MiR-27a Promotes Hemin-Induced Erythroid Differentiation of K562 Cells by Targeting CDC25B
Directory of Open Access Journals (Sweden)
Dongsheng Wang
2018-03-01
Full Text Available Background/Aims: MicroRNAs (miRNAs play a crucial role in erythropoiesis. MiR-23a∼27a∼24-2 clusters have been proven to take part in erythropoiesis via some proteins. CDC25B (cell division control Cdc2 phosphostase B is also the target of mir-27a; whether it regulates erythropoiesis and its mechanism are unknown. Methods: To evaluate the potential role of miR-27a during erythroid differentiation, we performed miR-27a gain- and loss-of-function experiments on hemin-induced K562 cells. We detected miR-27a expression after hemin stimulation at different time points. At the same time, the γ-globin gene also was measured via real-time PCR. According to the results of the chips, we screened the target protein of miR-27a through a dual-luciferase reporter assay and identified it via Western blot analyses. To evaluate the function of CDC25B, benzidine staining and flow cytometry were employed to detect the cell differentiation and cell cycle. Results: We found that miR-27a promotes hemin-induced erythroid differentiation of human K562 cells by targeting cell division cycle 25 B (CDC25B. Overexpression of miR-27a promotes the differentiation of hemin-induced K562 cells, as demonstrated by γ-globin overexpression. The inhibition of miR-27a expression suppresses erythroid differentiation, thus leading to a reduction in the γ-globin gene. CDC25B was identified as a new target of miR-27a during erythroid differentiation. Overexpression of miR-27a led to decreased CDC25B expression after hemin treatment, and CDC25B was up-regulated when miR-27a expression was inhibited. Moreover, the inhibition of CDC25B affected erythroid differentiation, as assessed by γ-globin expression. Conclusion: This study is the first report of the interaction between miR-27a and CDC25B, and it improves the understanding of miRNA functions during erythroid differentiation.
Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu
2012-08-01
Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type-specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34(+) haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl(2) induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. © 2011 The Authors Journal of Cellular and Molecular Medicine © 2011 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Uchida, Naoya; Demirci, Selami; Haro-Mora, Juan J; Fujita, Atsushi; Raines, Lydia N; Hsieh, Matthew M; Tisdale, John F
2018-06-15
In vitro erythroid differentiation from primary human cells is valuable to develop genetic strategies for hemoglobin disorders. However, current erythroid differentiation methods are encumbered by modest transduction rates and high baseline fetal hemoglobin production. In this study, we sought to improve both genetic modification and hemoglobin production among human erythroid cells in vitro . To model therapeutic strategies, we transduced human CD34 + cells and peripheral blood mononuclear cells (PBMCs) with lentiviral vectors and compared erythropoietin-based erythroid differentiation using fetal-bovine-serum-containing media and serum-free media. We observed more efficient transduction (85%-93%) in serum-free media than serum-containing media (20%-69%), whereas the addition of knockout serum replacement (KSR) was required for serum-free media to promote efficient erythroid differentiation (96%). High-level adult hemoglobin production detectable by electrophoresis was achieved using serum-free media similar to serum-containing media. Importantly, low fetal hemoglobin production was observed in the optimized serum-free media. Using KSR-containing, serum-free erythroid differentiation media, therapeutic adult hemoglobin production was detected at protein levels with β-globin lentiviral transduction in both CD34 + cells and PBMCs from sickle cell disease subjects. Our in vitro erythroid differentiation system provides a practical evaluation platform for adult hemoglobin production among human erythroid cells following genetic manipulation.
A hanging drop culture method to study terminal erythroid differentiation.
Gutiérrez, Laura; Lindeboom, Fokke; Ferreira, Rita; Drissen, Roy; Grosveld, Frank; Whyatt, David; Philipsen, Sjaak
2005-10-01
To design a culture method allowing the quantitative and qualitative analysis of terminal erythroid differentiation. Primary erythroid progenitors derived either from mouse tissues or from human umbilical cord blood were differentiated using hanging drop cultures and compared to methylcellulose cultures. Cultured cells were analyzed by FACS to assess differentiation. We describe a practical culture method by adapting the previously described hanging drop culture system to conditions allowing terminal differentiation of primary erythroid progenitors. Using minimal volumes of media and small numbers of cells, we obtained quantitative terminal erythroid differentiation within two days of culture in the case of murine cells and 4 days in the case of human cells. The established methods for ex vivo culture of primary erythroid progenitors, such as methylcellulose-based burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) assays, allow the detection of committed erythroid progenitors but are of limited value to study terminal erythroid differentiation. We show that the application of hanging drop cultures is a practical alternative that, in combination with clonogenic assays, enables a comprehensive assessment of the behavior of primary erythroid cells ex vivo in the context of genetic and drug-induced perturbations.
Dorn, Isabel; Klich, Katharina; Arauzo-Bravo, Marcos J; Radstaak, Martina; Santourlidis, Simeon; Ghanjati, Foued; Radke, Teja F; Psathaki, Olympia E; Hargus, Gunnar; Kramer, Jan; Einhaus, Martin; Kim, Jeong Beom; Kögler, Gesine; Wernet, Peter; Schöler, Hans R; Schlenke, Peter; Zaehres, Holm
2015-01-01
Epigenetic memory in induced pluripotent stem cells, which is related to the somatic cell type of origin of the stem cells, might lead to variations in the differentiation capacities of the pluripotent stem cells. In this context, induced pluripotent stem cells from human CD34(+) hematopoietic stem cells might be more suitable for hematopoietic differentiation than the commonly used fibroblast-derived induced pluripotent stem cells. To investigate the influence of an epigenetic memory on the ex vivo expansion of induced pluripotent stem cells into erythroid cells, we compared induced pluripotent stem cells from human neural stem cells and human cord blood-derived CD34(+) hematopoietic stem cells and evaluated their potential for differentiation into hematopoietic progenitor and mature red blood cells. Although genome-wide DNA methylation profiling at all promoter regions demonstrates that the epigenetic memory of induced pluripotent stem cells is influenced by the somatic cell type of origin of the stem cells, we found a similar hematopoietic induction potential and erythroid differentiation pattern of induced pluripotent stem cells of different somatic cell origin. All human induced pluripotent stem cell lines showed terminal maturation into normoblasts and enucleated reticulocytes, producing predominantly fetal hemoglobin. Differences were only observed in the growth rate of erythroid cells, which was slightly higher in the induced pluripotent stem cells derived from CD34(+) hematopoietic stem cells. More detailed methylation analysis of the hematopoietic and erythroid promoters identified similar CpG methylation levels in the induced pluripotent stem cell lines derived from CD34(+) cells and those derived from neural stem cells, which confirms their comparable erythroid differentiation potential. Copyright© Ferrata Storti Foundation.
Activated Fps/Fes tyrosine kinase regulates erythroid differentiation and survival.
Sangrar, Waheed; Gao, Yan; Bates, Barbara; Zirngibl, Ralph; Greer, Peter A
2004-10-01
A substantial body of evidence implicates the cytoplasmic protein tyrosine kinase Fps/Fes in regulation of myeloid differentiation and survival. In this study we wished to determine if Fps/Fes also plays a role in the regulation of erythropoiesis. Mice tissue-specifically expressing a "gain-of-function" mutant fps/fes transgene (fps(MF)) encoding an activated variant of Fps/Fes (MFps), were used to explore the in vivo biological role of Fps/Fes. Erythropoiesis in these mice was assessed by hematological analysis, lineage marker analysis, bone-marrow colony assays, and biochemical approaches. fps(MF) mice displayed reductions in peripheral red cell counts. However, there was an accumulation of immature erythroid precursors, which displayed increased survival. Fps/Fes and the related Fer kinase were both detected in early erythroid progenitors/blasts and in mature red cells. Fps/Fes was also activated in response to erythropoietin (EPO) and stem cell factor (SCF), two critical factors in erythroid development. In addition, increased Stat5A/B activation and reduced Erk1/2 phosphorylation was observed in fps(MF) primary erythroid cells in response to EPO or SCF, respectively. These data support a role for Fps/Fes in regulating the survival and differentiation of erythroid cells through modulation of Stat5A/B and Erk kinase pathways induced by EPO and SCF. The increased numbers and survival of erythroid progenitors from fps(MF) mice, and their differential responsiveness to SCF and EPO, implicates Fps/Fes in the commitment of multilineage progenitors to the erythroid lineage. The anemic phenotype in fps(MF) mice suggests that downregulation of Fps/Fes activity might be required for terminal erythroid differentiation.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Energy Technology Data Exchange (ETDEWEB)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.
International Nuclear Information System (INIS)
Suriguga,; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-01-01
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation
Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun
2013-12-15
Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.
International Nuclear Information System (INIS)
Watanabe, T.; Oishi, M.
1987-01-01
A previous report described an intracellular factor (differentiation-inducing factor I, or DIF-I) that seem to play a role in erythroid differentiation in mouse erythroleukemia (MEL) cells. The authors have detected another erythroid-inducing factor in cell-free extracts from dimethyl sulfoxide- or hexamethylenebis(acetamide)-treated MEL cells, which acts synergistically with DIF-I. The partially purified factor (termed DIF-II) triggered erythroid differentiation when introduced into undifferentiated MEL cells that had been potentiated by the induction of DIF-I. The activity in the extracts appeared in an inducible manner after addition of dimethyl sulfoxide or hexamethylenebis(acetamide), reached a maximum at 6 hr, and then rapidly decreased. The induction was inhibited by phorbol 12-myristate 13-acetate and also by cycloheximide. No induction was observed in a mutant MEL cell line defective in erythroid differentiation. These characteristics are consistent with the supposition that DIF-II is one of the putative dimethyl sulfoxide-inducible factors detected in previously reported cell-fusion and cytoplast-fusion experiments. The role of DIF-II in MEL-cell differentiation and in vitro differentiation in general is discussed
Selective toxicity of dihydroartemisinin on human CD34+ erythroid cell differentiation
International Nuclear Information System (INIS)
Finaurini, Sara; Ronzoni, Luisa; Colancecco, Alessandra; Cattaneo, Alessandra; Cappellini, Maria Domenica; Ward, Stephen A.; Taramelli, Donatella
2010-01-01
Artemisinins are safely used in the combination therapy for uncomplicated malaria, but their employment during pregnancy is still controversial. In fact, animal studies reported that the active metabolite, dihydroartemisinin (DHA), causes embryonic erythrocytes depletion, when the treatment is performed during a critical period of time. The present study investigates the effect of DHA on human developmental erythropoiesis in order to characterize the target erythroid stage and to predict the window of susceptibility in human pregnancy. As a model for human developmental erythropoiesis, peripheral blood purified, CD34+ cells were committed towards erythrocytes and DHA (0.5 or 2 μM) was added to different erythroid stages during 14 days culture. Erythroid differentiation was investigated by cytofluorimetric analysis of Glycophorin A expression, by morphological analysis and erythroid globin gene expression analysis with real-time PCR. It was found that the effect of DHA was dependent on the maturation stage of erythroid cells. In fact when DHA was added to the pro- and basophilic erythroblasts caused a significant dose-dependent inhibition of cell proliferation and a significant delay of erythroid differentiation, as measured by morphological analysis, expression of Glycophorin A by immunofluorescence and of erythroid globin genes by real-time PCR. In contrast, the inhibition of stem cells and of early progenitors was transient and masked by the subsequent exponential cell growth. No effect was observed on mature erythroid stages. This is the first demonstration that DHA affects human erythropoiesis in vitro, in a dose- and time-dependent manner; the target population seems to be the pro-erythroblast and basophilic erythroblast stage, suggesting that DHA toxicity is limited to primitive human erythropoiesis. These findings outline the relevance of DHA dosage and timing to prevent embryotoxicity and support current WHO recommendations of avoiding malaria treatment
Studies of globin gene expression in differentiating erythroid cells
International Nuclear Information System (INIS)
Sullivan, T.D.
1985-01-01
The author has addressed questions concerning globin gene expression and the loss of protein synthesis in the terminal stages of erythroid development. (1) The hypothesis that the rate of cell division affects the relative synthesis of γ and β globin in erythroid cells was investigated. The effect of hydroxyurea, aminopterin, or low culture temperature on the in vitro growth of erythroid progenitor cells and on the relative synthesis of γ and β globin was measured. No consistent change in γ globin synthesis was detected. (2) The hypothesis that the ratio of γ and β globin synthesis decreases during erythroid maturation because of differential mRNA stability was investigated. The half-lives of γ and β globin mRNAs and γ and β globin protein synthesis were measured in cultured reticulocytes. γ and β globin mRNAs were assayed by solution hybridization and by in vitro translation. Globin synthesis was determined by 3 H-leucine incorporation into the γ and β globin chains. γ and β globin mRNAs decay with similar half-lives in cultured reticulocytes. Therefore, the change in the ratio of γ and β globin synthesis during erythroid maturation cannot be explained by differences in mRNA stability and is likely to result from asynchronous transcription of the genes. These data suggest that protein synthesis in maturing reticulocytes is not limited by the quantity of mRNA but by the availability of translation factors. (3) The hypothesis was tested that the initiation factor GEF becomes limiting for protein synthesis during reticulocyte maturation
Directory of Open Access Journals (Sweden)
Deepti Jain
2015-06-01
Full Text Available During the maturation phase of mammalian erythroid differentiation, highly proliferative cells committed to the erythroid lineage undergo dramatic changes in morphology and function to produce circulating, enucleated erythrocytes. These changes are caused by equally dramatic alterations in gene expression, which in turn are driven by changes in the abundance and binding patterns of transcription factors such as GATA1. We have studied the dynamics of GATA1 binding by ChIP-seq and the global expression responses by RNA-seq in a GATA1-dependent mouse cell line model for erythroid maturation, in both cases examining seven progressive stages during differentiation. Analyses of these data should provide insights both into mechanisms of regulation (early versus late targets and the consequences in cell physiology (e.g., distinctive categories of genes regulated at progressive stages of differentiation. The data are deposited in the Gene Expression Omnibus, series GSE36029, GSE40522, GSE49847, and GSE51338.
Polyherbal EMSA ERITIN Promotes Erythroid Lineages and Lymphocyte Migration in Irradiated Mice
Directory of Open Access Journals (Sweden)
Ibrahim Mansur
2016-01-01
Full Text Available Radiotherapy is commonly used to kill malignant cells, but it can significantly deplete hematopoietic and splenic erythroblasts. Radioprotective agents are therefore very important in clinical radiotherapy. We examined the effect of poly-herbal EMSA ERITIN on immunological responses when administered to sublethally irradiated mice with the aim of highlighting promotes erythroid lineages and lymphocytes migration in irradiated mice with the parameter are TER119+CD123+in bone marrow and SDF-1 in bone marrow and spleen organ. Normal BALB/c mice were sublethally irradiated with 600 rad. EMSA ERITIN was administered orally at different doses:(1.04, 3.125 and 9.375 mg/g body weight for 15 days. On day 16 erythroid lineages (TER-119+CD123+ were observed in bone marrow and lymphocytes migration by the production of SDF-1 in spleen and bone marrow. Lymphocytes migration was indicated by the production of SDF-1 in spleen and bone marrow using flow cytometry analysis. EMSA ERITIN increased the generation of erythroid lineage cells marked by TER119+CD123+ and promoted lymphocyte migration by increasing SDF-1 production in bone marrow and spleen. EMSA ERITIN appears to be a powerful medicinal herb with potential as a food supplement to normalize homeostasis and erythropoiesis after radiation.
Directory of Open Access Journals (Sweden)
Shlomi Toobiak
Full Text Available Growing evidence supports the role of erythroblastic islands (EI as microenvironmental niches within bone marrow (BM, where cell-cell attachments are suggested as crucial for erythroid maturation. The inducible form of the enzyme heme oxygenase, HO-1, which conducts heme degradation, is absent in erythroblasts where hemoglobin (Hb is synthesized. Yet, the central macrophage, which retains high HO-1 activity, might be suitable to take over degradation of extra, harmful, Hb heme. Of these enzymatic products, only the hydrophobic gas molecule--CO can transfer from the macrophage to surrounding erythroblasts directly via their tightly attached membranes in the terminal differentiation stage.Based on the above, the study hypothesized CO to have a role in erythroid maturation. Thus, the effect of CO gas as a potential erythroid differentiation inducer on the common model for erythroid progenitors, K562 cells, was explored. Cells were kept under oxygen lacking environment to mimic BM conditions. Nitrogen anaerobic atmosphere (N₂A served as control for CO atmosphere (COA. Under both atmospheres cells proliferation ceased: in N₂A due to cell death, while in COA as a result of erythroid differentiation. Maturation was evaluated by increased glycophorin A expression and Hb concentration. Addition of 1%CO only to N₂A, was adequate for maintaining cell viability. Yet, the average Hb concentration was low as compared to COA. This was validated to be the outcome of diversified maturation stages of the progenitor's population.In fact, the above scenario mimics the in vivo EI conditions, where at any given moment only a minute portion of the progenitors proceeds into terminal differentiation. Hence, this model might provide a basis for further molecular investigations of the EI structure/function relationship.
Expression of assayable residual stem cell damage in erythroid differentiation
International Nuclear Information System (INIS)
Huebner, G.E.; Miller, M.E.; Cronkite, E.P.
1985-01-01
In rodents, residual damage is inducible in hematopoietic stem cells by exposure to ionizing radiation or alkylating agents. This damage can b e assayed in mice by transferring bone marrow into lethally irradiated syngeneic recipients and subsequently measuring the incremental increase of-( 125 I)iodo-2'-deoxyuridine incorporation in spleens. In this study, bone marrow from mice treated 3 weeks previously with Methylnitrosourea (50 mg/kg) or 450 rad was injected into recipients in order to determine possible residual effects of treatment of erythroid cell differentiation following stem cell seeding. Such effects were detected by a reduced amount of 59 Fe incorporation into spleens, thus indicatin g transfer of residual stem cell damage to differentiating cells. (orig.)
Hemozoin (malarial pigment directly promotes apoptosis of erythroid precursors.
Directory of Open Access Journals (Sweden)
Abigail A Lamikanra
2009-12-01
Full Text Available Severe malarial anemia is the most common syndrome of severe malaria in endemic areas. The pathophysiology of chronic malaria is characterised by a striking degree of abnormal development of erythroid precursors (dyserythropoiesis and an inadequate erythropoietic response in spite of elevated levels of erythropoietin. The cause of dyserythropoiesis is unclear although it has been suggested that bone-marrow macrophages release cytokines, chemokines or lipo-peroxides after exposure to hemozoin, a crystalloid form of undigested heme moieties from malarial infected erythrocytes, and so inhibit erythropoiesis. However, we have previously shown that hemozoin may directly inhibit erythroid development in vitro and the levels of hemozoin in plasma from patients with malarial anemia and hemozoin within the bone marrow was associated with reduced reticulocyte response. We hypothesized that macrophages may reduce, not enhance, the inhibitory effect of hemozoin on erythropoiesis. In an in vitro model of erythropoiesis, we now show that inhibition of erythroid cell development by hemozoin isolated from P. falciparum is characterised by delayed expression of the erythroid markers and increased apoptosis of progenitor cells. Crucially, macrophages appear to protect erythroid cells from hemozoin, consistent with a direct contribution of hemozoin to the depression of reticulocyte output from the bone marrow in children with malarial anemia. Moreover, hemozoin isolated from P. falciparum in vitro inhibits erythroid development independently of inflammatory mediators by inducing apoptotic pathways that not only involve activation of caspase 8 and cleavage of caspase 3 but also loss of mitochondrial potential. Taken together these data are consistent with a direct effect of hemozoin in inducing apoptosis in developing erythroid cells in malarial anemia. Accumulation of hemozoin in the bone marrow could therefore result in inadequate reticulocytosis in children that
Directory of Open Access Journals (Sweden)
Jian-Guo Ren
2010-09-01
Full Text Available Malic enzyme 2 (ME2 is a mitochondrial enzyme that catalyzes the conversion of malate to pyruvate and CO2 and uses NAD as a cofactor. Higher expression of this enzyme correlates with the degree of cell de-differentiation. We found that ME2 is expressed in K562 erythroleukemia cells, in which a number of agents have been found to induce differentiation either along the erythroid or the myeloid lineage. We found that knockdown of ME2 led to diminished proliferation of tumor cells and increased apoptosis in vitro. These findings were accompanied by differentiation of K562 cells along the erythroid lineage, as confirmed by staining for glycophorin A and hemoglobin production. ME2 knockdown also totally abolished growth of K562 cells in nude mice. Increased ROS levels, likely reflecting increased mitochondrial production, and a decreased NADPH/NADP+ ratio were noted but use of a free radical scavenger to decrease inhibition of ROS levels did not reverse the differentiation or apoptotic phenotype, suggesting that ROS production is not causally involved in the resultant phenotype. As might be expected, depletion of ME2 induced an increase in the NAD+/NADH ratio and ATP levels fell significantly. Inhibition of the malate-aspartate shuttle was insufficient to induce K562 differentiation. We also examined several intracellular signaling pathways and expression of transcription factors and intermediate filament proteins whose expression is known to be modulated during erythroid differentiation in K562 cells. We found that silencing of ME2 leads to phospho-ERK1/2 inhibition, phospho-AKT activation, increased GATA-1 expression and diminished vimentin expression. Metabolomic analysis, conducted to gain insight into intermediary metabolic pathways that ME2 knockdown might affect, showed that ME2 depletion resulted in high orotate levels, suggesting potential impairment of pyrimidine metabolism. Collectively our data point to ME2 as a potentially novel
Yamaguchi, Y; Kluge, N; Ostertag, W; Furusawa, M
1981-01-01
Cell cultures of 7,12-dimethylbenz[a]anthracene-induced rat erythroleukemia can be stimulated to synthesize hemoglobin when cultured in hypertonic media. During hypertonic treatment the intracellular osmotic conditions immediately readjust to those of the extracellular medium. None of the Friend virus-induced mouse erythroleukemia cell lines was inducible for differentiation with the same hypertonic culture conditions used for rat cells. Earliest commitment to erythroid terminal differentiati...
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells.
Directory of Open Access Journals (Sweden)
Gloria Bua
Full Text Available The pathogenic Parvovirus B19 (B19V is characterized by a strict adaptation to erythroid progenitor cells (EPCs, a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi and lower levels at day 18 (+1.5 Log from 2 to 48 hpi. B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18. Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6-15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage.
Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells
Bua, Gloria; Manaresi, Elisabetta; Bonvicini, Francesca; Gallinella, Giorgio
2016-01-01
The pathogenic Parvovirus B19 (B19V) is characterized by a strict adaptation to erythroid progenitor cells (EPCs), a heterogeneous population of differentiating cells with diverse phenotypic and functional properties. In our work, we studied the dynamics of B19V infection in EPCs in dependence on the cell differentiation stage, in terms of distribution of infected cells, synthesis of viral nucleic acids and production of infectious virus. EPCs at early differentiation stage led to an abortive infection, without viral genome replication and a very low transcriptional activity. EPCs at later stages were permissive, with highest levels of viral replicative activity at day 9 (+3.0 Log from 2 to 48 hpi) and lower levels at day 18 (+1.5 Log from 2 to 48 hpi). B19V DNA increment was in accordance with the percentage of cells positive to flow-FISH assay (41.4% at day 9, 1.1% at day 18). Quantitation of total RNA indicated a close association of genome replication and transcription with viral RNA accumulation within infected cells related to viral DNA increase during the course of infection. Analysis of the different classes of mRNAs revealed two distinct pattern of genome expression profile with a fine regulation in the frequency utilization of RNA processing signals: an early phase, when cleavage at the proximal site leading to a higher relative production of mRNA for NS protein, and a late phase, when cleavage at the distal site was more frequent leading to higher relative abundance of mRNA for VP and 11 kDA proteins. Infectious virus was released from cells at day 6–15, but not at day 18. Our results, providing a detailed description of B19V replication and expression profile in differentiating EPCs, highlight the very tight adaptation of B19V to a specific cellular target defined both by its erythroid lineage and its differentiation stage. PMID:26845771
Dihydroartemisinin inhibits the human erythroid cell differentiation by altering the cell cycle
International Nuclear Information System (INIS)
Finaurini, Sara; Basilico, Nicoletta; Corbett, Yolanda; D’Alessandro, Sarah; Parapini, Silvia; Olliaro, Piero; Haynes, Richard K.; Taramelli, Donatella
2012-01-01
Artemisinin derivatives such as dihydroartemisinin (DHA) induce significant depletion of early embryonic erythroblasts in animal models. We have reported previously that DHA specifically targets pro-erythroblasts and basophilic erythroblasts, when human CD34+ stem cells are differentiated toward the erythroid lineage, indicating that a window of susceptibility to artemisinins may exist also in human developmental erythropoiesis during pregnancy. To better investigate the toxicity of artemisinin derivatives, the structure–activity relationship was evaluated against the K562 leukaemia cell line, used as a model for differentiating early human erythroblasts. All artemisinins derivatives, except deoxyartemisinin, inhibited both spontaneous and induced erythroid differentiation, confirming that the peroxide bridge is responsible for the erythro-toxicity. On the contrary, cell growth was markedly reduced by DHA, artemisone and artesunate but not by artemisinin, 10-deoxoartemisinin or deoxy-artemisinin. The substituent at position C-10 is responsible only for the anti-proliferative effect, since 10-deoxoartemisinin did not reduce cell growth but arrested the differentiation of K562 cells. In particular, the results showed that DHA resulted the most potent and rapidly acting compound of the drug family, causing (i) the decreased expression of GpA surface receptors and the down regulation the γ-globin gene; (ii) the alteration of S phase of cell cycle and (iii) the induction of programmed cell death of early erythroblasts in a dose dependent manner within 24 h. In conclusion, these findings confirm that the active metabolite DHA is responsible for the erythro-toxicity of most of artemisinins used in therapy. Thus, as long as no further clinical data are available, current WHO recommendations of avoiding malaria treatment with artemisinins during the first trimester of pregnancy remain valid.
Vizirianakis, Ioannis S; Tezias, Sotirios S; Amanatiadou, Elsa P; Tsiftsoglou, Asterios S
2012-01-01
Repetitive sequences consist of >50% of mammalian genomic DNAs and among these SINEs (short interspersed nuclear elements), e.g. B1 elements, account for 8% of the mouse genome. In an effort to delineate the molecular mechanism(s) involved in the blockade of the in vitro differentiation program of MEL (murine erythroleukaemia) cells by treatment with methylation inhibitors, we detected a DNA region of 559 bp in chromosome 7 located downstream of the 3'-end of the β(major) globin gene (designated B1-559) with unique characteristics. We have fully characterized this B1-559 region that includes a B1 element, several repeats of ATG initiation codons and consensus DNA-binding sites for erythroid-specific transcription factors NF-E2 (nuclear factor-erythroid-derived 2), GATA-1 and EKLF (erythroid Krüppel-like factor). Fragments derived from B1-559 incubated with nuclear extracts form protein complexes in both undifferentiated and differentiated MEL cells. Transient reporter-gene experiments in MEL and human erythroleukaemia K-562 cells with recombinant constructs containing B1-559 fragments linked to HS-2 (hypersensitive site-2) sequences of human β-globin gene LCR (locus control region) indicated potential cooperation upon erythropoiesis and globin gene expression. The possible interaction between the B1-559 region and β(major) globin gene transcriptional activation upon execution of erythroid MEL cell differentiation programme is discussed. © The Author(s) Journal compilation © 2012 Portland Press Limited
Directory of Open Access Journals (Sweden)
Laurie A Steiner
Full Text Available CTCF and cohesinSA-1 are regulatory proteins involved in a number of critical cellular processes including transcription, maintenance of chromatin domain architecture, and insulator function. To assess changes in the CTCF and cohesinSA-1 interactomes during erythropoiesis, chromatin immunoprecipitation coupled with high throughput sequencing and mRNA transcriptome analyses via RNA-seq were performed in primary human hematopoietic stem and progenitor cells (HSPC and primary human erythroid cells from single donors.Sites of CTCF and cohesinSA-1 co-occupancy were enriched in gene promoters in HSPC and erythroid cells compared to single CTCF or cohesin sites. Cell type-specific CTCF sites in erythroid cells were linked to highly expressed genes, with the opposite pattern observed in HSPCs. Chromatin domains were identified by ChIP-seq with antibodies against trimethylated lysine 27 histone H3, a modification associated with repressive chromatin. Repressive chromatin domains increased in both number and size during hematopoiesis, with many more repressive domains in erythroid cells than HSPCs. CTCF and cohesinSA-1 marked the boundaries of these repressive chromatin domains in a cell-type specific manner.These genome wide data, changes in sites of protein occupancy, chromatin architecture, and related gene expression, support the hypothesis that CTCF and cohesinSA-1 have multiple roles in the regulation of gene expression during erythropoiesis including transcriptional regulation at gene promoters and maintenance of chromatin architecture. These data from primary human erythroid cells provide a resource for studies of normal and perturbed erythropoiesis.
Tomonaga, M; Jinnai, I; Tagawa, M; Amenomori, T; Nishino, K; Yao, E; Nonaka, H; Kuriyama, K; Yoshida, Y; Matsuo, T
1987-02-01
The bone marrow of a patient with acute undifferentiated leukemia developed unique colonies after a 14-day culture in erythropoietin (EPO)-containing methylcellulose. The colonies consisted of 20 to 200 nonhemoglobinized large blast cells. Cytogenetic analysis of single colonies revealed hypotetraploid karyotypes with several marker chromosomes that were identical to those found in directly sampled bone marrow. The concurrently formed erythroid bursts showed only normal karyotypes. No leukemic colony formation was observed in other culture systems with either colony-stimulating activity (CSA) or phytohemagglutinin-stimulated leukocyte-conditioned medium (PHA-LCM). The leukemic colonies exhibited a complete EPO-dose dependency similar to that of the patient's normal BFU-E. Although cytochemical and immunologic marker studies of the bone marrow cells failed to clarify the cell lineage of the leukemic cells with extraordinarily large cell size, ultrastructural study revealed erythroid differentiation such as siderosome formation in the cytoplasm and ferritin particles in the rhophecytosis invaginations. These findings indicate that the patient had poorly differentiated erythroid leukemia and that some of the clonogenic cells might respond to EPO in vitro. Corresponding to this biological feature, the leukemic cells were markedly decreased in number in response to repeated RBC transfusions, and partial remission was obtained. These observations suggest that erythroid leukemia distinct from erythroleukemia (M6) with a myeloblastic component, can develop as a minor entity of human acute leukemia.
Zheng, Qing-Qing; Zhao, You-Shan; Guo, Juan; Zhao, Si-da; Song, Lu-Xi; Fei, Cheng-Ming; Zhang, Zheng; Li, Xiao; Chang, Chun-Kang
2017-07-01
Erythroid apoptosis increases significantly in myelodysplastic syndrome (MDS) patients with iron overload, but the underlying mechanism is not fully clear. In this study, we aim to explore the effect of HIF-1a/ROS on erythroid apoptosis in MDS patients with iron overload. We found that iron overload injured cellular functions through up-regulating ROS levels in MDS/AML cells, including inhibited cell viability, increased cell apoptosis and blocked cell cycle at G0/G1 phase. Interestingly, overexpression of hypoxia inducible factor-1a (HIF-1a), which was under-expressed in iron overload models, reduced ROS levels and attenuated cell damage caused by iron overload in MDS/AML cells. And gene knockdown of HIF-1a got the similar results as iron overload in MDS/AML cells. Furthermore, iron overload caused high erythroid apoptosis was closely related with ROS in MDS patients. Importantly, the HIF-1a protein levels of erythrocytes elevated obviously after incubation with desferrioxamine (DFO) from MDS patients with iron overload, accompanied by ROS levels inhibited and erythroid apoptosis reduced. Taken together, our findings determine that the HIF-1a/ROS signaling pathway plays a key role in promoting erythroid apoptosis in MDS patients with iron overload. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Porter, P.N.; Ogawa, M.
1982-01-01
Bone marrow conditioned media (BMCM) increases burst number and the incorporation of 59 Fe into heme by bursts when peripheral blood or bone marrow cells are cultured at limiting serum concentrations. Burst-promoting activity (BPA) has now been purified approximately 300-fold from this source by ion-exchange chromatography on DEAE-Sephadex and absorption chromatography on hydroxyapatite agarose gel. Marrow BPA increased burst number and hemoglobin (Hb) synthesis in a dose-dependent manner. A larger increase in Hb synthesis than in burst number was consistently observed, which was probably a consequence of the increase in the number of cells per burst that occurs in the presence of BPA. The role of BPA in culture could be distinguished from erythropoietin (Ep), since no bursts grew in the absence of Ep, whether or not BPA was present, and since it had no effect on the growth of erythroid colonies scored at day 5 of culture. Our purified fraction did not support the growth of CFU-C in culture. Activity was stable at temperatures of 70 degrees C or lower for 10 min; exposure to 80 degrees C resulted in approximately 50% loss of activity. BPA was completely inactivated by treatment at 100 degrees C for 10 min. Thus, human bone marrow cells produce a heat-sensitive factor that specifically promotes the growth of early erythroid progenitors in culture
Czech Academy of Sciences Publication Activity Database
Petrák, J.; Myslivcová, D.; Man, Petr; Čmejlová, J.; Čmejla, R.; Vyoral, D.
2007-01-01
Roč. 35, - (2007), s. 193-202 ISSN 0301-472X R&D Projects: GA MŠk LC545 Grant - others:CZ(CZ) 023736; GA ČR(CZ) GA303/04/0003; GA MŠk(CZ) LC06044 Institutional research plan: CEZ:AV0Z50200510 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : murine erythroleukemia cells * erythroid differentiation * hexamethylene bisacetamide Subject RIV: EE - Microbiology, Virology Impact factor: 3.147, year: 2007
Comparison of different methods for erythroid differentiation in the K562 cell line.
Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein
2016-08-01
To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.
Directory of Open Access Journals (Sweden)
Josephine Wesely
2017-01-01
Full Text Available The transcriptional regulator far upstream binding protein 1 (FUBP1 is essential for fetal and adult hematopoietic stem cell (HSC self-renewal, and the constitutive absence of FUBP1 activity during early development leads to embryonic lethality in homozygous mutant mice. To investigate the role of FUBP1 in murine embryonic stem cells (ESCs and in particular during differentiation into hematopoietic lineages, we generated Fubp1 knockout (KO ESC clones using CRISPR/Cas9 technology. Although FUBP1 is expressed in undifferentiated ESCs and during spontaneous differentiation following aggregation into embryoid bodies (EBs, absence of FUBP1 did not affect ESC maintenance. Interestingly, we observed a delayed differentiation of FUBP1-deficient ESCs into the mesoderm germ layer, as indicated by impaired expression of several mesoderm markers including Brachyury at an early time point of ESC differentiation upon aggregation to EBs. Coculture experiments with OP9 cells in the presence of erythropoietin revealed a diminished differentiation capacity of Fubp1 KO ESCs into the erythroid lineage. Our data showed that FUBP1 is important for the onset of mesoderm differentiation and maturation of hematopoietic progenitor cells into the erythroid lineage, a finding that is supported by the phenotype of FUBP1-deficient mice.
Erythroid differentiation of fetal, newborn and adult haemopoietic stem cells
International Nuclear Information System (INIS)
Rencricca, N.J.; Howard, D.; Kubanek, B.; Stohlman, F.; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron ( 59 Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments. (author)
Erythroid differentiation of fetal, newborn, and adult haemopoietic stem cells
Energy Technology Data Exchange (ETDEWEB)
Rencricca, N J; Howard, D; Kubanek, B; Stohlman, F [Boston Univ., Mass. (USA). School of Medicine; Department of Biological Sciences, University of Lowell, Lowell, Massachusetts, USA)
1976-01-01
Erythroid regeneration was studied in lethally irradiated mice given transplants containing equivalent numbers of haemopoietic stem cells (i.e. CFU) from fetal liver, neonatal marrow or adult marrow. Adult marrow was taken from normal control mice, whose CFU for the most part were not in active cell cycle, as well as from phenylhydrazine-treated groups whose CFU were in similar state of proliferation (i.e. approximately 40-50% in DNA synthesis) as those derived from fetal liver and neonatal marrow. Splenic and femoral radioiron (/sup 59/Fe) incorporation were measured at intervals after transplantation and were found to begin earliest in mice given fetal liver, then in animals given neonatal marrow and latest in recipients of adult marrow. Peripheral reticulocytes showed a similar pattern of recovery. The data reported herein suggest that the differences in erythroid regeneration evoked by transplants of fetal liver, neonatal marrow or adult marrow, are not solely attributed to the degree of proliferation in the pluripotential stem cell compartment. These data may, however, suggest a shorter doubling time for cells comprising the fetal and newborn committed erythroid compartments.
Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.
2011-01-01
Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria; Ronchi, Antonella; Ruoppolo, Margherita; Santorelli, Lucia; Steinfelder, Robert; Elangovan, Sudharshan; Fugazza, Cristina; Caterino, Marianna
2017-01-01
are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark
International Nuclear Information System (INIS)
Valtieri, M.; Venturelli, D.; Care, A.; Fossati, C.; Pelosi, E.; Labbaye, C.; Mattia, G.; Gewirtz, A.M.; Calabretta, B.; Peschle, C.
1991-01-01
These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM, and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase
Unravelling pathways downstream Sox6 induction in K562 erythroid cells by proteomic analysis
Barbarani, Gloria
2017-10-20
The Sox6 transcription factor is crucial for terminal maturation of definitive red blood cells. Sox6-null mouse fetuses present misshapen and nucleated erythrocytes, due to impaired actin assembly and cytoskeleton stability. These defects are accompanied with a reduced survival of Sox6-/- red blood cells, resulting in a compensated anemia. Sox6-overexpression in K562 cells and in human primary ex vivo erythroid cultures enhances erythroid differentiation and leads to hemoglobinization, the hallmark of erythroid maturation. To obtain an overview on processes downstream to Sox6 expression, we performed a differential proteomic analysis on human erythroid K562 cells overexpressing Sox6. Sox6-overexpression induces dysregulation of 64 proteins, involved in cytoskeleton remodeling and in protein synthesis, folding and trafficking, key processes for erythroid maturation. Moreover, 43 out of 64 genes encoding for differentially expressed proteins contain within their proximal regulatory regions sites that are bound by SOX6 according to ENCODE ChIP-seq datasets and are possible direct SOX6 targets. SAR1B, one of the most induced proteins upon Sox6 overexpression, shares a conserved regulatory module, composed by a double SOX6 binding site and a GATA1 consensus, with the adjacent SEC24 A gene. Since both genes encode for COPII components, this element could concur to the coordinated expression of these proteins during erythropoiesis.
International Nuclear Information System (INIS)
Goupille, Olivier; Penglong, Tipparat; Lefèvre, Carine; Granger, Marine; Kadri, Zahra; Fucharoen, Suthat; Maouche-Chrétien, Leila; Leboulch, Philippe; Chrétien, Stany
2012-01-01
Highlights: ► UT7 erythroleukemia cells are known to be refractory to differentiate. ► Brief JQ1 treatment initiates the first steps of erythroid differentiation program. ► Engaged UT7 cells then maturate in the presence of erythropoietin. ► Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.
Energy Technology Data Exchange (ETDEWEB)
Goupille, Olivier [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Penglong, Tipparat [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Lefevre, Carine; Granger, Marine; Kadri, Zahra [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Fucharoen, Suthat [Thalassemia Research Center and Department of Clinical Pathology, Faculty of Medicine, Ramathibodi Hospital, Mahidol University (Thailand); Maouche-Chretien, Leila [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Leboulch, Philippe [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France); Genetics Division, Department of Medicine, Brigham and Women' s Hospital and Harvard Medical School, Boston, MA (United States); Chretien, Stany, E-mail: stany.chretien@cea.fr [CEA, Institute of Emerging Diseases and Innovative Therapies, Fontenay-aux-Roses (France); UMR INSERM U.962, University Paris XI, CEA, Fontenay-aux-Roses (France)
2012-12-07
Highlights: Black-Right-Pointing-Pointer UT7 erythroleukemia cells are known to be refractory to differentiate. Black-Right-Pointing-Pointer Brief JQ1 treatment initiates the first steps of erythroid differentiation program. Black-Right-Pointing-Pointer Engaged UT7 cells then maturate in the presence of erythropoietin. Black-Right-Pointing-Pointer Sustained JQ1 treatment inhibits both proliferation and erythroid differentiation. -- Abstract: Malignant transformation is a multistep process requiring oncogenic activation, promoting cellular proliferation, frequently coupled to inhibition of terminal differentiation. Consequently, forcing the reengagement of terminal differentiation of transformed cells coupled or not with an inhibition of their proliferation is a putative therapeutic approach to counteracting tumorigenicity. UT7 is a human leukemic cell line able to grow in the presence of IL3, GM-CSF and Epo. This cell line has been widely used to study Epo-R/Epo signaling pathways but is a poor model for erythroid differentiation. We used the BET bromodomain inhibition drug JQ1 to target gene expression, including that of c-Myc. We have shown that only 2 days of JQ1 treatment was required to transitory inhibit Epo-induced UT7 proliferation and to restore terminal erythroid differentiation. This study highlights the importance of a cellular erythroid cycle break mediated by c-Myc inhibition before initiation of the erythropoiesis program and describes a new model for BET bromodomain inhibitor drug application.
Bmi-1 Regulates Extensive Erythroid Self-Renewal
Directory of Open Access Journals (Sweden)
Ah Ram Kim
2015-06-01
Full Text Available Red blood cells (RBCs, responsible for oxygen delivery and carbon dioxide exchange, are essential for our well-being. Alternative RBC sources are needed to meet the increased demand for RBC transfusions projected to occur as our population ages. We previously have discovered that erythroblasts derived from the early mouse embryo can self-renew extensively ex vivo for many months. To better understand the mechanisms regulating extensive erythroid self-renewal, global gene expression data sets from self-renewing and differentiating erythroblasts were analyzed and revealed the differential expression of Bmi-1. Bmi-1 overexpression conferred extensive self-renewal capacity upon adult bone-marrow-derived self-renewing erythroblasts, which normally have limited proliferative potential. Importantly, Bmi-1 transduction did not interfere with the ability of extensively self-renewing erythroblasts (ESREs to terminally mature either in vitro or in vivo. Bmi-1-induced ESREs can serve to generate in vitro models of erythroid-intrinsic disorders and ultimately may serve as a source of cultured RBCs for transfusion therapy.
Erythroid Differentiation Regulator 1 as a Novel Biomarker for Hair Loss Disorders.
Woo, Yu Ri; Hwang, Sewon; Jeong, Seo Won; Cho, Dae Ho; Park, Hyun Jeong
2017-02-03
Erythroid differentiation regulator 1 (Erdr1) is known to be involved in the inflammatory process via regulating the immune system in many cutaneous disorders, such as psoriasis and rosacea. However, the role of Erdr1 in various hair loss disorders remains unclear. The aim of this study was to investigate the putative role of Erdr1 in alopecias. Skin samples from 21 patients with hair loss disorders and five control subjects were retrieved, in order to assess their expression levels of Erdr1. Results revealed that expression of Erdr1 was significantly downregulated in the epidermis and hair follicles of patients with hair loss disorders, when compared to that in the control group. In particular, the expression of Erdr1 was significantly decreased in patients with alopecia areata. We propose that Erdr1 downregulation might be involved in the pathogenesis of hair loss, and could be considered as a novel biomarker for hair loss disorders.
DEFF Research Database (Denmark)
Falchi, Mario; Varricchio, Lilian; Martelli, Fabrizio
2015-01-01
Cultures of human CD34(pos) cells stimulated with erythroid growth factors plus dexamethasone, a model for stress erythropoiesis, generate numerous erythroid cells plus a few macrophages (approx. 3%; 3:1 positive and negative for CD169). Interactions occurring between erythroblasts and macrophages...... in these cultures and the biological effects associated with these interactions were documented by live phase-contrast videomicroscopy. Macrophages expressed high motility interacting with hundreds/thousands of erythroblasts per hour. CD169(pos) macrophages established multiple rapid 'loose' interactions...... with proerythroblasts leading to formation of transient erythroblastic island-like structures. By contrast, CD169(neg) macrophages established 'tight' interactions with mature erythroblasts and phagocytosed these cells. 'Loose' interactions of CD169(pos) macrophages were associated with proerythroblast cytokinesis (the...
Directory of Open Access Journals (Sweden)
Sreoshi Chatterjee
Full Text Available Repeated weekly injections of rat erythrocytes produced autoimmune hemolytic anemia (AIHA in C57BL/6 mice after 5-6 weeks. Using the double in vivo biotinylation (DIB technique, recently developed in our laboratory, turnover of erythrocyte cohorts of different age groups during AIHA was monitored. Results indicate a significant decline in the proportion of reticulocytes, young and intermediate age groups of erythrocytes, but a significant increase in the proportion of old erythrocytes in blood circulation. Binding of the autoantibody was relatively higher to the young erythrocytes and higher levels of intracellular reactive oxygen species (ROS were also seen in these cells. Erythropoietic activity in the bone marrows and the spleen of AIHA induced mice was examined by monitoring the relative proportion of erythroid cells at various stages of differentiation in these organs. Cells at different stages of differentiation were enumerated flow cytometrically by double staining with anti-Ter119 and anti-transferrin receptor (CD71 monoclonal antibodies. Erythroid cells in bone marrow declined significantly in AIHA induced mice, erythroblast C being most affected (50% decline. Erythroblast C also recorded high intracellular ROS level along with increased levels of membrane-bound autoantibody. No such decline was observed in spleen. A model of AIHA has been proposed indicating that binding of autoantibodies may not be a sufficient condition for destruction of erythroid cells in bone marrow and in blood circulation. Last stage of erythropoietic differentiation in bone marrow and early stages of erythrocytes in blood circulation are specifically susceptible to removal in AIHA.
