prokaryotic and eukaryotic promoters using convolutional deep learning neural networks

    KAUST Repository

    Umarov, Ramzan; Solovyev, Victor


    Accurate computational identification of promoters remains a challenge as these key DNA regulatory regions have variable structures composed of functional motifs that provide gene-specific initiation of transcription. In this paper we utilize

  9. Regional Aspects of New Industrialization

    Directory of Open Access Journals (Sweden)

    Yakov Petrovich Silin


    new statistical information to the knowledge of regional economy because, since 2000, the regional statistics in the country have been operated to the data on federal districts, but not on large economic districts. We have allocated and considered several strategic directions of the structural transformations promoting the activation of the processes of the formation of new industrialization in the space of studied macro-region. The results of the research can serve as a reference point for the strategies of regional development

  10. Shifting Values: The Promotional Policies of Craft and Industrial Design in Flanders (1980-2001)

    NARCIS (Netherlands)

    Gimeno Martinez, J.C.


    This article looks at the shifts in cultural promotion of craft as a result of a particular political conjuncture in the region of Flanders (Belgium). In 1991, as a consequence of Belgian federalization, the promotion policies for craft in Flanders passed from being answerable to the Belgian state

  11. Identification of a novel temperature sensitive promoter in cho cells

    Directory of Open Access Journals (Sweden)

    Hesse Friedemann


    Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

  12. Effective Feature Selection for Classification of Promoter Sequences.

    Directory of Open Access Journals (Sweden)

    Kouser K

    Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

  13. Regional indexes for France. Methodology

    International Nuclear Information System (INIS)


    According to the U.S. Department of Energy, an estimated 25% of the GNP is affected by weather-related events. The variations in temperature - even small ones - can also have long-lasting effects on the operational results of a company. Among other, the Energy supply sector is sensitive to weather risks: a milder or harsher than usual winter leads to a decrease or increase of energy consumption. The price of electricity on power trading facilities like Powernext is especially sensitive to odd changes in temperatures. Powernext and Meteo-France (the French meteorological agency) have joined expertise in order to promote the use of weather indices in term of decision making or underlying of hedging tools to energy actors, end users from any other sector of activity and specialists of the weather risk hedging. The Powernext Weather indices are made from information collected by Meteo-France's main observation network according to the norms of international meteorology, in areas carefully selected. The gross data are submitted to a thorough review allowing the correction of abnormalities and the reconstitution of missing data. Each index is fashioned to take into account the economic activity in the various regions of the country as represented by each region's population. This demographic information represents a fair approximation of the weight of the regional economic activity. This document presents the calculation methodology of regional weather indexes for France. Each regional index covers an homogenous area in terms of temperature represented by the biggest city. Five reference cities are used to represent the 22 economical regions of France (Paris Orly, Lyon, Marignane, Bordeaux and Strasbourg). (J.S.)

  14. Introduction to Global Health Promotion. (United States)

    Torres, Jennifer


    Global health education is becoming increasingly prominent in universities throughout the country especially in programs focused on health and behavioral sciences, law, economics, and political science. Introduction to Global Health Promotion is a book that can be used by both instructors and students in the field of global health. The book provides theories and models, human rights, and technology relevant to the field. In addition the book is designed to share best evidence for promoting health and reducing morbidity and mortality in a variety of areas. The book can be used by health educators, public health practitioners, professors, and students as a resource for research and practice in the field of health promotion and disease prevention.


    DEFF Research Database (Denmark)

    Gish, Liv


    In new product development a central activity is to provide new ideas. Over the last decades experiences with stimulating employee creativity and establishing idea promoting initiatives have been made in industrial practice. Such initiatives are often labeled Idea Management – a research field...... with a growing interest. In this paper I examine three different idea promoting initiatives carried out in Grundfos, a leading pump manufacturer. In the analysis I address what understandings of idea work are inscribed in the initiatives and what role these initiatives play in the organization with respect...... understandings of idea work are inscribed in the idea promoting initiatives as they to some degree have to fit with the understandings embedded in practice in order to work....

  16. AAHD's Health Promotion and Wellness, Part 2: Health Promotion Programs (United States)

    Exceptional Parent, 2011


    This article is part 2 of a 4-part series on "Health Promotion and Wellness" from the American Association on Health and Disability (AAHD). According to the U.S. Census Bureau, more than 54 million people--one in five Americans--have a disability, and these Americans are more likely to report: (1) Being in poorer overall health; (2) Having less…

  17. Regional Convergence and Sustainable Development in China

    Directory of Open Access Journals (Sweden)

    Fang Yang


    Full Text Available Based on the convergence theory of economic growth, this paper extends this concept to the human development index and carries out an empirical analysis of regional development in China between 1997 and 2006. Our research shows that the conditional convergence has been identified. Investment in fixed assets, government expenditure on education, health and infrastructure construction have positive effects on regional convergence of social development. Population weighted analysis of human development index provides support for weak convergence amongst provinces. Analysis of dynamics of regional distribution reveals the club convergence, which indicate two different convergence states. Central China is in the shade and lags behind, giving rise to the so-called “central downfall”. To solve this problem, the “Rise of Central China” Plan is necessary to promote the connection between coastal and inland regions of China and reduce the regional development gap.

  18. Central Region Regionally Ecological Significant Areas (United States)

    Minnesota Department of Natural Resources — This is an analysis of regionally significant Terrestrial and Wetland Ecological Areas in the seven county metropolitan area. Individual forest, grassland and...

  19. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis. (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S


    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  20. Promoter-wide hypermethylation of the ribosomal RNA gene promoter in the suicide brain.

    Directory of Open Access Journals (Sweden)

    Patrick O McGowan

    Full Text Available BACKGROUND: Alterations in gene expression in the suicide brain have been reported and for several genes DNA methylation as an epigenetic regulator is thought to play a role. rRNA genes, that encode ribosomal RNA, are the backbone of the protein synthesis machinery and levels of rRNA gene promoter methylation determine rRNA transcription. METHODOLOGY/PRINCIPAL FINDINGS: We test here by sodium bisulfite mapping of the rRNA promoter and quantitative real-time PCR of rRNA expression the hypothesis that epigenetic differences in critical loci in the brain are involved in the pathophysiology of suicide. Suicide subjects in this study were selected for a history of early childhood neglect/abuse, which is associated with decreased hippocampal volume and cognitive impairments. rRNA was significantly hypermethylated throughout the promoter and 5' regulatory region in the brain of suicide subjects, consistent with reduced rRNA expression in the hippocampus. This difference in rRNA methylation was not evident in the cerebellum and occurred in the absence of genome-wide changes in methylation, as assessed by nearest neighbor. CONCLUSIONS/SIGNIFICANCE: This is the first study to show aberrant regulation of the protein synthesis machinery in the suicide brain. The data implicate the epigenetic modulation of rRNA in the pathophysiology of suicide.