TMEM14C is required for erythroid mitochondrial heme metabolism.
Yien, Yvette Y; Robledo, Raymond F; Schultz, Iman J; Takahashi-Makise, Naoko; Gwynn, Babette; Bauer, Daniel E; Dass, Abhishek; Yi, Gloria; Li, Liangtao; Hildick-Smith, Gordon J; Cooney, Jeffrey D; Pierce, Eric L; Mohler, Kyla; Dailey, Tamara A; Miyata, Non; Kingsley, Paul D; Garone, Caterina; Hattangadi, Shilpa M; Huang, Hui; Chen, Wen; Keenan, Ellen M; Shah, Dhvanit I; Schlaeger, Thorsten M; DiMauro, Salvatore; Orkin, Stuart H; Cantor, Alan B; Palis, James; Koehler, Carla M; Lodish, Harvey F; Kaplan, Jerry; Ward, Diane M; Dailey, Harry A; Phillips, John D; Peters, Luanne L; Paw, Barry H
2014-10-01
The transport and intracellular trafficking of heme biosynthesis intermediates are crucial for hemoglobin production, which is a critical process in developing red cells. Here, we profiled gene expression in terminally differentiating murine fetal liver-derived erythroid cells to identify regulators of heme metabolism. We determined that TMEM14C, an inner mitochondrial membrane protein that is enriched in vertebrate hematopoietic tissues, is essential for erythropoiesis and heme synthesis in vivo and in cultured erythroid cells. In mice, TMEM14C deficiency resulted in porphyrin accumulation in the fetal liver, erythroid maturation arrest, and embryonic lethality due to profound anemia. Protoporphyrin IX synthesis in TMEM14C-deficient erythroid cells was blocked, leading to an accumulation of porphyrin precursors. The heme synthesis defect in TMEM14C-deficient cells was ameliorated with a protoporphyrin IX analog, indicating that TMEM14C primarily functions in the terminal steps of the heme synthesis pathway. Together, our data demonstrate that TMEM14C facilitates the import of protoporphyrinogen IX into the mitochondrial matrix for heme synthesis and subsequent hemoglobin production. Furthermore, the identification of TMEM14C as a protoporphyrinogen IX importer provides a genetic tool for further exploring erythropoiesis and congenital anemias.
PCBP1 and NCOA4 regulate erythroid iron storage and heme biosynthesis.
Ryu, Moon-Suhn; Zhang, Deliang; Protchenko, Olga; Shakoury-Elizeh, Minoo; Philpott, Caroline C
2017-05-01
Developing erythrocytes take up exceptionally large amounts of iron, which must be transferred to mitochondria for incorporation into heme. This massive iron flux must be precisely controlled to permit the coordinated synthesis of heme and hemoglobin while avoiding the toxic effects of chemically reactive iron. In cultured animal cells, iron chaperones poly rC-binding protein 1 (PCBP1) and PCBP2 deliver iron to ferritin, the sole cytosolic iron storage protein, and nuclear receptor coactivator 4 (NCOA4) mediates the autophagic turnover of ferritin. The roles of PCBP, ferritin, and NCOA4 in erythroid development remain unclear. Here, we show that PCBP1, NCOA4, and ferritin are critical for murine red cell development. Using a cultured cell model of erythroid differentiation, depletion of PCBP1 or NCOA4 impaired iron trafficking through ferritin, which resulted in reduced heme synthesis, reduced hemoglobin formation, and perturbation of erythroid regulatory systems. Mice lacking Pcbp1 exhibited microcytic anemia and activation of compensatory erythropoiesis via the regulators erythropoietin and erythroferrone. Ex vivo differentiation of erythroid precursors from Pcbp1-deficient mice confirmed defects in ferritin iron flux and heme synthesis. These studies demonstrate the importance of ferritin for the vectorial transfer of imported iron to mitochondria in developing red cells and of PCBP1 and NCOA4 in mediating iron flux through ferritin.
Wang, Huan-You; Huang, Lily Jun-shen; Garcia, Rolando; Li, Shiyong; Galliani, Carlos A.
2010-01-01
Pure erythroid leukemia is a rare subtype of acute erythroid leukemia that is characterized by a predominant erythroid population, and erythroblastic sarcoma has not yet been described in the English literature. Here we report a first case of erythroblastic sarcoma which presented as bilateral ovarian masses in a three and half month old baby girl with pure erythroid leukemia. Bone marrow aspirate and biopsy showed the marrow was completely replaced by large-sized blasts consistent with erythroblasts. Immunophenotypically, both the tumor cells from the ovarian mass and bone marrow blasts were positive for CD117, glycophorin A, and hemoglobin A, demonstrating erythroid differentiation. Reverse transcriptase polymerase chain reaction showed the tumor cells from ovarian mass expressed hemoglobin F and α1 spectrin, confirming their erythroid lineage. Conventional karyotype of the bone marrow aspirates revealed del(6) (q23q25) and trisomy 7 in all 21 cells examined. Fluorescence in situ hybridization of the ovarian mass demonstrated loss of C-MYB at 6q23 locus in 41% of the cells, and deletion of chromosome 7 and 7q in 37% and 66% of cells, respectively. Taken together, we showed, for the first time, that pure erythroid leukemia presented as a myeloid sarcoma in the form of ovarian masses. PMID:21237494
Directory of Open Access Journals (Sweden)
Ryo Kurita
Full Text Available Transfusion of red blood cells (RBCs is a standard and indispensable therapy in current clinical practice. In vitro production of RBCs offers a potential means to overcome a shortage of transfusable RBCs in some clinical situations and also to provide a source of cells free from possible infection or contamination by microorganisms. Thus, in vitro production of RBCs may become a standard procedure in the future. We previously reported the successful establishment of immortalized mouse erythroid progenitor cell lines that were able to produce mature RBCs very efficiently. Here, we have developed a reliable protocol for establishing immortalized human erythroid progenitor cell lines that are able to produce enucleated RBCs. These immortalized cell lines produce functional hemoglobin and express erythroid-specific markers, and these markers are upregulated following induction of differentiation in vitro. Most importantly, these immortalized cell lines all produce enucleated RBCs after induction of differentiation in vitro, although the efficiency of producing enucleated RBCs remains to be improved further. To the best of our knowledge, this is the first demonstration of the feasibility of using immortalized human erythroid progenitor cell lines as an ex vivo source for production of enucleated RBCs.
Ponnazhagan, S; Weigel, K A; Raikwar, S P; Mukherjee, P; Yoder, M C; Srivastava, A
1998-06-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562-566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111-1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and
Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun
1998-01-01
A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited
International Nuclear Information System (INIS)
Abou-Khalil, S.; Abou-Khalil, W.H.; Whitney, P.L.; Yunis, A.A.
1986-01-01
Previous studies in the authors laboratory have suggested that mitochondrial amino acid (AA) pool is involved in the differential sensitivity of erythroid and myeloid cells to chloramphenicol (CAP). The present study examines the role of AA pool by analysis of its composition and testing the effects of its major components. The endogenous AA composition of isolated mitochondria protein was determined using a JEOL 5AH AA analyzer. L-( 14 C) leucine incorporation into mitochondrial protein was used to measure the rate of protein synthesis. Analysis of the endogenous pool in erythroleukemia (EM) and chloroleukemia (CM) mitochrondria showed similar total amount of AAs. However, some AAs were present in significantly higher or lower quantity within EM and CM (i.e. EM had about 2-fold higher glycine content). When compensating for each low AA addition of that particular acid to the reaction medium, only glycine and serine had significant effect. Thus, the addition of increasing concentrations of glycine or serine enhanced the sensitivity to CAP from 14% to 49-51% in CM but not in EM. Other AAs gave little or no effect. Since glycine is one of the first reactants in heme biosynthesis within mitochondria and is interconvertible with serine, it would appear that erythroid cells sensitivity to CAP is determined by the mitochondrial glycine-serine pool and may be somehow related of the pathway to heme biosynthesis in these cells
Thrombopoietin has a differentiative effect on late-stage human erythropoiesis.
Liu, W; Wang, M; Tang, D C; Ding, I; Rodgers, G P
1999-05-01
To further explore the mechanism of the effect of thrombopoietin (TPO) on erythropoiesis, we used a two-phase culture system to investigate the effect of TPO on late-stage human erythroid lineage differentiation. In serum-free suspension and semisolid cultures of human peripheral blood derived erythroid progenitors, TPO alone did not produce benzidine-positive cells. However, in serum-containing culture, TPO alone stimulated erythroid cell proliferation and differentiation, demonstrated by erythroid colony formation, production of benzidine-positive cells and haemoglobin (Hb) synthesis. Monoclonal anti-human erythropoietin antibody and anti-human erythropoietin receptor antibody completely abrogated the erythroid differentiative ability of TPO in the serum-containing systems. This implied that binding of EPO and EPO-R was essential for erythropoiesis and the resultant signal transduction may be augmented by the signals emanating from TPO-c-Mpl interaction. Experiment of withdrawal of TPO further demonstrated the involvement of TPO in late-stage erythropoiesis. RT-PCR results showed that there was EPO-R but not c-Mpl expression on developing erythroblasts induced by TPO in serum-containing system. Our results establish that TPO affects not only the proliferation of erythroid progenitors but also the differentiation of erythroid progenitors to mature erythroid cells.
Di Tullio, Alessandro; Passaro, Diana; Rouault-Pierre, Kevin; Purewal, Sukhveer; Bonnet, Dominique
2017-07-11
Nuclear factor erythroid-derived 2 (NF-E2) has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs) not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG) mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated) and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Alessandro Di Tullio
2017-07-01
Full Text Available Nuclear factor erythroid-derived 2 (NF-E2 has been associated with megakaryocyte maturation and platelet production. Recently, an increased in NF-E2 activity has been implicated in myeloproliferative neoplasms. Here, we investigate the role of NF-E2 in normal human hematopoiesis. Knockdown of NF-E2 in the hematopoietic stem and progenitor cells (HSPCs not only reduced the formation of megakaryocytes but also drastically impaired hematopoietic stem cell activity, decreasing human engraftment in immunodeficient (NSG mice. This phenotype is likely to be related to both increased cell proliferation (p21-mediated and reduced Notch1 protein expression, which favors HSPC differentiation over self-renewal. Strikingly, although NF-E2 silencing in HSPCs did not affect their myeloid and B cell differentiation in vivo, it almost abrogated T cell production in primary hosts, as confirmed by in vitro studies. This effect is at least partly due to Notch1 downregulation in NF-E2-silenced HSPCs. Together these data reveal that NF-E2 is an important driver of human hematopoietic stem cell maintenance and T lineage differentiation.
Human Cord Blood and Bone Marrow CD34+ Cells Generate Macrophages That Support Erythroid Islands.
Directory of Open Access Journals (Sweden)
Eyayu Belay
Full Text Available Recently, we developed a small molecule responsive hyperactive Mpl-based Cell Growth Switch (CGS that drives erythropoiesis associated with macrophages in the absence of exogenous cytokines. Here, we compare the physical, cellular and molecular interaction between the macrophages and erythroid cells in CGS expanded CD34+ cells harvested from cord blood, marrow or G-CSF-mobilized peripheral blood. Results indicated that macrophage based erythroid islands could be generated from cord blood and marrow CD34+ cells but not from G-CSF-mobilized CD34+ cells. Additional studies suggest that the deficiency resides with the G-CSF-mobilized CD34+ derived monocytes. Gene expression and proteomics studies of the in vitro generated erythroid islands detected the expression of erythroblast macrophage protein (EMP, intercellular adhesion molecule 4 (ICAM-4, CD163 and DNASE2. 78% of the erythroblasts in contact with macrophages reached the pre reticulocyte orthochromatic stage of differentiation within 14 days of culture. The addition of conditioned medium from cultures of CD146+ marrow fibroblasts resulted in a 700-fold increase in total cell number and a 90-fold increase in erythroid cell number. This novel CD34+ cell derived erythroid island may serve as a platform to explore the molecular basis of red cell maturation and production under normal, stress and pathological conditions.
Energy Technology Data Exchange (ETDEWEB)
Cai, Ying; Xu, Zhixiong; Xie, Jingping [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Ham, Amy-Joan L. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Koury, Mark J. [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States); Hiebert, Scott W. [Department of Biochemistry, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Brandt, Stephen J., E-mail: stephen.brandt@vanderbilt.edu [Department of Medicine, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cell and Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Tennessee Valley VA Healthcare System, Nashville, TN 37212 (United States)
2009-12-11
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
International Nuclear Information System (INIS)
Cai, Ying; Xu, Zhixiong; Xie, Jingping; Ham, Amy-Joan L.; Koury, Mark J.; Hiebert, Scott W.; Brandt, Stephen J.
2009-01-01
The TAL1 (or SCL) gene, originally discovered through its involvement by a chromosomal translocation in T-cell acute lymphoblastic leukemia, encodes a basic helix-loop-helix (bHLH) transcription factor essential for hematopoietic and vascular development. To identify its interaction partners, we expressed a tandem epitope-tagged protein in murine erythroleukemia (MEL) cells and characterized affinity-purified Tal1-containing complexes by liquid chromatography-tandem mass spectrometry analysis. In addition to known interacting proteins, two proteins related to the Eight-Twenty-One (ETO) corepressor, Eto2/Mtg16 and Mtgr1, were identified from the peptide fragments analyzed. Tal1 interaction with Eto2 and Mtgr1 was verified by coimmunoprecipitation analysis in Tal1, Eto2-, and Mtgr1-transfected COS-7 cells, MEL cells expressing V5 epitope-tagged Tal1 protein, and non-transfected MEL cells. Mapping analysis with Gal4 fusion proteins demonstrated a requirement for the bHLH domain of Tal1 and TAF110 domain of Eto2 for their interaction, and transient transfection and glutathione S-transferase pull-down analysis showed that Mtgr1 and Eto2 enhanced the other's association with Tal1. Enforced expression of Eto2 in differentiating MEL cells inhibited the promoter of the Protein 4.2 (P4.2) gene, a direct target of TAL1 in erythroid progenitors, and transduction of Eto2 and Mtgr1 augmented Tal1-mediated gene repression. Finally, chromatin immunoprecipitation analysis revealed that Eto2 occupancy of the P4.2 promoter in MEL cells decreased with differentiation, in parallel with a decline in Eto2 protein abundance. These results identify Eto2 and Mtgr1 as authentic interaction partners of Tal1 and suggest they act as heteromeric corepressors of this bHLH transcription factor during erythroid differentiation.
Vizirianakis, Ioannis S; Papachristou, Eleni T; Andreadis, Panagiotis; Zopounidou, Elena; Matragkou, Christina N; Tsiftsoglou, Asterios S
2015-07-01
Impairment of ribosome biogenesis contributes to the molecular pathophysiology of ribosomopathies by deregulating cell-lineage specific proliferation, differentiation and apoptosis decisions of haematopoietic progenitor cells. Here, using pro-erythroblast-like murine erythroleukemia (MEL) cells, a model system of erythroid maturation, we aimed to investigate whether genetic manipulation of RPS5 expression affects the capacity of cells to grow and differentiate in culture. Parental MEL cells stably transfected with full length RPS5 cDNA in sense (MEL-C14 culture) or antisense (MEL-antisenseRPS5 culture) orientation, as well as MEL cells transiently transfected with siRNAs specific for RPS5 gene silencing (MEL-RPS5siRNA culture) were assessed for their ability to fully execute their erythroid maturation program in culture. The data obtained thus far indicate that: a) MEL-antisenseRPS5 exhibit a pronounced delay in the initiation of differentiation, as well as an impairment of commitment, since the continuous presence of the inducer in culture is required for the cells to fully execute their erythroid maturation program. b) RNAi-mediating silencing of RPS5 gene expression resulted in the inability of MEL cells to differentiate; however, when these cells were allowed to recapitulate normal RPS5 gene expression levels they regained their differentiation capacity by accumulating high proportion of erythroid mature cells. c) Interestingly the latter, is accompanied by morphological changes of cells and an impairment of their proliferation and apoptosis potential. Such data for the first time correlate the RPS5 gene expression levels with the differentiation capacity of MEL cells in vitro, a fact that might also have implications in understanding ribosomopathies.
Houwerzijl, E. J.; Pol, H-W D.; Blom, N. R.; van der Want, J. J. L.; de Wolf, J. Thm; Vellenga, E.
Recent studies in erythroid cells have shown that autophagy is an important process for the physiological clearance of mitochondria during terminal differentiation. However, autophagy also plays an important role in removing damaged and dysfunctional mitochondria. Defective mitochondria and impaired
Directory of Open Access Journals (Sweden)
Pascariello Caterina
2008-05-01
Full Text Available Abstract Background Aldehyde dehydrogenase (ALDH is a cytosolic enzyme highly expressed in hematopoietic precursors from cord blood and granulocyte-colony stimulating factor mobilized peripheral blood, as well as in bone marrow from patients with acute myeloblastic leukemia. As regards human normal bone marrow, detailed characterization of ALDH+ cells has been addressed by one single study (Gentry et al, 2007. The goal of our work was to provide new information about the dissection of normal bone marrow progenitor cells based upon the simultaneous detection by flow cytometry of ALDH and early hematopoietic antigens, with particular attention to the expression of ALDH on erythroid precursors. To this aim, we used three kinds of approach: i multidimensional analytical flow cytometry, detecting ALDH and early hematopoietic antigens in normal bone marrow; ii fluorescence activated cell sorting of distinct subpopulations of progenitor cells, followed by in vitro induction of erythroid differentiation; iii detection of ALDH+ cellular subsets in bone marrow from pure red cell aplasia patients. Results In normal bone marrow, we identified three populations of cells, namely ALDH+CD34+, ALDH-CD34+ and ALDH+CD34- (median percentages were 0.52, 0.53 and 0.57, respectively. As compared to ALDH-CD34+ cells, ALDH+CD34+ cells expressed the phenotypic profile of primitive hematopoietic progenitor cells, with brighter expression of CD117 and CD133, accompanied by lower display of CD38 and CD45RA. Of interest, ALDH+CD34- population disclosed a straightforward erythroid commitment, on the basis of three orders of evidences. First of all, ALDH+CD34- cells showed a CD71bright, CD105+, CD45- phenotype. Secondly, induction of differentiation experiments evidenced a clear-cut expression of glycophorin A (CD235a. Finally, ALDH+CD34- precursors were not detectable in patients with pure red cell aplasia (PRCA. Conclusion Our study, comparing surface antigen expression of
Parvovirus B19 integration into human CD36+ erythroid progenitor cells.
Janovitz, Tyler; Wong, Susan; Young, Neal S; Oliveira, Thiago; Falck-Pedersen, Erik
2017-11-01
The pathogenic autonomous human parvovirus B19 (B19V) productively infects erythroid progenitor cells (EPCs). Functional similarities between B19V nonstructural protein (NS1), a DNA binding endonuclease, and the Rep proteins of Adeno-Associated Virus (AAV) led us to hypothesize that NS1 may facilitate targeted nicking of the human genome and B19 vDNA integration. We adapted an integration capture sequencing protocol (IC-Seq) to screen B19V infected human CD36+ EPCs for viral integrants, and discovered 40,000 unique B19V integration events distributed throughout the human genome. Computational analysis of integration patterns revealed strong correlations with gene intronic regions, H3K9me3 sites, and the identification of 41 base pair consensus sequence with an octanucleotide core motif. The octanucleotide core has homology to a single region of B19V, adjacent to the P6 promoter TATA box. We present the first direct evidence that B19V infection of erythroid progenitor cells disrupts the human genome and facilitates viral DNA integration. Copyright © 2017 Elsevier Inc. All rights reserved.
Massive splenomegaly in acute erythroid leukaemia (FAB Class-M6): an unusual presentation.
Sherazi, Syed Furqan Haider; Butt, Zeeshan
2012-09-01
AML-M6 has a peak incidence in the seventh decade with slight male preponderance, and can also present at a younger age. The usual features are anaemia, thrombocytopenia, malaise, fatigue, easy bruising, epistaxis and petechiae. Splenomegaly may occur in 20-40 % of the cases but massive splenomegaly is rare presentation and have been only reported once in humans and once in animals. A 22 year Asian female, presented with fatigue, pallor, mild jaundice, exertional dyspnoea, epigastric pain, tender right hypochondrium and massive splenomegaly. Investigations revealed anaemia and thrombocytopenia, tear drop cells, basophilic stippling, piokilocytosis and anisochromia; increased uric acid and LDH. Abdominal ultrasound showed enlarged liver (22cm) and spleen (20cm). Bone marrow aspiration revealed 51% erythroid and 24% non-erythroid precursors, depressed leukopoeisis and megakarypoeisis. Erythroblasts were PAS and CD71 positive and also reacted to Antihaemoglobin-Antibody. This report highlights characteristic features and diagnostic criteria of erythroleukaemia, differential diagnosis of massive splenomegaly and their rare association.
International Nuclear Information System (INIS)
Machherndl-Spandl, S; Suessner, S; Danzer, M; Proell, J; Gabriel, C; Lauf, J; Sylie, R; Klein, H-U; Béné, M C; Weltermann, A; Bettelheim, P
2013-01-01
Special attention has recently been drawn to the molecular network of different genes that are responsible for the development of erythroid cells. The aim of the present study was to establish in detail the immunophenotype of early erythroid cells and to compare the gene expression profile of freshly isolated early erythroid precursors with that of the CD34-positive (CD34 + ) compartment. Multiparameter flow cytometric analyses of human bone marrow mononuclear cell fractions (n=20) defined three distinct early erythroid stages. The gene expression profile of sorted early erythroid cells was analyzed by Affymetrix array technology. For 4524 genes, a differential regulation was found in CD105-positive erythroid cells as compared with the CD34 + progenitor compartment (2362 upregulated genes). A highly significant difference was observed in the expression level of genes involved in transcription, heme synthesis, iron and mitochondrial metabolism and transforming growth factor-β signaling. A comparison with recently published data showed over 1000 genes that as yet have not been reported to be upregulated in the early erythroid lineage. The gene expression level within distinct pathways could be illustrated directly by applying the Ingenuity software program. The results of gene expression analyses can be seen at the Gene Expression Omnibus repository
Zhao, Jingyao; Chen, Xufeng; Song, Guangrong; Zhang, Jiali; Liu, Haifeng; Liu, Xiaolong
2017-01-10
Hematopoietic stem cells (HSCs) are able to both self-renew and differentiate. However, how individual HSC makes the decision between self-renewal and differentiation remains largely unknown. Here we report that ablation of the key epigenetic regulator Uhrf1 in the hematopoietic system depletes the HSC pool, leading to hematopoietic failure and lethality. Uhrf1-deficient HSCs display normal survival and proliferation, yet undergo erythroid-biased differentiation at the expense of self-renewal capacity. Notably, Uhrf1 is required for the establishment of DNA methylation patterns of erythroid-specific genes during HSC division. The expression of these genes is enhanced in the absence of Uhrf1, which disrupts the HSC-division modes by promoting the symmetric differentiation and suppressing the symmetric self-renewal. Moreover, overexpression of one of the up-regulated genes, Gata1, in HSCs is sufficient to phenocopy Uhrf1-deficient HSCs, which show impaired HSC symmetric self-renewal and increased differentiation commitment. Taken together, our findings suggest that Uhrf1 controls the self-renewal versus differentiation of HSC through epigenetically regulating the cell-division modes, thus providing unique insights into the relationship among Uhrf1-mediated DNA methylation, cell-division mode, and HSC fate decision.
von Lindern, M.; Zauner, W.; Mellitzer, G.; Steinlein, P.; Fritsch, G.; Huber, K.; Löwenberg, B.; Beug, H.
1999-01-01
Although erythropoietin (Epo) is essential for the production of mature red blood cells, the cooperation with other factors is required for a proper balance between progenitor proliferation and differentiation. In avian erythroid progenitors, steroid hormones cooperate with tyrosine kinase receptors
International Nuclear Information System (INIS)
Clement, S.; Eberlin, A.; Najean, Y.; Chedeville, A.
1982-01-01
Growth patterns of marrow and blood erythroid progenitors were studied in 18 cases of pure erythrocytosis using different doses of erythropoietin. 8 cases demonstrated ''spontaneous'' growth of CFU-E and blood BFU-E as observed in myeloproliferative disorders, but without an excess of circulating CFU-GM. 3 of these patients also had other symptoms of a pan-myelopathy. All these cases showed good sensitivity to 32 P myelo-suppression. 10 cases demonstrated growth patterns of erythroid progenitors similar to those observed in normal subjects, except for an excess of blood BFU-E, which suggests an abnormality of homeostatic regulation. In 5 of these cases, myelo-suppression was not effective. It is suggested that a stem cell study could differentiate patients with pure erythrocytosis due to ''autonomous'' abnormal stem cell growth from cases due to abnormal regulation factors, and that such a discrimination might be usefull for the choice of theraphy. (authors)
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Acute erythroid neoplastic proliferations. A biological study based on 62 patients.
Domingo-Claros, Alicia; Larriba, Itziar; Rozman, Maruja; Irriguible, Dolors; Vallespí, Teresa; Aventin, Anna; Ayats, Ramon; Millá, Fuensanta; Solé, Francesc; Florensa, Lourdes; Gallart, Miquel; Tuset, Esperanza; Lopez, Carmen; Woessner, Soledad
2002-02-01
The terms acute erythroleukemia and AML-M6 are defined in the FAB classification as proliferations of dysplastic erythroid elements mixed with blasts of myeloid origin, but pure erythroid leukemias are not included. The recent WHO classification has a category of acute myeloid leukemia not otherwise categorized, which includes acute erythroid leukemia (M6) of two subtypes: M6a-erythroleukemia (erythroid/myeloid) and M6b-pure erythroid leukemia. The aims of this co-operative study were to discover the incidences of these different subtypes, and pay special attention to the morphology of these entities. We reviewed a series of 62 patients with erythroid neoplastic proliferations. Previous medical history, age, sex, peripheral blood and bone marrow cell counts, cytochemical stains, immunophenotype, and cytogenetics were evaluated at presentation. We analyzed the incidence of erythrocyte, leukocyte and platelet abnormalities in the peripheral blood. In bone marrow we analyzed dysplastic features of erythroblasts, granulocytic elements and the megakaryocytic lineage. Fifty-three patients met the criteria of M6a subtype of the WHO classification, and 2 were classified as having pure erythremia (M6b); 7 cases could not be classified according to the WHO criteria. Fifty-five patients presented with de novo acute leukemia, and seven patients had secondary acute leukemia. The most frequent dysplastic features in blood smears were: schistocytes, tear-drop and pincered cells in erythrocytes; hypogranulation and hyposegmentation in leukocytes; gigantism and hypogranulation in platelets. In bone marrow, megaloblastic changes, multinuclearity, karyorrhexis and basophilic stippling in erythroblasts; hypogranulation and gigantism in granulocytic series, and micromegakaryocytes and unconnected nuclei in megakarocytes were the most dysplastic features. A positive PAS reaction and increase of bone marrow iron with ring sideroblasts were common features. Trilineage dysplasia was
International Nuclear Information System (INIS)
Gardner, L.C.; Cox, T.M.
1988-01-01
Heme formation in reticulocytes from rabbits and rodents is subject to end product negative feedback regulation: intracellular free heme has been shown to control acquisition of transferrin iron for heme synthesis. To identify the site of control of heme biosynthesis in the human erythron, immature erythroid cells were obtained from peripheral blood and aspirated bone marrow. After incubation with human 59Fe transferrin, 2-[14C]glycine, or 4-[14C]delta-aminolevulinate, isotopic incorporation into extracted heme was determined. Addition of cycloheximide to increase endogenous free heme, reduced incorporation of labeled glycine and iron but not delta-aminolevulinate into cell heme. Incorporation of glycine and iron was also sensitive to inhibition by exogenous hematin (Ki, 30 and 45 microM, respectively) i.e. at concentrations in the range which affect cell-free protein synthesis in reticulocyte lysates. Hematin treatment rapidly diminished incorporation of intracellular 59Fe into heme by human erythroid cells but assimilation of 4-[14C]delta-aminolevulinate into heme was insensitive to inhibition by hematin (Ki greater than 100 microM). In human reticulocytes (unlike those from rabbits), addition of ferric salicylaldehyde isonicotinoylhydrazone, to increase the pre-heme iron pool independently of the transferrin cycle, failed to promote heme synthesis or modify feedback inhibition induced by hematin. In human erythroid cells (but not rabbit reticulocytes) pre-incubation with unlabeled delta-aminolevulinate or protoporphyrin IX greatly stimulated utilization of cell 59Fe for heme synthesis and also attenuated end product inhibition. In human erythroid cells heme biosynthesis is thus primarily regulated by feedback inhibition at one or more steps which lead to delta-aminolevulinate formation
Enhancement of erythroid colony growth in culture by hemin
International Nuclear Information System (INIS)
Porter, P.N.; Meints, R.H.; Mesner, K.
1979-01-01
Hemin was found to enhance the growth of murine erythroid colonies in culture. In the presence of 100 mU/ml erythropoietin (EPO), the addition of hemin (0.05-0.2 mM) resulted in the growth of twice as many colonies as were obtained with EPO alone. Hemin also significantly increased erythroid colony formation in culture in the absence of added EPO. Hemoblobin synthesis as measured by the incorporation of 59 Fe into cyclohexanone extractable heme was augmented in culture by hemin. Neither Δ-aminolevulinic acid, a hemin precursor, nor FeCl 3 increased colony number. (author)
A UNIFYING DIFFERENTIAL GAME OF ADVERTISING AND PROMOTIONS
HASSAN BENCHEKROUN
2007-01-01
The literature on advertising and promotions can be divided in two categories. A first group of models assume that promotion contributes (positively) to the goodwill towards the product, and a second group assumes that promotions reduce that goodwill. In this paper we build a differential game model where the impact of promotion on goodwill is endogenously determined. We conduct a comparative dynamics exercise. An unexpected result is that an increase in the sensitivity of sales to goodwill c...
Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F
2009-09-01
The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.
DEFF Research Database (Denmark)
Järås, Marcus; Johnels, Petra; Agerstam, Helena
2009-01-01
OBJECTIVE: The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. MATERIALS AND METHODS: We investigated...... and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. RESULTS: Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells...... and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. Under...
Effects of Internet Sales Promotion on a Differential Advertising Model
Directory of Open Access Journals (Sweden)
Hui Jiang
2018-01-01
Full Text Available Advertising and sales promotion are two important specific marketing communications tools. In this paper, Internet sales promotion is introduced into a differential advertising model and investigated quantitatively. The conditions for the existence and stability of periodic solutions are obtained. Flip bifurcation of periodic solution is investigated analytically. The results show that the sales promotion parameter can modify the stability of the differential advertising model and lead to chaos through flip bifurcation, the sales level will eventually be no less than a given value by adjusting the value of the sales promotion parameter, and the optimal sales promotion strategy can lead to maximum profit. Numerical results for periodic solutions, bifurcation diagrams, and the effects of sales promotion strategies, which are illustrated with an example, are in good agreement with the theoretical analysis. These results have certain significant theoretical and practical value in related markets.
Damaraju, Sita M; Shen, Yueyang; Elele, Ezinwa; Khusid, Boris; Eshghinejad, Ahmad; Li, Jiangyu; Jaffe, Michael; Arinzeh, Treena Livingston
2017-12-01
The discovery of electric fields in biological tissues has led to efforts in developing technologies utilizing electrical stimulation for therapeutic applications. Native tissues, such as cartilage and bone, exhibit piezoelectric behavior, wherein electrical activity can be generated due to mechanical deformation. Yet, the use of piezoelectric materials have largely been unexplored as a potential strategy in tissue engineering, wherein a piezoelectric biomaterial acts as a scaffold to promote cell behavior and the formation of large tissues. Here we show, for the first time, that piezoelectric materials can be fabricated into flexible, three-dimensional fibrous scaffolds and can be used to stimulate human mesenchymal stem cell differentiation and corresponding extracellular matrix/tissue formation in physiological loading conditions. Piezoelectric scaffolds that exhibit low voltage output, or streaming potential, promoted chondrogenic differentiation and piezoelectric scaffolds with a high voltage output promoted osteogenic differentiation. Electromechanical stimulus promoted greater differentiation than mechanical loading alone. Results demonstrate the additive effect of electromechanical stimulus on stem cell differentiation, which is an important design consideration for tissue engineering scaffolds. Piezoelectric, smart materials are attractive as scaffolds for regenerative medicine strategies due to their inherent electrical properties without the need for external power sources for electrical stimulation. Copyright © 2017 Elsevier Ltd. All rights reserved.
THE EFFECTS OF IL-1 AND IL-4 ON THE EPO-INDEPENDENT ERYTHROID PROGENITOR IN POLYCYTHEMIA-VERA
DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
1994-01-01
Human recombinant interleukin-1 (IL-1) was studied for its effects on the erythroid progenitors from normal subjects and from patients with polycythaemia vera (PV). No supportive effect of IL-1 was noticed on the normal, erythropoietin (Epo) dependent, erythroid burst-forming unit (BFU-E) using
Tridax procumbens flavonoids promote osteoblast differentiation and bone formation
Directory of Open Access Journals (Sweden)
Md. Abdullah Al Mamun
Full Text Available BACKGROUND: Tridaxprocumbens flavonoids (TPFs are well known for their medicinal properties among local natives. Besides traditionally used for dropsy, anemia, arthritis, gout, asthma, ulcer, piles, and urinary problems, it is also used in treating gastric problems, body pain, and rheumatic pains of joints. TPFs have been reported to increase osteogenic functioning in mesenchymal stem cells. Our previous study showed that TPFs were significantly suppressed the RANKL-induced differentiation of osteoclasts and bone resorption. However, the effects of TPFs to promote osteoblasts differentiation and bone formation remain unclear. TPFs were isolated from Tridax procumbens and investigated for their effects on osteoblasts differentiation and bone formation by using primary mouse calvarial osteoblasts RESULTS: TPFs promoted osteoblast differentiation in a dose-dependent manner demonstrated by up-regulation of alkaline phosphatase and osteocalcin. TPFs also upregulated osteoblast differentiation related genes, including osteocalcin, osterix, and Runx2 in primary osteoblasts. TPFs treated primary osteoblast cells showed significant upregulation of bone morphogenetic proteins (BMPs including Bmp-2, Bmp-4, and Bmp-7. Addition of noggin, a BMP specific-antagonist, inhibited TPFs induced upregulation of the osteocalcin, osterix, and Runx2 CONCLUSION: Our findings point towards the induction of osteoblast differentiation by TPFs and suggested that TPFs could be a potential anabolic agent to treat patients with bone loss-associated diseases such as osteoporosis
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
Cytokine-Regulated GADD45G Induces Differentiation and Lineage Selection in Hematopoietic Stem Cells
Directory of Open Access Journals (Sweden)
Frederic B. Thalheimer
2014-07-01
Full Text Available The balance of self-renewal and differentiation in long-term repopulating hematopoietic stem cells (LT-HSC must be strictly controlled to maintain blood homeostasis and to prevent leukemogenesis. Hematopoietic cytokines can induce differentiation in LT-HSCs; however, the molecular mechanism orchestrating this delicate balance requires further elucidation. We identified the tumor suppressor GADD45G as an instructor of LT-HSC differentiation under the control of differentiation-promoting cytokine receptor signaling. GADD45G immediately induces and accelerates differentiation in LT-HSCs and overrides the self-renewal program by specifically activating MAP3K4-mediated MAPK p38. Conversely, the absence of GADD45G enhances the self-renewal potential of LT-HSCs. Videomicroscopy-based tracking of single LT-HSCs revealed that, once GADD45G is expressed, the development of LT-HSCs into lineage-committed progeny occurred within 36 hr and uncovered a selective lineage choice with a severe reduction in megakaryocytic-erythroid cells. Here, we report an unrecognized role of GADD45G as a central molecular linker of extrinsic cytokine differentiation and lineage choice control in hematopoiesis.
Dynamic Rewiring of Promoter-Anchored Chromatin Loops during Adipocyte Differentiation
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Madsen, Jesper Grud Skat; Javierre, Biola Maria
2017-01-01
-C to demonstrate a rapid reorganization of promoter-anchored chromatin loops within 4 hr after inducing differentiation of 3T3-L1 preadipocytes. The establishment of new promoter-enhancer loops is tightly coupled to activation of poised (histone H3 lysine 4 mono- and dimethylated) enhancers, as evidenced...
Patra, Malay; Mukhopadhyay, Chaitali; Chakrabarti, Abhijit
2015-01-01
We have studied the conformational stability of the two homologous membrane skeletal proteins, the erythroid and non-erythroid spectrins, in their dimeric and tetrameric forms respectively during unfolding in the presence of urea and guanidine hydrochloride (GuHCl). Fluorescence and circular dichroism (CD) spectroscopy have been used to study the changes of intrinsic tryptophan fluorescence, anisotropy, far UV-CD and extrinsic fluorescence of bound 1-anilinonapthalene-8-sulfonic acid (ANS). Chemical unfolding of both proteins were reversible and could be described as a two state transition. The folded erythroid spectrin and non-erythroid spectrin were directly converted to unfolded monomer without formation of any intermediate. Fluorescence quenching, anisotropy, ANS binding and dynamic light scattering data suggest that in presence of low concentrations of the denaturants (up-to 1M) hydrogen bonding network and van der Waals interaction play a role inducing changes in quaternary as well as tertiary structures without complete dissociation of the subunits. This is the first report of two large worm like, multi-domain proteins obeying twofold rule which is commonly found in small globular proteins. The free energy of stabilization (ΔGu H 2 0) for the dimeric spectrin has been 20 kcal/mol lesser than the tetrameric from. PMID:25617632
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
Rujanapun, Narawadee; Aueviriyavit, Sasitorn; Boonrungsiman, Suwimon; Rosena, Apiwan; Phummiratch, Duangkamol; Riolueang, Suchada; Chalaow, Nipon; Viprakasit, Vip; Maniratanachote, Rawiwan
2015-12-01
Although immortalized cells established from cancerous cells have been widely used for studies in nanotoxicology studies, the reliability of the results derived from immortalized cells has been questioned because of their different characteristics from normal cells. In the present study, human primary erythroid cells in liquid culture were used as an in vitro hematological cell model for investigation of the nanotoxicity of silver nanoparticles (AgNPs) and comparing the results to the immortalized hematological cell lines HL60 and K562. The AgNPs caused significant cytotoxic effects in the primary erythroid cells, as shown by the decreased cell viability and induction of intracellular ROS generation and apoptosis, whereas they showed much lower cytotoxic and apoptotic effects in HL60 and K562 cells and did not induced ROS generation in these cell lines. Scanning electron microcopy revealed an interaction of AgNPs to the cell membrane in both primary erythroid and immortalized cells. In addition, AgNPs induced hemolysis in the primary erythroid cells in a dose-dependent manner, and transmission electron microcopy analysis revealed that AgNPs damaged the erythroid cell membrane. Taken together, these results suggest that human primary erythroid cells in liquid culture are a more sensitive alternative in vitro hematological model for nanotoxicology studies. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ruth Merkle
2016-08-01
Full Text Available Lung cancer, with its most prevalent form non-small-cell lung carcinoma (NSCLC, is one of the leading causes of cancer-related deaths worldwide, and is commonly treated with chemotherapeutic drugs such as cisplatin. Lung cancer patients frequently suffer from chemotherapy-induced anemia, which can be treated with erythropoietin (EPO. However, studies have indicated that EPO not only promotes erythropoiesis in hematopoietic cells, but may also enhance survival of NSCLC cells. Here, we verified that the NSCLC cell line H838 expresses functional erythropoietin receptors (EPOR and that treatment with EPO reduces cisplatin-induced apoptosis. To pinpoint differences in EPO-induced survival signaling in erythroid progenitor cells (CFU-E, colony forming unit-erythroid and H838 cells, we combined mathematical modeling with a method for feature selection, the L1 regularization. Utilizing an example model and simulated data, we demonstrated that this approach enables the accurate identification and quantification of cell type-specific parameters. We applied our strategy to quantitative time-resolved data of EPO-induced JAK/STAT signaling generated by quantitative immunoblotting, mass spectrometry and quantitative real-time PCR (qRT-PCR in CFU-E and H838 cells as well as H838 cells overexpressing human EPOR (H838-HA-hEPOR. The established parsimonious mathematical model was able to simultaneously describe the data sets of CFU-E, H838 and H838-HA-hEPOR cells. Seven cell type-specific parameters were identified that included for example parameters for nuclear translocation of STAT5 and target gene induction. Cell type-specific differences in target gene induction were experimentally validated by qRT-PCR experiments. The systematic identification of pathway differences and sensitivities of EPOR signaling in CFU-E and H838 cells revealed potential targets for intervention to selectively inhibit EPO-induced signaling in the tumor cells but leave the responses in
Mechanism governing heme synthesis reveals a GATA factor/heme circuit that controls differentiation.
Tanimura, Nobuyuki; Miller, Eli; Igarashi, Kazuhiko; Yang, David; Burstyn, Judith N; Dewey, Colin N; Bresnick, Emery H
2016-02-01
Metal ion-containing macromolecules have fundamental roles in essentially all biological processes throughout the evolutionary tree. For example, iron-containing heme is a cofactor in enzyme catalysis and electron transfer and an essential hemoglobin constituent. To meet the intense demand for hemoglobin assembly in red blood cells, the cell type-specific factor GATA-1 activates transcription of Alas2, encoding the rate-limiting enzyme in heme biosynthesis, 5-aminolevulinic acid synthase-2 (ALAS-2). Using genetic editing to unravel mechanisms governing heme biosynthesis, we discovered a GATA factor- and heme-dependent circuit that establishes the erythroid cell transcriptome. CRISPR/Cas9-mediated ablation of two Alas2 intronic cis elements strongly reduces GATA-1-induced Alas2 transcription, heme biosynthesis, and surprisingly, GATA-1 regulation of other vital constituents of the erythroid cell transcriptome. Bypassing ALAS-2 function in Alas2 cis element-mutant cells by providing its catalytic product 5-aminolevulinic acid rescues heme biosynthesis and the GATA-1-dependent genetic network. Heme amplifies GATA-1 function by downregulating the heme-sensing transcriptional repressor Bach1 and via a Bach1-insensitive mechanism. Through this dual mechanism, heme and a master regulator collaborate to orchestrate a cell type-specific transcriptional program that promotes cellular differentiation. © 2015 The Authors.
LoGerfo, Annalisa; Chico, Lucia; Borgia, Loredana; Petrozzi, Lucia; Rocchi, Anna; D'Amelio, Antonia; Carlesi, Cecilia; Caldarazzo Ienco, Elena; Mancuso, Michelangelo; Siciliano, Gabriele
2014-01-01
Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS). The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2) pathways. We genotyped, in a cohort of ALS patients (n = 145) and healthy controls (n = 168), three SNPs in Nrf2 gene promoter: -653 A/G, -651 G/A, and -617 C/A and evaluated, in a subset (n = 73) of patients, advanced oxidation protein products (AOPP), iron-reducing ability of plasma (FRAP), and plasma thiols (-SH) as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P < 0.05) and decreased levels of FRAP (P < 0.001) have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the -653 A/G, -651 G/A, and -617 C/A Nrf2 SNPs in ALS patients.
International Nuclear Information System (INIS)
Wangenheim, K.-H. von; Peterson, H.-P.; Huebner, G.E.; Feinendegen, L.E.
1987-01-01
To investigate cell proliferation in regenerating spleen, bone marrow of normal and gamma-irradiated donor mice (3 weeks after 5 Gy) was transfused into lethally irradiated recipients. In the donors and in the recipient spleens numbers of CFU-S and progenitor cells were determined. In the irradiated donors the progenitors were at control level after 3 weeks of recovery although CFU-S were still at 50% of control. Recipients of the irradiated marrow received therefore an increased proportion of progenitors. CFU-C appeared to be self-renewing and/or increased in number due to enhanced CFU-S differentiation, but not the erythroid progenitors. CFU-S self-renewal was reduced after 5 Gy. The data suggest that cell differentiation and maturation proceed during early splenic regeneration. The quantity of CFU-C does not necessarily mirror the situation in the stem cell compartment. (author)
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Alteration of keratinocyte differentiation and senescence by the tumor promoter dioxin
International Nuclear Information System (INIS)
Ray, Soma S.; Swanson, Hollie I.
2003-01-01
Exposure to the environmental contaminant dioxin, elicits a variety of responses, which includes tumor promotion, embryotoxicity/teratogenesis, and carcinogenesis in both animals and humans. Many of the effects of dioxin are mediated by the aryl hydrocarbon receptor (AHR), a ligand-activated bHLH (basic helix-loop-helix)/PAS transcription factor. We initiated this study to determine whether dioxin's tumor-promoting activities may lie in its ability to alter proliferation, differentiation, and/or senescence using normal human epidermal keratinocytes (HEKs). Here, we report that dioxin appears to accelerate differentiation as measured by flow cytometry and by increased expression of the differentiation markers involucrin and filaggrin. In addition, dioxin appears to increase proliferation as indicated by an increase in NADH/NADPH production and changes in cell cycle. Finally, dioxin decreases SA (senescence associated) β-galactosidase staining, an indicator of senescence, in the differentiating keratinocytes. These changes were accompanied by decreases in the expression levels of key cell cycle regulatory proteins p53, p16 INK4a , and p14 ARF . Our findings support the idea that dioxin may exert its tumor-promoting actions, in part, by downregulating the expression levels of key tumor suppressor proteins, which may impair the cell's ability to maintain its appropriate cellular status
A Rare Case of Pure Erythroid Sarcoma in a Pediatric Patient: Case Report and Literature Review
Directory of Open Access Journals (Sweden)
Pablo Manresa
2017-12-01
Full Text Available We describe an exceptional case of erythroid sarcoma in a pediatric patient as a growing orbital mass with no evidence of morphologic bone marrow involvement, who was finally diagnosed of pure erythroid sarcoma based on histopathology and flow cytometry criteria. We discuss the contribution of standardized eight-color flow cytometry as a rapid and reliable diagnostic method. The use of normal bone marrow databases allowed us to identify small aberrant populations in bone marrow and later confirm the diagnosis in the neoplastic tissue.
Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis
International Nuclear Information System (INIS)
Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam
2008-01-01
The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.
Directory of Open Access Journals (Sweden)
Ferdinando Mannello
2008-01-01
Full Text Available Background: Erythropoietin (Epo is an important regulator of erythropoiesis, and controls proliferation and differentiation of both erythroid and non-erythroid tissues. Epo is actively synthesized by breast cells during lactation, and also plays a role in breast tissues promoting hypoxia-induced cancer initiation. Our aims are to perform an exploratory investigation on the Epo accumulation in breast secretions from healthy and cancer patients and its localization in breast cancer cells.
Directory of Open Access Journals (Sweden)
Ikuta T
2013-12-01
Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to
The canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner
International Nuclear Information System (INIS)
Yano, Fumiko; Kugimiya, Fumitaka; Ohba, Shinsuke; Ikeda, Toshiyuki; Chikuda, Hirotaka; Ogasawara, Toru; Ogata, Naoshi; Takato, Tsuyoshi; Nakamura, Kozo; Kawaguchi, Hiroshi; Chung, Ung-il
2005-01-01
To better understand the role of the canonical Wnt signaling pathway in cartilage development, we adenovirally expressed a constitutively active (Canada) or a dominant negative (dn) form of lymphoid enhancer factor-1 (LEF-1), the main nuclear effector of the pathway, in undifferentiated mesenchymal cells, chondrogenic cells, and primary chondrocytes, and examined the expression of markers for chondrogenic differentiation and hypertrophy. caLEF-1 and LiCl, an activator of the canonical pathway, promoted both chondrogenic differentiation and hypertrophy, whereas dnLEF-1 and the gene silencing of β-catenin suppressed LiCl-promoted effects. To investigate whether these effects were dependent on Sox9, a master regulator of cartilage development, we stimulated Sox9-deficient ES cells with the pathway. caLEF-1 and LiCl promoted both chondrogenic differentiation and hypertrophy in wild-type, but not in Sox9-deficient, cells. The response of Sox9-deficient cells was restored by the adenoviral expression of Sox9. Thus, the canonical Wnt signaling pathway promotes chondrocyte differentiation in a Sox9-dependent manner
Directory of Open Access Journals (Sweden)
Annalisa LoGerfo
2014-01-01
Full Text Available Oxidative stress involvement has been strongly hypothesized among the possible pathogenic mechanisms of motor neuron degeneration in amyotrophic lateral sclerosis (ALS. The intracellular redox balance is finely modulated by numerous complex mechanisms critical for cellular functions, among which the nuclear factor erythroid-derived 2-like 2 (NFE2L2/Nrf2 pathways. We genotyped, in a cohort of ALS patients (n=145 and healthy controls (n=168, three SNPs in Nrf2 gene promoter: −653 A/G, −651 G/A, and −617 C/A and evaluated, in a subset (n=73 of patients, advanced oxidation protein products (AOPP, iron-reducing ability of plasma (FRAP, and plasma thiols (-SH as oxidative damage peripheral biomarkers. Nrf2 polymorphisms were not different among patients and controls. Increased levels of AOPP (P<0.05 and decreased levels of FRAP (P<0.001 have been observed in ALS patients compared with controls, but no difference in -SH values was found. Furthermore, no association was found between biochemical markers of redox balance and Nrf2 polymorphisms. These data confirm an altered redox balance in ALS and indicate that, while being abnormally modified compared to controls, the oxidative stress biomarkers assessed in this study are independent from the −653 A/G, −651 G/A, and −617 C/A Nrf2 SNPs in ALS patients.
Directory of Open Access Journals (Sweden)
Zita Garate
2015-12-01
Full Text Available Pyruvate kinase deficiency (PKD is a rare erythroid metabolic disease caused by mutations in the PKLR gene. Erythrocytes from PKD patients show an energetic imbalance causing chronic non-spherocytic hemolytic anemia, as pyruvate kinase defects impair ATP production in erythrocytes. We generated PKD induced pluripotent stem cells (PKDiPSCs from peripheral blood mononuclear cells (PB-MNCs of PKD patients by non-integrative Sendai viral vectors. PKDiPSCs were gene edited to integrate a partial codon-optimized R-type pyruvate kinase cDNA in the second intron of the PKLR gene by TALEN-mediated homologous recombination (HR. Notably, we found allele specificity of HR led by the presence of a single-nucleotide polymorphism. High numbers of erythroid cells derived from gene-edited PKDiPSCs showed correction of the energetic imbalance, providing an approach to correct metabolic erythroid diseases and demonstrating the practicality of this approach to generate the large cell numbers required for comprehensive biochemical and metabolic erythroid analyses.
Myelo-erythroid commitment after burn injury is under β-adrenergic control via MafB regulation.
Hasan, Shirin; Johnson, Nicholas B; Mosier, Michael J; Shankar, Ravi; Conrad, Peggie; Szilagyi, Andrea; Gamelli, Richard L; Muthumalaiappan, Kuzhali
2017-03-01
Severely injured burn patients receive multiple blood transfusions for anemia of critical illness despite the adverse consequences. One limiting factor to consider alternate treatment strategies is the lack of a reliable test platform to study molecular mechanisms of impaired erythropoiesis. This study illustrates how conditions resulting in a high catecholamine microenvironment such as burns can instigate myelo-erythroid reprioritization influenced by β-adrenergic stimulation leading to anemia. In a mouse model of scald burn injury, we observed, along with a threefold increase in bone marrow LSK cells (lin neg Sca1 + cKit + ), that the myeloid shift is accompanied with a significant reduction in megakaryocyte erythrocyte progenitors (MEPs). β-Blocker administration (propranolol) for 6 days after burn, not only reduced the number of LSKs and MafB + cells in multipotent progenitors, but also influenced myelo-erythroid bifurcation by increasing the MEPs and reducing the granulocyte monocyte progenitors in the bone marrow of burn mice. Furthermore, similar results were observed in burn patients' peripheral blood mononuclear cell-derived ex vivo culture system, demonstrating that commitment stage of erythropoiesis is impaired in burn patients and intervention with propranolol (nonselective β1,2-adrenergic blocker) increases MEPs. Also, MafB + cells that were significantly increased following standard burn care could be mitigated when propranolol was administered to burn patients, establishing the mechanistic regulation of erythroid commitment by myeloid regulatory transcription factor MafB. Overall, results demonstrate that β-adrenergic blockers following burn injury can redirect the hematopoietic commitment toward erythroid lineage by lowering MafB expression in multipotent progenitors and be of potential therapeutic value to increase erythropoietin responsiveness in burn patients. Copyright © 2017 the American Physiological Society.
Gamma-interferon alters globin gene expression in neonatal and adult erythroid cells
International Nuclear Information System (INIS)
Miller, B.A.; Perrine, S.P.; Antognetti, G.; Perlmutter, D.H.; Emerson, S.G.; Sieff, C.; Faller, D.V.
1987-01-01
The effect of gamma-interferon on fetal hemoglobin synthesis by purified cord blood, fetal liver, and adult bone marrow erythroid progenitors was studied with a radioligand assay to measure hemoglobin production by BFU-E-derived erythroblasts. Coculture with recombinant gamma-interferon resulted in a significant and dose-dependent decrease in fetal hemoglobin production by neonatal and adult, but not fetal, BFU-E-derived erythroblasts. Accumulation of fetal hemoglobin by cord blood BFU-E-derived erythroblasts decreased up to 38.1% of control cultures (erythropoietin only). Synthesis of both G gamma/A gamma globin was decreased, since the G gamma/A gamma ratio was unchanged. Picograms fetal hemoglobin per cell was decreased by gamma-interferon addition, but picograms total hemoglobin was unchanged, demonstrating that a reciprocal increase in beta-globin production occurred in cultures treated with gamma-interferon. No toxic effect of gamma-interferon on colony growth was noted. The addition of gamma-interferon to cultures resulted in a decrease in the percentage of HbF produced by adult BFU-E-derived cells to 45.6% of control. Fetal hemoglobin production by cord blood, fetal liver, and adult bone marrow erythroid progenitors, was not significantly affected by the addition of recombinant GM-CSF, recombinant interleukin 1 (IL-1), recombinant IL-2, or recombinant alpha-interferon. Although fetal progenitor cells appear unable to alter their fetal hemoglobin program in response to any of the growth factors added here, the interaction of neonatal and adult erythroid progenitors with gamma-interferon results in an altered expression of globin genes
MULLER, EW; DEWOLF, JTM; HENDRIKS, DW; ESSELINK, MT; HALIE, MR; VELLENGA, E
The effect of mast cell growth factor (MGF) was studied on erythropoietin (Epo)-dependent and Epo-independent (''spontaneous'') erythroid colony formation in patients with polycythemia vera (PV). MGF stimulated both Epo-dependent and Epo-independent erythroid colony formation from PV peripheral
Directory of Open Access Journals (Sweden)
William P Lafuse
Full Text Available Leishmania donovani is a parasite that causes visceral leishmaniasis by infecting and replicating in macrophages of the bone marrow, spleen, and liver. Severe anemia and leucopenia is associated with the disease. Although immune defense mechanisms against the parasite have been studied, we have a limited understanding of how L. donovani alters hematopoiesis. In this study, we used Syrian golden hamsters to investigate effects of L. donovani infection on erythropoiesis. Infection resulted in severe anemia and leucopenia by 8 weeks post-infection. Anemia was associated with increased levels of serum erythropoietin, which indicates the hamsters respond to the anemia by producing erythropoietin. We found that infection also increased numbers of BFU-E and CFU-E progenitor populations in the spleen and bone marrow and differentially altered erythroid gene expression in these organs. In the bone marrow, the mRNA expression of erythroid differentiation genes (α-globin, β-globin, ALAS2 were inhibited by 50%, but mRNA levels of erythroid receptor (c-kit, EpoR and transcription factors (GATA1, GATA2, FOG1 were not affected by the infection. This suggests that infection has a negative effect on differentiation of erythroblasts. In the spleen, erythroid gene expression was enhanced by infection, indicating that the anemia activates a stress erythropoiesis response in the spleen. Analysis of cytokine mRNA levels in spleen and bone marrow found that IFN-γ mRNA is highly increased by L. donovani infection. Expression of the IFN-γ inducible cytokine, TNF-related apoptosis-inducing ligand (TRAIL, was also up-regulated. Since TRAIL induces erythroblasts apoptosis, apoptosis of bone marrow erythroblasts from infected hamsters was examined by flow cytometry. Percentage of erythroblasts that were apoptotic was significantly increased by L. donovani infection. Together, our results suggest that L. donovani infection inhibits erythropoiesis in the bone marrow by
Fusion of ZMYND8 and RELA genes in acute erythroid leukemia
DEFF Research Database (Denmark)
Panagopoulos, Ioannis; Micci, Francesca; Thorsen, Jim
2013-01-01
Acute erythroid leukemia was diagnosed in a 4-month-old boy. Cytogenetic analysis of bone marrow (BM) cells showed a t(11;20)(p11;q11) translocation. RNA extracted from the BM was sequenced and analyzed for fusion transcripts using the software FusionMap. A ZMYND8-RELA fusion was ranked first. RT...
Indian hedgehog (Ihh) both promotes and restricts thymocyte differentiation.
Outram, Susan V; Hager-Theodorides, Ariadne L; Shah, Divya K; Rowbotham, Nicola J; Drakopoulou, Ekati; Ross, Susan E; Lanske, Beate; Dessens, Johannes T; Crompton, Tessa
2009-03-05
We show that Indian Hedgehog (Ihh) regulates T-cell development and homeostasis in both fetal and adult thymus, controlling thymocyte number. Fetal Ihh(-/-) thymi had reduced differentiation to double-positive (DP) cell and reduced cell numbers compared with wild-type littermates. Surprisingly, fetal Ihh(+/-) thymi had increased thymocyte numbers and proportion of DP cells relative to wild type, indicating that Ihh also negatively regulates thymocyte development. In vitro treatment of thymus explants with exogenous recombinant Hedgehog protein promoted thymocyte development in Ihh(-/-) thymi but inhibited thymocyte development in Ihh(+/-), confirming both positive and negative regulatory functions of Ihh. Analysis of Rag(-/-)Ihh(+/-) thymi showed that Ihh promotes T-cell development before pre-T-cell receptor (pre-TCR) signaling, but negatively regulates T-cell development only after pre-TCR signaling has taken place. We show that Ihh is most highly expressed by the DP population and that Ihh produced by DP cells feeds back to negatively regulate the differentiation and proliferation of their double-negative progenitors. Thus, differentiation from double-negative to DP cell, and hence the size of the DP population, is dependent on the concentration of Ihh in the thymus. Analysis of Ihh conditional knockout and heterozygote adult mice showed that Ihh also influences thymocyte number in the adult.
Vascular Mural Cells Promote Noradrenergic Differentiation of Embryonic Sympathetic Neurons
Directory of Open Access Journals (Sweden)
Vitor Fortuna
2015-06-01
Full Text Available The sympathetic nervous system controls smooth muscle tone and heart rate in the cardiovascular system. Postganglionic sympathetic neurons (SNs develop in close proximity to the dorsal aorta (DA and innervate visceral smooth muscle targets. Here, we use the zebrafish embryo to ask whether the DA is required for SN development. We show that noradrenergic (NA differentiation of SN precursors temporally coincides with vascular mural cell (VMC recruitment to the DA and vascular maturation. Blocking vascular maturation inhibits VMC recruitment and blocks NA differentiation of SN precursors. Inhibition of platelet-derived growth factor receptor (PDGFR signaling prevents VMC differentiation and also blocks NA differentiation of SN precursors. NA differentiation is normal in cloche mutants that are devoid of endothelial cells but have VMCs. Thus, PDGFR-mediated mural cell recruitment mediates neurovascular interactions between the aorta and sympathetic precursors and promotes their noradrenergic differentiation.
International Nuclear Information System (INIS)
Xie, Xin; Dai, Hui; Zhuang, Binyu; Chai, Li; Xie, Yanguang; Li, Yuzhen
2016-01-01
The effects and the underlying mechanisms of hydrogen sulfide (H 2 S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H 2 S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H 2 S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H 2 S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H 2 S promotes keratinocyte proliferation and differentiation. • The effects of H 2 S on proliferation and differentiation is modulated by autophagy. • Exogenous H 2 S has no effect on keratinocyte apoptosis.
Interleukin-33 promoting Th1 lymphocyte differentiation dependents on IL-12.
Komai-Koma, Mousa; Wang, Eryi; Kurowska-Stolarska, Mariola; Li, Dong; McSharry, Charles; Xu, Damo
2016-03-01
The pro-Th2 cytokine IL-33 is now emerging as an important Th1 cytokine-IFN-γ inducer in murine CD4(+) T cells that is essential for protective cell-mediated immunity against viral infection in mice. However, whether IL-33 can promote human Th1 cell differentiation and how IL-33 polarizes Th1 cells is less understood. We assessed the ability of IL-33 to induce Th1 cell differentiation and IFN-γ production in vitro and in vivo. We report here that IL-33 alone had no ability in Th1 cell polarization. However it potentiated IL-12-mediated Th1 cell differentiation and IFN-γ production in TCR-stimulated murine and human CD4(+) T cells in vitro and in vivo. IL-33 promoted Th1 cell development via MyD88 and synergized with IL-12 to enhance St2 and IL-12R expression in CD4(+) T cells. These data therefore provide a novel mechanism for Th1 cell differentiation and optimal induction of a Type 1 response. Thus, IL-33 is capable of inducing IL-12-dependent Th1 cell differentiation in human and mouse CD4(+) T cells. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
Vascular Mural Cells Promote Noradrenergic Differentiation of Embryonic Sympathetic Neurons.
Fortuna, Vitor; Pardanaud, Luc; Brunet, Isabelle; Ola, Roxana; Ristori, Emma; Santoro, Massimo M; Nicoli, Stefania; Eichmann, Anne
2015-06-23
The sympathetic nervous system controls smooth muscle tone and heart rate in the cardiovascular system. Postganglionic sympathetic neurons (SNs) develop in close proximity to the dorsal aorta (DA) and innervate visceral smooth muscle targets. Here, we use the zebrafish embryo to ask whether the DA is required for SN development. We show that noradrenergic (NA) differentiation of SN precursors temporally coincides with vascular mural cell (VMC) recruitment to the DA and vascular maturation. Blocking vascular maturation inhibits VMC recruitment and blocks NA differentiation of SN precursors. Inhibition of platelet-derived growth factor receptor (PDGFR) signaling prevents VMC differentiation and also blocks NA differentiation of SN precursors. NA differentiation is normal in cloche mutants that are devoid of endothelial cells but have VMCs. Thus, PDGFR-mediated mural cell recruitment mediates neurovascular interactions between the aorta and sympathetic precursors and promotes their noradrenergic differentiation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Xie, Xin [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Dai, Hui [Department of Cardiology, The First Affiliated Hospital of Harbin Medical University, Harbin, 150001, Heilongjiang Province (China); Zhuang, Binyu [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China); Chai, Li; Xie, Yanguang [Institute of Dermatology of Heilongjiang Province, Harbin, 150001, Heilongjiang Province (China); Li, Yuzhen, E-mail: liyuzhen@medmail.com.cn [Department of Dermatology, The Second Affiliated Hospital of Harbin Medical University, Harbin, 150086, Heilongjiang Province (China)
2016-04-08
The effects and the underlying mechanisms of hydrogen sulfide (H{sub 2}S) on keratinocyte proliferation and differentiation are still less known. In the current study, we investigated the effects and the underlying mechanisms of exogenous H{sub 2}S on keratinocyte proliferation and differentiation. Human keratinocytes (HaCaT cells) were treated with various concentrations (0.05, 0.25, 0.5 and 1 mM) of sodium hydrosulfide (NaHS, a donor of H{sub 2}S) for 24 h. A CCK-8 assay was used to assess cell viability. Western blot analysis was performed to determine the expression levels of proteins associated with differentiation and autophagy. Transmission electron microscopy was performed to observe autophagic vacuoles, and flow cytometry was applied to evaluate apoptosis. NaHS promoted the viability, induced the differentiation, and enhanced autophagic activity in a dose-dependent manner in HaCaT cells but had no effect on cell apoptosis. Blockage of autophagy by ATG5 siRNA inhibited NaHS-induced cell proliferation and differentiation. The current study demonstrated that autophagy in response to exogenous H{sub 2}S treatment promoted keratinocyte proliferation and differentiation. Our results provide additional insights into the potential role of autophagy in keratinocyte proliferation and differentiation. - Highlights: • Exogenous H{sub 2}S promotes keratinocyte proliferation and differentiation. • The effects of H{sub 2}S on proliferation and differentiation is modulated by autophagy. • Exogenous H{sub 2}S has no effect on keratinocyte apoptosis.
Hildén, K; Tuuri, T; Erämaa, M; Ritvos, O
1999-07-20
Activins were originally isolated based on their ability to stimulate follicle-stimulating hormone secretion but later they have been shown to regulate a number of different cellular functions such as nerve cell survival, mesoderm induction during early embryogenesis as well as hematopoiesis. We studied the regulation of activin A, a homodimer of betaA-subunits, mRNA and protein in K562 erythroleukemia cells, which are known to be induced toward the erythroid lineage in response to activin or TGF-beta or toward the megakaryocytic lineage by the phorbol ester protein kinase C activator 12-O-tetradecanoylphorbol-13-acetate (TPA). Here we show by Northern blot analysis as well as by Western and ligand blotting that TPA strongly promotes activin betaA-subunit mRNA and activin A protein expression in K562 cells in time- and concentration dependent manner. In contrast, neither activin A nor TGF-beta induced betaA-subunit mRNA expression during erythroid differentiation in K562 cells. Interestingly, whereas activin type II receptors are not regulated during K562 cell differentiation (Hilden et al. (1994) Blood 83, 2163-2170), we now show that the activin type I and IB receptor mRNAs are clearly induced by TPA but not by activin or TGF-beta. We also show that the inducing effect of TPA on expression of activin betaA-subunit mRNA is potentiated by the protein kinase A activator 8-bromo-cAMP. We conclude that activin A and its type I receptors appear to be co-ordinately up-regulated during megakaryocytic differentiation of K562 cells.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Methylation of miR-145a-5p promoter mediates adipocytes differentiation
Energy Technology Data Exchange (ETDEWEB)
Du, Jingjing; Cheng, Xiao; Shen, Linyuan; Tan, Zhendong; Luo, Jia; Wu, Xiaoqian; Liu, Chendong [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Yang, Qiong [Department of Animal Husbandry and Veterinary Medicine, Chengdu Agricultural College, Chengdu 611100, Sichuan (China); Jiang, Yanzhi [College of Life and Science, Sichuan Agricultural University, Chengdu 611130 (China); Tang, Guoqing; Li, Xuewei [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhang, Shunhua, E-mail: zhangsh1919@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhu, Li, E-mail: zhuli7508@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China)
2016-06-17
MicroRNAs (miRNAs, miR) play important roles in adipocyte development. Recent studies showed that the expression of several miRNAs is closely related with promoter methylation. However, it is not known whether miRNA mediates adipocytes differentiation by means of DNA methylation. Here, we showed that miR-145a-5p was poorly expressed in adipose tissue from mice fed a high fat diet (HFD). Overexpression or inhibition of miR-145a-5p was unfavorable or beneficial, respectively, for adipogenesis, and these effects were achieved by regulating adipocyte-specific genes involved in lipogenic transcription, fatty acid synthesis, and fatty acid transportation. Particularly, we first suggested that miR-145a-5p mimics or inhibitors promoted or repressed adipocytes proliferation by regulating p53 and p21, which act as cell cycle regulating factors. Surprisingly, the miR-145a-5p-repressed adipocyte differentiation was enhanced or rescued when cells treated with 5-Aza-dC were transfected with miR-145a-5p mimics or inhibitors, respectively. These data indicated that, as a new mean to positively regulate adipocyte proliferation, the process of miR-145a-5p-inhibited adipogenesis may be regulated by DNA methylation. -- Highlights: •MiR-145a-5p promotes adipocytes proliferation. •MiR-145a-5p is negatively correlated with obesity. •MiR-145a-5p mediates adipocytes differentiation via regulating pathway related adipocytes differentiation. MiR-145a-5p mediating adipocytes differentiation was regulated by DNA methylation.
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
Erythroid cells in vitro: from developmental biology to blood transfusion products.
Migliaccio, Anna Rita; Whitsett, Carolyn; Migliaccio, Giovanni
2009-07-01
Red blood cells (RBCs) transfusion plays a critical role in numerous therapies. Disruption of blood collection by political unrest, natural disasters and emerging infections and implementation of restrictions on the use of erythropoiesis-stimulating agents in cancer may impact blood availability in the near future. These considerations highlight the importance of developing alternative blood products. Knowledge about the processes that control RBC production has been applied to the establishment of culture conditions allowing ex-vivo generation of RBCs in numbers close to those (2.5 x 10 cells/ml) present in a transfusion, from cord blood, donated blood units or embryonic stem cells. In addition, experimental studies demonstrate that such cells protect mice from lethal bleeding. Therefore, erythroid cells generated ex vivo may be suitable for transfusion provided they can be produced safely in adequate numbers. However, much remains to be done to translate a theoretical production of approximately 2.5 x 10 RBCs in the laboratory into a 'clinical grade production process'. This review summarizes the state-of-the-art in establishing ex-vivo culture conditions for erythroid cells and discusses the most compelling issues to be addressed to translate this progress into a clinical grade transfusion product.
Huang, Xinghua; Chen, Mo; Ding, Yan; Wang, Qin
2017-03-01
Neuronal hearing loss has become a prevalent health problem. This study focused on the function of arctigenin (ARC) in promoting survival and neuronal differentiation of mouse cochlear neural stem cells (NSCs), and its protection against gentamicin (GMC) induced neuronal hearing loss. Mouse cochlea was used to isolate NSCs, which were subsequently cultured in vitro. The effects of ARC on NSC survival, neurosphere formation, differentiation of NSCs, neurite outgrowth, and neural excitability in neuronal network in vitro were examined. Mechanotransduction ability demonstrated by intact cochlea, auditory brainstem response (ABR), and distortion product optoacoustic emissions (DPOAE) amplitude in mice were measured to evaluate effects of ARC on GMC-induced neuronal hearing loss. ARC increased survival, neurosphere formation, neuron differentiation of NSCs in mouse cochlear in vitro. ARC also promoted the outgrowth of neurites, as well as neural excitability of the NSC-differentiated neuron culture. Additionally, ARC rescued mechanotransduction capacity, restored the threshold shifts of ABR and DPOAE in our GMC ototoxicity murine model. This study supports the potential therapeutic role of ARC in promoting both NSCs proliferation and differentiation in vitro to functional neurons, thus supporting its protective function in the therapeutic treatment of neuropathic hearing loss in vivo. © 2017 Wiley Periodicals, Inc.
Reduction of erythroid progenitors in protein-energy malnutrition.
Borelli, Primavera; Blatt, Solange; Pereira, Juliana; de Maurino, Beatriz Beutler; Tsujita, Maristela; de Souza, Ana Cristina; Xavier, José Guilherme; Fock, Ricardo Ambrósio
2007-02-01
Protein-energy malnutrition is a syndrome in which anaemia together with multivitamin and mineral deficiency may be present. The pathophysiological mechanisms involved have not, however, yet been completely elucidated. The aim of the present study was to evaluate the pathophysiological processes that occur in this anaemia in animals that were submitted to protein-energy malnutrition, in particular with respect to Fe concentration and the proliferative activity of haemopoietic cells. For this, histological, histochemical, cell culture and immunophenotyping techniques were used. Two-month-old male Swiss mice were submitted to protein-energy malnutrition with a low-protein diet (20 g/kg) compared with control diet (400 g/kg). When the experimental group had attained a 20 % loss of their original body weight, the animals from both groups received, intravenously, 20 IU erythropoietin every other day for 14 d. Malnourished animals showed a decrease in red blood cells, Hb concentration and reticulocytopenia, as well as severe bone marrow and splenic atrophy. The results for serum Fe, total Fe-binding capacity, transferrin and erythropoietin in malnourished animals were no different from those of the control animals. Fe reserves in the spleen, liver and bone marrow were found to be greater in the malnourished animals. The mixed colony-forming unit assays revealed a smaller production of granulocyte-macrophage colony-forming units, erythroid burst-forming units, erythroid colony-forming units and CD45, CD117, CD119 and CD71 expression in the bone marrow and spleen cells of malnourished animals. These findings suggest that, in this protein-energy malnutrition model, anaemia is not caused by Fe deficiency or erythropoietin deficiency, but is a result of ineffective erythropoiesis.
Alternans promotion in cardiac electrophysiology models by delay differential equations.
Gomes, Johnny M; Dos Santos, Rodrigo Weber; Cherry, Elizabeth M
2017-09-01
Cardiac electrical alternans is a state of alternation between long and short action potentials and is frequently associated with harmful cardiac conditions. Different dynamic mechanisms can give rise to alternans; however, many cardiac models based on ordinary differential equations are not able to reproduce this phenomenon. A previous study showed that alternans can be induced by the introduction of delay differential equations (DDEs) in the formulations of the ion channel gating variables of a canine myocyte model. The present work demonstrates that this technique is not model-specific by successfully promoting alternans using DDEs for five cardiac electrophysiology models that describe different types of myocytes, with varying degrees of complexity. By analyzing results across the different models, we observe two potential requirements for alternans promotion via DDEs for ionic gates: (i) the gate must have a significant influence on the action potential duration and (ii) a delay must significantly impair the gate's recovery between consecutive action potentials.
Alternans promotion in cardiac electrophysiology models by delay differential equations
Gomes, Johnny M.; dos Santos, Rodrigo Weber; Cherry, Elizabeth M.
2017-09-01
Cardiac electrical alternans is a state of alternation between long and short action potentials and is frequently associated with harmful cardiac conditions. Different dynamic mechanisms can give rise to alternans; however, many cardiac models based on ordinary differential equations are not able to reproduce this phenomenon. A previous study showed that alternans can be induced by the introduction of delay differential equations (DDEs) in the formulations of the ion channel gating variables of a canine myocyte model. The present work demonstrates that this technique is not model-specific by successfully promoting alternans using DDEs for five cardiac electrophysiology models that describe different types of myocytes, with varying degrees of complexity. By analyzing results across the different models, we observe two potential requirements for alternans promotion via DDEs for ionic gates: (i) the gate must have a significant influence on the action potential duration and (ii) a delay must significantly impair the gate's recovery between consecutive action potentials.
International Nuclear Information System (INIS)
Wang, Shengchao; Kawashima, Nobuyuki; Sakamoto, Kei; Katsube, Ken-ichi; Umezawa, Akihiro; Suda, Hideaki
2010-01-01
Research highlights: → High Rbpj mRNA expression was observed in mesenchymal cells surrounding the bone of mouse embryos. → Overexpression of Rbpj depressed Notch-Hes1/Hey1 signaling. → Rbpj upregulated promoter activities of Runx2 and Ose2. → Rbpj promoted osteoblastic differentiation/maturation in Kusa-A1 cells. -- Abstract: Pluripotent mesenchymal stem cells possess the ability to differentiate into many cell types, but the precise mechanisms of differentiation are still unclear. Here, we provide evidence that Rbpj (recombination signal-binding protein for immunoglobulin kappa j region) protein, the primary nuclear mediator of Notch, is involved in osteogenesis. Overexpression of Rbpj promoted osteogenic differentiation of mouse Kusa-A1 cells in vitro and in vivo. Transient transfection of an Rbpj expression vector into Kusa-A1 cells upregulated promoter activities of Runx2 and Ose2. Enhanced osteogenic potentials including high alkaline phosphatase activity, rapid calcium deposition, and increased calcified nodule formation, were observed in established stable Rbpj-overexpressing Kusa-A1 (Kusa-A1/Rbpj) cell line. In vivo mineralization by Kusa-A1/Rbpj was promoted compared to that by Kusa-A1 host cells. Histological findings revealed that expression of Rbpj was primarily observed in osteoblasts. These results suggest that Rbpj may play essential roles in osteoblast differentiation.
Energy Technology Data Exchange (ETDEWEB)
Wang, Shengchao [Department of Preventive Dentistry, School of Stomatology, The Fourth Military Medical University, 145 West Changle Road, 710032 Xi' an (China); Kawashima, Nobuyuki, E-mail: kawashima.n.endo@tmd.ac.jp [Department of Pulp Biology and Endodontics, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549 (Japan); Sakamoto, Kei; Katsube, Ken-ichi [Department of Oral Pathology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549 (Japan); Umezawa, Akihiro [Department of Reproductive Biology and Pathology, National Institute for Child Health and Development, 2-10-4 Ohkura, Setagaya-ku, Tokyo 157-8535 (Japan); Suda, Hideaki [Department of Pulp Biology and Endodontics, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549 (Japan); GCOE Program, International Research Center for Molecular Science in Tooth and Bone Diseases, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549 (Japan)
2010-09-10
Research highlights: {yields} High Rbpj mRNA expression was observed in mesenchymal cells surrounding the bone of mouse embryos. {yields} Overexpression of Rbpj depressed Notch-Hes1/Hey1 signaling. {yields} Rbpj upregulated promoter activities of Runx2 and Ose2. {yields} Rbpj promoted osteoblastic differentiation/maturation in Kusa-A1 cells. -- Abstract: Pluripotent mesenchymal stem cells possess the ability to differentiate into many cell types, but the precise mechanisms of differentiation are still unclear. Here, we provide evidence that Rbpj (recombination signal-binding protein for immunoglobulin kappa j region) protein, the primary nuclear mediator of Notch, is involved in osteogenesis. Overexpression of Rbpj promoted osteogenic differentiation of mouse Kusa-A1 cells in vitro and in vivo. Transient transfection of an Rbpj expression vector into Kusa-A1 cells upregulated promoter activities of Runx2 and Ose2. Enhanced osteogenic potentials including high alkaline phosphatase activity, rapid calcium deposition, and increased calcified nodule formation, were observed in established stable Rbpj-overexpressing Kusa-A1 (Kusa-A1/Rbpj) cell line. In vivo mineralization by Kusa-A1/Rbpj was promoted compared to that by Kusa-A1 host cells. Histological findings revealed that expression of Rbpj was primarily observed in osteoblasts. These results suggest that Rbpj may play essential roles in osteoblast differentiation.
Novel hydrated graphene ribbon unexpectedly promotes aged seed germination and root differentiation
Hu, Xiangang; Zhou, Qixing
2014-01-01
It is well known that graphene (G) induces nanotoxicity towards living organisms. Here, a novel and biocompatible hydrated graphene ribbon (HGR) unexpectedly promoted aged (two years) seed germination. HGR formed at the normal temperature and pressure (120 days hydration), presented 17.1% oxygen, 0.9% nitrogen groups, disorder-layer structure, with 0.38 nm thickness ribbon morphology. Interestingly, there were bulges around the edges of HGR. Compared to G and graphene oxide (GO), HGR increased seed germination by 15% root differentiation between 52 and 59% and enhanced resistance to oxidative stress. The metabonomics analysis discovered that HGR upregulated carbohydrate, amino acid, and fatty acids metabolism that determined secondary metabolism, nitrogen sequestration, cell membrane integrity, permeability, and oxidation resistance. Hexadecanoic acid as a biomarker promoted root differentiation and increased the germination rate. Our discovery is a novel HGR that promotes aged seed germination, illustrates metabolic specificity among graphene-based materials, and inspires innovative concepts in the regulation of seed development.
Yang, Wanlei; Han, Weiqi; He, Wei; Li, Jianlei; Wang, Jirong; Feng, Haotian; Qian, Yu
2016-03-01
Effective and safe induction of osteogenic differentiation is one of the key elements of bone tissue engineering. Surface topography of scaffold materials was recently found to promote osteogenic differentiation. Utilization of this topography may be a safer approach than traditional induction by growth factors or chemicals. The aim of this study is to investigate the enhancement of osteogenic differentiation by surface topography and its mechanism of action. Hydroxyapatite (HA) discs with average roughness (Ra) of surface topography ranging from 0.2 to 1.65 μm and mean distance between peaks (RSm) ranging from 89.7 to 18.6 μm were prepared, and human bone-marrow mesenchymal stem cells (hBMSCs) were cultured on these discs. Optimal osteogenic differentiation was observed on discs with surface topography characterized by Ra ranging from 0.77 to 1.09 μm and RSm ranging from 53.9 to 39.3 μm. On this surface configuration of HA, hBMSCs showed oriented attachment, F-actin arrangement, and a peak in the expression of Yes-associated protein (YAP) and PDZ binding motif (TAZ) (YAP/TAZ). These results indicated that the surface topography of HA promoted osteogenic differentiation of hBMSCs, possibly by increasing cell attachment and promoting the YAP/TAZ signaling pathway. Copyright © 2015 Elsevier B.V. All rights reserved.
Du, C; Xu, Y; Yang, K; Chen, S; Wang, X; Wang, S; Wang, C; Shen, M; Chen, F; Chen, M; Zeng, D; Li, F; Wang, T; Wang, F; Zhao, J; Ai, G; Cheng, T; Su, Y; Wang, J
2017-04-01
Estrogen is reported to be involved in thrombopoiesis and the disruption of its signaling may cause myeloproliferative disease, yet the underlying mechanisms remain largely unknown. GATA-binding factor 1 (GATA1) is a key regulator of megakaryocyte (MK) differentiation and its deficiency will lead to megakaryoblastic leukemia. Here we show that estrogen can dose-dependently promote MK polyploidization and maturation via activation of estrogen receptor beta (ERβ), accompanied by a significant upregulation of GATA1. Chromatin immunoprecipitation and a dual luciferase assay demonstrate that ERβ can directly bind the promoter region of GATA1 and activate its transcription. Steroid receptor coactivator 3 (SRC3) is involved in ERβ-mediated GATA1 transcription. The deficiency of ERβ or SRC3, similar to the inhibition of GATA1, leads to the impediment of estrogen-induced MK polyploidization and platelet production. Further investigations reveal that signal transducer and activator of transcription 1 signaling pathway downstream of GATA1 has a crucial role in estrogen-induced MK polyploidization, and ERβ-mediated GATA1 upregulation subsequently enhances nuclear factor erythroid-derived 2 expression, thereby promoting proplatelet formation and platelet release. Our study provides a deep insight into the molecular mechanisms of estrogen signaling in regulating thrombopoiesis and the pathogenesis of ER deficiency-related leukemia.
Directory of Open Access Journals (Sweden)
Mukesh K Gupta
Full Text Available Myocardial infarction results in extensive cardiomyocyte death which can lead to fatal arrhythmias or congestive heart failure. Delivery of stem cells to repopulate damaged cardiac tissue may be an attractive and innovative solution for repairing the damaged heart. Instructive polymer scaffolds with a wide range of properties have been used extensively to direct the differentiation of stem cells. In this study, we have optimized the chemical and mechanical properties of an electrospun polymer mesh for directed differentiation of embryonic stem cells (ESCs towards a cardiomyogenic lineage. A combinatorial polymer library was prepared by copolymerizing three distinct subunits at varying molar ratios to tune the physicochemical properties of the resulting polymer: hydrophilic polyethylene glycol (PEG, hydrophobic poly(ε-caprolactone (PCL, and negatively-charged, carboxylated PCL (CPCL. Murine ESCs were cultured on electrospun polymeric scaffolds and their differentiation to cardiomyocytes was assessed through measurements of viability, intracellular reactive oxygen species (ROS, α-myosin heavy chain expression (α-MHC, and intracellular Ca(2+ signaling dynamics. Interestingly, ESCs on the most compliant substrate, 4%PEG-86%PCL-10%CPCL, exhibited the highest α-MHC expression as well as the most mature Ca(2+ signaling dynamics. To investigate the role of scaffold modulus in ESC differentiation, the scaffold fiber density was reduced by altering the electrospinning parameters. The reduced modulus was found to enhance α-MHC gene expression, and promote maturation of myocyte Ca(2+ handling. These data indicate that ESC-derived cardiomyocyte differentiation and maturation can be promoted by tuning the mechanical and chemical properties of polymer scaffold via copolymerization and electrospinning techniques.
Effects of trichostatins on differentiation of murine erythroleukemia cells
International Nuclear Information System (INIS)
Yoshida, M.; Nomura, S.; Beppu, T.
1987-01-01
The fungistatic antibiotics trichostatins (TS) A and C were isolated from culture broth of Streptomyces platensis No. 145 and were found to be potent inducers of differentiation in murine erythroleukemia (Friend and RV133) cells at concentrations of 1.5 X 10(-8) M for TSA and 5 X 10(-7) M for TSC. Differentiation induced by TS was cooperatively enhanced by UV irradiation but not by treatment with dimethyl sulfoxide. This enhanced activity was completely inhibited by adding cycloheximide to the culture medium 2 h after exposure to TS, suggesting that TS are dimethyl sulfoxide-type inducers of erythroid differentiation. No inhibitory effect of TS was observed on macromolecular synthesis in cultured cells
Jin, Hao; Sood, Raman; Xu, Jin; Zhen, Fenghua; English, Milton A; Liu, P Paul; Wen, Zilong
2009-02-01
One unique feature of vertebrate definitive hematopoiesis is the ontogenic switching of hematopoietic stem cells from one anatomical compartment or niche to another. In mice, hematopoietic stem cells are believed to originate in the aorta-gonad-mesonephros (AGM), subsequently migrate to the fetal liver (FL) and finally colonize the bone marrow (BM). Yet, the differentiation potential of hematopoietic stem cells within early niches such as the AGM and FL remains incompletely defined. Here, we present in vivo analysis to delineate the differentiation potential of definitive hematopoietic stem/progenitor cells (HSPCs) in the zebrafish AGM and FL analogies, namely the ventral wall of dorsal aorta (VDA) and the posterior blood island (PBI), respectively. Cell fate mapping and analysis of zebrafish runx1(w84x) and vlad tepes (vlt(m651)) mutants revealed that HSPCs in the PBI gave rise to both erythroid and myeloid lineages. However, we surprisingly found that HSPCs in the VDA were not quiescent but were uniquely adapted to generate myeloid but not erythroid lineage cells. We further showed that such distinct differentiation output of HSPCs was, at least in part, ascribed to the different micro-environments present in these two niches. Our results highlight the importance of niche in shaping the differentiation output of developing HSPCs.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Shiwen [Department of Mechanical Engineering, Faculty of Engineering and Department of Biochemistry & Genetics, Faculty of Medicine and Manitoba Institute of Child Health, The University of Manitoba, Winnipeg, Manitoba (Canada); Children Hospital Research Institute of Manitoba, Winnipeg (Canada); Sichuan University, Chengdu (China); Xu, Kaige; Darabi, Mohammad Ali [Children Hospital Research Institute of Manitoba, Winnipeg (Canada); Yuan, Quan [Sichuan University, Chengdu (China); Xing, Malcolm [Department of Mechanical Engineering, Faculty of Engineering and Department of Biochemistry & Genetics, Faculty of Medicine and Manitoba Institute of Child Health, The University of Manitoba, Winnipeg, Manitoba (Canada)
2016-12-01
Alginate hydrogels have been used in cell encapsulation for many years but a prevalent issue with pure alginates is that they are unable to provide enough bioactive properties to interact with mammalian cells. This paper discusses the modification of alginate with mussel-inspired dopamine for cell loading and anti-infection. Mouse bone marrow stem cells were immobilized into alginate and alginate-dopamine beads and fibers. Through live-dead and MTT assay, alginates modified by dopamine promoted cell viability and proliferation. In vitro cell differentiation results showed that such an alginate-dopamine gel can promote the osteogenic differentiation of mesenchymal stem cell after PCR and ALP assays. In addition to that, the adhesive prosperities of dopamine allowed for coating the surface of alginate-dopamine gel with silver nanoparticles, which provided the gel with significant antibacterial characteristics. Overall, these results demonstrate that a dopamine-modified alginate gel can be a great tool for cell encapsulation to promote cell proliferation and can be applied to bone regeneration, especially in contaminated bone defects. - Highlights: • Dopamine modified alginate bead and fiber promote cell viability and proliferation. • Alginate-dopamine gel promotes osteogenic differentiation of MSCs. • Dopamine reduced nanosilver for anti-infection. • Alginate-dopamine bead and fiber for delivery of mesenchymal stem cells (MSCs)
International Nuclear Information System (INIS)
Zhang, Shiwen; Xu, Kaige; Darabi, Mohammad Ali; Yuan, Quan; Xing, Malcolm
2016-01-01
Alginate hydrogels have been used in cell encapsulation for many years but a prevalent issue with pure alginates is that they are unable to provide enough bioactive properties to interact with mammalian cells. This paper discusses the modification of alginate with mussel-inspired dopamine for cell loading and anti-infection. Mouse bone marrow stem cells were immobilized into alginate and alginate-dopamine beads and fibers. Through live-dead and MTT assay, alginates modified by dopamine promoted cell viability and proliferation. In vitro cell differentiation results showed that such an alginate-dopamine gel can promote the osteogenic differentiation of mesenchymal stem cell after PCR and ALP assays. In addition to that, the adhesive prosperities of dopamine allowed for coating the surface of alginate-dopamine gel with silver nanoparticles, which provided the gel with significant antibacterial characteristics. Overall, these results demonstrate that a dopamine-modified alginate gel can be a great tool for cell encapsulation to promote cell proliferation and can be applied to bone regeneration, especially in contaminated bone defects. - Highlights: • Dopamine modified alginate bead and fiber promote cell viability and proliferation. • Alginate-dopamine gel promotes osteogenic differentiation of MSCs. • Dopamine reduced nanosilver for anti-infection. • Alginate-dopamine bead and fiber for delivery of mesenchymal stem cells (MSCs)
Moon, Mi-Young; Kim, Hyun Jung; Choi, Bo Young; Sohn, Min; Chung, Tae Nyoung; Suh, Sang Won
2018-01-01
Zinc is an essential element required for cell division, migration, and proliferation. Under zinc-deficient conditions, proliferation and differentiation of neural progenitors are significantly impaired. Adipose-derived mesenchymal stem cells (AD-MSCs) are multipotent stem cells that can differentiate into neurons. The aim of this study was to evaluate the effect of zinc on AD-MSC proliferation and differentiation. We initially examined the effect of zinc on stem cell proliferation at the undifferentiated stage. AD-MSCs showed high proliferation rates on day 6 in 30 μ M and 100 μ M of ZnCl 2 . Zinc chelation inhibited AD-MSC proliferation via downregulation of ERK1/2 activity. We then assessed whether zinc was involved in cell migration and neurite outgrowth during differentiation. After three days of neuronal differentiation, TUJ-1-positive cells were observed, implying that AD-MSCs had differentiated into early neuron or neuron-like cells. Neurite outgrowth was increased in the zinc-treated group, while the CaEDTA-treated group showed diminished, shrunken neurites. Furthermore, we showed that zinc promoted neurite outgrowth via the inactivation of RhoA and led to the induction of neuronal gene expression (MAP2 and nestin) in differentiated stem cells. Taken together, zinc promoted AD-MSC proliferation and affected neuronal differentiation, mainly by increasing neurite outgrowth.
Directory of Open Access Journals (Sweden)
Mi-Young Moon
2018-01-01
Full Text Available Zinc is an essential element required for cell division, migration, and proliferation. Under zinc-deficient conditions, proliferation and differentiation of neural progenitors are significantly impaired. Adipose-derived mesenchymal stem cells (AD-MSCs are multipotent stem cells that can differentiate into neurons. The aim of this study was to evaluate the effect of zinc on AD-MSC proliferation and differentiation. We initially examined the effect of zinc on stem cell proliferation at the undifferentiated stage. AD-MSCs showed high proliferation rates on day 6 in 30 μM and 100 μM of ZnCl2. Zinc chelation inhibited AD-MSC proliferation via downregulation of ERK1/2 activity. We then assessed whether zinc was involved in cell migration and neurite outgrowth during differentiation. After three days of neuronal differentiation, TUJ-1-positive cells were observed, implying that AD-MSCs had differentiated into early neuron or neuron-like cells. Neurite outgrowth was increased in the zinc-treated group, while the CaEDTA-treated group showed diminished, shrunken neurites. Furthermore, we showed that zinc promoted neurite outgrowth via the inactivation of RhoA and led to the induction of neuronal gene expression (MAP2 and nestin in differentiated stem cells. Taken together, zinc promoted AD-MSC proliferation and affected neuronal differentiation, mainly by increasing neurite outgrowth.
Kawaii, Satoru; Lansky, Ephraim P
2004-01-01
Differentiation refers to the ability of cancer cells to revert to their normal counterparts, and its induction represents an important noncytotoxic therapy for leukemia, and also breast, prostate, and other solid malignancies. Flavonoids are a group of differentiation-inducing chemicals with a potentially lower toxicology profile than retinoids. Flavonoid-rich polyphenol fractions from the pomegranate (Punica granatum) fruit exert anti-proliferative, anti-invasive, anti-eicosanoid, and pro-apoptotic actions in breast and prostate cancer cells and anti-angiogenic activities in vitro and in vivo. Here we tested flavonoid-rich fractions from fresh (J) and fermented (W) pomegranate juice and from an aqueous extraction of pomegranate pericarps (P) as potential differentiation-promoting agents of human HL-60 promyelocytic leukemia cells. Four assays were used to assess differentiation: nitro blue tetrazolium reducing activity, nonspecific esterase activity, specific esterase activity, and phagocytic activity. In addition, the effect of these extracts on HL-60 proliferation was evaluated. Extracts W and P were strong promoters of differentiation in all settings, with extract J showing only a relatively mild differentiation-promoting effect. The extracts had proportional inhibitory effects on HL-60 cell proliferation. The results highlight an important, previously unknown, mechanism of the cancer preventive and suppressive potential of pomegranate fermented juice and pericarp extracts.
Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming
2017-05-01
Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.
Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.
2015-01-01
Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726
Wnt-10b secreted from lymphocytes promotes differentiation of skin epithelial cells
International Nuclear Information System (INIS)
Ouji, Yukiteru; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki
2006-01-01
Wnt-10b was originally isolated from lymphoid tissue and is known to be involved in a wide range of biological actions, while recently it was found to be expressed early in the development of hair follicles. However, few studies have been conducted concerning the role of Wnt-10b with the differentiation of skin epithelial cells. To evaluate its role in epithelial differentiation, we purified Wnt-10b from the supernatant of a concanavalin A-stimulated lymphocyte culture using an affinity column and investigated its effects on the differentiation of adult mouse-derived primary skin epithelial cells (MPSEC). MPSEC cultured with Wnt-10b showed morphological changes from cuboidal to spindle-shaped with inhibited proliferation, and also obtained characteristics of the hair shaft and inner root sheath of the hair follicle, represented by red-colored Ayoub Shklar staining, and reactions to AE-13 and AE-15 as seen with immunocytology. Further, RT-PCR analysis demonstrated the expression of mRNA for keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5, in Wnt-10b-treated MPSEC. In addition, involvement of the canonical Wnt signal pathway was demonstrated by a TCF reporter (pTOPFLASH) assay. These results suggest that Wnt-10b promotes the differentiation of MPSEC and may play an important role in hair follicle development by promoting differentiation of epithelial cells
Gao, Yi-ning; Wang, Dan-ying; Pan, Zong-fu; Mei, Yu-qin; Wang, Zhi-qiang; Zhu, Dan-yan; Lou, Yi-jia
2012-07-01
To set up a platform for phenotype-based primary screening of drug candidates promoting neuronal subtype differentiation in embryonic stem cells (ES) with light microscope. Hanging drop culture 4-/4+ method was employed to harvest the cells around embryoid body (EB) at differentiation endpoint. Morphological evaluation for neuron-like cells was performed with light microscope. Axons for more than three times of the length of the cell body were considered as neuron-like cells. The compound(s) that promote neuron-like cells was further evaluated. Icariin (ICA, 10(-6)mol/L) and Isobavachin (IBA, 10(-7)mol/L) were selected to screen the differentiation-promoting activity on ES cells. Immunofluorescence staining with specific antibodies (ChAT, GABA) was used to evaluate the neuron subtypes. The cells treated with IBA showed neuron-like phenotype, but the cells treated with ICA did not exhibit the morphological changes. ES cells treated with IBA was further confirmed to be cholinergic and GABAergic neurons. Phenotypic screening with light microscope for molecules promoting neuronal differentiation is an effective method with advantages of less labor and material consuming and time saving, and false-positive results derived from immunofluorescence can be avoided. The method confirms that IBA is able to facilitate ES cells differentiating into neuronal cells, including cholinergic neurons and GABAergic neurons.
Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S; Martin, Pamela M
2014-05-13
Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Human globin gene expression was evaluated by RT-quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase-qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous β(s) mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
Control of heme synthesis during Friend cell differentiation: role of iron and transferrin
International Nuclear Information System (INIS)
Laskey, J.D.; Ponka, P.; Schulman, H.M.
1986-01-01
In many types of cells the synthesis of σ-aminolevulinic acid (ALA) limits the rate of heme formation. However, results from this laboratory with reticulocytes suggest that the rate of iron uptake from 125 I-transferrin (Tf), rather than ALA synthase activity, limits the rate of heme synthesis in erythroid cells. To determine whether changes occur in iron metabolism and the control of heme synthesis during erythroid cell development Friend erythroleukemia cells induced to erythroid differentiation by dimethylsulfoxide (DMSO) were studied. While added ALA stimulated heme synthesis in uninduced Friend cells (suggesting ALA synthase is limiting) it did not do so in induced cells. Therefore the possibility was investigated that, in induced cells, iron uptake from Tf limits and controls heme synthesis. Several aspects of iron metabolism were investigated using the synthetic iron chelator salicylaldehyde isonicotinoyl hydrazone (SIH). Both induced and uninduced Friend cells take up and utilize Fe for heme synthesis directly from Fe-SIH without the involvement of transferrin and transferrin receptors and to a much greater extent than from saturating levels or 59 Fe-Tf (20 μM). Furthermore, in induced Friend cells 100 μM Fe-SIH stimulated 2- 14 C-glycine incorporation into heme up to 3.6-fold as compared to the incorporation observed with saturating concentrations of Fe-Tf. These results indicate that some step(s) in the pathway of iron from extracellular Tf to protoporphyrin, rather than the activity of ALA synthase, limits and controls the overall rate of heme and possibly hemoglobin synthesis in differentiating Friend erythroleukemia cells
The flavonoid fisetin promotes osteoblasts differentiation through Runx2 transcriptional activity.
Léotoing, Laurent; Davicco, Marie-Jeanne; Lebecque, Patrice; Wittrant, Yohann; Coxam, Véronique
2014-06-01
Flavonoids represent a group of polyphenolic compounds commonly found in daily nutrition with proven health benefits. Among this group, the flavonol fisetin has been previously shown to protect bone by repressing osteoclast differentiation. In the present study, we investigated the role of fisetin in regulating osteoblasts physiology. In vivo mice treated with LPSs exhibited osteoporosis features associated with a dramatic repression of osteoblast marker expression. In this model, inhibition of osteocalcin and type I collagen alpha 1 transcription was partially countered by a daily consumption of fisetin. Interestingly, in vitro, fisetin promoted both osteoblast alkaline phosphatase activity and mineralization process. To decipher how fisetin may exert its positive effect on osteoblastogenesis, we analyzed its ability to control the runt-related transcription factor 2 (Runx2), a key organizer in developing and maturing osteoblasts. While fisetin did not impact Runx2 mRNA and protein levels, it upregulated its transcriptional activity. Actually, fisetin stimulated the luciferase activity of a reporter plasmid driven by the osteocalcin gene promoter that contains Runx2 binding sites and promoted the mRNA expression of osteocalcin and type I collagen alpha 1 targets. Bone sparing properties of fisetin also rely on its positive influence on osteoblast differentiation and activity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Survey of Differentially Methylated Promoters in Prostate Cancer Cell Lines
Directory of Open Access Journals (Sweden)
Yipeng Wang
2005-08-01
Full Text Available DNA methylation, copy number in the genomes of three immortalized prostate epithelial, five cancer cell lines (LNCaP, PC3, PC3M, PC3M-Pro4, PC3MLN4 were compared using a microarray-based technique. Genomic DNA is cut with a methylation-sensitive enzyme Hpall, followed by linker ligation, polymerase chain reaction (PCR amplification, labeling, hybridization to an array of promoter sequences. Only those parts of the genomic DNA that have unmethylated restriction sites within a few hundred base pairs generate PCR products detectable on an array. Of 2732 promoter sequences on a test array, 504 (18.5% showed differential hybridization between immortalized prostate epithelial, cancer cell lines. Among candidate hypermethylated genes in cancer-derived lines, there were eight (CD44, CDKN1A, ESR1, PLAU, RARB, SFN, TNFRSF6, TSPY previously observed in prostate cancer, 13 previously known methylation targets in other cancers (ARHI, bcl-2, BRCA1, CDKN2C, GADD45A, MTAP, PGR, SLC26A4, SPARC, SYK, TJP2, UCHL1, WIT-1. The majority of genes that appear to be both differentially methylated, differentially regulated between prostate epithelial, cancer cell lines are novel methylation targets, including PAK6, RAD50, TLX3, PIR51, MAP2K5, INSR, FBN1, GG2-1, representing a rich new source of candidate genes used to study the role of DNA methylation in prostate tumors.
International Nuclear Information System (INIS)
Costa-Silva, Bruno; Coelho da Costa, Meline; Melo, Fernanda Rosene; Neves, Cynara Mendes; Alvarez-Silva, Marcio; Calloni, Giordano Wosgrau; Trentin, Andrea Goncalves
2009-01-01
The neural crest (NC) is a model system used to investigate multipotency during vertebrate development. Environmental factors control NC cell fate decisions. Despite the well-known influence of extracellular matrix molecules in NC cell migration, the issue of whether they also influence NC cell differentiation has not been addressed at the single cell level. By analyzing mass and clonal cultures of mouse cephalic and quail trunk NC cells, we show for the first time that fibronectin (FN) promotes differentiation into the smooth muscle cell phenotype without affecting differentiation into glia, neurons, and melanocytes. Time course analysis indicated that the FN-induced effect was not related to massive cell death or proliferation of smooth muscle cells. Finally, by comparing clonal cultures of quail trunk NC cells grown on FN and collagen type IV (CLIV), we found that FN strongly increased both NC cell survival and the proportion of unipotent and oligopotent NC progenitors endowed with smooth muscle potential. In contrast, melanocytic progenitors were prominent in clonogenic NC cells grown on CLIV. Taken together, these results show that FN promotes NC cell differentiation along the smooth muscle lineage, and therefore plays an important role in fate decisions of NC progenitor cells
International Nuclear Information System (INIS)
Zhang, Jing; Wang, Zhihua; Jiang, Yong; Niu, Zhongying; Fu, Lei; Luo, Zhirong; Cooper, Paul R.; Smith, Anthony J.; He, Wenxi
2015-01-01
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jing [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Stomatologic Hospital & College, Anhui Medical University, Key Lab of Oral Diseases Research of Anhui Province, Hefei (China); Wang, Zhihua; Jiang, Yong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Niu, Zhongying [Treatment center of oral diseases, The 306th Hospital of People' s Liberation Army, Beijing (China); Fu, Lei; Luo, Zhirong [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China); Cooper, Paul R.; Smith, Anthony J. [Oral Biology, School of Dentistry, University of Birmingham, B4 6NN (United Kingdom); He, Wenxi, E-mail: hewenxi@fmmu.edu.cn [State Key Laboratory of Military Stomatology, Department of Operative Dentistry & Endodontics, School of Stomatology, The Fourth Military Medical University, Xi' an (China)
2015-03-15
The transcription factor Nuclear Factor I-C (NFIC) has been implicated in the regulation of tooth root development, where it may be anticipated to impact on the behavior of stem cells from the apical papilla (SCAPs) and root odontoblast activity. We hypothesized that NFIC may provide an important target for promoting dentin/root regeneration. In the present study, the effects of NFIC on the proliferation and differentiation of SCAPs were investigated. Over-expression of NFIC increased cell proliferation, mineralization nodule formation and alkaline phosphatase (ALP) activity in SCAPs. Furthermore, NFIC up-regulated the mRNA levels of odontogenic-related markers, ALP, osteocalcin and collagen type I as well as dentin sialoprotein protein levels. In contrast, knockdown of NFIC by si-RNA inhibited the mineralization capacity of SCAPs and down-regulated the expression of odontogenic-related markers. In conclusion, the results indicated that upregulation of NFIC activity in SCAPs may promote osteo/odontoblastic differentiation of SCAPs. - Highlights: • NFIC promotes the proliferation of SCAPs in vitro. • NFIC promotes osteo/odontogenic differentiation of SCAPs in vitro. • Knockdown of NFIC inhibits odontogenic differentiation in SCAPs.
Unverzagt, K L; Martinson, J; Lee, W; Stiff, P J; Williams, S; Bender, J G
1996-01-01
Two and three color flow cytometry of normal human bone marrow was used to identify CD34+ progenitor cells and examine their binding to the plant lectin Ulex europaeus I (Ulex). In normal bone marrow, 48.48 +/- 17.4% of the CD34+ cells bind to Ulex. Two color flow cytometry was used to sort CD34 + cells, and subsets of CD34+ cells, CD34+ Ulex+ and CD34+ Ulex-. These populations were sorted into colony assays to assess myeloid (CFU-GM) and erythroid (BFU-E) progenitors. The CD34+ Ulex+ subset was 84 +/- 14% BFU-E colonies (mean +/- S.D.) and had the highest cloning efficiency of 28 +/- 13%. Three color analysis of CD34+ Ulex+ cells showed staining with other erythroid (CD71, GlyA) antibodies and lack of stain. ing with myeloid (CD13, CD45RA) antibodies. These studies confirmed the erythroid characteristics of this subpopulation.
Energy Technology Data Exchange (ETDEWEB)
Li, Ying [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023 (China); Huang, Xiaohua [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Clinical Biochemistry, College of Laboratory Medicine, Dalian Medical University, Dalian 116044 (China); An, Yue [Department of Clinical Laboratory, Second Affiliated Hospital of Dalian Medical University, Dalian 116023 (China); Ren, Feng [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Yang, Zara Zhuyun; Zhu, Hongmei; Zhou, Lei [The Key Laboratory of Stem Cell and Regenerative Medicine, Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650228 (China); Department of Anatomy and Developmental Biology, Monash University, Clayton 3800 (Australia); He, Xiaowen; Schachner, Melitta [Keck Center for Collaborative Neuroscience and Department of Cell Biology and Neuroscience, Rutgers University, New Brunswick, NJ (United States); Xiao, Zhicheng, E-mail: zhicheng.xiao@monash.edu [The Key Laboratory of Stem Cell and Regenerative Medicine, Institute of Molecular and Clinical Medicine, Kunming Medical University, Kunming 650228 (China); Department of Anatomy and Developmental Biology, Monash University, Clayton 3800 (Australia); Ma, Keli, E-mail: makeli666@aliyun.com [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Li, Yali, E-mail: yalilipaper@gmail.com [Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian 116044 (China); Department of Anatomy, National University of Singapore, Singapore 119078 (Singapore)
2013-10-25
Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study, we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression.
International Nuclear Information System (INIS)
Li, Ying; Huang, Xiaohua; An, Yue; Ren, Feng; Yang, Zara Zhuyun; Zhu, Hongmei; Zhou, Lei; He, Xiaowen; Schachner, Melitta; Xiao, Zhicheng; Ma, Keli; Li, Yali
2013-01-01
Highlights: •Down-regulating FUT9 and ST3Gal4 expression blocks L1-induced neuronal differentiation of ESCs. •Up-regulating FUT9 and ST3Gal4 expression in L1-ESCs depends on the activation of PLCγ. •L1 promotes ESCs to differentiate into neuron through regulating cell surface glycosylation. -- Abstract: Cell recognition molecule L1 (CD171) plays an important role in neuronal survival, migration, differentiation, neurite outgrowth, myelination, synaptic plasticity and regeneration after injury. Our previous study has demonstrated that overexpressing L1 enhances cell survival and proliferation of mouse embryonic stem cells (ESCs) through promoting the expression of FUT9 and ST3Gal4, which upregulates cell surface sialylation and fucosylation. In the present study, we examined whether sialylation and fucosylation are involved in ESC differentiation through L1 signaling. RNA interference analysis showed that L1 enhanced differentiation of ESCs into neurons through the upregulation of FUT9 and ST3Gal4. Furthermore, blocking the phospholipase Cγ (PLCγ) signaling pathway with either a specific PLCγ inhibitor or knockdown PLCγ reduced the expression levels of both FUT9 and ST3Gal4 mRNAs and inhibited L1-mediated neuronal differentiation. These results demonstrate that L1 promotes neuronal differentiation from ESCs through the L1-mediated enhancement of FUT9 and ST3Gal4 expression
Jaako, Pekka; Debnath, Shubhranshu; Olsson, Karin; Zhang, Y; Flygare, Johan; Lindström, M S; Bryder, David; Karlsson, Stefan
2015-01-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of Mdm2, the main negative regulator of p53, by the 5S ribonucleoprot...
Electrical Stimulation Promotes Cardiac Differentiation of Human Induced Pluripotent Stem Cells
Directory of Open Access Journals (Sweden)
Damián Hernández
2016-01-01
Full Text Available Background. Human induced pluripotent stem cells (iPSCs are an attractive source of cardiomyocytes for cardiac repair and regeneration. In this study, we aim to determine whether acute electrical stimulation of human iPSCs can promote their differentiation to cardiomyocytes. Methods. Human iPSCs were differentiated to cardiac cells by forming embryoid bodies (EBs for 5 days. EBs were then subjected to brief electrical stimulation and plated down for 14 days. Results. In iPS(Foreskin-2 cell line, brief electrical stimulation at 65 mV/mm or 200 mV/mm for 5 min significantly increased the percentage of beating EBs present by day 14 after plating. Acute electrical stimulation also significantly increased the cardiac gene expression of ACTC1, TNNT2, MYH7, and MYL7. However, the cardiogenic effect of electrical stimulation was not reproducible in another iPS cell line, CERA007c6. Beating EBs from control and electrically stimulated groups expressed various cardiac-specific transcription factors and contractile muscle markers. Beating EBs were also shown to cycle calcium and were responsive to the chronotropic agents, isoproterenol and carbamylcholine, in a concentration-dependent manner. Conclusions. Our results demonstrate that brief electrical stimulation can promote cardiac differentiation of human iPS cells. The cardiogenic effect of brief electrical stimulation is dependent on the cell line used.
ERG promotes the maintenance of hematopoietic stem cells by restricting their differentiation
DEFF Research Database (Denmark)
Knudsen, Kasper Jermiin; Rehn, Matilda Carolina; Hasemann, Marie Sigurd
2015-01-01
The balance between self-renewal and differentiation is crucial for the maintenance of hematopoietic stem cells (HSCs). Whereas numerous gene regulatory factors have been shown to control HSC self-renewal or drive their differentiation, we have relatively few insights into transcription factors...... and functional HSCs. Molecularly, we could demonstrate that ERG, in addition to promoting the expression of HSC self-renewal genes, also represses a group of MYC targets, thereby explaining why Erg loss closely mimics Myc overexpression. Consistently, the BET domain inhibitor CPI-203, known to repress Myc...... expression, confers a partial phenotypic rescue. In summary, ERG plays a critical role in coordinating the balance between self-renewal and differentiation of HSCs....
International Nuclear Information System (INIS)
Bouhlel, Mohamed Amine; Brozek, John; Derudas, Bruno; Zawadzki, Christophe; Jude, Brigitte; Staels, Bart; Chinetti-Gbaguidi, Giulia
2009-01-01
Macrophages adapt their response to micro-environmental signals. While Th1 cytokines promote pro-inflammatory M1 macrophages, Th2 cytokines promote an 'alternative' anti-inflammatory M2 macrophage phenotype. Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors expressed in macrophages where they control the inflammatory response. It has been shown that PPARγ promotes the differentiation of monocytes into anti-inflammatory M2 macrophages in humans and mice, while a role for PPARβ/δ in this process has been reported only in mice and no data are available for PPARα. Here, we show that in contrast to PPARγ, expression of PPARα and PPARβ/δ overall does not correlate with the expression of M2 markers in human atherosclerotic lesions, whereas a positive correlation with genes of lipid metabolism exists. Moreover, unlike PPARγ, PPARα or PPARβ/δ activation does not influence human monocyte differentiation into M2 macrophages in vitro. Thus, PPARα and PPARβ/δ do not appear to modulate the alternative differentiation of human macrophages.
Selective AR Modulators that Distinguish Proliferative from Differentiative Gene Promoters
2016-08-01
levels, and in some cases be useful in early stage disease or watchful waiting, and in other cases castration resistant prostate cancer (CRPC...dependent kinase inhibitor p21 gene through an androgen response element in the proximal promoter. Molecular endocrinology 13, 376 (Mar, 1999). 9...analyses and in mouse xenograft experiments, as planned. We will also continue to probe the molecular mechanism by which dox elicits these differential
Energy Technology Data Exchange (ETDEWEB)
Popova, Evgenya Y.; Krauss, Sharon Wald; Short, Sarah A.; Lee, Gloria; Villalobos, Jonathan; Etzell, Joan; Koury, Mark J.; Ney, Paul A.; Chasis, Joel Anne; Grigoryev, Sergei A.
2008-08-21
Terminal erythroid differentiation in vertebrates is characterized by progressive heterochromatin formation, chromatin condensation and, in mammals, culminates in nuclear extrusion. To date, although mechanisms regulating avian erythroid chromatin condensation have been identified, little is known regarding this process during mammalian erythropoiesis. To elucidate the molecular basis for mammalian erythroblast chromatin condensation, we used Friend virus-infected murine spleen erythroblasts that undergo terminal differentiation in vitro. Chromatin isolated from early and late stage erythroblasts had similar levels of linker and core histones, only a slight difference in nucleosome repeats, and no significant accumulation of known developmentally-regulated architectural chromatin proteins. However, histone H3(K9) dimethylation markedly increased while histone H4(K12) acetylation dramatically decreased and became segregated from the histone methylation as chromatin condensed. One histone deacetylase, HDAC5, was significantly upregulated during the terminal stages of Friend virus-infected erythroblast differentiation. Treatment with histone deacetylase inhibitor, trichostatin A, blocked both chromatin condensation and nuclear extrusion. Based on our data, we propose a model for a unique mechanism in which extensive histone deacetylation at pericentromeric heterochromatin mediates heterochromatin condensation in vertebrate erythroblasts that would otherwise be mediated by developmentally-regulated architectural proteins in nucleated blood cells.
EZH2 regulates neuroblastoma cell differentiation via NTRK1 promoter epigenetic modifications.
Li, Zhenghao; Takenobu, Hisanori; Setyawati, Amallia Nuggetsiana; Akita, Nobuhiro; Haruta, Masayuki; Satoh, Shunpei; Shinno, Yoshitaka; Chikaraishi, Koji; Mukae, Kyosuke; Akter, Jesmin; Sugino, Ryuichi P; Nakazawa, Atsuko; Nakagawara, Akira; Aburatani, Hiroyuki; Ohira, Miki; Kamijo, Takehiko
2018-05-01
The polycomb repressor complex 2 molecule EZH2 is now known to play a role in essential cellular processes, namely, cell fate decisions, cell cycle regulation, senescence, cell differentiation, and cancer development/progression. EZH2 inhibitors have recently been developed; however, their effectiveness and underlying molecular mechanisms in many malignancies have not yet been elucidated in detail. Although the functional role of EZH2 in tumorigenesis in neuroblastoma (NB) has been investigated, mutations of EZH2 have not been reported. A Kaplan-Meier analysis on the event free survival and overall survival of NB patients indicated that the high expression of EZH2 correlated with an unfavorable prognosis. In order to elucidate the functional roles of EZH2 in NB tumorigenesis and its aggressiveness, we knocked down EZH2 in NB cell lines using lentivirus systems. The knockdown of EZH2 significantly induced NB cell differentiation, e.g., neurite extension, and the neuronal differentiation markers, NF68 and GAP43. EZH2 inhibitors also induced NB cell differentiation. We performed a comprehensive transcriptome analysis using Human Gene Expression Microarrays and found that NTRK1 (TrkA) is one of the EZH2-related suppression targets. The depletion of NTRK1 canceled EZH2 knockdown-induced NB cell differentiation. Our integrative methylome, transcriptome, and chromatin immunoprecipitation assays using NB cell lines and clinical samples clarified that the NTRK1 P1 and P2 promoter regions were regulated differently by DNA methylation and EZH2-related histone modifications. The NTRK1 transcript variants 1/2, which were regulated by EZH2-related H3K27me3 modifications at the P1 promoter region, were strongly expressed in favorable, but not unfavorable NB. The depletion and inhibition of EZH2 successfully induced NTRK1 transcripts and functional proteins. Collectively, these results indicate that EZH2 plays important roles in preventing the differentiation of NB cells and also
DEFF Research Database (Denmark)
Olsen, Line; Bressendorff, Simon; Troelsen, Jesper T
2005-01-01
The intestinal alkaline phosphatase gene (ALPI) encodes a digestive brush-border enzyme, which is highly upregulated during small intestinal epithelial cell differentiation. To identify new putative promoter motifs responsible for the regulation of ALPI expression during differentiation of the en...
Senescence from glioma stem cell differentiation promotes tumor growth
International Nuclear Information System (INIS)
Ouchi, Rie; Okabe, Sachiko; Migita, Toshiro; Nakano, Ichiro; Seimiya, Hiroyuki
2016-01-01
Glioblastoma (GBM) is a lethal brain tumor composed of heterogeneous cellular populations including glioma stem cells (GSCs) and differentiated non-stem glioma cells (NSGCs). While GSCs are involved in tumor initiation and propagation, NSGCs' role remains elusive. Here, we demonstrate that NSGCs undergo senescence and secrete pro-angiogenic proteins, boosting the GSC-derived tumor formation in vivo. We used a GSC model that maintains stemness in neurospheres, but loses the stemness and differentiates into NSGCs upon serum stimulation. These NSGCs downregulated telomerase, shortened telomeres, and eventually became senescent. The senescent NSGCs released pro-angiogenic proteins, including vascular endothelial growth factors and senescence-associated interleukins, such as IL-6 and IL-8. Conditioned medium from senescent NSGCs promoted proliferation of brain microvascular endothelial cells, and mixed implantation of GSCs and senescent NSGCs into mice enhanced the tumorigenic potential of GSCs. The senescent NSGCs seem to be clinically relevant, because both clinical samples and xenografts of GBM contained tumor cells that expressed the senescence markers. Our data suggest that senescent NSGCs promote malignant progression of GBM in part via paracrine effects of the secreted proteins. - Highlights: • Non-stem glioma cells (NSGCs) lose telomerase and eventually become senescent. • Senescent NSGCs secrete pro-angiogenic proteins, such as VEGFs, IL-6, and IL-8. • Senescent NSGCs enhance the growth of brain microvascular endothelial cells. • Senescent NSGCs enhance the tumorigenic potential of glioma stem cells in vivo.
Senescence from glioma stem cell differentiation promotes tumor growth
Energy Technology Data Exchange (ETDEWEB)
Ouchi, Rie [Division of Molecular Biotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, 3-8-31 Ariake, Koto-ku, Tokyo 135-8550 (Japan); Laboratory of Molecular Target Therapy of Cancer, Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, 3-8-31 Ariake, Koto-ku, Tokyo 135-8550 (Japan); Okabe, Sachiko; Migita, Toshiro [Division of Molecular Biotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, 3-8-31 Ariake, Koto-ku, Tokyo 135-8550 (Japan); Nakano, Ichiro [Department of Neurosurgery, Comprehensive Cancer Center, University of Alabama at Birmingham, 1824 6th Avenue South, Birmingham, AL 35233 (United States); Seimiya, Hiroyuki, E-mail: hseimiya@jfcr.or.jp [Division of Molecular Biotherapy, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, 3-8-31 Ariake, Koto-ku, Tokyo 135-8550 (Japan); Laboratory of Molecular Target Therapy of Cancer, Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, 3-8-31 Ariake, Koto-ku, Tokyo 135-8550 (Japan)
2016-02-05
Glioblastoma (GBM) is a lethal brain tumor composed of heterogeneous cellular populations including glioma stem cells (GSCs) and differentiated non-stem glioma cells (NSGCs). While GSCs are involved in tumor initiation and propagation, NSGCs' role remains elusive. Here, we demonstrate that NSGCs undergo senescence and secrete pro-angiogenic proteins, boosting the GSC-derived tumor formation in vivo. We used a GSC model that maintains stemness in neurospheres, but loses the stemness and differentiates into NSGCs upon serum stimulation. These NSGCs downregulated telomerase, shortened telomeres, and eventually became senescent. The senescent NSGCs released pro-angiogenic proteins, including vascular endothelial growth factors and senescence-associated interleukins, such as IL-6 and IL-8. Conditioned medium from senescent NSGCs promoted proliferation of brain microvascular endothelial cells, and mixed implantation of GSCs and senescent NSGCs into mice enhanced the tumorigenic potential of GSCs. The senescent NSGCs seem to be clinically relevant, because both clinical samples and xenografts of GBM contained tumor cells that expressed the senescence markers. Our data suggest that senescent NSGCs promote malignant progression of GBM in part via paracrine effects of the secreted proteins. - Highlights: • Non-stem glioma cells (NSGCs) lose telomerase and eventually become senescent. • Senescent NSGCs secrete pro-angiogenic proteins, such as VEGFs, IL-6, and IL-8. • Senescent NSGCs enhance the growth of brain microvascular endothelial cells. • Senescent NSGCs enhance the tumorigenic potential of glioma stem cells in vivo.
Perrotta, Silverio; Cucciolla, Valeria; Ferraro, Marcella; Ronzoni, Luisa; Tramontano, Annunziata; Rossi, Francesca; Scudieri, Anna Chiara; Borriello, Adriana; Roberti, Domenico; Nobili, Bruno; Cappellini, Maria Domenica; Oliva, Adriana; Amendola, Giovanni; Migliaccio, Anna Rita; Mancuso, Patrizia; Martin-Padura, Ines; Bertolini, Francesco; Yoon, Donghoon; Prchal, Josef T.; Della Ragione, Fulvio
2010-01-01
Background Gain-of-function of erythropoietin receptor (EPOR) mutations represent the major cause of primary hereditary polycythemia. EPOR is also found in non-erythroid tissues, although its physiological role is still undefined. Methodology/Principal Findings We describe a family with polycythemia due to a heterozygous mutation of the EPOR gene that causes a G→T change at nucleotide 1251 of exon 8. The novel EPOR G1251T mutation results in the replacement of a glutamate residue by a stop codon at amino acid 393. Differently from polycythemia vera, EPOR G1251T CD34+ cells proliferate and differentiate towards the erythroid phenotype in the presence of minimal amounts of EPO. Moreover, the affected individuals show a 20-fold increase of circulating endothelial precursors. The analysis of erythroid precursor membranes demonstrates a heretofore undescribed accumulation of the truncated EPOR, probably due to the absence of residues involved in the EPO-dependent receptor internalization and degradation. Mutated receptor expression in EPOR-negative cells results in EPOR and Stat5 phosphorylation. Moreover, patient erythroid precursors present an increased activation of EPOR and its effectors, including Stat5 and Erk1/2 pathway. Conclusions/Significance Our data provide an unanticipated mechanism for autosomal dominant inherited polycythemia due to a heterozygous EPOR mutation and suggest a regulatory role of EPO/EPOR pathway in human circulating endothelial precursors homeostasis. PMID:20700488
Masselli, E; Carubbi, C; Gobbi, G; Mirandola, P; Galli, D; Martini, S; Bonomini, S; Crugnola, M; Craviotto, L; Aversa, F; Vitale, M
2015-11-01
Among the three classic Philadelphia chromosome-negative myeloproliferative neoplasms, primary myelofibrosis (PMF) is the most severe in terms of disease biology, survival and quality of life. Abnormalities in the process of differentiation of PMF megakaryocytes (MKs) are a hallmark of the disease. Nevertheless, the molecular events that lead to aberrant megakaryocytopoiesis have yet to be clarified. Protein kinase Cɛ (PKCɛ) is a novel serine/threonine kinase that is overexpressed in a variety of cancers, promoting aggressive phenotype, invasiveness and drug resistance. Our previous findings on the role of PKCɛ in normal (erythroid and megakaryocytic commitment) and malignant (acute myeloid leukemia) hematopoiesis prompted us to investigate whether it could be involved in the pathogenesis of PMF MK-impaired differentiation. We demonstrate that PMF megakaryocytic cultures express higher levels of PKCɛ than healthy donors, which correlate with higher disease burden but not with JAK2V617F mutation. Inhibition of PKCɛ function (by a negative regulator of PKCɛ translocation) or translation (by target small hairpin RNA) leads to reduction in PMF cell growth, restoration of PMF MK differentiation and inhibition of PKCɛ-related anti-apoptotic signaling (Bcl-xL). Our data suggest that targeting PKCɛ directly affects the PMF neoplastic clone and represent a proof-of-concept for PKCɛ inhibition as a novel therapeutic strategy in PMF.
Wnt-10b, uniquely among Wnts, promotes epithelial differentiation and shaft growth
International Nuclear Information System (INIS)
Ouji, Yukiteru; Yoshikawa, Masahide; Moriya, Kei; Nishiofuku, Mariko; Matsuda, Ryosuke; Ishizaka, Shigeaki
2008-01-01
Although Wnts are expressed in hair follicles throughout life from embryo to adult, and considered to be critical for their development and maturation, their roles remain largely unknown. In the present study, we investigated the effects of Wnts (Wnt-3a, Wnt-5a, Wnt-10b, and Wnt-11) on epithelial cell differentiation using adult mouse-derived primary skin epithelial cell (MPSEC) cultures and hair growth using hair follicle organ cultures. Only Wnt-10b showed evident promotion of epithelial cell differentiation and hair shaft growth, in contrast to Wnt-3a, 5a, and 11. Our results suggest that Wnt-10b is unique and plays an important role in differentiation of epithelial cells in the hair follicle
Yang, Zhigang; Yao, Hong; Fei, Fei; Li, Yuwei; Qu, Jie; Li, Chunyuan; Zhang, Shiwu
2018-04-01
During development and tumor progression, cells need a sufficient blood supply to maintain development and rapid growth. It is reported that there are three patterns of blood supply for tumor growth: endothelium-dependent vessels, mosaic vessels, and vasculogenic mimicry (VM). VM was first reported in highly aggressive uveal melanomas, with tumor cells mimicking the presence and function of endothelial cells forming the walls of VM vessels. The walls of mosaic vessels are randomly lined with both endothelial cells and tumor cells. We previously proposed a three-stage process, beginning with VM, progressing to mosaic vessels, and eventually leading to endothelium-dependent vessels. However, many phenomena unique to VM channel formation remain to be elucidated, such as the origin of erythrocytes before VM vessels connect with endothelium-dependent vessels. In adults, erythroid cells are generally believed to be generated from hematopoietic stem cells in the bone marrow. In contrast, embryonic tissue obtains oxygen through formation of blood islands, which are largely composed of embryonic hemoglobin with a higher affinity with oxygen, in the absence of mature erythrocytes. Recent data from our laboratory suggest that embryonic blood-forming mechanisms also exist in cancer tissue, particularly when these tissues are under environmental stress such as hypoxia. We review the evidence from induced pluripotent stem cells in vitro and in vivo to support this previously underappreciated cell functionality in normal and cancer cells, including the ability to generate erythroid cells. We will also summarize the current understanding of tumor angiogenesis, VM, and our recent work on polyploid giant cancer cells, with emphasis on their ability to generate erythroid cells and their association with tumor growth under hypoxia. An alternative embryonic pathway to obtain oxygen in cancer cells exists, particularly when they are under hypoxic conditions.
Caceres, Gisela; McGraw, Kathy; Yip, Bon Ham; Pellagatti, Andrea; Johnson, Joseph; Zhang, Ling; Liu, Kenian; Zhang, Lan Min; Fulp, William J.; Lee, Ji-Hyun; Al Ali, Najla H.; Basiorka, Ashley; Smith, Larry J.; Daugherty, F. Joseph; Littleton, Neil; Wells, Richard A.; Sokol, Lubomir; Wei, Sheng; Komrokji, Rami S.; Boultwood, Jacqueline; List, Alan F.
2013-01-01
Stabilization of p53 in erythroid precursors in response to nucleosomal stress underlies the hypoplastic anemia in myelodysplastic syndromes (MDS) with chromosome 5q deletion [del(5q)]. We investigated whether cenersen, a clinically active 20-mer antisense oligonucleotide complementary to TP53 exon10, could suppress p53 expression and restore erythropoiesis in del(5q) MDS. Cenersen treatment of ribosomal protein S-14-deficient erythroblasts significantly reduced cellular p53 and p53-up-regulated modulator of apoptosis expression compared with controls, accompanied by a significant reduction in apoptosis and increased cell proliferation. In a two-stage erythroid differentiation assay, cenersen significantly suppressed nuclear p53 in bone marrow CD34+ cells isolated from patients with del(5q) MDS, whereas erythroid burst recovery increased proportionally to the magnitude of p53 suppression without evidence of del(5q) clonal suppression (r = −0.6; P = 0.005). To explore the effect of p53 suppression on erythropoiesis in vivo, dexamethasone, a glucocorticoid receptor-dependent p53 antagonist, was added to lenalidomide treatment in eight lower-risk, transfusion-dependent, del(5q) MDS patients with acquired drug resistance. Transfusion independence was restored in five patients accompanied by expansion of erythroid precursors and decreased cellular p53 expression. We conclude that targeted suppression of p53 could support effective erythropoiesis in lenalidomide-resistant del(5q) MDS. PMID:24043769
Directory of Open Access Journals (Sweden)
Keun-A Chang
2011-04-01
Full Text Available The use of non-chemical methods to differentiate stem cells has attracted researchers from multiple disciplines, including the engineering and the biomedical fields. No doubt, growth factor based methods are still the most dominant of achieving some level of proliferation and differentiation control--however, chemical based methods are still limited by the quality, source, and amount of the utilized reagents. Well-defined non-chemical methods to differentiate stem cells allow stem cell scientists to control stem cell biology by precisely administering the pre-defined parameters, whether they are structural cues, substrate stiffness, or in the form of current flow. We have developed a culture system that allows normal stem cell growth and the option of applying continuous and defined levels of electric current to alter the cell biology of growing cells. This biphasic current stimulator chip employing ITO electrodes generates both positive and negative currents in the same culture chamber without affecting surface chemistry. We found that biphasic electrical currents (BECs significantly increased the proliferation of fetal neural stem cells (NSCs. Furthermore, BECs also promoted the differentiation of fetal NSCs into neuronal cells, as assessed using immunocytochemistry. Our results clearly show that BECs promote both the proliferation and neuronal differentiation of fetal NSCs. It may apply to the development of strategies that employ NSCs in the treatment of various neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases.
Tang, G; Dong, X; Huang, X; Huang, X-J; Liu, H; Wang, Y; Ye, W-C; Shi, L
2015-09-10
Neuronal differentiation is a critical developmental process that determines accurate synaptic connection and circuit wiring. A wide variety of naturally occurring compounds have been shown as promising drug leads for the generation and differentiation of neurons. Here we report that a diarylheptanoid from the plant Alpinia officinarum, 7-(4-hydroxyphenyl)-1-phenyl-4E-hepten-3-one (Cpd 1), exhibited potent activities in neuronal differentiation and neurite outgrowth. Cpd 1 induced differentiation of neuroblastoma Neuro-2a cells into a neuron-like morphology, and accelerated the establishment of axon-dendrite polarization of cultured hippocampal neurons. Moreover, Cpd 1 promoted neurite extension in both Neuro-2a cells and neurons. We showed that the effects of Cpd 1 on neuronal differentiation and neurite growth were specifically dependent on the activation of extracellular signal-regulated kinases (ERKs) and phosphoinositide 3-kinase (PI3K)-Akt signaling pathways. Importantly, intraperitoneal administration of Cpd 1 promoted the differentiation of new-born progenitor cells into mature neurons in the adult hippocampal dentate gyrus. Collectively, this study identifies a naturally occurring diarylheptanoid with beneficial effects on neuronal differentiation and neurite outgrowth in vitro and in vivo. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Yu, In Tag; Park, Jin-Yong; Kim, Sung Hyun; Lee, Jeong-Sik; Kim, Yong-Seok; Son, Hyeon
2009-02-01
Valproate (VPA) influences the proliferation and differentiation of neuronal cells. However, little is known about the downstream events, such as alterations in gene transcription, that are associated with cell fate choice. To determine whether VPA plays an instructive role in cell fate choice during hippocampal neurogenesis, the expression of genes involved in the cell cycle and neuronal differentiation was investigated. Treatment with VPA during the progenitor stages resulted in strong inhibition of cell proliferation and induction of neuronal differentiation, accompanied by increases in the expression of proneural transcription factors and in neuronal cell numbers. The increased expression of Ngn1, Math1 and p15 points to a shift towards neuronal fate in response to histone deacetylase inhibitors (HDACi). Chromatin immunoprecipitation (ChIP) analysis showed that acetylated histone H4 (Ac-H4) was associated with the Ngn1, Math1 and p15 promoters in cultured hippocampal neural progenitor cells. VPA-induced hippocampal neurogenesis was also accompanied by association of Ac-H4 with the Ngn1 promoter in hippocampal extracts. The discovery of an association between HDACi and the Ngn1, Math1 and p15 promoters extends the importance of HDAC inhibition as a key regulator of neuronal differentiation at the transcriptional level.
Active form Notch4 promotes the proliferation and differentiation of 3T3-L1 preadipocytes
Energy Technology Data Exchange (ETDEWEB)
Lai, Peng-Yeh [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Tsai, Chong-Bin [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China); Department of Ophthalmology, Chiayi Christian Hospital, Chiayi 600, Taiwan, ROC (China); Tseng, Min-Jen, E-mail: biomjt@ccu.edu.tw [Institute of Molecular Biology and Department of Life Science, National Chung Cheng University, Chiayi 621, Taiwan, ROC (China)
2013-01-18
Highlights: ► Notch4IC modulates the ERK pathway and cell cycle to promote 3T3-L1 proliferation. ► Notch4IC facilitates 3T3-L1 differentiation by up-regulating proadipogenic genes. ► Notch4IC promotes proliferation during the early stage of 3T3-L1 adipogenesis. ► Notch4IC enhances differentiation during subsequent stages of 3T3-L1 adipogenesis. -- Abstract: Adipose tissue is composed of adipocytes, which differentiate from precursor cells in a process called adipogenesis. Many signal molecules are involved in the transcriptional control of adipogenesis, including the Notch pathway. Previous adipogenic studies of Notch have focused on Notch1 and HES1; however, the role of other Notch receptors in adipogenesis remains unclear. Q-RT-PCR analyses showed that the augmentation of Notch4 expression during the differentiation of 3T3-L1 preadipocytes was comparable to that of Notch1. To elucidate the role of Notch4 in adipogenesis, the human active form Notch4 (N4IC) was transiently transfected into 3T3-L1 cells. The expression of HES1, Hey1, C/EBPδ and PPARγ was up-regulated, and the expression of Pref-1, an adipogenic inhibitor, was down-regulated. To further characterize the effect of N4IC in adipogenesis, stable cells expressing human N4IC were established. The expression of N4IC promoted proliferation and enhanced differentiation of 3T3-L1 cells compared with those of control cells. These data suggest that N4IC promoted proliferation through modulating the ERK pathway and the cell cycle during the early stage of 3T3-L1 adipogenesis and facilitated differentiation through up-regulating adipogenic genes such as C/EBPα, PPARγ, aP2, LPL and HSL during the middle and late stages of 3T3-L1 adipogenesis.
The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.
Directory of Open Access Journals (Sweden)
W H Davin Townley-Tilson
Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that
Gu, Lintao; Cui, Xinhua; Wei, Wei; Yang, Jia; Li, Xuezhong
2017-11-15
Neural stem cells (NSCs) have exhibited promising potential in therapies against neuronal hearing loss. Ferulic acid (FA) has been widely reported to enhance neurogenic differentiation of different stem cells. We investigated the role of FA in promoting NSC transplant therapy to prevent gentamicin-induced neuronal hearing loss. NSCs were isolated from mouse cochlear tissues to establish in vitro culture, which were then treated with FA. The survival and differentiation of NSCs were evaluated. Subsequently, neurite outgrowth and excitability of the in vitro neuronal network were assessed. Gentamicin was used to induce neuronal hearing loss in mice, in the presence and absence of FA, followed by assessments of auditory brainstem response (ABR) and distortion product optoacoustic emissions (DPOAE) amplitude. FA promoted survival, neurosphere formation and differentiation of NSCs, as well as neurite outgrowth and excitability of in vitro neuronal network. Furthermore, FA restored ABR threshold shifts and DPOAE in gentamicin-induced neuronal hearing loss mouse model in vivo. Our data, for the first time, support potential therapeutic efficacy of FA in promoting survival and differentiation of NSCs to prevent gentamicin-induced neuronal hearing loss. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jozef Madzo
2014-01-01
Full Text Available Hematopoietic stem cell differentiation involves the silencing of self-renewal genes and induction of a specific transcriptional program. Identification of multiple covalent cytosine modifications raises the question of how these derivatized bases influence stem cell commitment. Using a replicative primary human hematopoietic stem/progenitor cell differentiation system, we demonstrate dynamic changes of 5-hydroxymethylcytosine (5-hmC during stem cell commitment and differentiation to the erythroid lineage. Genomic loci that maintain or gain 5-hmC density throughout erythroid differentiation contain binding sites for erythroid transcription factors and several factors not previously recognized as erythroid-specific factors. The functional importance of 5-hmC was demonstrated by impaired erythroid differentiation, with augmentation of myeloid potential, and disrupted 5-hmC patterning in leukemia patient-derived CD34+ stem/early progenitor cells with TET methylcytosine dioxygenase 2 (TET2 mutations. Thus, chemical conjugation and affinity purification of 5-hmC-enriched sequences followed by sequencing serve as resources for deciphering functional implications for gene expression during stem cell commitment and differentiation along a particular lineage.
Directory of Open Access Journals (Sweden)
AA Pourfatollah
2005-10-01
Full Text Available Introduction: Considering the importance of co-culture in differentiation of embryonic stem cells, the aim of this study was evaluation of the effect of co-culturing fetal liver stroma cells with P19 cells on the line of differentiation. Materials and Methods: For this purpose, P19 cells were cultured directly in semisolid medium. These cells proliferated and primarily differentiated to colonies know as embryoid bodies (EBs after 8-12 days. The Ebs cells were trypsinized and dissociated to single or double cells. Then these cells were co-cultured on the mouse fetal liver feeder layer in the absence of exogenous factors. After 14-18 days, the colonies were studied morphologically by benzidine and giemsa staining and also counted under invert microscope. Results: The percentages of benzidine positive (or erythroid and negative colonies were 94% and 6% respectively and also the cells of colonies were studied by Giemsa staining. Results showed that they were myeloid or lymphoid type cells. Thus, the results show that in the presence of mouse fetal liver feeder layer, the number of erythroid colonies was increased. Conclusions: Therefore, this technique may be effective for differentiation of stem cells from different sources into hematopoietic cells and can be used in future for human cell therapy.
Nurhayati, Retno Wahyu; Ojima, Yoshihiro; Taya, Masahito
2015-04-01
Introduction of a polyploidy inducer is a promising strategy to achieve a high level of polyploidization during megakaryocytic (MK) differentiation. Here, we report that a multi-kinase inhibitor, BMS-777607, is a potent polyploidy inducer for elevating high ploidy cell formation in the MK-differentiated CHRF-288-11 (CHRF) cells. Our result showed that BMS-777607 strongly inhibited cell division without affecting cell viability when detected at day 1 after treatment. As a consequence, the high ploidy (≥8N) cells were accumulated in culture for 8 days, with an increase from 16.2 to 75.2 % of the total cell population. The elevated polyploidization was accompanied by the increased expression level of MK marker, CD41 (platelet glycoprotein IIb/IIIa, GPIIb/IIIa), suggesting that BMS-777607 promoted both polyploidization and commitment of MK-differentiated CHRF cells. Platelet-like fragments (PFs) were released by mature CHRF cells. Based on a flow cytometry assay, it was found that the PFs produced from BMS-777607-treated cells tended to have larger size and higher expression of GPIIb/IIIa, a receptor for platelet adhesion. Taken together, these results suggested that BMS-777607 promoted MK differentiation of CHRF cells and increased the functional property of platelet-like fragments.
Wnt-10b promotes differentiation of skin epithelial cells in vitro
International Nuclear Information System (INIS)
Ouji, Yukiteru; Yoshikawa, Masahide; Shiroi, Akira; Ishizaka, Shigeaki
2006-01-01
To evaluate the role of Wnt-10b in epithelial differentiation, we investigated the effects of Wnt-10b on adult mouse-derived primary skin epithelial cells (MPSEC). Recombinant Wnt-10b protein (rWnt-10b) was prepared using a gene engineering technique and MPSEC were cultured in its presence, which resulted in morphological changes from cuboidal to spindle-shaped and inhibited their proliferation. Further, involvement of the canonical Wnt signal pathway was also observed. MPSEC treated with rWnt-10b showed characteristics of the hair shaft and inner root sheath of the hair follicle, in results of Ayoub Shklar staining and immunocytochemistry. Further, the cells expressed mRNA for differentiated epithelial cells, including keratin 1, keratin 2, loricrin, mHa5, and mHb5, in association with a decreased expression of the basal cell marker keratin 5. These results suggest that Wnt-10b promotes the differentiation of MPSEC
Non-erythroid alpha spectrin prevents telomere dysfunction after DNA interstrand cross-link damage
Zhang, Pan; Herbig, Utz; Coffman, Frederick; Lambert, Muriel W.
2013-01-01
Telomere integrity is critical for telomere function and genomic stability. We previously demonstrated that non-erythroid ?-spectrin (?IISp) is present in mammalian cell nuclei where it is important in repair of DNA interstrand cross-links (ICLs) and chromosome stability. We now demonstrate that ?IISp is also important for telomere maintenance after ICL damage. It localizes to telomeres in S phase after ICL damage where it has enhanced association with TRF1 and TRF2 and is required for recrui...
Directory of Open Access Journals (Sweden)
Yu Fujita
2015-11-01
Full Text Available Extracellular vesicles (EVs, such as exosomes and microvesicles, encapsulate proteins and microRNAs (miRNAs as new modulators of both intercellular crosstalk and disease pathogenesis. The composition of EVs is modified by various triggers to maintain physiological homeostasis. In response to cigarette smoke exposure, the lungs develop emphysema, myofibroblast accumulation and airway remodelling, which contribute to chronic obstructive pulmonary disease (COPD. However, the lung disease pathogenesis through modified EVs in stress physiology is not understood. Here, we investigated an EV-mediated intercellular communication mechanism between primary human bronchial epithelial cells (HBECs and lung fibroblasts (LFs and discovered that cigarette smoke extract (CSE-induced HBEC-derived EVs promote myofibroblast differentiation in LFs. Thorough evaluations of the modified EVs and COPD lung samples showed that cigarette smoke induced relative upregulation of cellular and EV miR-210 expression of bronchial epithelial cells. Using co-culture assays, we showed that HBEC-derived EV miR-210 promotes myofibroblast differentiation in LFs. Surprisingly, we found that miR-210 directly regulates autophagy processes via targeting ATG7, and expression levels of miR-210 are inversely correlated with ATG7 expression in LFs. Importantly, autophagy induction was significantly decreased in LFs from COPD patients, and silencing ATG7 in LFs led to myofibroblast differentiation. These findings demonstrate that CSE triggers the modification of EV components and identify bronchial epithelial cell-derived miR-210 as a paracrine autophagy mediator of myofibroblast differentiation that has potential as a therapeutic target for COPD. Our findings show that stressor exposure changes EV compositions as emerging factors, potentially controlling pathological disorders such as airway remodelling in COPD.
Directory of Open Access Journals (Sweden)
Dhananjay M Nawandar
2015-10-01
Full Text Available Epstein-Barr virus (EBV is a human herpesvirus associated with B-cell and epithelial cell malignancies. EBV lytically infects normal differentiated oral epithelial cells, where it causes a tongue lesion known as oral hairy leukoplakia (OHL in immunosuppressed patients. However, the cellular mechanism(s that enable EBV to establish exclusively lytic infection in normal differentiated oral epithelial cells are not currently understood. Here we show that a cellular transcription factor known to promote epithelial cell differentiation, KLF4, induces differentiation-dependent lytic EBV infection by binding to and activating the two EBV immediate-early gene (BZLF1 and BRLF1 promoters. We demonstrate that latently EBV-infected, telomerase-immortalized normal oral keratinocyte (NOKs cells undergo lytic viral reactivation confined to the more differentiated cell layers in organotypic raft culture. Furthermore, we show that endogenous KLF4 expression is required for efficient lytic viral reactivation in response to phorbol ester and sodium butyrate treatment in several different EBV-infected epithelial cell lines, and that the combination of KLF4 and another differentiation-dependent cellular transcription factor, BLIMP1, is highly synergistic for inducing lytic EBV infection. We confirm that both KLF4 and BLIMP1 are expressed in differentiated, but not undifferentiated, epithelial cells in normal tongue tissue, and show that KLF4 and BLIMP1 are both expressed in a patient-derived OHL lesion. In contrast, KLF4 protein is not detectably expressed in B cells, where EBV normally enters latent infection, although KLF4 over-expression is sufficient to induce lytic EBV reactivation in Burkitt lymphoma cells. Thus, KLF4, together with BLIMP1, plays a critical role in mediating lytic EBV reactivation in epithelial cells.
Lei, Jiehua; Yuan, Yuqi; Lyu, Zhonglin; Wang, Mengmeng; Liu, Qi; Wang, Hongwei; Yuan, Lin; Chen, Hong
2017-08-30
Glycosaminoglycans (GAGs), especially heparin and heparan sulfate (HS), hold great potential for inducing the neural differentiation of embryonic stem cells (ESCs) and have brought new hope for the treatment of neurological diseases. However, the disadvantages of natural heparin/HS, such as difficulty in isolating them with a sufficient amount, highly heterogeneous structure, and the risk of immune responses, have limited their further therapeutic applications. Thus, there is a great demand for stable, controllable, and well-defined synthetic alternatives of heparin/HS with more effective biological functions. In this study, based upon a previously proposed unit-recombination strategy, several heparin-mimicking polymers were synthesized by integrating glucosamine-like 2-methacrylamido glucopyranose monomers (MAG) with three sulfonated units in different structural forms, and their effects on cell proliferation, the pluripotency, and the differentiation of ESCs were carefully studied. The results showed that all the copolymers had good cytocompatibility and displayed much better bioactivity in promoting the neural differentiation of ESCs as compared to natural heparin; copolymers with different sulfonated units exhibited different levels of promoting ability; among them, copolymer with 3-sulfopropyl acrylate (SPA) as a sulfonated unit was the most potent in promoting the neural differentiation of ESCs; the promoting effect is dependent on the molecular weight and concentration of P(MAG-co-SPA), with the highest levels occurring at the intermediate molecular weight and concentration. These results clearly demonstrated that the sulfonated unit in the copolymers played an important role in determining the promoting effect on ESCs' neural differentiation; SPA was identified as the most potent sulfonated unit for copolymer with the strongest promoting ability. The possible reason for sulfonated unit structure as a vital factor influencing the ability of the copolymers
International Nuclear Information System (INIS)
Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.
2015-01-01
Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling
Tributyltin Differentially Promotes Development of a Phenotypically Distinct Adipocyte
Regnier, Shane M.; El-Hashani, Essam; Kamau, Wakanene; Zhang, Xiaojie; Massad, Nicole L.; Sargis, Robert M.
2015-01-01
Objective Environmental endocrine disrupting chemicals (EDCs) are increasingly implicated in the pathogenesis of obesity. Evidence implicates various EDCs as being pro-adipogenic, including tributyltin (TBT), which activates the peroxisome proliferator activated receptor-γ (PPARγ). However, the conditions required for TBT-induced adipogenesis and its functional consequences are incompletely known. Methods The co-stimulatory conditions necessary for preadipocyte-to-adipocyte differentiation were compared between TBT and the pharmacological PPARγ agonist troglitazone (Trog) in the 3T3-L1 cell line; basal and insulin-stimulated glucose uptake were assessed using radiolabeled 2-deoxyglucose. Results TBT enhanced expression of the adipocyte marker C/EBPα with co-exposure to either isobutylmethylxanthine or insulin in the absence of other adipogenic stimuli. Examination of several adipocyte-specific proteins revealed that TBT and Trog differentially affected protein expression despite comparable PPARγ stimulation. In particular, TBT reduced adiponectin expression upon maximal adipogenic stimulation. Under submaximal stimulation, TBT and Trog differentially promoted adipocyte-specific gene expression despite similar lipid accumulation. Moreover, TBT attenuated Trog-induced adipocyte gene expression under conditions of co-treatment. Finally, TBT-induced adipocytes exhibited altered glucose metabolism, with increased basal glucose uptake. Conclusions TBT-induced adipocytes are functionally distinct from those generated by a pharmacological PPARγ agonist, suggesting that obesogen-induced adipogenesis may generate dysfunctional adipocytes with the capacity to deleteriously affect global energy homeostasis. PMID:26243053
Tributyltin differentially promotes development of a phenotypically distinct adipocyte.
Regnier, Shane M; El-Hashani, Essam; Kamau, Wakanene; Zhang, Xiaojie; Massad, Nicole L; Sargis, Robert M
2015-09-01
Environmental endocrine disrupting chemicals (EDCs) are increasingly implicated in the pathogenesis of obesity. Evidence implicates various EDCs as being proadipogenic, including tributyltin (TBT), which activates the peroxisome proliferator activated receptor-γ (PPARγ). However, the conditions required for TBT-induced adipogenesis and its functional consequences are incompletely known. The costimulatory conditions necessary for preadipocyte-to-adipocyte differentiation were compared between TBT and the pharmacological PPARγ agonist troglitazone (Trog) in the 3T3-L1 cell line; basal and insulin-stimulated glucose uptake were assessed using radiolabeled 2-deoxyglucose. TBT enhanced expression of the adipocyte marker C/EBPα with coexposure to either isobutylmethylxanthine or insulin in the absence of other adipogenic stimuli. Examination of several adipocyte-specific proteins revealed that TBT and Trog differentially affected protein expression despite comparable PPARγ stimulation. In particular, TBT reduced adiponectin expression upon maximal adipogenic stimulation. Under submaximal stimulation, TBT and Trog differentially promoted adipocyte-specific gene expression despite similar lipid accumulation. Moreover, TBT attenuated Trog-induced adipocyte gene expression under conditions of cotreatment. Finally, TBT-induced adipocytes exhibited altered glucose metabolism, with increased basal glucose uptake. TBT-induced adipocytes are functionally distinct from those generated by a pharmacological PPARγ agonist, suggesting that obesogen-induced adipogenesis may generate dysfunctional adipocytes with the capacity to deleteriously affect global energy homeostasis. © 2015 The Obesity Society.
Zhao, Kong-Nan; Masci, Paul P.; Lavin, Martin F.
2011-01-01
Spectrin is a central component of the cytoskeletal protein network in a variety of erythroid and non-erythroid cells. In keratinocytes, this protein has been shown to be pericytoplasmic and plasma membrane associated, but its characteristics and function have not been established in these cells. Here we demonstrate that spectrin increases dramatically in amount and is assembled into the cytoskeleton during differentiation in mouse and human keratinocytes. The spectrin-like cytoskeleton was predominantly organized in the granular and cornified layers of the epidermis and disrupted by actin filament inhibitors, but not by anti-mitotic drugs. When the cytoskeleton was disrupted PKCδ was activated by phosphorylation on Thr505. Specific inhibition of PKCδ(Thr505) activation with rottlerin prevented disruption of the spectrin-like cytoskeleton and the associated morphological changes that accompany differentiation. Rottlerin also inhibited specific phosphorylation of the PKCδ substrate adducin, a cytoskeletal protein. Furthermore, knock-down of endogenous adducin affected not only expression of adducin, but also spectrin and PKCδ, and severely disrupted organization of the spectrin-like cytoskeleton and cytoskeletal distribution of both adducin and PKCδ. These results demonstrate that organization of a spectrin-like cytoskeleton is associated with keratinocytes differentiation, and disruption of this cytoskeleton is mediated by either PKCδ(Thr505) phosphorylation associated with phosphorylated adducin or due to reduction of endogenous adducin, which normally connects and stabilizes the spectrin-actin complex. PMID:22163289
MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2
International Nuclear Information System (INIS)
Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming
2016-01-01
MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.
MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2
Energy Technology Data Exchange (ETDEWEB)
Zhu, Haigang; Hou, Liyue; Liu, Jingjing; Li, Zhiming, E-mail: lizm_1001@sina.com
2016-02-26
MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 by luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.
Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V
2017-07-11
In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing
Micro-Topographies Promote Late Chondrogenic Differentiation Markers in the ATDC5 Cell Line.
Le, Bach Q; Vasilevich, Aliaksei; Vermeulen, Steven; Hulshof, Frits; Stamatialis, Dimitrios F; van Blitterswijk, Clemens A; de Boer, Jan
2017-05-01
Chemical and mechanical cues are well-established influencers of in vitro chondrogenic differentiation of ATDC5 cells. Here, we investigate the role of topographical cues in this differentiation process, a study not been explored before. Previously, using a library of surface micro-topographies we found some distinct patterns that induced alkaline phosphatase (ALP) production in human mesenchymal stromal cells. ALP is also a marker for hypertrophy, the end stage of chondrogenic differentiation preceding bone formation. Thus, we hypothesized that these patterns could influence end-stage chondrogenic differentiation of ATDC5 cells. In this study, we randomly selected seven topographies among the ALP influencing hits. Cells grown on these surfaces displayed varying nuclear shape and actin filament structure. When stimulated with insulin-transferrin-selenium (ITS) medium, nodule formation occurred and in some cases showed alignment to the topographical patterns. Gene expression analysis of cells growing on topographical surfaces in the presence of ITS medium revealed a downregulation of early markers and upregulation of late markers of chondrogenic differentiation compared to cells grown on a flat surface. In conclusion, we demonstrated that surface topography in addition to other cues can promote hypertrophic differentiation suitable for bone tissue engineering.
Energy Technology Data Exchange (ETDEWEB)
Kim, Jae-Sung; Park, Min-Gyeong; Lee, Seul Ah; Park, Sun-Young; Kim, Heung-Joong; Yu, Sun-Kyoung; Kim, Chun Sung; Kim, Su-Gwan; Oh, Ji-Su; You, Jae-Seek; Kim, Jin-Soo; Seo, Yo-Seob [Oral Biology Research Institute, School of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of); Chun, Hong Sung [Department of Biomedical Science, Chosun University, Gwangju 501-759 (Korea, Republic of); Park, Joo-Cheol [Department of Oral Histology-Developmental Biology, School of Dentistry and Dental Research Institute, BK 21, Seoul National University, Seoul 110-749 (Korea, Republic of); Kim, Do Kyung, E-mail: kdk@chosun.ac.kr [Oral Biology Research Institute, School of Dentistry, Chosun University, Gwangju 501-759 (Korea, Republic of)
2014-04-18
Highlights: • miR-663 is significantly up-regulated during MDPC-23 odontoblastic cell differentiation. • miR-663 accelerates mineralization in MDPC-23 odontoblastic cells without cell proliferation. • miR-663 promotes odontoblastic cell differentiation by targeting APC and activating Wnt/β-catenin signaling in MDPC-23 cells. - Abstract: MicroRNAs (miRNAs) regulate cell differentiation by inhibiting mRNA translation or by inducing its degradation. However, the role of miRNAs in odontogenic differentiation is largely unknown. In this present study, we observed that the expression of miR-663 increased significantly during differentiation of MDPC-23 cells to odontoblasts. Furthermore, up-regulation of miR-663 expression promoted odontogenic differentiation and accelerated mineralization without proliferation in MDPC-23 cells. In addition, target gene prediction for miR-663 revealed that the mRNA of the adenomatous polyposis coli (APC) gene, which is associated with the Wnt/β-catenin signaling pathway, has a miR-663 binding site in its 3′-untranslated region (3′UTR). Furthermore, APC expressional was suppressed significantly by miR-663, and this down-regulation of APC expression triggered activation of Wnt/β-catenin signaling through accumulation of β-catenin in the nucleus. Taken together, these findings suggest that miR-663 promotes differentiation of MDPC-23 cells to odontoblasts by targeting APC-mediated activation of Wnt/β-catenin signaling. Therefore, miR-663 can be considered a critical regulator of odontoblast differentiation and can be utilized for developing miRNA-based therapeutic agents.
Directory of Open Access Journals (Sweden)
Jiafei Xi
2013-01-01
Full Text Available In vitro models of human erythropoiesis are useful in studying the mechanisms of erythroid differentiation in normal and pathological conditions. Here we describe an erythroid liquid culture system starting from cord blood derived hematopoietic stem cells (HSCs. HSCs were cultured for more than 50 days in erythroid differentiation conditions and resulted in a more than 109-fold expansion within 50 days under optimal conditions. Homogeneous erythroid cells were characterized by cell morphology, flow cytometry, and hematopoietic colony assays. Furthermore, terminal erythroid maturation was improved by cosculturing with human fetal liver stromal cells. Cocultured erythroid cells underwent multiple maturation events, including decrease in size, increase in glycophorin A expression, and nuclear condensation. This process resulted in extrusion of the pycnotic nuclei in up to 80% of the cells. Importantly, they possessed the capacity to express the adult definitive β-globin chain upon further maturation. We also show that the oxygen equilibrium curves of the cord blood-differentiated red blood cells (RBCs are comparable to normal RBCs. The large number and purity of erythroid cells and RBCs produced from cord blood make this method useful for fundamental research in erythroid development, and they also provide a basis for future production of available RBCs for transfusion.
Erythropoiesis in the aged mouse. I. Response to stimulation in vivo
International Nuclear Information System (INIS)
Udupa, K.B.; Lipschitz, D.A.
1984-01-01
Changes in erythropoiesis with age were studied by examining the hematocrit increase in response to hypoxia in aged mice and by assessing the change in erythropoiesis following the injection of erythropoietin in young and old polycythemic mice. The increase in hematocrit after exposure to hypoxia was more variable and generally lower in old mice than in young mice. When erythropoietin was injected into polycythemic animals, the increase in differentiated erythroid cells and 59 Fe incorporation into erythroid marrow and peripheral blood cells was significantly lower in old mice than in young mice. In contrast to differentiated erythroid cells, there was less evidence of a reduced response to simulation of the more primitive erythroid progenitor cells of aged animals. The early undifferentiated erythroid progenitor, burst-forming units, did not decrease when either young or aged mice were made polycythemic, and no change following erythropoietin injection was noted. Polycythemia suppressed the late-differentiated erythroid progenitor, erythroid colony-forming units, to a greater extent in aged animals, but when erythropoietin was injected, the percent increase over the subsequent 24 hours was identical to that in young mice. These observations indicate a reduced erythropoietic capacity with age, the abnormality being most obvious in the more mature erythroid precursors
Vitamin K2 promotes mesenchymal stem cell differentiation by inhibiting miR‑133a expression.
Zhang, Yuelei; Weng, Shiyang; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, Youshui
2017-05-01
Vitamin K2 has been demonstrated to promote the osteogenic differentiation of mesenchymal stem cells; however, the mechanisms underlying this effect remain unclear. As microRNA (miR)‑133a has been identified as a negative regulator of osteogenic differentiation, the present study hypothesized that vitamin K2 promoted osteogenesis by inhibiting miR‑133a. Using human bone marrow stromal cells (hBMSCs) overexpressing miR‑133a, or a control, the expression levels of osteogenesis‑associated proteins, including runt‑related transcription factor 2, alkaline phosphatase and osteocalcin, were analyzed. miR‑133a significantly suppressed the osteogenic differentiation of hBMSCs. To determine the effect of vitamin K2 on miR‑133a expression and osteogenesis, hBMSCs were treated with vitamin K2. Vitamin K2 inhibited miR‑133a expression, which was accompanied by enhanced osteogenic differentiation. Furthermore, the expression levels of vitamin K epoxide reductase complex subunit 1, the key protein in γ‑carboxylation, were downregulated by miR‑133a overexpression and upregulated by vitamin K2 treatment, indicating a positive feedback on γ‑carboxylation. The results of the present study suggested that vitamin K2 targets miR‑133a to regulate osteogenesis.
Directory of Open Access Journals (Sweden)
Jingru Meng
2016-04-01
Full Text Available Glucagon-like peptide 1 (GLP-1 plays an important role in regulating bone remodeling, and GLP-1 receptor agonist shows a positive relationship with osteoblast activity. However, GLP-1 receptor is not found in osteoblast, and the mechanism of GLP-1 receptor agonist on regulating bone remodeling is unclear. Here, we show that the GLP-1 receptor agonist exendin-4 (Ex-4 promoted bone formation and increased bone mass and quality in a rat unloading-induced bone loss model. These functions were accompanied by an increase in osteoblast number and serum bone formation markers, while the adipocyte number was decreased. Furthermore, GLP-1 receptor was detected in bone marrow stromal cells (BMSCs, but not in osteoblast. Activation of GLP-1 receptor by Ex-4 promoted the osteogenic differentiation and inhibited BMSC adipogenic differentiation through regulating PKA/β-catenin and PKA/PI3K/AKT/GSK3β signaling. These findings reveal that GLP-1 receptor regulates BMSC osteogenic differentiation and provide a molecular basis for therapeutic potential of GLP-1 against osteoporosis.
Strontium Promotes Cementoblasts Differentiation through Inhibiting Sclerostin Expression In Vitro
Directory of Open Access Journals (Sweden)
Xingfu Bao
2014-01-01
Full Text Available Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.
Directory of Open Access Journals (Sweden)
Guang-yu Zhang
2015-01-01
Full Text Available MicroRNA-9 (miR-9 has been shown to promote the differentiation of bone marrow mesenchymal stem cells into neuronal cells, but the precise mechanism is unclear. Our previous study confirmed that increased autophagic activity improved the efficiency of neuronal differentiation in bone marrow mesenchymal stem cells. Accumulating evidence reveals that miRNAs adjust the autophagic pathways. This study used miR-9-1 lentiviral vector and miR-9-1 inhibitor to modulate the expression level of miR-9. Autophagic activity and neuronal differentiation were measured by the number of light chain-3 (LC3-positive dots, the ratio of LC3-II/LC3, and the expression levels of the neuronal markers enolase and microtubule-associated protein 2. Results showed that LC3-positive dots, the ratio of LC3-II/LC3, and expression of neuron specific enolase and microtubule-associated protein 2 increased in the miR-9 + group. The above results suggest that autophagic activity increased and bone marrow mesenchymal stem cells were prone to differentiate into neuronal cells when miR-9 was overexpressed, demonstrating that miR-9 can promote neuronal differentiation by increasing autophagic activity.
Directory of Open Access Journals (Sweden)
Pei-Yi Wu
Full Text Available Neuroblastoma (NB is the most common malignant disease of infancy. MYCN amplification is a prognostic factor for NB and is a sign of highly malignant disease and poor patient prognosis. In this study, we aimed to investigate novel MYCN-related genes and assess how they affect NB cell behavior. The different gene expression found in 10 MYCN amplification NB tumors and 10 tumors with normal MYCN copy number were analyzed using tissue oligonucleotide microarrays. Ingenuity Pathway Analysis was subsequently performed to identify the potential genes involved in MYCN regulation pathways. Aryl hydrocarbon receptor (AHR, a receptor for dioxin-like compounds, was found to be inversely correlated with MYCN expression in NB tissues. This correlation was confirmed in a further 14 human NB samples. Moreover, AHR expression in NB tumors was found to correlate highly with histological grade of differentiation. In vitro studies revealed that AHR overexpression in NB cells induced spontaneous cell differentiation. In addition, it was found that ectopic expression of AHR suppressed MYCN promoter activity resulting in downregulation of MYCN expression. The suppression effect of AHR on the transcription of MYCN was compensated for by E2F1 overexpression, indicating that E2F1 is involved in the AHR-regulating MYCN pathway. Furthermore, AHR shRNA promotes the expression of E2F1 and MYCN in NB cells. These findings suggest that AHR is one of the upstream regulators of MYCN. Through the modulation of E2F1, AHR regulates MYCN gene expression, which may in turn affect NB differentiation.
Directory of Open Access Journals (Sweden)
Schmidt Enrico K
2004-05-01
Full Text Available Abstract Background Erythropoietin is a multifunctional cytokine which regulates the number of erythrocytes circulating in mammalian blood. This is crucial in order to maintain an appropriate oxygen supply throughout the body. Stimulation of primary human erythroid progenitors (PEPs with erythropoietin (Epo leads to the activation of the mitogenic kinases (MEKs and Erks. How this is accomplished mechanistically remained unclear. Results Biochemical studies with human cord blood-derived PEPs now show that Ras and the class Ib enzyme of the phosphatidylinositol-3 kinase (PI3K family, PI3K gamma, are activated in response to minimal Epo concentrations. Surprisingly, three structurally different PI3K inhibitors block Ras, MEK and Erk activation in PEPs by Epo. Furthermore, Erk activation in PEPs is insensitive to the inhibition of Raf kinases but suppressed upon PKC inhibition. In contrast, Erk activation induced by stem cell factor, which activates c-Kit in the same cells, is sensitive to Raf inhibition and insensitive to PI3K and PKC inhibitors. Conclusions These unexpected findings contrast with previous results in human primary cells using Epo at supraphysiological concentrations and open new doors to eventually understanding how low Epo concentrations mediate the moderate proliferation of erythroid progenitors under homeostatic blood oxygen levels. They indicate that the basal activation of MEKs and Erks in PEPs by minimal concentrations of Epo does not occur through the classical cascade Shc/Grb2/Sos/Ras/Raf/MEK/Erk. Instead, MEKs and Erks are signal mediators of PI3K, probably the recently described PI3K gamma, through a Raf-independent signaling pathway which requires PKC activity. It is likely that higher concentrations of Epo that are induced by hypoxia, for example, following blood loss, lead to additional mitogenic signals which greatly accelerate erythroid progenitor proliferation.
Forced differentiation of CFU-S by iron-55 erythrocytocide
International Nuclear Information System (INIS)
Reincke, U.; Brookoff, D.; Burlington, H.; Cronkite, E.P.; Mount Sinai School of Medicine, New York
1979-01-01
Cascades of Auger electrons are emitted in the decay of 55 Fe and absorbed in tissue within a 1μm radius. Cytocidal amounts of 55 Fe can therefore eliminate erythroid precursors with minimal damage to adjacent cells. A single intravenous injection leads to continued erythrocytocide in mice because the isotope is reutilized and has a 2.7 year half-life. The cytocide evokes an early compensatory response from morphologically unrecognizable precursors which differentiate into pronormoblasts. These early events leave the granuloid series undisturbed but they are accompanied by a precipitous fall in pluripotent stem cell (CFU-S) numbers in bone marrow, spleen, and blood. The pretreatment levels of CFU-S are not restored. Gradual decline of CFU-S is associated with intermittently increased turnover rates and reduced settings of cell production, yet the capacity for quick restoration of blood loss is unimpaired. The precipitous initial stem cell decrease is not caused by irradiation damage, as shown in a separate experimental series that used the frozen-storage cytocide technique. Only over several weeks could 55 Fe radiation accumulate to lethal levels in nondividing stem cells. This irradiation is attributed to incorporation of small amounts of 55 Fe into CFU-S, from where it is slowly cleared. The stem cell loss immediately following 55 Fe injection is in our interpretation caused by rapid differentiation along the erythroid pathway in a response that involves all progenitor populations. Data are consistent with the hypothesis of limited cell renewal capacity which thereby gains further support. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Zou, Yulong [Department of Orthopaedic; Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Qazvini, Nader Taheri [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Zane, Kylie [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Sadati, Monirosadat [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Wei, Qiang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Liao, Junyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Fan, Jiaming [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Song, Dongzhe [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department of Conservative Dentistry and Endodontics, West China School of Stomatology, Sichuan University, Chengdu 610041, China; Liu, Jianxiang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; amp, Technology, Wuhan 430022, China; Ma, Chao [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Departments of Neurosurgery and Otolaryngology-Head; amp, Neck Surgery, The Affiliated Zhongnan Hospital of Wuhan University, Wuhan 430071, China; Qu, Xiangyang [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Chen, Liqun [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Yu, Xinyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Zhicai [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; amp, Technology, Wuhan 430022, China; Zhao, Chen [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zeng, Zongyue [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Ruyi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Yan, Shujuan [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Wu, Tingting [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Departments of Neurosurgery and Otolaryngology-Head; amp, Neck Surgery, The Affiliated Zhongnan Hospital of Wuhan University, Wuhan 430071, China; Wu, Xingye [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Shu, Yi [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Li, Yasha [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; Zhang, Wenwen [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department; Reid, Russell R. [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Department of Surgery, Section of Plastic; Lee, Michael J. [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Wolf, Jennifer Moritis [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Tirrell, Matthew [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; He, Tong-Chuan [Molecular Oncology Laboratory, Department of Orthopaedic Surgery and Rehabilitation Medicine, The University of Chicago Medical Center, Chicago, Illinois 60637, United States; Ministry of Education Key Laboratory of; de Pablo, Juan J. [Institute for Molecular Engineering, The University of Chicago, Chicago, Illinois 60637, United States; Argonne National Laboratory, Argonne, Illinois 60439, United States; Deng, Zhong-Liang [Department of Orthopaedic
2017-05-04
Graphene-based materials are used in many fields but have found only limited applications in biomedicine, including bone tissue engineering. Here, we demonstrate that novel hybrid materials consisting of gelatin-derived graphene and silicate nanosheets of Laponite (GL) are biocompatible and promote osteogenic differentiation of mesenchymal stem cells (MSCs). Homogeneous cell attachment, long-term proliferation, and osteogenic differentiation of MSCs on a GL-scaffold were confirmed using optical microscopy and scanning electron microscopy. GL-powders made by pulverizing the GL-scaffold were shown to promote bone morphogenetic protein (BMP9)-induced osteogenic differentiation. GL-powders increased the alkaline phosphatase (ALP) activity in immortalized mouse embryonic fibroblasts but decreased the ALP activity in more-differentiated immortalized mouse adipose-derived cells. Note, however, that GL-powders promoted BMP9-induced calcium mineral deposits in both MSC lines, as assessed using qualitative and quantitative alizarin red assays. Furthermore, the expression of chondro-osteogenic regulator markers such as Runx2, Sox9, osteopontin, and osteocalcin was upregulated by the GL-powder, independent of BMP9 stimulation; although the powder synergistically upregulated the BMP9-induced Osterix expression, the adipogenic marker PPAR gamma was unaffected. Furthermore, in vivo stem cell implantation experiments demonstrated that GL-powder could significantly enhance the BMP9-induced ectopic bone formation from MSCs. Collectively, our results strongly suggest that the GL hybrid materials promote BMP9-induced osteogenic differentiation of MSCs and hold promise for the development of bone tissue engineering platforms.
Erythroid cell mitochondria receive endosomal iron by a "kiss-and-run" mechanism.
Hamdi, Amel; Roshan, Tariq M; Kahawita, Tanya M; Mason, Anne B; Sheftel, Alex D; Ponka, Prem
2016-12-01
In erythroid cells, more than 90% of transferrin-derived iron enters mitochondria where ferrochelatase inserts Fe 2+ into protoporphyrin IX. However, the path of iron from endosomes to mitochondrial ferrochelatase remains elusive. The prevailing opinion is that, after its export from endosomes, the redox-active metal spreads into the cytosol and mysteriously finds its way into mitochondria through passive diffusion. In contrast, this study supports the hypothesis that the highly efficient transport of iron toward ferrochelatase in erythroid cells requires a direct interaction between transferrin-endosomes and mitochondria (the "kiss-and-run" hypothesis). Using a novel method (flow sub-cytometry), we analyze lysates of reticulocytes after labeling these organelles with different fluorophores. We have identified a double-labeled population definitively representing endosomes interacting with mitochondria, as demonstrated by confocal microscopy. Moreover, we conclude that this endosome-mitochondrion association is reversible, since a "chase" with unlabeled holotransferrin causes a time-dependent decrease in the size of the double-labeled population. Importantly, the dissociation of endosomes from mitochondria does not occur in the absence of holotransferrin. Additionally, mutated recombinant holotransferrin, that cannot release iron, significantly decreases the uptake of 59 Fe by reticulocytes and diminishes 59 Fe incorporation into heme. This suggests that endosomes, which are unable to provide iron to mitochondria, cause a "traffic jam" leading to decreased endocytosis of holotransferrin. Altogether, our results suggest that a molecular mechanism exists to coordinate the iron status of endosomal transferrin with its trafficking. Besides its contribution to the field of iron metabolism, this study provides evidence for a new intracellular trafficking pathway of organelles. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Weina Cao
2018-02-01
Full Text Available Background/Aims: Impaired adipogenesis may be the underlying cause in the development of obesity and type II diabetes. Mechanistically, the family of Homeobox transcription factors is implicated in the regulation of adipocyte fate. Hoxa5 is highly expressed in adipocytes, and its mRNA expression is decreased during differentiation. However, the function of Hoxa5 in adipose tissue has been poorly understood. The aim of this study is to unveil the role of Hoxa5 on adipocyte differentiation and its underlying mechanisms. Methods: Quantitative real-time PCR (qPCR and western blot were performed to determine Hoxa5 expression in primary adipocytes and in adipose tissues from mice. Lipid accumulation was evaluated by bodipy staining. Dual luciferase assay was applied to explore the transcription factor of Hoxa5 and the transcriptional target gene modulated by Hoxa5. All measurements were performed at least for three times at least. Results: A significant reduction of Hoxa5 expression was observed in adipose tissue of High Fat Diet (HFD induced obesity mice. We determined Hoxa5 increased adipocytes differentiation and mitochondrial biogenesis in adipocytes in vitro. CEBPβ was determined a transcription factor of Hoxa5 and inhibited methylation level of Hoxa5 by combining on the promoter of Hoxa5. Importantly, we found Fabp4, a known positive regulator of adipocytes differentiation, was transcriptional activation by Hoxa5. In addition, Hoxa5 promotes adipocytes differentiation by inhibiting PKA/HSL pathway. Conclusion: Our study demonstrated the promoting role of Hoxa5 in adipocytes differentiation and therefore bringing a new therapeutic mean to the treatment of obesity and type II diabetes.
PRV-1, erythroid colonies and platelet Mpl are unrelated to thrombosis in essential thrombocythaemia
DEFF Research Database (Denmark)
Vannucchi, Alessandro M; Pancrazzi, Alessandro; Antonioli, Elisabetta
2004-01-01
markers of ET, namely PRV-1 overexpression, endogenous erythroid colony (EEC) formation, and reduced platelet Mpl content. Fifty-three (60%) of 88 subjects studied had monoclonal myelopoiesis and presented a 32% incidence of major thrombosis compared with 6% of polyclonal subjects (P = 0.......009). The frequency of abnormalities of PRV-1, EEC, or Mpl was similar in monoclonal and polyclonal subjects (respectively, 28%, 48%, 75%, and 37%, 27%, 63%), and none of them correlated with thrombosis. We conclude that the exploited epigenetic markers constitute independent phenotypic variations...
Qi, Chao; Zhou, Ding; Zhu, Ying-Jie; Sun, Tuan-Wei; Chen, Feng; Zhang, Chang-Qing
2017-08-01
Human bone mesenchymal stem cells (hBMSCs) have the ability to differentiate into bone and cartilage for clinical bone regeneration. Biomaterials with an innate ability to stimulate osteogenic differentiation of hBMSCs into bone and cartilage are considered attractive candidates for the applications in bone tissue engineering and regeneration. In this paper, we synthesized fructose 1,6-bisphosphate dicalcium (Ca 2 FBP) porous microspheres by the sonochemical method, and investigated the ability of Ca 2 FBP for the promotion of the osteogenic differentiation of hBMSCs. After the hBMSCs were co-cultured with the sterilized powder of Ca 2 FBP porous microspheres for different times, the cell proliferation assay, alkaline phosphatase activity assay, quantitative real-time polymerase chain reaction and western blotting were performed to investigate the bioactivity and osteogenic differentiation performance of the as-prepared product. Compared with hydroxyapatite nanorods, Ca 2 FBP porous microspheres show a superior bioactivity and osteoinductive potential, and can promote the cell differentiation of hBMSCs in vitro, thus, they are promising for applications in the tissue engineering field such as dental and bone defect repair. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zeadin, Melec G.; Butcher, Martin K.; Shaughnessy, Stephen G. [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada); Werstuck, Geoff H., E-mail: Geoff.Werstuck@taari.ca [Department of Medicine, McMaster University, Hamilton, ON (Canada); Thrombosis and Atherosclerosis Research Institute, Hamilton, ON (Canada)
2012-09-07
Highlights: Black-Right-Pointing-Pointer Leptin promotes osteoblast differentiation of primary smooth muscle cells. Black-Right-Pointing-Pointer Leptin regulates the expression of genes involved in osteoblast differentiation. Black-Right-Pointing-Pointer Constitutively active GSK-3{beta} attenuates leptin-induced osteoblast differentiation. Black-Right-Pointing-Pointer This suggests that leptin signals through GSK-3{beta} to promote osteoblast differentiation. -- Abstract: In this study, we begin to investigate the underlying mechanism of leptin-induced vascular calcification. We found that treatment of cultured bovine aortic smooth muscle cells (BASMCs) with leptin (0.5-4 {mu}g/ml) induced osteoblast differentiation in a dose-dependent manner. Furthermore, we found that leptin significantly increased the mRNA expression of osteopontin and bone sialoprotein, while down-regulating matrix gla protein (MGP) expression in BASMCs. Key factors implicated in osteoblast differentiation, including members of the Wnt signaling pathway, were examined. Exposure to leptin enhanced phosphorylation of GSK-3{beta} on serine-9 thereby inhibiting activity and promoting the nuclear accumulation of {beta}-catenin. Transfection of BASMCs with an adenovirus that expressed constitutively active GSK-3{beta} (Ad-GSK-3{beta} S9A) resulted in a >2-fold increase in GSK-3{beta} activity and a significant decrease in leptin-induced alkaline phosphatase (ALP) activity. In addition, qRT-PCR analysis showed that GSK-3{beta} activation resulted in a significant decrease in the expression of osteopontin and bone sialoprotein, but a marked increase in MGP mRNA expression. When taken together, our results suggest a mechanism by which leptin promotes osteoblast differentiation and vascular calcification in vivo.
Wu, Xiuxiang; Qu, Xuebin; Zhang, Qiang; Dong, Fuxing; Yu, Hongli; Yan, Chen; Qi, Dashi; Wang, Meng; Liu, Xuan; Yao, Ruiqin
2014-04-01
The aim of this study was to investigate quercetin's (Qu) ability to promote proliferation and differentiation of oligodendrocyte precursor cells (OPCs) under oxygen/glucose deprivation (OGD)-induced injury in vitro. The results showed that after OGD, OPCs survival rate was significantly increased by Qu as measured by Cell Counting Kit-8. Furthermore, Qu treatment reduced apoptosis of OPCs surveyed by Hoechst 33258 nuclear staining. Qu at 9 and 27 μM promoted the proliferation of OPCs the most by Brdu and Olig2 immunocytochemical staining after OGD 3 days. Also, Qu treatment for 8 days after OGD, the differentiation of OPCs to oligodendrocyte was detected by immunofluorescence staining showing that O4, Olig2, and myelin basic protein (MBP) positive cells were significantly increased compared to control group. Additionally, the protein levels of Olig2 and MBP of OPCs were quantified using western blot and mRNA levels of Olig2 and Inhibitor of DNA binding 2 (Id2) were measured by RT-PCR. Western blot showed a significant increase in Olig2 and MBP expression levels compared with controls after OGD and Qu treatment with a linear does-response curve from 3 to 81 μM. After treatment with Qu compared to its control group, Olig2 mRNA level was significantly up-regulated, whereas Id2 mRNA level was down-regulated. In conclusion, Qu at 3-27 μM can promote the proliferation and differentiation of OPCs after OGD injury and may regulate the activity of Olig2 and Id2.
Directory of Open Access Journals (Sweden)
Prasuna Paluru
2014-03-01
Full Text Available The Wnt gene family consists of structurally related genes encoding secreted signaling molecules that have been implicated in many developmental processes, including regulation of cell fate and patterning during embryogenesis. Previously, we found that Wnt signaling is required for primitive or yolk sac-derived-erythropoiesis using the murine embryonic stem cell (ESC system. Here, we examine the effect of Wnt signaling on the formation of early hematopoietic progenitors derived from human ESCs. The first hematopoietic progenitor cells in the human ESC system express the pan-hematopoietic marker CD41 and the erythrocyte marker, glycophorin A or CD235. We have developed a novel serum-free, feeder-free, adherent differentiation system that can efficiently generate large numbers of CD41 + CD235+ cells. We demonstrate that this cell population contains progenitors not just for primitive erythroid and megakaryocyte cells but for the myeloid lineage as well and term this population the primitive common myeloid progenitor (CMP. Treatment of mesoderm-specified cells with Wnt3a led to a loss of hematopoietic colony-forming ability while the inhibition of canonical Wnt signaling with DKK1 led to an increase in the number of primitive CMPs. Canonical Wnt signaling also inhibits the expansion and/or survival of primitive erythrocytes and megakaryocytes, but not myeloid cells, derived from this progenitor population. These findings are in contrast to the role of Wnt signaling during mouse ESC differentiation and demonstrate the importance of the human ESC system in studying species-specific differences in development.
Fan, Cuiqing; Xiong, Yuan; Zhu, Ning; Lu, Yabin; Zhang, Jiewen; Wang, Song; Liang, Zicai; Shen, Yan; Chen, Meihong
2011-03-01
Cancers are characterized by poor differentiation. Differentiation therapy is a strategy to alleviate malignant phenotypes by inducing cancer cell differentiation. Here we carried out a combinatorial high-throughput screen with a random siRNA library on human erythroleukemia K-562 cell differentiation. Two siRNAs screened from the library were validated to be able to induce erythroid differentiation to varying degrees, determined by CD235 and globin up-regulation, GATA-2 down-regulation, and cell growth inhibition. The screen we performed here is the first trial of screening cancer differentiation-inducing agents from a random siRNA library, demonstrating that a random siRNA library can be considered as a new resource in efforts to seek new therapeutic agents for cancers. As a random siRNA library has a broad coverage for the entire genome, including known/unknown genes and protein coding/non-coding sequences, screening using a random siRNA library can be expected to greatly augment the repertoire of therapeutic siRNAs for cancers.
NLS-RARα promotes proliferation and inhibits differentiation in HL-60 cells.
Hu, Xiu-Xiu; Zhong, Liang; Zhang, Xi; Gao, Yuan-Mei; Liu, Bei-Zhong
2014-01-01
A unique mRNA produced in leukemic cells from a t(15;17) acute promyelocytic leukemia (APL) patient encodes a fusion protein between the retinoic acid receptor α (RARα) and a myeloid gene product called PML. Studies have reported that neutrophil elastase (NE) cleaves bcr-1-derived PML-RARα in early myeloid cells, leaving only the nuclear localization signal (NLS) of PML attached to RARα. The resultant NLS-RARα fusion protein mainly localizes to, and functions within, the cell nucleus. It is speculated that NLS-RARα may act in different ways from the wild-type RARα, but its biological characteristics have not been reported. This study takes two approaches. Firstly, the NLS-RARα was silenced with pNLS-RARα-shRNA. The mRNA and protein expression of NLS-RARα were detected by RT-PCR and Western blot respectively. Cell proliferation in vitro was assessed by MTT assay. Flow cytometry (FCM) was used to detect the differentiation of cells. Secondly, the NLS-RARα was over-expressed by preparation of recombinant adenovirus HL-60/pAd-NLS-RARα. The assays of mRNA and protein expression of NLS-RARα, and cell proliferation, were as above. By contrast, cell differentiation was stimulated by all trans retinoic acid (ATRA) (2.5µmol/L) at 24h after virus infection of pAd-NLS-RARα, and then detected by CD11b labeling two days later. The transcription and translation of C-MYC was detected in HL-60/pAd-NLS-RARα cells which treated by ATRA. Our results showed that compared to the control groups, the expression of NLS-RARα was significantly reduced in the HL-60/pNLS-RARα-shRNA cells, and increased dramatically in the HL-60/pAd-NLS-RARα cells. The proliferation was remarkably inhibited in the HL-60/pNLS-RARα-shRNA cells in a time-dependent manner, but markedly promoted in the HL-60/pAd-NLS-RARα cells. FCM outcome revealed the differentiation increased in HL-60/pNLS-RARα-shRNA cells, and decreased in the HL-60/pAd-NLS-RARα cells treated with 2.5µmol/L ATRA. The
Directory of Open Access Journals (Sweden)
Shy Cian Khor
Full Text Available Aging results in a loss of muscle mass and strength. Myoblasts play an important role in maintaining muscle mass through regenerative processes, which are impaired during aging. Vitamin E potentially ameliorates age-related phenotypes. Hence, this study aimed to determine the effects of the tocotrienol-rich fraction (TRF and α-tocopherol (ATF in protecting myoblasts from replicative senescence and promoting myogenic differentiation. Primary human myoblasts were cultured into young and senescent stages and were then treated with TRF or ATF for 24 h, followed by an analysis of cell proliferation, senescence biomarkers, cellular morphology and differentiation. Our data showed that replicative senescence impaired the normal regenerative processes of myoblasts, resulting in changes in cellular morphology, cell proliferation, senescence-associated β-galactosidase (SA-β-gal expression, myogenic differentiation and myogenic regulatory factors (MRFs expression. Treatment with both TRF and ATF was beneficial to senescent myoblasts in reclaiming the morphology of young cells, improved cell viability and decreased SA-β-gal expression. However, only TRF treatment increased BrdU incorporation in senescent myoblasts, as well as promoted myogenic differentiation through the modulation of MRFs at the mRNA and protein levels. MYOD1 and MYOG gene expression and myogenin protein expression were modulated in the early phases of myogenic differentiation. In conclusion, the tocotrienol-rich fraction is superior to α-tocopherol in ameliorating replicative senescence-related aberration and promoting differentiation via modulation of MRFs expression, indicating vitamin E potential in modulating replicative senescence of myoblasts.
Forced differentiation of CFU-s by iron-55 erythrocytocide
International Nuclear Information System (INIS)
Reincke, U.; Brookoff, D.; Burlington, H.; Cronkite, E.P.
1978-01-01
Cascades of Auger electrons are emitted in the decay of 55 Fe and absorbed in tissue within a 1 μm radius. Cytocidal amounts of 55 Fe can therefore eliminate erythroid precursors with minimal damage to adjacent cells. Early events leave the granuloid series undisturbed but they are accompanied by a precipitous fall of pluripotent stem cells levels (CFU-s) in bone marrow, spleen, and blood. The pretreatment levels of CFU-s are not restored. Gradual decline of CFU-s is associated with intermittently increased turnover rate and reduced settings of cell production, yet unimpaired capacity for quick restoration of blood loss. The precipitous initial stem cell decrease is not caused by irradiation damage as shown in a separate experimental series which uses the frozen-storage cytocide technique. Only over several weeks could 55 Fe radiation accumulate to lethal levels in nondividing stem cells. This irradiation is attributed to incorporation of small amounts of 55 Fe into CFU-s from where it is slowly cleared. The stem cell loss immediately following 55 Fe injection is in our interpretation caused by rapid differentiation along the erythroid pathway in a response that involves all progenitor populations. Data are consistent with the hypothesis of limited cell renewal capacity which thereby gains further support
Neural stem cells promote nerve regeneration through IL12-induced Schwann cell differentiation.
Lee, Don-Ching; Chen, Jong-Hang; Hsu, Tai-Yu; Chang, Li-Hsun; Chang, Hsu; Chi, Ya-Hui; Chiu, Ing-Ming
2017-03-01
Regeneration of injured peripheral nerves is a slow, complicated process that could be improved by implantation of neural stem cells (NSCs) or nerve conduit. Implantation of NSCs along with conduits promotes the regeneration of damaged nerve, likely because (i) conduit supports and guides axonal growth from one nerve stump to the other, while preventing fibrous tissue ingrowth and retaining neurotrophic factors; and (ii) implanted NSCs differentiate into Schwann cells and maintain a growth factor enriched microenvironment, which promotes nerve regeneration. In this study, we identified IL12p80 (homodimer of IL12p40) in the cell extracts of implanted nerve conduit combined with NSCs by using protein antibody array and Western blotting. Levels of IL12p80 in these conduits are 1.6-fold higher than those in conduits without NSCs. In the sciatic nerve injury mouse model, implantation of NSCs combined with nerve conduit and IL12p80 improves motor recovery and increases the diameter up to 4.5-fold, at the medial site of the regenerated nerve. In vitro study further revealed that IL12p80 stimulates the Schwann cell differentiation of mouse NSCs through the phosphorylation of signal transducer and activator of transcription 3 (Stat3). These results suggest that IL12p80 can trigger Schwann cell differentiation of mouse NSCs through Stat3 phosphorylation and enhance the functional recovery and the diameter of regenerated nerves in a mouse sciatic nerve injury model. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Debeb, Bisrat G.; Xu Wei; Mok, Henry; Li Li; Robertson, Fredika; Ueno, Naoto T.; Reuben, Jim; Lucci, Anthony; Cristofanilli, Massimo; Woodward, Wendy A.
2010-01-01
Purpose: It has been shown that valproic acid (VA) enhances the proliferation and self-renewal of normal hematopoietic stem cells and that breast cancer stem/progenitor cells can be resistant to radiation. From these data, we hypothesized that VA would fail to radiosensitize breast cancer stem/progenitor cells grown to three-dimensional (3D) mammospheres. Methods and Materials: We used the MCF7 breast cancer cell line grown under stem cell-promoting culture conditions (3D mammosphere) and standard nonstem cell monolayer culture conditions (two-dimensional) to examine the effect of pretreatment with VA on radiation sensitivity in clonogenic survival assays and on the expression of embryonic stem cell transcription factors. Results: 3D-cultured MCF-7 cells expressed higher levels of Oct4, Nanog, and Sox2. The 3D passage enriched self-renewal and increased radioresistance in the 3D mammosphere formation assays. VA radiosensitized adherent cells but radioprotected 3D cells in single-fraction clonogenic assays. Moreover, fractionated radiation sensitized VA-treated adherent MCF7 cells but did not have a significant effect on VA-treated single cells grown to mammospheres. Conclusion: We have concluded that VA might preferentially radiosensitize differentiated cells compared with those expressing stem cell surrogates and that stem cell-promoting culture is a useful tool for in vitro evaluation of novel cancer therapeutic agents and radiosensitizers.
Iqbal, Asif J; McNeill, Eileen; Kapellos, Theodore S; Regan-Komito, Daniel; Norman, Sophie; Burd, Sarah; Smart, Nicola; Machemer, Daniel E W; Stylianou, Elena; McShane, Helen; Channon, Keith M; Chawla, Ajay; Greaves, David R
2014-10-09
The recruitment of monocytes and their differentiation into macrophages at sites of inflammation are key events in determining the outcome of the inflammatory response and initiating the return to tissue homeostasis. To study monocyte trafficking and macrophage differentiation in vivo, we have generated a novel transgenic reporter mouse expressing a green fluorescent protein (GFP) under the control of the human CD68 promoter. CD68-GFP mice express high levels of GFP in both monocyte and embryo-derived tissue resident macrophages in adult animals. The human CD68 promoter drives GFP expression in all CD115(+) monocytes of adult blood, spleen, and bone marrow; we took advantage of this to directly compare the trafficking of bone marrow-derived CD68-GFP monocytes to that of CX3CR1(GFP) monocytes in vivo using a sterile zymosan peritonitis model. Unlike CX3CR1(GFP) monocytes, which downregulate GFP expression on differentiation into macrophages in this model, CD68-GFP monocytes retain high-level GFP expression for 72 hours after differentiation into macrophages, allowing continued cell tracking during resolution of inflammation. In summary, this novel CD68-GFP transgenic reporter mouse line represents a powerful resource for analyzing monocyte mobilization and monocyte trafficking as well as studying the fate of recruited monocytes in models of acute and chronic inflammation. © 2014 by The American Society of Hematology.
Locker, Morgane; Kellermann, Odile; Boucquey, Marie; Khun, Huot; Huerre, Michel; Poliard, Anne
2004-01-01
The pluripotent mesoblastic C1 cell line was used under serum-free culture conditions to investigate how paracrine and autocrine signals cooperate to drive chondrogenesis. Sequential addition of two systemic hormones, dexamethasone and triiodothyronine, permits full chondrogenic differentiation. The cell intrinsic activation of the BMP signaling pathway and Sox9 expression occurring on mesoblastic condensation is insufficient for recruitment of the progenitors. Dexamethasone-dependent Sox9 upregulation is essential for chondrogenesis. Differentiation of lineage stem cells relies on cell autonomous regulations modulated by external signals. We used the pluripotent mesoblastic C1 cell line under serum-free culture conditions to investigate how paracrine and autocrine signals cooperate to induce differentiation of a precursor clone along the chondrogenic lineage. C1 cells, cultured as aggregates, were induced toward chondrogenesis by addition of 10(-7) M dexamethasone in serum-free medium. After 30 days, dexamethasone was replaced by 10 nM triiodothyronine to promote final hypertrophic conversion. Mature and hypertrophic phenotypes were characterized by immunocytochemistry using specific antibodies against types II and X collagens, respectively. Type II collagen, bone morphogenetic proteins (BMPs), BMP receptors, Smads, and Sox9 expression were monitored by reverse transcriptase-polymerase chain reaction (RT-PCR), Northern blot, and/or Western blot analysis. Once C1 cells have formed nodules, sequential addition of two systemic hormones is sufficient to promote full chondrogenic differentiation. In response to dexamethasone, nearly 100% of the C1 precursors engage in chondrogenesis and convert within 30 days into mature chondrocytes, which triggers a typical cartilage matrix. On day 25, a switch in type II procollagen mRNA splicing acted as a limiting step in the acquisition of the mature chondrocyte phenotype. On day 30, substitution of dexamethasone with
Directory of Open Access Journals (Sweden)
Choi SY
2015-07-01
Full Text Available Seon Young Choi,1 Min Seok Song,1 Pan Dong Ryu,1 Anh Thu Ngoc Lam,2 Sang-Woo Joo,2 So Yeong Lee1 1Laboratory of Veterinary Pharmacology, Research Institute for Veterinary Science, College of Veterinary Medicine, Seoul National University, 2Department of Chemistry, Soongsil University, Seoul, South Korea Abstract: Gold nanoparticles (AuNPs are attractive materials for use in biomedicine due to their physical properties. Increasing evidence suggests that several nanoparticles induce the differentiation of human mesenchymal stem cells into osteoblasts and adipocytes. In this study, we hypothesized that chitosan-conjugated AuNPs promote the osteogenic differentiation of human adipose-derived mesenchymal stem cells. For the evaluation of osteogenic differentiation, alizarin red staining, an alamarBlue® assay, and a quantitative real-time polymerase chain reaction analysis were performed. In order to examine specific signaling pathways, immunofluorescence and a western blotting assay were performed. Our results demonstrate that chitosan-conjugated AuNPs increase the deposition of calcium content and the expression of marker genes related to osteogenic differentiation in human adipose-derived mesenchymal stem cells at nontoxic concentrations. These results indicate that chitosan-conjugated AuNPs promote osteogenesis through the Wnt/β-catenin signaling pathway. Therefore, chitosan-conjugated AuNPs can be used as a reagent for promoting bone formation. Keywords: chitosan-conjugated gold nanoparticle, mineralization, nonphosphorylated beta-catenin
Directory of Open Access Journals (Sweden)
Rossella Cioncada
Full Text Available MF59 is an oil-in-water emulsion adjuvant approved for human influenza vaccination in European Union. The mode of action of MF59 is not fully elucidated yet, but results from several years of investigation indicate that MF59 establishes an immunocompetent environment at injection site which promotes recruitment of immune cells, including antigen presenting cells (APCs, that are facilitated to engulf antigen and transport it to draining lymph node (dLN where the antigen is accumulated. In vitro studies showed that MF59 promotes the differentiation of monocytes to dendritic cells (Mo-DCs. Since after immunization with MF59, monocytes are rapidly recruited both at the injection site and in dLN and appear to have a morphological change toward a DC-like phenotype, we asked whether MF59 could play a role in inducing differentiation of Mo-DC in vivo. To address this question we immunized mice with the auto-fluorescent protein Phycoerythrin (PE as model antigen, in presence or absence of MF59. We measured the APC phenotype and their antigen uptake within dLNs, the antigen distribution within the dLN compartments and the humoral response to PE. In addition, using Ovalbumin as model antigen, we measured the capacity of dLN APCs to induce antigen-specific CD4 T cell proliferation. Here, we show, for the first time, that MF59 promotes differentiation of Mo-DCs within dLNs from intranodal recruited monocytes and we suggest that this differentiation could take place in the medullary compartment of the LN. In addition we show that the Mo-DC subset represents the major source of antigen-loaded and activated APCs within the dLN when immunizing with MF59. Interestingly, this finding correlates with the enhanced triggering of antigen-specific CD4 T cell response induced by LN APCs. This study therefore demonstrates that MF59 is able to promote an immunocompetent environment also directly within the dLN, offering a novel insight on the mechanism of action of
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Directory of Open Access Journals (Sweden)
Sollars Vincent E
2009-03-01
Full Text Available Abstract Background Omega 3 fatty acids have been found to inhibit proliferation, induce apoptosis, and promote differentiation in various cell types. The processes of cell survival, expansion, and differentiation are of key importance in the regulation of hematopoiesis. We investigated the role of omega 3 fatty acids in controlling the frequency of various myeloid progenitor cells in the bone marrow of mice. Increased progenitor cell frequency and blocked differentiation are characteristics of hematopoietic disorders of the myeloid lineage, such as myeloproliferative diseases and myeloid leukemias. Results We found that increasing the proportion of omega 3 fatty acids relative to the proportion of omega 6 fatty acids in the diet caused increased differentiation and reduced the frequency of myeloid progenitor cells in the bone marrow of mice. Furthermore, this had no adverse effect on peripheral white blood cell counts. Conclusion Our results indicate that omega 3 fatty acids impact hematopoietic differentiation by reducing myeloid progenitor cell frequency in the bone marrow and promoting progenitor cell differentiation. Further exploration of this discovery could lead to the use of omega 3 fatty acids as a therapeutic option for patients that have various disorders of hematopoiesis.
Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S
2015-11-01
Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.
Directory of Open Access Journals (Sweden)
Chen Li
2016-01-01
Full Text Available Gold nanoparticles (AuNPs had been widely applied in the practice and advancement of chemistry, biology, and medicine due to facility of synthesis and versatility in surface functionalization. Recent studies had shown that AuNPs can be applied to cells, affecting cellular physiological processes such as proliferation and differentiation. In this study, four diameters of AuNPs (20, 40, 60, and 80 nm were cocultured with human periodontal ligament cells (hPDLCs at six different concentrations. The optimal size and concentration of AuNPs were selected to treat human periodontal ligament stem cells (hPDLSCs to evaluate proliferation. Moreover, the influence of AuNPs on multiple differentiation capacity of hPDLSCs was clarified. The results revealed that AuNPs (60 nm, 56 μM can effectively promote the proliferation of hPDLCs/hPDLSCs in vitro, slightly enhance osteoblastic differentiation, and have no effect on adipogenic differentiation. In addition, the expression of COL-1, Runx2, BSP, and OCN was upregulated in the presence of AuNPs (60 nm, 56 μM. These results indicated that AuNPs (60 nm, 56 μM can effectively promote the proliferation of hPDLCs/hPDLSCs and have no significant effect on the differentiation of hPDLSCs. These results provide an insight on the advantage of implementing of AuNPs on hPDLSCs culture and expose the influence of these materials on periodontal tissue engineering.
Energy Technology Data Exchange (ETDEWEB)
Lee, Sang-Jin; Go, Ga-Yeon; Yoo, Miran; Kim, Yong Kee [Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Seo, Dong-Wan [College of Pharmacy, Dankook University, Cheonan 330-714 (Korea, Republic of); Kang, Jong-Sun [Department of Molecular Cell Biology, Sungkyunkwan University School of Medicine, Samsung Biomedical Research Institute, Suwon 440-746 (Korea, Republic of); Bae, Gyu-Un, E-mail: gbae@sookmyung.ac.kr [Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)
2016-01-29
Peroxisome proliferator-activated receptor β/δ (PPARβ/δ) regulates postnatal myogenesis by alleviating myostatin activity, but the molecular mechanisms by which it regulates myogenesis are not fully understood. In this study, we investigate molecular mechanisms of PPARβ/δ in myoblast differentiation. C2C12 myoblasts treated with a PPARβ/δ agonist, GW0742 exhibit enhanced myotube formation and muscle-specific gene expression. GW0742 treatment dramatically activates promyogenic kinases, p38MAPK and Akt, in a dose-dependent manner. GW0742-stimulated myoblast differentiation is mediated by p38MAPK and Akt, since it failed to restore myoblast differentiation repressed by inhibition of p38MAPK and Akt. In addition, GW0742 treatment enhances MyoD-reporter activities. Consistently, overexpression of PPARβ/δ enhances myoblast differentiation accompanied by elevated activation of p38MAPK and Akt. Collectively, these results suggest that PPARβ/δ enhances myoblast differentiation through activation of promyogenic signaling pathways. - Highlights: • A PPARβ/δ agonist, GW0742 promotes myoblast differentiation. • GW0742 activates both p38MAPK and Akt activation in myogenic differentiation. • GW0742 enhances MyoD activity for myogenic differentiation. • Overexpression of PPARβ/δ enhances myoblast differentiation via activating promyogenic signaling pathways. • This is the first finding for agonistic mechanism of PPARβ/δ in myogenesis.
International Nuclear Information System (INIS)
Lee, Sang-Jin; Go, Ga-Yeon; Yoo, Miran; Kim, Yong Kee; Seo, Dong-Wan; Kang, Jong-Sun; Bae, Gyu-Un
2016-01-01
Peroxisome proliferator-activated receptor β/δ (PPARβ/δ) regulates postnatal myogenesis by alleviating myostatin activity, but the molecular mechanisms by which it regulates myogenesis are not fully understood. In this study, we investigate molecular mechanisms of PPARβ/δ in myoblast differentiation. C2C12 myoblasts treated with a PPARβ/δ agonist, GW0742 exhibit enhanced myotube formation and muscle-specific gene expression. GW0742 treatment dramatically activates promyogenic kinases, p38MAPK and Akt, in a dose-dependent manner. GW0742-stimulated myoblast differentiation is mediated by p38MAPK and Akt, since it failed to restore myoblast differentiation repressed by inhibition of p38MAPK and Akt. In addition, GW0742 treatment enhances MyoD-reporter activities. Consistently, overexpression of PPARβ/δ enhances myoblast differentiation accompanied by elevated activation of p38MAPK and Akt. Collectively, these results suggest that PPARβ/δ enhances myoblast differentiation through activation of promyogenic signaling pathways. - Highlights: • A PPARβ/δ agonist, GW0742 promotes myoblast differentiation. • GW0742 activates both p38MAPK and Akt activation in myogenic differentiation. • GW0742 enhances MyoD activity for myogenic differentiation. • Overexpression of PPARβ/δ enhances myoblast differentiation via activating promyogenic signaling pathways. • This is the first finding for agonistic mechanism of PPARβ/δ in myogenesis.
Prospective identification of erythroid elements in cultured peripheral blood.
Miller, J L; Njoroge, J M; Gubin, A N; Rodgers, G P
1999-04-01
We have developed a prospective approach to identify the generation of erythroid cells derived from cultured peripheral blood mononuclear cells (PBMC) by monitoring the expression of the cell surface protein CD48. Unpurified populations of PBMC obtained from the buffy coats of normal volunteers were grown in suspension culture in the absence or presence of erythropoietin. A profile of surface CD48 expression permitted a flow cytometric identification of erythropoietin responsive populations at various stages of their maturation. In the absence of erythropoietin (EPO) supplemented media, the CD48- cells represented <5% of the total population of PBMC remaining in culture. In cultures supplemented with 1 U/mL EPO, the mean percentage of CD48- cells increased to 34.7 + 14.9% (p < 0.01) after 14 days in culture. Coordinated CD34 and CD71 (transferrin receptor) expression, morphology, gamma-globin transcription, and colony formation in methylcellulose were observed during the 14-day culture period. Flow cytometric monitoring of bulk cultured PBMC provides a simple and reliable means for the prospective or real-time study of human erythropoiesis.
Effects of low-level (1.0 R) x-irradiation on the erythroid response of the rat bone marrow
International Nuclear Information System (INIS)
Gong, J.K.; Glomski, C.A.; Frederiksen, N.L.; Lawson, A.J.; Daley, J.P.
1976-01-01
The levels of normoblasts in the bone marrow of six groups of female Sprague--Dawley rats previously exposed to a 1.0 R dose of x rays were compared with those in sham-exposed animals at intervals from 14 hr to 10 weeks postirradiation. Four parameters were analyzed, the percentage of normoblasts in Wright's Giemsa stained marrow smears, and the number of erythroid precursors per milligram of isolated marrow sample, per whole femur, and per entire skeleton. The studies were based on marrow examinations and on 59 Fe tracer data. At all intervals except the earliest, [14 hr], significant elevations in the percentage of normoblasts were found in the bone marrow. In addition, at 6 and 10 weeks postirradiation increases were found in the number of normoblasts in the isolated marrow samples, whole femurs, and total skeletons. When compared 81 hr after phlebotomy, subnormal increases in normoblast levels were found in all four parameters of the irradiated subjects. The results suggest that x irradiation at this dose level can induce an abnormal marrow function manifested by an elevated number of normoblasts and, after phlebotomy, by a subnormal proliferation of the erythroid precursors
Bonvicini, Francesca; Bua, Gloria; Manaresi, Elisabetta; Gallinella, Giorgio
2016-07-15
Human parvovirus B19 (B19V) commonly induces self-limiting infections but can also cause severe clinical manifestations in patients with underlying haematological disorders or with immune system deficits. Currently, therapeutic options for B19V entirely rely on symptomatic and supportive treatments since a specific antiviral therapy is not yet available. Recently a first step in the research for active compounds inhibiting B19V replication has allowed identifying the acyclic nucleoside phosphonate cidofovir (CDV). Herein, the effect of CDV against B19V replication was characterized in human erythroid progenitor cells (EPCs) cultured and infected following different experimental approaches to replicate in vitro the infection of an expanding erythroid cell population in the bone marrow. B19V replication was selectively inhibited both in infected EPCs extendedly exposed to CDV 500μM (viral inhibition 82%) and in serially infected EPCs cultures with passage of the virus progeny, constantly under drug exposure (viral inhibition 99%). In addition, a potent inhibitory effect against B19V (viral inhibition 92%) was assessed in a short-term infection of EPCs treated with CDV 500μM 1day before viral infection. In the evaluated experimental conditions, the enhanced effect of CDV against B19V might be ascribed both to the increased intracellular drug concentration achieved by extended exposure, and to a progressive reduction in efficiency of the replicative process within treated EPCs population. Copyright © 2016 Elsevier B.V. All rights reserved.
Dynamic 3D culture promotes spontaneous embryonic stem cell differentiation in vitro.
Gerlach, Jörg C; Hout, Mariah; Edsbagge, Josefina; Björquist, Petter; Lübberstedt, Marc; Miki, Toshio; Stachelscheid, Harald; Schmelzer, Eva; Schatten, Gerald; Zeilinger, Katrin
2010-02-01
Spontaneous in vitro differentiation of mouse embryonic stem cells (mESC) is promoted by a dynamic, three-dimensional (3D), tissue-density perfusion technique with continuous medium perfusion and exchange in a novel four-compartment, interwoven capillary bioreactor. We compared ectodermal, endodermal, and mesodermal immunoreactive tissue structures formed by mESC at culture day 10 with mouse fetal tissue development at gestational day E9.5. The results show that the bioreactor cultures more closely resemble mouse fetal tissue development at gestational day E9.5 than control mESC cultured in Petri dishes.
Heme and erythropoieis: more than a structural role.
Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela
2014-06-01
Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own synthesis and regulates the expression of several erythroid-specific genes. Heme is synthesized in developing erythroid progenitors by the stage of proerythroblast, through a series of eight enzymatic reactions divided between mitochondria and cytosol. Defects of heme synthesis in the erythroid lineage result in sideroblastic anemias, characterized by microcytic anemia associated to mitochondrial iron overload, or in erythropoietic porphyrias, characterized by porphyrin deposition in erythroid cells. Here, we focus on the heme biosynthetic pathway and on human erythroid disorders due to defective heme synthesis. The regulatory role of heme during erythroid differentiation is discussed as well as the heme-mediated regulatory mechanisms that allow the orchestration of the adaptive cell response to heme deficiency. Copyright© Ferrata Storti Foundation.
[Update on the biology of heme synthesis in erythroid cells].
Fujiwara, Tohru; Harigae, Hideo
2015-02-01
Heme is a prosthetic group of hemoproteins playing important roles in oxygen transport, detoxification, circadian rhythm, microRNA processing, regulation of transcription, and translation. The majority of heme (-85%) is synthesized in red blood cells mainly for hemoglobin production, whereas hepatocytes account for most of the rest, functioning primarily in the synthesis of cytochrome P450 enzymes and mitochondrial respiratory enzymes. Thus, failure of heme biosynthesis causes severe inherited or acquired disorders in humans, including porphyria and sideroblastic anemia. The heme biosynthetic pathway is composed of eight enzymes that work in either mitochondria or the cytoplasm, which have been extensively researched and frequently reviewed. On the other hand, the mechanisms governing transport and intracellular trafficking of heme intermediates, as well as their potential links to human diseases, are poorly understood. Herein, we focus on recent understanding of the heme biosynthetic pathway and on human disorders due to defective heme synthesis in erythroid cells, such as X-linked sideroblastic anemia and erythropoietic protoporphyria.
Directory of Open Access Journals (Sweden)
Ali Dehghanifard
2012-07-01
Full Text Available Background: The use of drugs with the ability to induce production of fetal hemoglobin as a novel therapeutic approach in treating β-Hemoglobinopathies is considered. γ-globin gene expression inducer drugs including sodium butyrate and thalidomide can reduce additional α-globin chains accumulation in erythroid precursors. Materials and Methods: In this experimental study, MACS kit was used to isolate CD133+ cells of umbilical cord blood. Further, the effect of two drugs of thalidomide and sodium butyrate were separately and combined studied on the induction of quantitative expression of β-globin and γ-globin genes in erythroid precursor cells derived from CD133+ stem cells in-vitro. For this purpose, the technique SYBR green Real-time PCR was used.Results: Flow cytometry results showed that approximately 95% of purified cells were CD133+. Real-time PCR results also showed the increased levels of γ-globin mRNA in the cell groups treated with thalidomide, sodium butyrate and combination of drugs as 2.6 and 1.2 and 3.5 times respectively, and for β-globin gene, it is respectively 1.4 and 1.3 and 1.6 times compared with the control group (p<0.05.Conclusion: The study results showed that the mentioned drug combination can act as a pharmaceutical composition affecting the induction of fetal hemoglobin expression in erythroid precursor cells derived from CD133 + cells.
Energy Technology Data Exchange (ETDEWEB)
Naruse, Masae; Shibasaki, Koji; Ishizaki, Yasuki, E-mail: yasukiishizaki@gunma-u.ac.jp
2015-08-07
The origins and developmental regulation of cerebellar oligodendrocytes are largely unknown, although some hypotheses of embryonic origins have been suggested. Neural stem cells exist in the white matter of postnatal cerebellum, but it is unclear whether these neural stem cells generate oligodendrocytes at postnatal stages. We previously showed that cerebellar progenitor cells, including neural stem cells, widely express CD44 at around postnatal day 3. In the present study, we showed that CD44-positive cells prepared from the postnatal day 3 cerebellum gave rise to neurospheres, while CD44-negative cells prepared from the same cerebellum did not. These neurospheres differentiated mainly into oligodendrocytes and astrocytes, suggesting that CD44-positive neural stem/progenitor cells might generate oligodendrocytes in postnatal cerebellum. We cultured CD44-positive cells from the postnatal day 3 cerebellum in the presence of signaling molecules known as mitogens or inductive differentiation factors for oligodendrocyte progenitor cells. Of these, only FGF-2 promoted survival and proliferation of CD44-positive cells, and these cells differentiated into O4+ oligodendrocytes. Furthermore, we examined the effect of FGF-2 on cerebellar oligodendrocyte development ex vivo. FGF-2 enhanced proliferation of oligodendrocyte progenitor cells and increased the number of O4+ and CC1+ oligodendrocytes in slice cultures. These results suggest that CD44-positive cells might be a source of cerebellar oligodendrocytes and that FGF-2 plays important roles in their development at an early postnatal stage. - Highlights: • CD44 is expressed in cerebellar neural stem/progenitor cells at postnatal day 3 (P3). • FGF-2 promoted proliferation of CD44-positive progenitor cells from P3 cerebellum. • FGF-2 promoted oligodendrocytic differentiation of CD44-positive progenitor cells. • FGF-2 increased the number of oligodendrocytes in P3 cerebellar slice culture.
International Nuclear Information System (INIS)
Naruse, Masae; Shibasaki, Koji; Ishizaki, Yasuki
2015-01-01
The origins and developmental regulation of cerebellar oligodendrocytes are largely unknown, although some hypotheses of embryonic origins have been suggested. Neural stem cells exist in the white matter of postnatal cerebellum, but it is unclear whether these neural stem cells generate oligodendrocytes at postnatal stages. We previously showed that cerebellar progenitor cells, including neural stem cells, widely express CD44 at around postnatal day 3. In the present study, we showed that CD44-positive cells prepared from the postnatal day 3 cerebellum gave rise to neurospheres, while CD44-negative cells prepared from the same cerebellum did not. These neurospheres differentiated mainly into oligodendrocytes and astrocytes, suggesting that CD44-positive neural stem/progenitor cells might generate oligodendrocytes in postnatal cerebellum. We cultured CD44-positive cells from the postnatal day 3 cerebellum in the presence of signaling molecules known as mitogens or inductive differentiation factors for oligodendrocyte progenitor cells. Of these, only FGF-2 promoted survival and proliferation of CD44-positive cells, and these cells differentiated into O4+ oligodendrocytes. Furthermore, we examined the effect of FGF-2 on cerebellar oligodendrocyte development ex vivo. FGF-2 enhanced proliferation of oligodendrocyte progenitor cells and increased the number of O4+ and CC1+ oligodendrocytes in slice cultures. These results suggest that CD44-positive cells might be a source of cerebellar oligodendrocytes and that FGF-2 plays important roles in their development at an early postnatal stage. - Highlights: • CD44 is expressed in cerebellar neural stem/progenitor cells at postnatal day 3 (P3). • FGF-2 promoted proliferation of CD44-positive progenitor cells from P3 cerebellum. • FGF-2 promoted oligodendrocytic differentiation of CD44-positive progenitor cells. • FGF-2 increased the number of oligodendrocytes in P3 cerebellar slice culture
Rigid microenvironments promote cardiac differentiation of mouse and human embryonic stem cells
Arshi, Armin; Nakashima, Yasuhiro; Nakano, Haruko; Eaimkhong, Sarayoot; Evseenko, Denis; Reed, Jason; Stieg, Adam Z.; Gimzewski, James K.; Nakano, Atsushi
2013-04-01
While adult heart muscle is the least regenerative of tissues, embryonic cardiomyocytes are proliferative, with embryonic stem (ES) cells providing an endless reservoir. In addition to secreted factors and cell-cell interactions, the extracellular microenvironment has been shown to play an important role in stem cell lineage specification, and understanding how scaffold elasticity influences cardiac differentiation is crucial to cardiac tissue engineering. Though previous studies have analyzed the role of matrix elasticity on the function of differentiated cardiomyocytes, whether it affects the induction of cardiomyocytes from pluripotent stem cells is poorly understood. Here, we examine the role of matrix rigidity on cardiac differentiation using mouse and human ES cells. Culture on polydimethylsiloxane (PDMS) substrates of varied monomer-to-crosslinker ratios revealed that rigid extracellular matrices promote a higher yield of de novo cardiomyocytes from undifferentiated ES cells. Using a genetically modified ES system that allows us to purify differentiated cardiomyocytes by drug selection, we demonstrate that rigid environments induce higher cardiac troponin T expression, beating rate of foci, and expression ratio of adult α- to fetal β- myosin heavy chain in a purified cardiac population. M-mode and mechanical interferometry image analyses demonstrate that these ES-derived cardiomyocytes display functional maturity and synchronization of beating when co-cultured with neonatal cardiomyocytes harvested from a developing embryo. Together, these data identify matrix stiffness as an independent factor that instructs not only the maturation of already differentiated cardiomyocytes but also the induction and proliferation of cardiomyocytes from undifferentiated progenitors. Manipulation of the stiffness will help direct the production of functional cardiomyocytes en masse from stem cells for regenerative medicine purposes.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yun; Wang, Jing [Department of Neurology, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Clinical Stem Cell Center, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Chen, Guian [Clinical Stem Cell Center, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Reproductive Medical Center, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Fan, Dongsheng, E-mail: dsfan@yahoo.cn [Department of Neurology, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Clinical Stem Cell Center, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Deng, Min, E-mail: dengmin1706@yahoo.com.cn [Department of Neurology, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China); Clinical Stem Cell Center, Peking University Third Hospital, 49 North Garden Road, Haidian District, Beijing 100191 (China)
2011-01-14
Research highlights: {yields} Nicotinamide inhibit Sirt1. {yields} MASH1 and Ngn2 activation. {yields} Increase the expression of HB9. {yields} Motoneurons formation increases significantly. -- Abstract: Several protocols direct human embryonic stem cells (hESCs) toward differentiation into functional motoneurons, but the efficiency of motoneuron generation varies based on the human ESC line used. We aimed to develop a novel protocol to increase the formation of motoneurons from human ESCs. In this study, we tested a nuclear histone deacetylase protein, Sirt1, to promote neural precursor cell (NPC) development during differentiation of human ESCs into motoneurons. A specific inhibitor of Sirt1, nicotinamide, dramatically increased motoneuron formation. We found that about 60% of the cells from the total NPCs expressed HB9 and {beta}III-tubulin, commonly used motoneuronal markers found in neurons derived from ESCs following nicotinamide treatment. Motoneurons derived from ESC expressed choline acetyltransferase (ChAT), a positive marker of mature motoneuron. Moreover, we also examined the transcript levels of Mash1, Ngn2, and HB9 mRNA in the differentiated NPCs treated with the Sirt1 activator resveratrol (50 {mu}M) or inhibitor nicotinamide (100 {mu}M). The levels of Mash1, Ngn2, and HB9 mRNA were significantly increased after nicotinamide treatment compared with control groups, which used the traditional protocol. These results suggested that increasing Mash1 and Ngn2 levels by inhibiting Sirt1 could elevate HB9 expression, which promotes motoneuron differentiation. This study provides an alternative method for the production of transplantable motoneurons, a key requirement in the development of hESC-based cell therapy in motoneuron disease.
International Nuclear Information System (INIS)
Zhang, Yun; Wang, Jing; Chen, Guian; Fan, Dongsheng; Deng, Min
2011-01-01
Research highlights: → Nicotinamide inhibit Sirt1. → MASH1 and Ngn2 activation. → Increase the expression of HB9. → Motoneurons formation increases significantly. -- Abstract: Several protocols direct human embryonic stem cells (hESCs) toward differentiation into functional motoneurons, but the efficiency of motoneuron generation varies based on the human ESC line used. We aimed to develop a novel protocol to increase the formation of motoneurons from human ESCs. In this study, we tested a nuclear histone deacetylase protein, Sirt1, to promote neural precursor cell (NPC) development during differentiation of human ESCs into motoneurons. A specific inhibitor of Sirt1, nicotinamide, dramatically increased motoneuron formation. We found that about 60% of the cells from the total NPCs expressed HB9 and βIII-tubulin, commonly used motoneuronal markers found in neurons derived from ESCs following nicotinamide treatment. Motoneurons derived from ESC expressed choline acetyltransferase (ChAT), a positive marker of mature motoneuron. Moreover, we also examined the transcript levels of Mash1, Ngn2, and HB9 mRNA in the differentiated NPCs treated with the Sirt1 activator resveratrol (50 μM) or inhibitor nicotinamide (100 μM). The levels of Mash1, Ngn2, and HB9 mRNA were significantly increased after nicotinamide treatment compared with control groups, which used the traditional protocol. These results suggested that increasing Mash1 and Ngn2 levels by inhibiting Sirt1 could elevate HB9 expression, which promotes motoneuron differentiation. This study provides an alternative method for the production of transplantable motoneurons, a key requirement in the development of hESC-based cell therapy in motoneuron disease.
Liu, Xiao; Gilmore, Kerry J; Moulton, Simon E; Wallace, Gordon G
2009-12-01
The purpose of this work was to investigate for the first time the potential biomedical applications of novel polypyrrole (PPy) composites incorporating a large polyelectrolyte dopant, poly (2-methoxy-5 aniline sulfonic acid) (PMAS). The physical and electrochemical properties were characterized. The PPy/PMAS composites were found to be smooth and hydrophilic and have low electrical impedance. We demonstrate that PPy/PMAS supports nerve cell (PC12) differentiation, and that clinically relevant 250 Hz biphasic current pulses delivered via PPy/PMAS films significantly promote nerve cell differentiation in the presence of nerve growth factor (NGF). The capacity of PPy/PMAS composites to support and enhance nerve cell differentiation via electrical stimulation renders them valuable for medical implants for neurological applications.
The hidden winners of renewable energy promotion: Insights into sector-specific wage differentials
International Nuclear Information System (INIS)
Antoni, Manfred; Janser, Markus; Lehmer, Florian
2015-01-01
In light of Germany's energy system transformation, this paper examines differences in employment structures and wage differentials between renewable energy establishments and their sector peers. To do so, we have developed a novel data set by linking company-level information from the German Renewable Energy Federation with administrative establishment-level data from the Institute for Employment Research. Descriptive evidence shows significant differences in wages and several other characteristics between renewable energy establishments and their sector peers. Our estimates give evidence that human capital and other establishment-level characteristics mostly explain the wage differential among manufacturers and energy providers. However, we find a persistent ‘renewable energy wage premium' of more than ten percent in construction/installation activities and architectural/engineering services. We interpret this premium as a positive indirect effect of the promotion of renewable energies for the benefit of employees in renewable energy establishments within these two sectors. - Highlights: • Renewable energy (RE) firms pay considerably more than their non-RE sector peers. • In manufacturing and energy supply, firm attributes explain mainly the wage gap. • In installation, planning and project management one third remains unexplained. • This unexplained rest represents a ‘RE wage premium’ of around 10 percent. • The employees in both sectors are the ‘hidden winners’ of RE promotion.
Salamon, Achim; van Vlierberghe, Sandra; van Nieuwenhove, Ine; Baudisch, Frank; Graulus, Geert-Jan; Benecke, Verena; Alberti, Kristin; Neumann, Hans-Georg; Rychly, Joachim; Martins, José C.; Dubruel, Peter; Peters, Kirsten
2014-01-01
Due to the weak regeneration potential of cartilage, there is a high clinical incidence of articular joint disease, leading to a strong demand for cartilaginous tissue surrogates. The aim of this study was to evaluate a gelatin-based hydrogel for its suitability to support chondrogenic differentiation of human mesenchymal stem cells. Gelatin-based hydrogels are biodegradable, show high biocompatibility, and offer possibilities to introduce functional groups and/or ligands. In order to prove their chondrogenesis-supporting potential, a hydrogel film was developed and compared with standard cell culture polystyrene regarding the differentiation behavior of human mesenchymal stem cells. Cellular basis for this study were human adipose tissue-derived mesenchymal stem cells, which exhibit differentiation potential along the adipogenic, osteogenic and chondrogenic lineage. The results obtained show a promotive effect of gelatin-based hydrogels on chondrogenic differentiation of mesenchymal stem cells in vitro and therefore encourage subsequent in vivo studies. PMID:28788517
Dual reporter transgene driven by 2.3Col1a1 promoter is active in differentiated osteoblasts
Marijanovic, Inga; Jiang, Xi; Kronenberg, Mark S.; Stover, Mary Louise; Erceg, Ivana; Lichtler, Alexander C.; Rowe, David W.
2003-01-01
AIM: As quantitative and spatial analyses of promoter reporter constructs are not easily performed in intact bone, we designed a reporter gene specific to bone, which could be analyzed both visually and quantitatively by using chloramphenicol acetyltransferase (CAT) and a cyan version of green fluorescent protein (GFPcyan), driven by a 2.3-kb fragment of the rat collagen promoter (Col2.3). METHODS: The construct Col2.3CATiresGFPcyan was used for generating transgenic mice. Quantitative measurement of promoter activity was performed by CAT analysis of different tissues derived from transgenic animals; localization was performed by visualized GFP in frozen bone sections. To assess transgene expression during in vitro differentiation, marrow stromal cell and neonatal calvarial osteoblast cultures were analyzed for CAT and GFP activity. RESULTS: In mice, CAT activity was detected in the calvaria, long bone, teeth, and tendon, whereas histology showed that GFP expression was limited to osteoblasts and osteocytes. In cell culture, increased activity of CAT correlated with increased differentiation, and GFP activity was restricted to mineralized nodules. CONCLUSION: The concept of a dual reporter allows a simultaneous visual and quantitative analysis of transgene activity in bone.
Walker, Aisha L.; Ofori-Acquah, Solomon
2016-01-01
The clinical benefits of hydroxyurea treatment in patients with sickle cell disease (SCD) are due largely to increased gamma-globin expression. However, mechanisms that control gamma-globin expression by hydroxyurea in erythroid progenitors are incompletely understood. Here, we investigated the role of two hydroxyurea transporters, urea transporter B (UTB) and organic cation/carnitine transporter 1 (OCTN1), in this process. Endogenous expression of both transporters peaked towards the end of ...
Kang, Jung-Ok; Lee, Jee-Boong; Chang, Jun
2016-01-01
Cholera toxin (CT), an exotoxin produced by Vibrio cholera, acts as a mucosal adjuvant. In a previous study, we showed that CT skews differentiation of CD4 T cells to IL-17-producing Th17 cells. Here, we found that intranasal administration of CT induced migration of migratory dendritic cell (DC) populations, CD103+ DCs and CD11bhi DCs, to the lung draining mediastinal lymph nodes (medLN). Among those DC subsets, CD11bhi DCs that were relatively immature had a major role in Th17 cell differentiation after administration of CT. CT-treated BMDCs showed reduced expression of MHC class II and CD86, similar to CD11bhi DCs in medLN, and these BMDCs promoted Th17 cell differentiation more potently than other BMDCs expressing higher levels of MHC class II and CD86. By analyzing the expression of activation markers such as CD25 and CD69, proliferation and IL-2 production, we determined that CT-treated BMDCs showed diminished antigen-presenting potential to CD4+ T cells compared with normal BMDCs. We also found that CT-stimulated BMDCs promote activin A expression as well as IL-6 and IL-1β, and activin A had a synergic role with TGF-β1 in CT-mediated Th17 cell differentiation. Taken together, our results suggest that CT-stimulated DCs promote Th17 cell differentiation by not only modulating antigen-presenting potential but also inducing Th polarizing cytokines.
Sowa, Yoshihiro; Kishida, Tsunao; Imura, Tetsuya; Numajiri, Toshiaki; Nishino, Kenichi; Tabata, Yasuhiko; Mazda, Osam
2016-02-01
During recent decades, multipotent stem cells were found to reside in the adipose tissue, and these adipose-derived stem cells were shown to play beneficial roles, like those of Schwann cells, in peripheral nerve regeneration. However, it has not been well established whether adipose-derived stem cells offer beneficial effects to peripheral nerve injuries in vivo as Schwann cells do. Furthermore, the in situ survival and differentiation of adipose-derived stem cells after transplantation at the injured peripheral nerve tissue remain to be fully elucidated. Adipose-derived stem cells and Schwann cells were transplanted with gelatin hydrogel tubes at the artificially blunted sciatic nerve lesion in mice. Neuroregenerative abilities of them were comparably estimated. Cre-loxP-mediated fate tracking was performed to visualize survival in vivo of transplanted adipose-derived stem cells and to investigate whether they differentiated into Schwann linage cells at the peripheral nerve injury site. The transplantation of adipose-derived stem cells promoted regeneration of axons, formation of myelin, and restoration of denervation muscle atrophy to levels comparable to those achieved by Schwann cell transplantation. The adipose-derived stem cells survived for at least 4 weeks after transplantation without differentiating into Schwann cells. Transplanted adipose-derived stem cells did not differentiate into Schwann cells but promoted peripheral nerve regeneration at the injured site. The neuroregenerative ability was comparable to that of Schwann cells. Adipose-derived stem cells at an undifferentiated stage may be used as an alternative cell source for autologous cell therapy for patients with peripheral nerve injury.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Haibin; Shang, Linshan; Li, Xi; Zhang, Xiyu; Gao, Guimin; Guo, Chenhong; Chen, Bingxi; Liu, Qiji [Key Laboratory of Experimental Teratology, MOE, Institute of Molecular Medicine and Genetics, Shandong University, 44 Wen Hua Xi Lu, Jinan, Shandong 250012 (China); Gong, Yaoqin, E-mail: yxg8@sdu.edu.cn [Key Laboratory of Experimental Teratology, MOE, Institute of Molecular Medicine and Genetics, Shandong University, 44 Wen Hua Xi Lu, Jinan, Shandong 250012 (China); Shao, Changshun, E-mail: shao@biology.rutgers.edu [Key Laboratory of Experimental Teratology, MOE, Institute of Molecular Medicine and Genetics, Shandong University, 44 Wen Hua Xi Lu, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)
2009-10-15
Resveratrol has been shown to possess many health-benefiting effects, including the promotion of bone formation. In this report we investigated the mechanism by which resveratrol promotes osteoblastic differentiation from pluripotent mesenchymal cells. Since Wnt signaling is well documented to induce osteoblastogenesis and bone formation, we characterized the factors involved in Wnt signaling in response to resveratrol treatment. Resveratrol treatment of mesenchymal cells led to an increase in stabilization and nuclear accumulation of {beta}-catenin dose-dependently and time-dependently. As a consequence of the increased nuclear accumulation of {beta}-catenin, the ability to activate transcription of {beta}-catenin-TCF/LEF target genes that are required for osteoblastic differentiation was upregulated. However, resveratrol did not affect the initial step of the Wnt signaling pathway, as resveratrol was as effective in upregulating the activity of {beta}-catenin in cells in which Lrp5 was knocked down as in control cells. In addition, while conditioned medium enriched in Wnt signaling antagonist Dkk1 was able to inhibit Wnt3a-induced {beta}-catenin upregulation, this inhibitory effect can be abolished in resveratrol-treated cells. Furthermore, we showed that the level of glycogen synthase kinase 3{beta} (GSK-3{beta}), which phosphorylates and destabilizes {beta}-catenin, was reduced in response to resveratrol treatment. The phosphorylation of GSK-3{beta} requires extracellular signal-regulated kinase (ERK)1/2. Together, our data indicate that resveratrol promotes osteoblastogenesis and bone formation by augmenting Wnt signaling.
International Nuclear Information System (INIS)
Zhou, Haibin; Shang, Linshan; Li, Xi; Zhang, Xiyu; Gao, Guimin; Guo, Chenhong; Chen, Bingxi; Liu, Qiji; Gong, Yaoqin; Shao, Changshun
2009-01-01
Resveratrol has been shown to possess many health-benefiting effects, including the promotion of bone formation. In this report we investigated the mechanism by which resveratrol promotes osteoblastic differentiation from pluripotent mesenchymal cells. Since Wnt signaling is well documented to induce osteoblastogenesis and bone formation, we characterized the factors involved in Wnt signaling in response to resveratrol treatment. Resveratrol treatment of mesenchymal cells led to an increase in stabilization and nuclear accumulation of β-catenin dose-dependently and time-dependently. As a consequence of the increased nuclear accumulation of β-catenin, the ability to activate transcription of β-catenin-TCF/LEF target genes that are required for osteoblastic differentiation was upregulated. However, resveratrol did not affect the initial step of the Wnt signaling pathway, as resveratrol was as effective in upregulating the activity of β-catenin in cells in which Lrp5 was knocked down as in control cells. In addition, while conditioned medium enriched in Wnt signaling antagonist Dkk1 was able to inhibit Wnt3a-induced β-catenin upregulation, this inhibitory effect can be abolished in resveratrol-treated cells. Furthermore, we showed that the level of glycogen synthase kinase 3β (GSK-3β), which phosphorylates and destabilizes β-catenin, was reduced in response to resveratrol treatment. The phosphorylation of GSK-3β requires extracellular signal-regulated kinase (ERK)1/2. Together, our data indicate that resveratrol promotes osteoblastogenesis and bone formation by augmenting Wnt signaling.
International Nuclear Information System (INIS)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn
2013-01-01
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i
An Alu-like RNA promotes cell differentiation and reduces malignancy of human neuroblastoma cells
Castelnuovo Manuele; Massone Sara; Tasso Roberta; Fiorino Gloria; Gatti Monica; Robello Mauro; Gatta Elena; Berger Audrey; Strub Katharina; Florio Tullio; Dieci Giorgio; Cancedda Ranieri; Pagano Aldo
2010-01-01
Neuroblastoma (NB) is a pediatric cancer characterized by remarkable cell heterogeneity within the tumor nodules. Here, we demonstrate that the synthesis of a pol III-transcribed noncoding (nc) RNA (NDM29) strongly restricts NB development by promoting cell differentiation, a drop of malignancy processes, and a dramatic reduction of the tumor initiating cell (TIC) fraction in the NB cell population. Notably, the overexpression of NDM29 also confers to malignant NB cells an unpredicted suscept...
Directory of Open Access Journals (Sweden)
Achim Salamon
2014-02-01
Full Text Available Due to the weak regeneration potential of cartilage, there is a high clinical incidence of articular joint disease, leading to a strong demand for cartilaginous tissue surrogates. The aim of this study was to evaluate a gelatin-based hydrogel for its suitability to support chondrogenic differentiation of human mesenchymal stem cells. Gelatin-based hydrogels are biodegradable, show high biocompatibility, and offer possibilities to introduce functional groups and/or ligands. In order to prove their chondrogenesis-supporting potential, a hydrogel film was developed and compared with standard cell culture polystyrene regarding the differentiation behavior of human mesenchymal stem cells. Cellular basis for this study were human adipose tissue-derived mesenchymal stem cells, which exhibit differentiation potential along the adipogenic, osteogenic and chondrogenic lineage. The results obtained show a promotive effect of gelatin-based hydrogels on chondrogenic differentiation of mesenchymal stem cells in vitro and therefore encourage subsequent in vivo studies.
Direct targets of pSTAT5 signalling in erythropoiesis.
Directory of Open Access Journals (Sweden)
Kevin R Gillinder
Full Text Available Erythropoietin (EPO acts through the dimeric erythropoietin receptor to stimulate proliferation, survival, differentiation and enucleation of erythroid progenitor cells. We undertook two complimentary approaches to find EPO-dependent pSTAT5 target genes in murine erythroid cells: RNA-seq of newly transcribed (4sU-labelled RNA, and ChIP-seq for pSTAT5 30 minutes after EPO stimulation. We found 302 pSTAT5-occupied sites: ~15% of these reside in promoters while the rest reside within intronic enhancers or intergenic regions, some >100kb from the nearest TSS. The majority of pSTAT5 peaks contain a central palindromic GAS element, TTCYXRGAA. There was significant enrichment for GATA motifs and CACCC-box motifs within the neighbourhood of pSTAT5-bound peaks, and GATA1 and/or KLF1 co-occupancy at many sites. Using 4sU-RNA-seq we determined the EPO-induced transcriptome and validated differentially expressed genes using dynamic CAGE data and qRT-PCR. We identified known direct pSTAT5 target genes such as Bcl2l1, Pim1 and Cish, and many new targets likely to be involved in driving erythroid cell differentiation including those involved in mRNA splicing (Rbm25, epigenetic regulation (Suv420h2, and EpoR turnover (Clint1/EpsinR. Some of these new EpoR-JAK2-pSTAT5 target genes could be used as biomarkers for monitoring disease activity in polycythaemia vera, and for monitoring responses to JAK inhibitors.
Directory of Open Access Journals (Sweden)
Zhou GQ
2017-10-01
Full Text Available Guoqiang Zhou,1–3 Sudan Liu,1 Yanyan Ma,1 Wenshi Xu,1 Wei Meng,1 Xue Lin,1 Wenying Wang,1,3 Shuxiang Wang,1–3 Jinchao Zhang1–3 1College of Chemistry and Environmental Science, 2Key Laboratory of Medicinal Chemistry and Molecular Diagnosis of Ministry of Education, 3Key Laboratory of Chemical Biology of Hebei Province, Hebei University, Baoding, Hebei, People’s Republic of China Abstract: The development of an artificial bone graft which can promote the regeneration of fractures or diseased bones is currently the most challenging aspect in bone tissue engineering. To achieve the purpose of promoting bone proliferation and differentiation, the artificial graft needs have a similar structure and composition of extracellular matrix. One-step electrospinning method of biocomposite nanofibers containing hydroxyapatite (HA nanoparticles and collagen (Coll were developed for potential application in bone tissue engineering. Nanocomposite scaffolds of poly(L-lactide (PLLA, PLLA/HA, PLLA/Coll, and PLLA/Coll/HA were fabricated by electrospinning. The morphology, diameter, elements, hydrophilicity, and biodegradability of the composite scaffolds have been investigated. The biocompatibility of different nanocomposite scaffolds was assessed using mouse osteoblasts MC3T3-E1 in vitro, and the proliferation, differentiation, and mineralization of cells on different nanofibrous scaffolds were investigated. The results showed that PLLA/Coll/HA nanofiber scaffolds enhanced cell adhesion, spreading, proliferation, differentiation, mineralization, and gene expression of osteogenic markers compared to other scaffolds. In addition, the nanofibrous scaffolds maintained a stable composition at the beginning of the degradation period and morphology wastage and weight loss were observed when incubated for up to 80 days in physiological simulated conditions. The PLLA/Coll/HA composite nanofibrous scaffolds could be a potential material for guided bone regeneration
Valli, Emanuele; Trazzi, Stefania; Fuchs, Claudia; Erriquez, Daniela; Bartesaghi, Renata; Perini, Giovanni; Ciani, Elisabetta
2012-01-01
Mutations in the CDKL5 (cyclin-dependent kinase-like 5) gene are associated with a severe epileptic encephalopathy (early infantile epileptic encephalopathy type 2, EIEE2) characterized by early-onset intractable seizures, infantile spasms, severe developmental delay, intellectual disability, and Rett syndrome (RTT)-like features. Despite the clear involvement of CDKL5 mutations in intellectual disability, the function of this protein during brain development and the molecular mechanisms involved in its regulation are still unknown. Using human neuroblastoma cells as a model system we found that an increase in CDKL5 expression caused an arrest of the cell cycle in the G(0)/G(1) phases and induced cellular differentiation. Interestingly, CDKL5 expression was inhibited by MYCN, a transcription factor that promotes cell proliferation during brain development and plays a relevant role in neuroblastoma biology. Through a combination of different and complementary molecular and cellular approaches we could show that MYCN acts as a direct repressor of the CDKL5 promoter. Overall our findings unveil a functional axis between MYCN and CDKL5 governing both neuron proliferation rate and differentiation. The fact that CDKL5 is involved in the control of both neuron proliferation and differentiation may help understand the early appearance of neurological symptoms in patients with mutations in CDKL5. Copyright © 2012 Elsevier B.V. All rights reserved.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
Zhang, Jin-fang; Fu, Wei-ming; He, Ming-liang; Xie, Wei-dong; Lv, Qing; Wan, Gang; Li, Guo; Wang, Hua; Lu, Gang; Hu, Xiang; Jiang, Su; Li, Jian-na; Lin, Marie C M; Zhang, Ya-ou; Kung, Hsiang-fu
2011-01-01
Osteogenic differentiation of mesenchymal stem cells (MSCs) is a complex process, which is regulated by various factors including microRNAs. Our preliminary data showed that the expression of endogenous miR-20a was increased during the course of osteogenic differentiation. Simultaneously, the expression of osteoblast markers and regulators BMP2, BMP4, Runx2, Osx, OCN and OPN was also elevated whereas adipocyte markers PPARγ and osteoblast antagonist, Bambi and Crim1, were downregulated, thereby suggesting that miR-20a plays an important role in regulating osteoblast differentiation. To validate this hypothesis, we tested its effects on osteogenic differentiation by introducing miR-20a mimics and lentiviral-miR20a-expression vectors into hMSCs. We showed that miR-20a promoted osteogenic differentiation by the upregulation of BMP/Runx2 signaling. We performed bioinformatics analysis and predicted that PPARγ, Bambi and Crim1 would be potential targets of miR-20a. PPARγ is a negative regulator of BMP/Runx2 signaling whereas Bambi or Crim1 are antagonists of the BMP pathway. Furthermore, we confirmed that all these molecules were indeed the targets of miR-20a by luciferase reporter, quantitative RT-PCR and western blot assays. Similarly to miR-20a overexpression, the osteogenesis was enhanced by the silence of PPARγ, Bambi or Crim1 by specific siRNAs. Taken together, for the first time, we demonstrated that miR-20a promoted the osteogenesis of hMSCs in a co-regulatory pattern by targeting PPARγ, Bambi and Crim1, the negative regulators of BMP signaling.
Directory of Open Access Journals (Sweden)
Hye-Min Kim
2016-12-01
Full Text Available Bone homeostasis is tightly regulated to balance bone formation and bone resorption. Many anabolic drugs are used as bone-targeted therapeutic agents for the promotion of osteoblast-mediated bone formation or inhibition of osteoclast-mediated bone resorption. Previous studies showed that ginsenoside Re has the effect of the suppression of osteoclast differentiation in mouse bone-marrow derived macrophages and zebrafish. Herein, we investigated whether ginsenoside Re affects osteoblast differentiation and mineralization in in vitro and in vivo models. Mouse osteoblast precursor MC3T3-E1 cells were used to investigate cell viability, alkaline phosphatase (ALP activity, and mineralization. In addition, we examined osteoblastic signaling pathways. Ginsenoside Re affected ALP activity without cytotoxicity, and we also observed the stimulation of osteoblast differentiation through the activation of osteoblast markers including runt-related transcription factor 2, type 1 collagen, ALP, and osteocalcin in MC3T3-E1 cells. Moreover, Alizarin red S staining indicated that ginsenoside Re increased osteoblast mineralization in MC3T3-E1 cells and zebrafish scales compared to controls. These results suggest that ginsenoside Re promotes osteoblast differentiation as well as inhibits osteoclast differentiation, and it could be a potential therapeutic agent for bone diseases.
Nakamichi, Noritaka; Ishioka, Yukichi; Hirai, Takao; Ozawa, Shusuke; Tachibana, Masaki; Nakamura, Nobuhiro; Takarada, Takeshi; Yoneda, Yukio
2009-08-15
We have previously shown significant potentiation of Ca(2+) influx mediated by N-methyl-D-aspartate receptors, along with decreased microtubules-associated protein-2 (MAP2) expression, in hippocampal neurons cultured under static magnetism without cell death. In this study, we investigated the effects of static magnetism on the functionality of neural progenitor cells endowed to proliferate for self-replication and differentiate into neuronal, astroglial, and oligodendroglial lineages. Neural progenitor cells were isolated from embryonic rat neocortex and hippocampus, followed by culture under static magnetism at 100 mT and subsequent determination of the number of cells immunoreactive for a marker protein of particular progeny lineages. Static magnetism not only significantly decreased proliferation of neural progenitor cells without affecting cell viability, but also promoted differentiation into cells immunoreactive for MAP2 with a concomitant decrease in that for an astroglial marker, irrespective of the presence of differentiation inducers. In neural progenitors cultured under static magnetism, a significant increase was seen in mRNA expression of several activator-type proneural genes, such as Mash1, Math1, and Math3, together with decreased mRNA expression of the repressor type Hes5. These results suggest that sustained static magnetism could suppress proliferation for self-renewal and facilitate differentiation into neurons through promoted expression of activator-type proneural genes by progenitor cells in fetal rat brain.
Energy Technology Data Exchange (ETDEWEB)
Huberman, E.; Weeks, C.; Herrmann, A.; Callaham, M.; Slaga, T.
1981-02-01
Polyamine levels were evaluated in human HL-60 promyelocytic leukemia cells after treatment with inducers of terminal differentiation. Differentiation in these cells was determined by increases in the percentage of morphologically mature cells and in lysozyme activity. Treatment of the HL-60 cells with phorbol 12-myristate-13-acetate (PMA), phorbol 12,13-didecanoate or other inducers of terminal differentiation such as dimethylsulfoxide and retinoic acid resulted in increased levels of putrescine. However, no increase in putrescine could be detected after PMA treatment of a HL-60 cell variant that exhibited a decreased susceptibility to PMA-induced terminal differentiation. Similarly, no increase in putrescine was observed with two nontumor-promoters (phorbol 12,13-diacetate and 4-O-methyl-PMA) or with anthralin, a non-phorbol tumor promoter. In addition to enhancing putrescine levels, PMA also increased the amount of spermidine and decreased the amount of spermine. The increase in putrescine and spermidine preceded the expression of the various differentiation markers. Unlike the changes observed in the polyamine levels after PMA treatment, the activities of ornithine and S-adenosylmethionine decarboxylases, which are polyamine biosynthetic enzymes, did not significantly change. ..cap alpha..-Methylornithine and ..cap alpha..-difluoromethylornithine and methylglyoxal bis(guanylhydrazone), which are inhibitors of the polyamine biosynthetic enzymes, did not affect differentiation in control or PMA-treated cells. Because of these observations, we suggest that the change in polyamine levels involve biochemical pathways other than the known biosynthetic ones. By-products of these pathways may perhaps be the controlling factors involved in the induction of terminal differentiation in the HL-60 and other cell types as well.
Directory of Open Access Journals (Sweden)
Fang Xiao
Full Text Available p38 mitogen-activated protein kinase (MAPK is an essential kinase involved in myogenic differentiation. Although many substrates of p38 MAPK have been identified, little is known about its upstream activators during myogenic differentiation. TRAF6 is known to function in cytokine signaling during inflammatory responses. However, not much is known about its role in myogenic differentiation and muscle regeneration. We showed here that TRAF6 and its intrinsic ubiquitin E3 ligase activity are required for myogenic differentiation. In mouse myoblasts, knockdown of TRAF6 compromised the p38 MAPK and Akt pathways, while deliberate activation of either pathway rescued the differentiation defect caused by TRAF6 knockdown. TAK1 acted as a key signal transducer downstream of TRAF6 in myogenic differentiation. In vivo, knockdown of TRAF6 in mouse muscles compromised the injury-induced muscle regeneration without impairing macrophage infiltration and myoblast proliferation. Collectively, we demonstrated that TRAF6 promotes myogenic differentiation and muscle regeneration via the TAK1/p38 MAPK and Akt pathways.
MicroRNA-24 promotes 3T3-L1 adipocyte differentiation by directly targeting the MAPK7 signaling
Energy Technology Data Exchange (ETDEWEB)
Jin, Min, E-mail: min_jin@zju.edu.cn [Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang, 310009 (China); Wu, Yutao; Wang, Jing [School of Medicine, Zhejiang University, 288# Yuhangtang Rd, Hangzhou, Zhejiang, 310003 (China); Chen, Jian; Huang, Yiting; Rao, Jinpeng; Feng, Chun [Division of Reproductive Medicine & Infertility, The Second Affiliated Hospital, School of Medicine, Zhejiang University, 88#, Jiefang Rd., Hangzhou, Zhejiang, 310009 (China)
2016-05-20
Over the past years, MicroRNAs (miRNAs) act as a vital role in harmony with gene regulation and maintaining cellular homeostasis. It is well testified that miRNAshave been involved in numerous physiological and pathological processes, including embryogenesis, cell fate decision, and cellular differentiation. Adipogenesis is an organized process of cellular differentiation by which pre-adipocytes differentiate towards mature adipocytes, and it is tightly modulated by a series of transcription factors such as peroxisome proliferator-activated receptor γ (PPAR-γ) and sterol regulatory-element binding proteins 1 (SREBP1). However, the molecular mechanisms underlying the connection between miRNAs and adipogenesis-related transcription factors remain obscure. In this study, we unveiled that miR- 24 was remarkably upregulated during 3T3-L1 adipogenesis. Overexpression of miR-24 significantly promoted 3T3-L1 adipogenesis, as evidenced by its ability to increase the expression of PPAR-γ and SREBP1, lipid droplet formation and triglyceride (TG) accumulation. Furthermore, we found that neither ectopic expression of miR-24nor miR-24 inhibitor affect cell proliferation and cell cycle progression. Finally, we demonstrated that miR-24 plays the modulational role by directly repressing MAPK7, a key number in the MAPK signaling pathway. These data indicate that miR-24 is a novel positive regulator of adipocyte differentiation by targeting MAPK7, which provides new insights into the molecular mechanism of miRNA-mediated cellular differentiation. -- Highlights: •We firstly found miR-24 was upregulated in 3T3-L1 pre-adipocytes differentiation. •miR-24 promoted 3T3-L1 pre-adipocytes differentiation while silencing the expression of miR-24 had an opposite function. •miR-24 regulated 3T3-L1 differentiation by directly targeting MAPK7 signaling pathway. •miR-24did not affect 3T3-L1 pre-adipocytes cellular proliferation.
Li, Yuan; Zhang, Hongwei; Zhu, Xiaoyu; Feng, Dongchuan; Gong, Jinchao; Han, Tao
2013-11-01
Neuroblastoma is among the most aggressive tumors that occur in childhood and infancy. The clinical prognosis of children with advanced-stage neuroblastoma is still poor. Interleukin-24 (IL-24) is emerging as a new cytokine involved in tumor cellular proliferation, differentiation, and apoptosis and has been widely studied as a tumor inhibitor. However, little is known about this cytokine's role in neuroblastoma. In this study, we investigated the possible effects of IL-24 on inducing neuroblastoma cell differentiation, growth inhibition, and apoptosis in vitro. Our data show that IL-24 promotes neuroblastoma SH-SY5Y cell differentiation, growth inhibition, and apoptosis. Furthermore, we found that the differentiation- and apoptosis-inducing action of IL-24 depends on the accumulation of reactive oxygen species (ROS). These results suggest that IL-24 can induce neuroblastoma cell differentiation and apoptosis and may be a potential therapeutic agent for neuroblastoma.
Bioengineered Bruch's-like extracellular matrix promotes retinal pigment epithelial differentiation
Directory of Open Access Journals (Sweden)
Samuel McLenachan
2017-07-01
Full Text Available In the eye, the retinal pigment epithelium (RPE adheres to a complex protein matrix known as Bruch's membrane (BrM. The aim of this study was to provide enriched conditions for RPE cell culture through the production of a BrM-like matrix. Our hypothesis was that a human RPE cell line would deposit an extracellular matrix (ECM resembling BrM. The composition and structure of ECM deposited by ARPE19 cells (ARPE19-ECM was characterized. To produce ARPE19-ECM, ARPE19 cells were cultured in the presence dextran sulphate. ARPE19-ECM was decellularized using deoxycholate and characterized by immunostaining and western blot analysis. Primary human RPE and induced pluripotent stem cells were seeded onto ARPE19-ECM or geltrex coated surfaces and examined by microscopy or RT-PCR. Culture of ARPE19 cells with dextran sulphate promoted nuclear localization of SOX2, formation of tight junctions and deposition of ECM. ARPE19 cells deposited ECM proteins found in the inner layers of BrM, including fibronectin, vitronectin, collagens IV and V as well as laminin-alpha-5, but not those found in the middle elastic layer (elastin or the outer layers (collagen VI. ARPE19-ECM promoted pigmentation in human RPE and pluripotent stem cell cultures. Expression of RPE65 was significantly increased on ARPE19-ECM compared with geltrex in differentiating pluripotent stem cell cultures. ARPE19 cells deposit ECM with a composition and structure similar to BrM in the retina. Molecular cues present in ARPE19-ECM promote the acquisition and maintenance of the RPE phenotype. Together, these results demonstrate a simple method for generating a BrM-like surface for enriched RPE cell cultures.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Qiang [Department of General Dentistry and Emergency, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Zhao, Zhi-Ning [Clinical Laboratory, 451 Hospital of Chinese PLA, Xi' an 710054 (China); Cheng, Jing-Tao [Department of Special Dentistry, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Zhang, Bin [Department of Orthodontics, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Xu, Jie [Department of Periodontology, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Huang, Fei; Zhao, Rui-Ni [Department of General Dentistry and Emergency, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China); Chen, Yong-Jin, E-mail: cyj1229@fmmu.edu.cn [Department of General Dentistry and Emergency, College of Stomatology, Fourth Military Medical University, Xi' an, Shaanxi 710032 (China)
2011-01-07
Research highlights: {yields} Ibandronate significantly promote the proliferation of PDLSC cells. {yields} Ibandronate enhanced the expression of ALP, COL-1, OPG, OCN, Runx2. {yields} The expression of a class of miRNAs, e.g., miR-18a, miR-133a, miR-141 and miR-19a, was significantly modified in PDLSC cells cultured with ibandronate. {yields} Ibandronate regulates the expression of diverse bone formation-related genes via miRNAs in PDLSCs. {yields} Ibandronate can suppress the activity of osteoclast while promoting the proliferation of osteoblast by regulating the expression of microRNAs. -- Abstract: Bisphosphonates (BPs) have a profound effect on bone resorption and are widely used to treat osteoclast-mediated bone diseases. They suppress bone resorption by inhibiting the activity of mature osteoclasts and/or the formation of new osteoclasts. Osteoblasts may be an alternative target for BPs. Periodontal ligament stem cells (PDLSCs) exhibit osteoblast-like features and are capable of differentiating into osteoblasts or cementoblasts. This study aimed to determine the effects of ibandronate, a nitrogen-containing BP, on the proliferation and the differentiation of PDLSCs and to identify the microRNAs (miRNAs) that mediate these effects. The PDLSCs were treated with ibandronate, and cell proliferation was measured using the MTT (3-dimethylthiazol-2,5-diphenyltetrazolium bromide) assay. The expression of genes and miRNAs involved in osteoblastic differentiation was assayed using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). Ibandronate promoted the proliferation of PDLSCs and enhanced the expression of alkaline phosphatase (ALP), type I collagen (COL-1), osteoprotegerin (OPG), osteocalcin (OCN), and Runx2. The expression of miRNAs, including miR-18a, miR-133a, miR-141 and miR-19a, was significantly altered in the PDLSCs cultured with ibandronate. In PDLSCs, ibandronate regulates the expression of diverse bone formation
International Nuclear Information System (INIS)
Zhou, Qiang; Zhao, Zhi-Ning; Cheng, Jing-Tao; Zhang, Bin; Xu, Jie; Huang, Fei; Zhao, Rui-Ni; Chen, Yong-Jin
2011-01-01
Research highlights: → Ibandronate significantly promote the proliferation of PDLSC cells. → Ibandronate enhanced the expression of ALP, COL-1, OPG, OCN, Runx2. → The expression of a class of miRNAs, e.g., miR-18a, miR-133a, miR-141 and miR-19a, was significantly modified in PDLSC cells cultured with ibandronate. → Ibandronate regulates the expression of diverse bone formation-related genes via miRNAs in PDLSCs. → Ibandronate can suppress the activity of osteoclast while promoting the proliferation of osteoblast by regulating the expression of microRNAs. -- Abstract: Bisphosphonates (BPs) have a profound effect on bone resorption and are widely used to treat osteoclast-mediated bone diseases. They suppress bone resorption by inhibiting the activity of mature osteoclasts and/or the formation of new osteoclasts. Osteoblasts may be an alternative target for BPs. Periodontal ligament stem cells (PDLSCs) exhibit osteoblast-like features and are capable of differentiating into osteoblasts or cementoblasts. This study aimed to determine the effects of ibandronate, a nitrogen-containing BP, on the proliferation and the differentiation of PDLSCs and to identify the microRNAs (miRNAs) that mediate these effects. The PDLSCs were treated with ibandronate, and cell proliferation was measured using the MTT (3-dimethylthiazol-2,5-diphenyltetrazolium bromide) assay. The expression of genes and miRNAs involved in osteoblastic differentiation was assayed using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). Ibandronate promoted the proliferation of PDLSCs and enhanced the expression of alkaline phosphatase (ALP), type I collagen (COL-1), osteoprotegerin (OPG), osteocalcin (OCN), and Runx2. The expression of miRNAs, including miR-18a, miR-133a, miR-141 and miR-19a, was significantly altered in the PDLSCs cultured with ibandronate. In PDLSCs, ibandronate regulates the expression of diverse bone formation-related genes via miRNAs. The exact
International Nuclear Information System (INIS)
Tahara, Tsuyoshi; Sun Jiying; Igarashi, Kazuhiko; Taketani, Shigeru
2004-01-01
The transcriptional factor Bach1 forms a heterodimer with small Maf family, and functions as a repressor of the Maf recognition element (MARE) in vivo. To investigate the involvement of Bach1 in the heme-dependent regulation of the expression of the α-globin gene, human erythroleukemia K562 cells were cultured with succinylacetone (SA), a heme biosynthetic inhibitor, and the level of α-globin mRNA was examined. A decrease of α-globin mRNA was observed in SA-treated cells, which was restored by the addition of hemin. The heme-dependent expression of α-globin occurred at the transcriptional level since the expression of human α-globin gene promoter-reporter gene containing hypersensitive site-40 (HS-40) was decreased when K562 cells were cultured with SA. Hemin treatment restored the decrease of the promoter activity by SA. The regulation of the HS-40 activity by heme was dependent on the NF-E2/AP-1 (NA) site, which is similar to MARE. The NA site-binding activity of Bach1 in K562 increased upon SA-treatment, and the increase was diminished by the addition of hemin. The transient expression of Bach1 and mutated Bach1 lacking CP motifs suppressed the HS-40 activity, and cancellation of the repressor activity by hemin was observed when wild-type Bach1 was expressed. The expression of NF-E2 strengthened the restoration of the Bach1-effect by hemin. Interestingly, nuclear localization of Bach1 increased when cells were treated with SA, while hemin induced the nuclear export of Bach1. These results indicated that heme plays an important role in the induction of α-globin gene expression through disrupting the interaction of Bach1 and the NA site in HS-40 enhancer in erythroid cells
Directory of Open Access Journals (Sweden)
Desirée L Salazar
2010-08-01
Full Text Available Traumatic spinal cord injury (SCI results in partial or complete paralysis and is characterized by a loss of neurons and oligodendrocytes, axonal injury, and demyelination/dysmyelination of spared axons. Approximately 1,250,000 individuals have chronic SCI in the U.S.; therefore treatment in the chronic stages is highly clinically relevant. Human neural stem cells (hCNS-SCns were prospectively isolated based on fluorescence-activated cell sorting for a CD133(+ and CD24(-/lo population from fetal brain, grown as neurospheres, and lineage restricted to generate neurons, oligodendrocytes and astrocytes. hCNS-SCns have recently been transplanted sub-acutely following spinal cord injury and found to promote improved locomotor recovery. We tested the ability of hCNS-SCns transplanted 30 days post SCI to survive, differentiate, migrate, and promote improved locomotor recovery.hCNS-SCns were transplanted into immunodeficient NOD-scid mice 30 days post spinal cord contusion injury. hCNS-SCns transplanted mice demonstrated significantly improved locomotor recovery compared to vehicle controls using open field locomotor testing and CatWalk gait analysis. Transplanted hCNS-SCns exhibited long-term engraftment, migration, limited proliferation, and differentiation predominantly to oligodendrocytes and neurons. Astrocytic differentiation was rare and mice did not exhibit mechanical allodynia. Furthermore, differentiated hCNS-SCns integrated with the host as demonstrated by co-localization of human cytoplasm with discrete staining for the paranodal marker contactin-associated protein.The results suggest that hCNS-SCns are capable of surviving, differentiating, and promoting improved locomotor recovery when transplanted into an early chronic injury microenvironment. These data suggest that hCNS-SCns transplantation has efficacy in an early chronic SCI setting and thus expands the "window of opportunity" for intervention.
Lin, Fei-Xiang; Du, Shi-Xin; Liu, De-Zhong; Hu, Qin-Xiao; Yu, Guo-Yong; Wu, Chu-Cheng; Zheng, Gui-Zhou; Xie, Da; Li, Xue-Dong; Chang, Bo
2016-01-01
Naringin is an active compound extracted from Rhizoma Drynariae, and studies have revealed that naringin can promote proliferation and osteogenic differentiation of bone marrow stromal cells (BMSCs). In this study, we explored whether naringin could promote osteogenic differentiation of BMSCs by upregulating Foxc2 expression via the Indian hedgehog (IHH) signaling pathway. BMSCs were cultured in basal medium, basal medium with naringin, osteogenic induction medium, osteogenic induction medium with naringin and osteogenic induction medium with naringin in the presence of the IHH inhibitor cyclopamine (CPE). We examined cell proliferation by using a WST-8 assay, and differentiation by Alizarin Red S staining (for mineralization) and alkaline phosphatase (ALP) activity. In addition, we detected core-binding factor α1 (Cbfα1), osteocalcin (OCN), bone sialoprotein (BSP), peroxisome proliferation-activated receptor gamma 2 (PPARγ2) and Foxc2 expression by using RT-PCR. We also determined Foxc2 and IHH protein levels by western blotting. Naringin increased the mineralization of BMSCs, as shown by Alizarin red S assays, and induced ALP activity. In addition, naringin significantly increased the mRNA levels of Foxc2, Cbfα1, OCN, and BSP, while decreasing PPARγ2 mRNA levels. Furthermore, the IHH inhibitor CPE inhibited the osteogenesis-potentiating effects of naringin. Naringin increased Foxc2 and stimulated the activation of IHH, as evidenced by increased expression of proteins that were inhibited by CPE. Our findings indicate that naringin promotes osteogenic differentiation of BMSCs by up-regulating Foxc2 expression via the IHH signaling pathway.
Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z
2014-03-28
12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation.
International Nuclear Information System (INIS)
Sun, X; Lu, B; Hu, B; Xiao, W; Li, W; Huang, Z
2014-01-01
12-O-tetradecanoylphorbol-13-acetate (TPA) activates multiple signaling pathways, alters gene expression and causes leukemic cell differentiation. How TPA-induced genes contribute to leukemic cell differentiation remains elusive. We noticed that chromosome 7 open reading frame 41 (C7ORF41) was a TPA-responsive gene and its upregulation concurred with human megakaryocyte differentiation. In K562 cells, ectopic expression of C7ORF41 significantly increased CD61 expression, enhanced ERK and JNK signaling, and upregulated RUNX1 and FLI1, whereas C7ORF41 knockdown caused an opposite phenotype. These observations suggest that C7ORF41 may promote megakaryocyte differentiation partially through modulating ERK and JNK signaling that leads to upregulation of RUNX1 and FLI1. In supporting this, C7ORF41 overexpression rescued megakaryocyte differentiation blocked by ERK inhibition while JNK inhibition abrogated the upregulation of FLI1 by C7ORF41. Furthermore, we found that Y34F mutant C7ORF41 inhibited megakaryocyte differentiation. nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) was the major activator of C7ORF41 that in turn repressed NF-κB activity by inhibiting its phosphorylation at serine 536, while MAPK/ERK was the potent repressor of C7ORF41. Finally, we showed that C7ORF41 knockdown in mouse fetal liver cells impaired megakaryocyte differentiation. Taken together, we have identified the function of a novel gene C7ORF41 that forms interplaying regulatory network in TPA-induced signaling and promotes leukemic and normal megakaryocyte differentiation
FGF‐2 promotes osteocyte differentiation through increased E11/podoplanin expression
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N.; Fleming, Robert; Vincent, Tonia L.; Buttle, David J.; Pitsillides, Andrew A.; Farquharson, Colin
2018-01-01
E11/podoplanin is critical in the early stages of osteoblast‐to‐osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF‐2 on E11‐mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast‐like cells and murine primary osteoblasts to FGF‐2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF‐2‐related changes in E11 expression and dendrite formation. FGF‐2 strongly activated the ERK signaling pathway in osteoblast‐like cells but inhibition of this pathway did not block the ability of FGF‐2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF‐2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF‐2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. PMID:29215722
Sebastian, Soji; Sreenivas, Prethish; Sambasivan, Ramkumar; Cheedipudi, Sirisha; Kandalla, Prashanth; Pavlath, Grace K.; Dhawan, Jyotsna
2009-01-01
Most cells in adult tissues are nondividing. In skeletal muscle, differentiated myofibers have exited the cell cycle permanently, whereas satellite stem cells withdraw transiently, returning to active proliferation to repair damaged myofibers. We have examined the epigenetic mechanisms operating in conditional quiescence by analyzing the function of a predicted chromatin regulator mixed lineage leukemia 5 (MLL5) in a culture model of reversible arrest. MLL5 is induced in quiescent myoblasts and regulates both the cell cycle and differentiation via a hierarchy of chromatin and transcriptional regulators. Knocking down MLL5 delays entry of quiescent myoblasts into S phase, but hastens S-phase completion. Cyclin A2 (CycA) mRNA is no longer restricted to S phase, but is induced throughout G0/G1, with activation of the cell cycle regulated element (CCRE) in the CycA promoter. Overexpressed MLL5 physically associates with the CCRE and impairs its activity. MLL5 also regulates CycA indirectly: Cux, an activator of CycA promoter and S phase is induced in RNAi cells, and Brm/Brg1, CCRE-binding repressors that promote differentiation are repressed. In knockdown cells, H3K4 methylation at the CCRE is reduced, reflecting quantitative global changes in methylation. MLL5 appears to lack intrinsic histone methyl transferase activity, but regulates expression of histone-modifying enzymes LSD1 and SET7/9, suggesting an indirect mechanism. Finally, expression of muscle regulators Pax7, Myf5, and myogenin is impaired in MLL5 knockdown cells, which are profoundly differentiation defective. Collectively, our results suggest that MLL5 plays an integral role in novel chromatin regulatory mechanisms that suppress inappropriate expression of S-phase-promoting genes and maintain expression of determination genes in quiescent cells. PMID:19264965
Chen, Tian; Liu, Zhi; Sun, Wenhua; Li, Jingyu; Liang, Yan; Yang, Xianrui; Xu, Yang; Yu, Mei; Tian, Weidong; Chen, Guoqing; Bai, Ding
2015-12-07
Dentinogenesis is the formation of dentin, a substance that forms the majority of teeth, and this process is performed by odontoblasts. Dental papilla cells (DPCs), as the progenitor cells of odontoblasts, undergo the odontogenic differentiation regulated by multiple cytokines and paracrine signal molecules. Ape1 is a perfect paradigm of the function complexity of a biological macromolecule with two major functional regions for DNA repair and redox regulation, respectively. To date, it remains unclear whether Ape1 can regulate the dentinogenesis in DPCs. In the present study, we firstly examed the spatio-temporal expression of Ape1 during tooth germ developmental process, and found the Ape1 expression was initially high and then gradually reduced along with the tooth development. Secondly, the osteo/odontogenic differentiation capacity of DPCs was up-regulated when treated with either Ape1-shRNA or E3330 (a specific inhibitor of the Ape1 redox function), respectively. Moreover, we found that the canonical Wnt signaling pathway was activated in this process, and E3330 reinforced-osteo/odontogenic differentiation capacity was suppressed by Dickkopf1 (DKK1), a potent antagonist of canonical Wnt signaling pathway. Taken together, we for the first time showed that inhibition of Ape1 redox regulation could promote the osteo/odontogenic differentiation capacity of DPCs via canonical Wnt signaling pathway.
Hamidi, Sofiane; Letourneur, Didier; Aid-Launais, Rachida; Di Stefano, Antonio; Vainchenker, William; Norol, Françoise; Le Visage, Catherine
2014-04-01
Somatic stem cells require specific niches and three-dimensional scaffolds provide ways to mimic this microenvironment. Here, we studied a scaffold based on Fucoidan, a sulfated polysaccharide known to influence morphogen gradients during embryonic development, to support human embryonic stem cells (hESCs) differentiation toward the cardiac lineage. A macroporous (pore 200 μm) Fucoidan scaffold was selected to support hESCs attachment and proliferation. Using a protocol based on the cardiogenic morphogen bone morphogenic protein 2 (BMP2) and transforming growth factor (TGFβ) followed by tumor necrosis factor (TNFα), an effector of cardiopoietic priming, we examined the cardiac differentiation in the scaffold compared to culture dishes and embryoid bodies (EBs). At day 8, Fucoidan scaffolds supported a significantly higher expression of the 3 genes encoding for transcription factors marking the early step of embryonic cardiac differentiation NKX2.5 (prelease TGFβ and TNFα was confirmed by Luminex technology. We also found that Fucoidan scaffolds supported the late stage of embryonic cardiac differentiation marked by a significantly higher atrial natriuretic factor (ANF) expression (pstress in the soft hydrogel impaired sarcomere formation, as confirmed by molecular analysis of the cardiac muscle myosin MYH6 and immunohistological staining of sarcomeric α-actinin. Nevertheless, Fucoidan scaffolds contributed to the development of thin filaments connecting beating areas through promotion of smooth muscle cells, thus enabling maintenance of beating areas for up to 6 months. In conclusion, Fucoidan scaffolds appear as a very promising biomaterial to control cardiac differentiation from hESCs that could be further combined with mechanical stress to promote sarcomere formation at terminal stages of differentiation.
The effect of ceruloplasmin on erythroid precursor cells in the marrow of irradiated mice
International Nuclear Information System (INIS)
Suda, Toshio; Miura, Yasusada; Ozawa, Keiya; Yamada, Masaaki.
1981-01-01
The effect of ceruloplasmine on erythroid colony forming unit (CFU-e) of irradiated mice was investigated. Whole body #betta# ray irradiation of 100rad decreased the number of CFU-e from 154 to 40 per 4 * 10 4 myeloid nucleated cells. When human #betta#-globulin of 1 mg/kg or ceruloplasmin of 1 mg/kg was administrated immediately after irradiation, the number of CFU-e increased to that of more than normal and normal value in 2 days, respectively. In the case where ceruloplasmin was begun to administrated 7 days before irradiation, though the CFU-e number decreased from 144 to 44, the number increased to 317 after 2 days, and gradually decreased to the normal value by 16 days after irradiation. (Nakanishi, T)
Xiao, Lin; Guo, Dazhi; Hu, Chun; Shen, Weiran; Shan, Lei; Li, Cui; Liu, Xiuyun; Yang, Wenjing; Zhang, Weidong; He, Cheng
2012-07-01
Differentiation of oligodendrocyte progenitor cells (OPCs) into mature oligodendrocytes is a prerequisite for remyelination after demyelination, and impairment of this process is suggested to be a major reason for remyelination failure. Diosgenin, a plant-derived steroid, has been implicated for therapeutic use in many diseases, but little is known about its effect on the central nervous system. In this study, using a purified rat OPC culture model, we show that diosgenin significantly and specifically promotes OPC differentiation without affecting the viability, proliferation, or migration of OPC. Interestingly, the effect of diosgenin can be blocked by estrogen receptor (ER) antagonist ICI 182780 but not by glucocorticoid and progesterone receptor antagonist RU38486, nor by mineralocorticoid receptor antagonist spirolactone. Moreover, it is revealed that both ER-alpha and ER-beta are expressed in OPC, and diosgenin can activate the extracellular signal-regulated kinase 1/2 (ERK1/2) in OPC via ER. The pro-differentiation effect of diosgenin can also be obstructed by the ERK inhibitor PD98059. Furthermore, in the cuprizone-induced demyelination model, it is demonstrated that diosgenin administration significantly accelerates/enhances remyelination as detected by Luxol fast blue stain, MBP immunohistochemistry and real time RT-PCR. Diosgenin also increases the number of mature oligodendrocytes in the corpus callosum while it does not affect the number of OPCs. Taking together, our results suggest that diosgenin promotes the differentiation of OPC into mature oligodendrocyte through an ER-mediated ERK1/2 activation pathway to accelerate remyelination, which implicates a novel therapeutic usage of this steroidal natural product in demyelinating diseases such as multiple sclerosis (MS). Copyright © 2012 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Kimira, Yoshifumi; Ogura, Kana; Taniuchi, Yuri; Kataoka, Aya; Inoue, Naoki; Sugihara, Fumihito; Nakatani, Sachie; Shimizu, Jun; Wada, Masahiro; Mano, Hiroshi
2014-01-01
Highlights: • Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization. • Pro-Hyp significantly increased alkaline phosphatase activity. • Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. - Abstract: Prolyl-hydroxyproline (Pro-Hyp) is one of the major constituents of collagen-derived dipeptides. The objective of this study was to investigate the effects of Pro-Hyp on the proliferation and differentiation of MC3T3-E1 osteoblastic cells. Addition of Pro-Hyp did not affect MC3T3-E1 cell proliferation and matrix mineralization but alkaline phosphatase activity was significantly increased. Furthermore, cells treated with Pro-Hyp significantly upregulated gene expression of Runx2, Osterix, and Col1α1. These results indicate that Pro-Hyp promotes osteoblast differentiation. This study demonstrates for the first time that Pro-Hyp has a positive effect on osteoblast differentiation with upregulation of Runx2, Osterix, and Collα1 gene expression
Guo, Hongfeng; Zhang, Yuan; Li, Zhengsheng; Kang, Fei; Yang, Bo; Kang, Xia; Wen, Can; Yan, Yanfei; Jiang, Bo; Fan, Yujiang
2013-01-01
Properties of the cell-material interface are determining factors in the successful function of cells for cartilage tissue engineering. Currently, cell adhesion is commonly promoted through the use of polypeptides; however, due to their lack of complementary or modulatory domains, polypeptides must be modified to improve their ability to promote adhesion. In this study, we utilized the principle of matrix-based biomimetic modification and a recombinant protein, which spans fragments 7–10 of fibronectin module III (heterophilic motif ) and extracellular domains 1–2 of cadherin-11 (rFN/Cad-11) (homophilic motif ), to modify the interface of collagen type II (Col II) sponges. We showed that the designed material was able to stimulate cell proliferation and promote better chondrogenic differentiation of rabbit mesenchymal stem cells (MSCs) in vitro than both the FN modified surfaces and the negative control. Further, the Col II/rFN/Cad-11-MSCs composite stimulated cartilage formation in vivo; the chondrogenic effect of Col II alone was much less significant. These results suggested that the rFN/Cad-11-modified collagen type II biomimetic interface has dual biological functions of promoting adhesion and stimulating chondrogenic differentiation. This substance, thus, may serve as an ideal scaffold material for cartilage tissue engineering, enhancing repair of injured cartilage in vivo. PMID:23919505
Purnomo, Adityan Dwi; Hadi, Sudharto Prawata; Prabawani, Bulan
2015-01-01
PT. Nasmoco Pemuda Semarang is a company engaged in the marketing of Toyota products for Central Java and Yogyakarta. The tied competition of automotive business led to decreased supposed to be adjective in the number of buyers and many new products from Toyota competitors sells new products with a more elegant design and reasonable price. This study is aimed to identify the driving factors of purchase decisions, specifically differentiation (X1) and promotion (X2) factor on purchasing decisi...
Yan, Yu-Hui; Li, Shao-Heng; Gao, Zhong; Zou, Sa-Feng; Li, Hong-Yan; Tao, Zhen-Yu; Song, Jie; Yang, Jing-Xian
2016-12-01
Recently, the potential for neural stem cells (NSCs) to be used in the treatment of Alzheimer's disease (AD) has been reported; however, the therapeutic effects are modest by virtue of the low neural differentiation rate. In our study, we transfected bone marrow-derived NSCs (BM-NSCs) with Neurotrophin-3 (NT-3), a superactive neurotrophic factor that promotes neuronal survival, differentiation, and migration of neuronal cells, to investigate the effects of NT-3 gene overexpression on the proliferation and differentiation into cholinergic neuron of BM-NSCs in vitro and its possible molecular mechanism. BM-NSCs were generated from BM mesenchymal cells of adult C57BL/6 mice and cultured in vitro. After transfected with NT-3 gene, immunofluorescence and RT-PCR method were used to determine the ability of BM-NSCs on proliferation and differentiation into cholinergic neuron; Acetylcholine Assay Kit was used for acetylcholine (Ach). RT-PCR and WB analysis were used to characterize mRNA and protein level related to the Notch signaling pathway. We found that NT-3 can promote the proliferation and differentiation of BM-NSCs into cholinergic neurons and elevate the levels of acetylcholine (ACh) in the supernatant. Furthermore, NT-3 gene overexpression increase the expression of Hes1, decreased the expression of Mash1 and Ngn1 during proliferation of BM-NSCs. Whereas, the expression of Hes1 was down-regulated, and Mash1 and Ngn1 expression were up-regulated during differentiation of BM-NSCs. Our findings support the prospect of using NT-3-transduced BM-NSCs in developing therapies for AD due to their equivalent therapeutic potential as subventricular zone-derived NSCs (SVZ-NSCs), greater accessibility, and autogenous attributes. Copyright © 2016 Elsevier Inc. All rights reserved.
EGR1 induces tenogenic differentiation of tendon stem cells and promotes rabbit rotator cuff repair.
Tao, Xu; Liu, Junpeng; Chen, Lei; Zhou, You; Tang, Kanglai
2015-01-01
The rate of healing failure after surgical repair of chronic rotator cuff tears is considerably high. The aim of this study was to investigate the function of the zinc finger transcription factor early growth response 1 (EGR1) in the differentiation of tendon stem cells (TSCs) and in tendon formation, healing, and tendon tear repair using an animal model of rotator cuff repair. Tenocyte, adipocyte, osteocyte, and chondrocyte differentiation as well as the expression of related genes were determined in EGR1-overexpressing TSCs (EGR1-TSCs) using tissue-specific staining, immunofluorescence staining, quantitative PCR, and western blotting. A rabbit rotator cuff repair model was established, and TSCs and EGR1-TSCs in a fibrin glue carrier were applied onto repair sites. The rabbits were sacrificed 8 weeks after repair operation, and tissues were histologically evaluated and tenocyte-related gene expression was determined. EGR1 induced tenogenic differentiation of TSCs and inhibited non-tenocyte differentiation of TSCs. Furthermore, EGR1 promoted tendon repair in a rabbit model of rotator cuff injury. The BMP12/Smad1/5/8 signaling pathway was involved in EGR1-induced tenogenic differentiation and rotator cuff tendon repair. EGR1 plays a key role in tendon formation, healing, and repair through BMP12/Smad1/5/8 pathway. EGR1-TSCs is a promising treatment for rotator cuff tendon repair surgeries. © 2015 S. Karger AG, Basel.
EGR1 Induces Tenogenic Differentiation of Tendon Stem Cells and Promotes Rabbit Rotator Cuff Repair
Directory of Open Access Journals (Sweden)
Xu Tao
2015-01-01
Full Text Available Background/Aims: The rate of healing failure after surgical repair of chronic rotator cuff tears is considerably high. The aim of this study was to investigate the function of the zinc finger transcription factor early growth response 1 (EGR1 in the differentiation of tendon stem cells (TSCs and in tendon formation, healing, and tendon tear repair using an animal model of rotator cuff repair. Methods: Tenocyte, adipocyte, osteocyte, and chondrocyte differentiation as well as the expression of related genes were determined in EGR1-overexpressing TSCs (EGR1-TSCs using tissue-specific staining, immunofluorescence staining, quantitative PCR, and western blotting. A rabbit rotator cuff repair model was established, and TSCs and EGR1-TSCs in a fibrin glue carrier were applied onto repair sites. The rabbits were sacrificed 8 weeks after repair operation, and tissues were histologically evaluated and tenocyte-related gene expression was determined. Results: EGR1 induced tenogenic differentiation of TSCs and inhibited non-tenocyte differentiation of TSCs. Furthermore, EGR1 promoted tendon repair in a rabbit model of rotator cuff injury. The BMP12/Smad1/5/8 signaling pathway was involved in EGR1-induced tenogenic differentiation and rotator cuff tendon repair. Conclusion: EGR1 plays a key role in tendon formation, healing, and repair through BMP12/Smad1/5/8 pathway. EGR1-TSCs is a promising treatment for rotator cuff tendon repair surgeries.
Glen, Katie E; Workman, Victoria L; Ahmed, Forhad; Ratcliffe, Elizabeth; Stacey, Adrian J; Thomas, Robert J
2013-09-01
Economic ex vivo manufacture of erythrocytes at 10(12) cell doses requires an efficiently controlled bio-process capable of extensive proliferation and high terminal density. High-resolution characterization of the process would identify production strategies for increased efficiency, monitoring and control. CD34(+) cord blood cells or equivalent cells that had been pre-expanded for 7 days with Delta1 Notch ligand were placed in erythroid expansion and differentiation conditions in a micro-scale ambr suspension bioreactor. Multiple culture parameters were varied, and phenotype markers and metabolites measured to identify conserved trends and robust monitoring markers. The cells exhibited a bi-modal erythroid differentiation pattern with an erythroid marker peak after 2 weeks and 3 weeks of culture; differentiation was comparatively weighted toward the second peak in Delta1 pre-expanded cells. Both differentiation events were strengthened by omission of stem cell factor and dexamethasone. The cumulative cell proliferation and death, or directly measured CD45 expression, enabled monitoring of proliferative rate of the cells. The metabolic activities of the cultures (glucose, glutamine and ammonia consumption or production) were highly variable but exhibited systematic change synchronized with the change in differentiation state. Erythroid differentiation chronology is partly determined by the heterogeneous CD34(+) progenitor compartment with implications for input control; Delta1 ligand-mediated progenitor culture can alter differentiation profile with control benefits for engineering production strategy. Differentiation correlated changes in cytokine response, markers and metabolic state will enable scientifically designed monitoring and timing of manufacturing process steps. Copyright © 2013 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto
2013-01-01
In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011
Directory of Open Access Journals (Sweden)
Alessandra Pisciotta
Full Text Available Human dental pulp is a promising alternative source of stem cells for cell-based tissue engineering in regenerative medicine, for the easily recruitment with low invasivity for the patient and for the self-renewal and differentiation potential of cells. So far, in vitro culture of mesenchymal stem cells is usually based on supplementing culture and differentiation media with foetal calf serum (FCS. FCS is known to contain a great quantity of growth factors, and thus to promote cell attachment on plastic surface as well as expansion and differentiation. Nevertheless, FCS as an animal origin supplement may represent a potential means for disease transmission besides leading to a xenogenic immune response. Therefore, a significant interest is focused on investigating alternative supplements, in order to obtain a sufficient cell number for clinical application, avoiding the inconvenients of FCS use. In our study we have demonstrated that human serum (HS is a suitable alternative to FCS, indeed its addition to culture medium induces a high hDPSCs proliferation rate and improves the in vitro osteogenic differentiation. Furthermore, hDPSCs-collagen constructs, pre-differentiated with HS-medium in vitro for 10 days, when implanted in immunocompromised rats, are able to restore critical size parietal bone defects. Therefore these data indicate that HS is a valid substitute for FCS to culture and differentiate in vitro hDPSCs in order to obtain a successful bone regeneration in vivo.
FGF-2 promotes osteocyte differentiation through increased E11/podoplanin expression.
Ikpegbu, Ekele; Basta, Lena; Clements, Dylan N; Fleming, Robert; Vincent, Tonia L; Buttle, David J; Pitsillides, Andrew A; Staines, Katherine A; Farquharson, Colin
2018-07-01
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the nature of the underlying signaling pathways regulating this process. Exposure of MC3T3 osteoblast-like cells and murine primary osteoblasts to FGF-2 (10 ng/ml) increased E11 mRNA and protein expression (p 70% reduction of basal E11 mRNA expression (p < 0.05) and effectively abrogated FGF-2-related changes in E11 expression and dendrite formation. FGF-2 strongly activated the ERK signaling pathway in osteoblast-like cells but inhibition of this pathway did not block the ability of FGF-2 to enhance E11 expression or to promote acquisition of the osteocyte phenotype. The results of this study highlight a novel mechanism by which FGF-2 can regulate osteoblast differentiation and osteocyte formation. Specifically, the data suggests that FGF-2 promotes osteocytogenesis through increased E11 expression and further studies will identify if this regulatory pathway is essential for bone development and maintenance in health and disease. © 2017 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Ma, Qinlong; Chen, Chunhai; Deng, Ping; Zhu, Gang; Lin, Min; Zhang, Lei; Xu, Shangcheng; He, Mindi; Lu, Yonghui; Duan, Weixia; Pi, Huifeng; Cao, Zhengwang; Pei, Liping; Li, Min; Liu, Chuan; Zhang, Yanwen; Zhong, Min; Zhou, Zhou; Yu, Zhengping
2016-01-01
Exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) can enhance hippocampal neurogenesis in adult mice. However, little is focused on the effects of ELF-EMFs on embryonic neurogenesis. Here, we studied the potential effects of ELF-EMFs on embryonic neural stem cells (eNSCs). We exposed eNSCs to ELF-EMF (50 Hz, 1 mT) for 1, 2, and 3 days with 4 hours per day. We found that eNSC proliferation and maintenance were significantly enhanced after ELF-EMF exposure in proliferation medium. ELF-EMF exposure increased the ratio of differentiated neurons and promoted the neurite outgrowth of eNSC-derived neurons without influencing astrocyes differentiation and the cell apoptosis. In addition, the expression of the proneural genes, NeuroD and Ngn1, which are crucial for neuronal differentiation and neurite outgrowth, was increased after ELF-EMF exposure. Moreover, the expression of transient receptor potential canonical 1 (TRPC1) was significantly up-regulated accompanied by increased the peak amplitude of intracellular calcium level induced by ELF-EMF. Furthermore, silencing TRPC1 expression eliminated the up-regulation of the proneural genes and the promotion of neuronal differentiation and neurite outgrowth induced by ELF-EMF. These results suggest that ELF-EMF exposure promotes the neuronal differentiation and neurite outgrowth of eNSCs via up-regulation the expression of TRPC1 and proneural genes (NeuroD and Ngn1). These findings also provide new insights in understanding the effects of ELF-EMF exposure on embryonic brain development. PMID:26950212
Yao, Xiuhua; Huang, Huiling; Li, Zhou; Liu, Xiaohua; Fan, Weijia; Wang, Xinping; Sun, Xuelian; Zhu, Jianmin; Zhou, Hongrui; Wei, Huaying
2017-08-01
Taurine has been reported to influence osteogenic differentiation, but the role of taurine on cartilaginous differentiation using human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) remains unclear. In this study, we investigated the effect of taurine (0, 1, 5 and 10 mM) on the proliferation and chondrogenesis of hUC-MSCs by analyzing cell proliferation, accumulation of glycosaminoglycans and expression of cartilage specific mRNA. The results show though taurine did not affected the proliferation of hUC-MSCs, 5 mM of taurine is sufficient to enhanced the accumulation of glycosaminoglycans and up-regulate cartilage specific mRNA expression, namely collagen type II, aggrecan and SOX9. Taurine also inhibits chondrocyte dedifferentiation by reducing expression of collagen type I mRNA. Taken together, our study reveals that taurine promotes and maintains the chondrogenesis of hUC-MSCs.
Wang, Mengmeng; Lyu, Zhonglin; Chen, Gaojian; Wang, Hongwei; Yuan, Yuqi; Ding, Kaiguo; Yu, Qian; Yuan, Lin; Chen, Hong
2015-10-28
A new strategy for the fabrication of glycosaminoglycan (GAG) analogs was proposed by copolymerizing the sulfonated unit and the glyco unit, 'splitted' from the sulfated saccharide building blocks of GAGs. The synthetic polymers can promote cell proliferation and neural differentiation of embryonic stem cells with the effects even better than those of heparin.
Li, Zhenzhen; Han, Shichao; Wang, Xingqin; Han, Fu; Zhu, Xiongxiang; Zheng, Zhao; Wang, Hongtao; Zhou, Qin; Wang, Yunchuan; Su, Linlin; Shi, Jihong; Tang, Chaowu; Hu, Dahai
2015-03-11
Bone marrow mesenchymal stem cells (BMSCs), which have the ability to self-renew and to differentiate into multiple cell types, have recently become a novel strategy for cell-based therapies. The differentiation of BMSCs into keratinocytes may be beneficial for patients with burns, disease, or trauma. However, the currently available cells are exposed to animal materials during their cultivation and induction. These xeno-contaminations severely limit their clinical outcomes. Previous studies have shown that the Rho kinase (ROCK) inhibitor Y-27632 can promote induction efficiency and regulate the self-renewal and differentiation of stem cells. In the present study, we attempted to establish a xeno-free system for the differentiation of BMSCs into keratinocytes and to investigate whether Y-27632 can facilitate this differentiation. BMSCs isolated from patients were cultured by using a xeno-free system and characterised by using flow cytometric analysis and adipogenic and osteogenic differentiation assays. Human primary keratinocytes were also isolated from patients. Then, the morphology, population doubling time, and β-galactosidase staining level of these cells were evaluated in the presence or absence of Y-27632 to determine the effects of Y-27632 on the state of the keratinocytes. Keratinocyte-like cells (KLCs) were detected at different time points by immunocytofluorescence analysis. Moreover, the efficiency of BMSC differentiation under different conditions was measured by quantitative real-time-polymerase chain reaction (RT-PCR) and Western blot analyses. The ROCK inhibitor Y-27632 promoted the proliferation and lifespan of human primary keratinocytes. In addition, we showed that keratinocyte-specific markers could be detected in BMSCs cultured in a xeno-free system using keratinocyte-conditioned medium (KCM) independent of the presence of Y-27632. However, the efficiency of the differentiation of BMSCs into KLCs was significantly higher in the presence of Y
Nuclear RNA sequencing of the mouse erythroid cell transcriptome.
Directory of Open Access Journals (Sweden)
Jennifer A Mitchell
Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.
Zhang, Xinhua; Zhang, Lei; Cheng, Xiang; Guo, Yuxiu; Sun, Xiaohui; Chen, Geng; Li, Haoming; Li, Pengcheng; Lu, Xiaohui; Tian, Meiling; Qin, Jianbing; Zhou, Hui; Jin, Guohua
2014-01-01
Our previous studies indicated that transcription factor Brn-4 is upregulated in the surgically denervated hippocampus in vivo, promoting neuronal differentiation of hippocampal neural stem cells (NSCs) in vitro. The molecules mediating Brn-4 upregulation in the denervated hippocampus remain unknown. In this study we examined the levels of insulin-like growth factor-1 (IGF-1) in hippocampus following denervation. Surgical denervation led to a significant increase in IGF-1 expression in vivo. We also report that IGF-1 treatment on NSCs in vitro led to a marked acceleration of Brn-4 expression and cell differentiation down neuronal pathways. The promotion effects were blocked by PI3K-specific inhibitor (LY294002), but not MAPK inhibitor (PD98059); levels of phospho-Akt were increased by IGF-1 treatment. In addition, inhibition of IGF-1 receptor (AG1024) and mTOR (rapamycin) both attenuated the increased expression of Brn-4 induced by IGF-1. Together, the results demonstrated that upregulation of IGF-1 induced by hippocampal denervation injury leads to activation of the PI3K/Akt signaling pathway, which in turn gives rise to upregulation of the Brn-4 and subsequent stem cell differentiation down neuronal pathways. PMID:25474202
Abdo, Shaaban; Shi, Yixuan; Otoukesh, Abouzar; Ghosh, Anindya; Lo, Chao-Sheng; Chenier, Isabelle; Filep, Janos G; Ingelfinger, Julie R; Zhang, Shao Ling; Chan, John S D
2014-10-01
This study investigated the impact of catalase (Cat) overexpression in renal proximal tubule cells (RPTCs) on nuclear factor erythroid 2-related factor 2 (Nrf2) stimulation of angiotensinogen (Agt) gene expression and the development of hypertension and renal injury in diabetic Akita transgenic mice. Additionally, adult male mice were treated with the Nrf2 activator oltipraz with or without the inhibitor trigonelline. Rat RPTCs, stably transfected with plasmid containing either rat Agt or Nrf2 gene promoter, were also studied. Cat overexpression normalized systolic BP, attenuated renal injury, and inhibited RPTC Nrf2, Agt, and heme oxygenase-1 (HO-1) gene expression in Akita Cat transgenic mice compared with Akita mice. In vitro, high glucose level, hydrogen peroxide, and oltipraz stimulated Nrf2 and Agt gene expression; these changes were blocked by trigonelline, small interfering RNAs of Nrf2, antioxidants, or pharmacological inhibitors of nuclear factor-κB and p38 mitogen-activated protein kinase. The deletion of Nrf2-responsive elements in the rat Agt gene promoter abolished the stimulatory effect of oltipraz. Oltipraz administration also augmented Agt, HO-1, and Nrf2 gene expression in mouse RPTCs and was reversed by trigonelline. These data identify a novel mechanism, Nrf2-mediated stimulation of intrarenal Agt gene expression and activation of the renin-angiotensin system, by which hyperglycemia induces hypertension and renal injury in diabetic mice. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
The Differential Effects of Social Media Sites for Promoting Cancer Risk Reduction.
Lauckner, Carolyn; Whitten, Pamela
2016-09-01
Social media are potentially valuable tools for disseminating cancer education messages, but the differential effects of various sites on persuasive outcomes are unknown. In an effort to inform future health promotion, this research tested the effects of Facebook, YouTube, Twitter, and blogs for delivering a cancer risk reduction message. Using an experimental design, participants were randomly placed in several conditions that delivered the same message but with different forms of social media. Effects on comprehension and attitudes were examined, as they are important variables in the behavior change process. YouTube led to higher comprehension and stronger attitudes toward cancer risk reduction than Twitter, but there were no differences between other sites. Additionally, YouTube led to stronger attitudes toward cancer risk reduction as compared to Facebook, but not any other sites. These results demonstrate that, even if the message is kept constant, the form of social media used to deliver content can have an effect on persuasive outcomes. More research is needed to determine the mechanisms behind the differences found, however. Altogether, this line of research is valuable for any individuals seeking to use social media for health promotion purposes and could have direct implications for the development of cancer risk reduction campaigns.
miR-148a-3p Mediates Notch Signaling to Promote the Differentiation and M1 Activation of Macrophages
Directory of Open Access Journals (Sweden)
Fei Huang
2017-10-01
Full Text Available The Notch pathway plays critical roles in the differentiation and polarized activation of macrophages; however, the downstream molecular mechanisms underlying Notch activity in macrophages remain elusive. Our previous study has identified a group of microRNAs that mediate Notch signaling to regulate macrophage activation and tumor-associated macrophages (TAMs. In this study, we demonstrated that miR-148a-3p functions as a novel downstream molecule of Notch signaling to promote the differentiation of monocytes into macrophages in the presence of granulocyte macrophage colony-stimulating factor (GM-CSF. Meanwhile, miR-148a-3p promoted M1 and inhibited M2 polarization of macrophages upon Notch activation. Macrophages overexpressing miR-148a-3p exhibited enhanced ability to engulf and kill bacteria, which was mediated by excessive production of reactive oxygen species (ROS. Further studies using reporter assay and Western blotting identified Pten as a direct target gene of miR-148a-3p in macrophages. Macrophages overexpressing miR-148a-3p increased their ROS production through the PTEN/AKT pathway, likely to defend against bacterial invasion. Moreover, miR-148a-3p also enhanced M1 macrophage polarization and pro-inflammatory responses through PTEN/AKT-mediated upregulation of NF-κB signaling. In summary, our data establish a novel molecular mechanism by which Notch signaling promotes monocyte differentiation and M1 macrophage activation through miR-148a-3p, and suggest that miR-148a-3p-modified monocytes or macrophages are potential new tools for the treatment of inflammation-related diseases.
DEFF Research Database (Denmark)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
2013-01-01
, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...
Directory of Open Access Journals (Sweden)
Pierre-Benoit Ancey
2017-07-01
Full Text Available Understanding the processes that govern liver progenitor cell differentiation has important implications for the design of strategies targeting chronic liver diseases, whereby regeneration of liver tissue is critical. Although DNA methylation (5mC and hydroxymethylation (5hmC are highly dynamic during early embryonic development, less is known about their roles at later stages of differentiation. Using an in vitro model of hepatocyte differentiation, we show here that 5hmC precedes the expression of promoter 1 (P1-dependent isoforms of HNF4A, a master transcription factor of hepatocyte identity. 5hmC and HNF4A expression from P1 are dependent on ten-eleven translocation (TET dioxygenases. In turn, the liver pioneer factor FOXA2 is necessary for TET1 binding to the P1 locus. Both FOXA2 and TETs are required for the 5hmC-related switch in HNF4A expression. The epigenetic event identified here may be a key step for the establishment of the hepatocyte program by HNF4A.
Directory of Open Access Journals (Sweden)
Xiao-Na Pan
Full Text Available Nowadays, drug resistance still represents a major obstacle to successful acute myeloid leukemia (AML treatment and the underlying mechanism is not fully elucidated. Here, we found that high expression of c-Myc was one of the cytogenetic characteristics in the drug-resistant leukemic cells. c-Myc over-expression in leukemic cells induced resistance to chemotherapeutic drugs, enhanced colony formation capacity and inhibited cell differentiation induced by all-trans retinoic acid (ATRA. Meanwhile, inhibition of c-Myc by shRNA or specific c-Myc inhibitor 10058-F4 rescued the sensitivity to cytotoxic drugs, restrained the colony formation ability and promoted differentiation. RT-PCR and western blotting analysis showed that down-regulation of C/EBPβ contributed to the poor differentiation state of leukemic cells induced by c-Myc over-expression. Importantly, over-expression of C/EBPβ could reverse c-Myc induced drug resistance. In primary AML cells, the c-Myc expression was negatively correlated with C/EBPβ. 10058-F4, displayed anti-proliferative activity and increased cellular differentiation with up-regulation of C/EBPβ in primary AML cells. Thus, our study indicated that c-Myc could be a novel target to overcome drug resistance, providing a new approach in AML therapy.
Directory of Open Access Journals (Sweden)
Dalia Ali
2018-01-01
Full Text Available Bone marrow mesenchymal stem cells (BMSCs are adult multipotent stem cells that can differentiate into mesodermal lineage cells, including adipocytes and osteoblasts. However, the epigenetic mechanisms governing the lineage-specific commitment of BMSCs into adipocytes or osteoblasts are under investigation. Herein, we investigated the epigenetic effect of romidepsin, a small molecule dual inhibitor targeting HDAC1 and HDAC2 identified through an epigenetic library functional screen. BMSCs exposed to romidepsin (5 nM exhibited enhanced adipocytic and osteoblastic differentiation. Global gene expression and signaling pathway analyses of differentially expressed genes revealed a strong enrichment of genes involved in adipogenesis and osteogenesis in romidepsin-treated BMSCs during induction into adipocytes or osteoblasts, respectively. Pharmacological inhibition of FAK signaling during adipogenesis or inhibition of FAK or TGFβ signaling during osteogenesis diminished the biological effects of romidepsin on BMSCs. The results of chromatin immunoprecipitation combined with quantitative polymerase chain reaction indicated a significant increase in H3K9Ac epigenetic markers in the promoter regions of peroxisome proliferator-activated receptor gamma (PPARγ and KLF15 (related to adipogenesis or SP7 (Osterix and alkaline phosphatase (ALP (related to osteogenesis in romidepsin-treated BMSCs. Our data indicated that romidepsin is a novel in vitro modulator of adipocytic and osteoblastic differentiation of BMSCs.
Schwann cells promote neuronal differentiation of bone marrow ...
African Journals Online (AJOL)
Administrator
2011-04-25
Apr 25, 2011 ... Bone marrow stromal cells (BMSCs), a type of multipotent stem cell, can differentiate into various types ... induced to differentiate into neuron-like cells when they are ... axonal regeneration and functional reconstruction do not.
von Lindern, M.; Deiner, E. M.; Dolznig, H.; Parren-van Amelsvoort, M.; Hayman, M. J.; Mullner, E. W.; Beug, H.
2001-01-01
Primary erythroid progenitors can be expanded by the synergistic action of erythropoietin (Epo), stem cell factor (SCF) and glucocorticoids. While Epo is required for erythropoiesis in general, glucocorticoids and SCF mainly contribute to stress erythropoiesis in hypoxic mice. This ability of normal
Wang, Yuli; Yin, Ying; Jiang, Fei; Chen, Ning
2015-02-01
Human amnion mesenchymal stem cells (HAMSCs) can be obtained from human amniotic membrane, a highly abundant and readily available tissue. HAMSC sources present fewer ethical issues, have low immunogenicity, anti-inflammatory properties, considerable advantageous characteristics, and are considered an attractive potential treatment material in the field of regenerative medicine. We used a co-culture system to determine whether HAMSCs could promote osteogenesis in human bone marrow mesenchymal stem cells (HBMSCs). We isolated HAMSCs from discarded amnion samples and collected them using pancreatin/collagenase digestion. We cultured HAMSCs and HBMSCSs in basal medium. Activity of alkaline phosphatase (ALP), an early osteogenesis marker, was increased in the co-culture system compared to the control single cultures, which we also confirmed by ALP staining. We used immunofluorescence testing to investigate the effects of co-culturing with HAMSCs on HBMSC proliferation, which revealed that the co-culturing enhanced EdU expression in HBMSCs. Western blotting and quantitative real-time PCR indicated that co-culturing promoted osteogenesis in HBMSCs. Furthermore, Alizarin red S staining revealed that extracellular matrix calcium levels in mineralized nodule formation produced by the co-cultures were higher than that in the controls. Using the same co-culture system, we further observed the effects of HAMSCs on osteogenic differentiation in primary osteoblasts by Western blotting, which better addressed the mechanism for HAMSCs in bone regeneration. The results showed HAMSCs are osteogenic and not only play a role in promoting HBMSC proliferation and osteogenic differentiation but also in osteoblasts, laying the foundation for new regenerative medicine methods.
Directory of Open Access Journals (Sweden)
Yin-Hua Zhao
2015-05-01
Full Text Available Our previous studies have shown that hydrostatic pressure can serve as an active regulator for bone marrow mesenchymal stem cells (BMSCs. The current work further investigates the roles of cytoskeletal regulatory proteins Ras homolog gene family member A (RhoA and Ras-related C3 botulinum toxin substrate 1 (Rac1 in hydrostatic pressure-related effects on BMSCs. Flow cytometry assays showed that the hydrostatic pressure promoted cell cycle initiation in a RhoA- and Rac1-dependent manner. Furthermore, fluorescence assays confirmed that RhoA played a positive and Rac1 displayed a negative role in the hydrostatic pressure-induced F-actin stress fiber assembly. Western blots suggested that RhoA and Rac1 play central roles in the pressure-inhibited ERK phosphorylation, and Rac1 but not RhoA was involved in the pressure-promoted JNK phosphorylation. Finally, real-time polymerase chain reaction (PCR experiments showed that pressure promoted the expression of osteogenic marker genes in BMSCs at an early stage of osteogenic differentiation through the up-regulation of RhoA activity. Additionally, the PCR results showed that pressure enhanced the expression of chondrogenic marker genes in BMSCs during chondrogenic differentiation via the up-regulation of Rac1 activity. Collectively, our results suggested that RhoA and Rac1 are critical to the pressure-induced proliferation and differentiation, the stress fiber assembly, and MAPK activation in BMSCs.
Zhao, Yin-Hua; Lv, Xin; Liu, Yan-Li; Zhao, Ying; Li, Qiang; Chen, Yong-Jin; Zhang, Min
2015-05-01
Our previous studies have shown that hydrostatic pressure can serve as an active regulator for bone marrow mesenchymal stem cells (BMSCs). The current work further investigates the roles of cytoskeletal regulatory proteins Ras homolog gene family member A (RhoA) and Ras-related C3 botulinum toxin substrate 1 (Rac1) in hydrostatic pressure-related effects on BMSCs. Flow cytometry assays showed that the hydrostatic pressure promoted cell cycle initiation in a RhoA- and Rac1-dependent manner. Furthermore, fluorescence assays confirmed that RhoA played a positive and Rac1 displayed a negative role in the hydrostatic pressure-induced F-actin stress fiber assembly. Western blots suggested that RhoA and Rac1 play central roles in the pressure-inhibited ERK phosphorylation, and Rac1 but not RhoA was involved in the pressure-promoted JNK phosphorylation. Finally, real-time polymerase chain reaction (PCR) experiments showed that pressure promoted the expression of osteogenic marker genes in BMSCs at an early stage of osteogenic differentiation through the up-regulation of RhoA activity. Additionally, the PCR results showed that pressure enhanced the expression of chondrogenic marker genes in BMSCs during chondrogenic differentiation via the up-regulation of Rac1 activity. Collectively, our results suggested that RhoA and Rac1 are critical to the pressure-induced proliferation and differentiation, the stress fiber assembly, and MAPK activation in BMSCs. Copyright © 2015. Published by Elsevier B.V.
Ali, Dalia; Alshammari, Hassan; Vishnubalaji, Radhakrishnan; Chalisserry, Elna Paul; Hamam, Rimi; Alfayez, Musaad; Kassem, Moustapha; Aldahmash, Abdullah; Alajez, Nehad M
2017-03-01
The role of bone marrow adipocytes (BMAs) in overall energy metabolism and their effects on bone mass are currently areas of intensive investigation. BMAs differentiate from bone marrow stromal cells (BMSCs); however, the molecular mechanisms regulating BMA differentiation are not fully understood. In this study, we investigated the effect of CUDC-907, identified by screening an epigenetic small-molecule library, on adipocytic differentiation of human BMSCs (hBMSCs) and determined its molecular mechanism of action. Human bone marrow stromal cells exposed to CUDC-907 (500 nM) exhibited enhanced adipocytic differentiation (∼2.9-fold increase, P < 0.005) compared with that of control cells. Global gene expression and signaling pathway analyses of differentially expressed genes revealed a strong enrichment of genes involved in adipogenesis, cell cycle, and DNA replication. Chromatin immune precipitation combined with quantitative polymerase chain reaction showed significant increase in H3K9ac epigenetic marker in the promoter regions of AdipoQ, FABP4, PPARγ, KLF15, and CEBPA in CUDC-907-treated hBMSCs. Follow-up experiments corroborated that the inhibition of histone deacetylase (HDAC) activity enhanced adipocytic differentiation, while the inhibition of PI3K decreased adipocytic differentiation. In addition, CUDC-907 arrested hBMSCs in the G0-G1 phase of the cell cycle and reduced the number of S-phase cells. Our data reveal that HDAC, PI3K, and cell cycle genes are important regulators of BMA formation and demonstrate that adipocyte differentiation of hBMSCs is associated with complex changes in a number of epigenetic and genetic pathways, which can be targeted to regulate BMA formation.
Zhuo, Yi; Wang, Lei; Ge, Lite; Li, Xuan; Duan, Da; Teng, Xiaohua; Jiang, Miao; Liu, Kai; Yuan, Ting; Wu, Pei; Wang, Hao; Deng, Yujia; Xie, Huali; Chen, Ping; Xia, Ying; Lu, Ming
2017-08-01
Olfactory mucosa mesenchymal stem cells (OM-MSCs) display significant clonogenic activity and may be easily propagated for Parkinson's disease therapies. Methods of inducing OM-MSCs to differentiate into dopaminergic (DAergic) neurons using olfactory ensheathing cells (OECs) are thus an attractive topic of research. We designed a hypoxic induction protocol to generate DAergic neurons from OM-MSCs using a physiological oxygen (O 2 ) level of 3% and OEC-conditioned medium (OCM; HI group). The normal induction (NI) group was cultured in O 2 at ambient air level (21%). The role of hypoxia-inducible factor-1α (HIF-1α) in the differentiation of OM-MSCs under hypoxia was investigated by treating cells with an HIF-1α inhibitor before induction (HIR group). The proportions of β-tubulin- and tyrosine hydroxylase (TH)-positive cells were significantly increased in the HI group compared with the NI and HIR groups, as shown by immunocytochemistry and Western blotting. Furthermore, the level of dopamine was significantly increased in the HI group. A slow outward potassium current was recorded in differentiated cells after 21 d of induction using whole-cell voltage-clamp tests. A hypoxic environment thus promotes OM-MSCs to differentiate into DAergic neurons by increasing the expression of HIF-1α and by activating downstream target gene TH. This study indicated that OCM under hypoxic conditions could significantly upregulate key transcriptional factors involved in the development of DAergic neurons from OM-MSCs, mediated by HIF-1α. Hypoxia promotes DAergic neuronal differentiation of OM-MSCs, and HIF-1α may play an important role in hypoxia-inducible pathways during DAergic lineage specification and differentiation in vitro.
Ogawa, Tatsuya; Tsuji-Kawahara, Sachiyo; Yuasa, Takae; Kinoshita, Saori; Chikaishi, Tomomi; Takamura, Shiki; Matsumura, Haruo; Seya, Tsukasa; Saga, Toshihiko; Miyazawa, Masaaki
2011-06-01
Natural killer (NK) cells function as early effector cells in the innate immune defense against viral infections and also participate in the regulation of normal and malignant hematopoiesis. NK cell activities have been associated with early clearance of viremia in experimental simian immunodeficiency virus and clinical human immunodeficiency virus type 1 (HIV-1) infections. We have previously shown that NK cells function as major cytotoxic effector cells in vaccine-induced immune protection against Friend virus (FV)-induced leukemia, and NK cell depletion totally abrogates the above protective immunity. However, how NK cells recognize retrovirus-infected cells remains largely unclear. The present study demonstrates a correlation between the expression of the products of retinoic acid early transcript-1 (RAE-1) genes in target cells and their susceptibility to killing by NK cells isolated from FV-infected animals. This killing was abrogated by antibodies blocking the NKG2D receptor in vitro. Further, the expression of RAE-1 proteins on erythroblast surfaces increased early after FV inoculation, and administration of an RAE-1-blocking antibody resulted in increased spleen infectious centers and exaggerated pathology, indicating that FV-infected erythroid cells are recognized by NK cells mainly through the NKG2D-RAE-1 interactions in vivo. Enhanced retroviral replication due to host gene-targeting resulted in markedly increased RAE-1 expression in the absence of massive erythroid cell proliferation, indicating a direct role of retroviral replication in RAE-1 upregulation.
Directory of Open Access Journals (Sweden)
Wan Chen
2015-11-01
Full Text Available Background/Aims: Dexamethasone (Dex-induced spontaneous tendon rupture and decreased self-repair capability is very common in clinical practice. The metaplasia of adipose tissue in the ruptured tendon indicates that Dex may induce tendon stem cells (TSCs to differentiate into adipocytes, but the mechanism remains unclear. In the present study, we used in vitro methods to investigate the effects of Dex on rat TSC differentiation and the molecular mechanisms underlying this process. Methods: First, we used qPCR and Western blotting to detect the expression of the adipogenic differentiation markers aP2 and C/EBPα after treating the TSCs with Dex. Oil red staining was used to confirm that high concentration Dex promoted adipogenic differentiation of rat TSCs. Next, we used qPCR and Western blotting to detect the effect of a high concentration of dexamethasone on molecules related to the canonical WNT/β-catenin pathway in TSCs. Results: Treating rat TSCs with Dex promoted the synthesis of the inhibitory molecule dickkopf1 (DKK1 at the mRNA and protein levels. Western blotting results further showed that Dex downregulated the cellular signaling molecule phosphorylated glycogen synthase kinase-3β (P-GSK-3 β (ser9, upregulated P-GSK-3β (tyr216, and downregulated the pivotal signaling molecule β-catenin. Furthermore, DKK1 knockdown attenuated Dex-induced inhibition of the canonical WNT/β-catenin pathway and of the adipogenic differentiation of TSCs. Lithium chloride (LiCl, a GSK-3β inhibitor reduced Dex-induced inhibition of the classical WNT/β-catenin pathway in TSCs and of the differentiation of TSCs to adipocytes. Conclusion: In conclusion, by upregulating DKK1 expression, reducing the level of P-GSK-3β (ser9, and increasing the level of P-GSK-3β (tyr216, Dex causes the degradation of β-catenin, the central molecule of the classical WNT pathway, thereby inducing rat TSCs to differentiate into adipocytes.
Wang, Qin; Yang, Lin; Wang, Yaping
2015-06-01
Stroke has become the leading cause of mortality worldwide. Hypoxic or ischemic insults are crucial factors mediating the neural damage in the brain tissue of stroke patients. Neural stem cells (NSCs) have been recognized as a promising tool for the treatment of ischemic stroke and other neurodegenerative diseases due to their inducible pluripotency. In this study, we aim to mimick the cerebral hypoxic-ischemic injury in vitro using oxygen-glucose deprivation (OGD) strategy, and evaluate the effects of OGD on the NSC's neural differentiation, as well as the differentiated neurite outgrowth. Our data showed that NSCs under the short-term 2h OGD treatment are able to maintain cell viability and the capability to form neurospheres. Importantly, this moderate OGD treatment promotes NSC differentiation to neurons and enhances the performance of the mature neuronal networks, accompanying increased neurite outgrowth of differentiated neurons. However, long-term 6h and 8h OGD exposures in NSCs lead to decreased cell survival, reduced differentiation and diminished NSC-derived neurite outgrowth. The expressions of neuron-specific microtubule-associated protein 2 (MAP-2) and growth associated protein 43 (GAP-43) are increased by short-term OGD treatments but suppressed by long-term OGD. Overall, our results demonstrate that short-term OGD exposure in vitro induces differentiation of NSCs while maintaining their proliferation and survival, providing valuable insights of adopting NSC-based therapy for ischemic stroke and other neurodegenerative disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.
Survey and evaluation of mutations in the human KLF1 transcription unit.
Gnanapragasam, Merlin Nithya; Crispino, John D; Ali, Abdullah M; Weinberg, Rona; Hoffman, Ronald; Raza, Azra; Bieker, James J
2018-04-26
Erythroid Krüppel-like Factor (EKLF/KLF1) is an erythroid-enriched transcription factor that plays a global role in all aspects of erythropoiesis, including cell cycle control and differentiation. We queried whether its mutation might play a role in red cell malignancies by genomic sequencing of the KLF1 transcription unit in cell lines, erythroid neoplasms, dysplastic disorders, and leukemia. In addition, we queried published databases from a number of varied sources. In all cases we only found changes in commonly notated SNPs. Our results suggest that if there are mutations in KLF1 associated with erythroid malignancies, they are exceedingly rare.
Directory of Open Access Journals (Sweden)
Xinhua Zhang
Full Text Available Our previous studies indicated that transcription factor Brn-4 is upregulated in the surgically denervated hippocampus in vivo, promoting neuronal differentiation of hippocampal neural stem cells (NSCs in vitro. The molecules mediating Brn-4 upregulation in the denervated hippocampus remain unknown. In this study we examined the levels of insulin-like growth factor-1 (IGF-1 in hippocampus following denervation. Surgical denervation led to a significant increase in IGF-1 expression in vivo. We also report that IGF-1 treatment on NSCs in vitro led to a marked acceleration of Brn-4 expression and cell differentiation down neuronal pathways. The promotion effects were blocked by PI3K-specific inhibitor (LY294002, but not MAPK inhibitor (PD98059; levels of phospho-Akt were increased by IGF-1 treatment. In addition, inhibition of IGF-1 receptor (AG1024 and mTOR (rapamycin both attenuated the increased expression of Brn-4 induced by IGF-1. Together, the results demonstrated that upregulation of IGF-1 induced by hippocampal denervation injury leads to activation of the PI3K/Akt signaling pathway, which in turn gives rise to upregulation of the Brn-4 and subsequent stem cell differentiation down neuronal pathways.
Expression of the transcription factor Evi-1 in human erythroleukemia cell lines and in leukemias.
Fontenay-Roupie, M; Bouscary, D; Melle, J; Viguié, F; Picard, F; Guesnu, M; Dreyfus, F
1997-02-01
The Evi-1 proto-oncogene is a zinc finger DNA binding protein. Although activation of the Evi-1 gene has been associated with chromosomal rearrangements of the 3q25-q28 region, ectopic expression of Evi-1 could also be observed in acute myelogenous leukemias and myelodysplastic syndromes without cytogenetic abnormalities of the 3q26 locus. In this study, human erythroleukemic cell lines were screened for the expression of Evi-1 mRNA by northern blotting. Evi-1 was expressed in all the erythroid cell lines, whether undifferentiated (K 562, HEL, LAMA 84) or exhibiting spontaneous terminal erythroid differentiation (KU 812, JK-1). Evi-1 mRNA levels were constant or elevated in hemoglobin-synthesizing KU 812 or K 562 cells in response to erythropoietin or hemin treatment, respectively. In human acute myeloblastic leukemias (AML), 11/30 expressed Evi-1 by RT-PCR. Among these cases, 4/6 erythroleukemias without abnormalities of the 3q25-q28 region were found positive. The presence of acidophilic erythroblasts (15-47% of bone marrow cells) accounted for the existence of a terminal erythroid differentiation in all Evi-1-positive AML M6, whereas one negative case was poorly differentiated and referred to as AML M6 variant. These results suggest that Evi-1 mRNA expression can coexist with erythroid differentiation.
Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide
2016-06-01
We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. Copyright © 2016 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Ding, Ying; Yan, Qing; Ruan, Jing-Wen; Zhang, Yan-Qing; Li, Wen-Jie; Zhang, Yu-Jiao; Li, Yan; Dong, Hongxin; Zeng, Yuan-Shan
2009-01-01
Background Bone marrow mesenchymal stem cells (MSCs) are one of the potential tools for treatment of the spinal cord injury; however, the survival and differentiation of MSCs in an injured spinal cord still need to be improved. In the present study, we investigated whether Governor Vessel electro-acupuncture (EA) could efficiently promote bone marrow mesenchymal stem cells (MSCs) survival and differentiation, axonal regeneration and finally, functional recovery in the transected spinal cord. Results The spinal cords of adult Sprague-Dawley (SD) rats were completely transected at T10, five experimental groups were performed: 1. sham operated control (Sham-control); 2. operated control (Op-control); 3. electro-acupuncture treatment (EA); 4. MSCs transplantation (MSCs); and 5. MSCs transplantation combined with electro-acupuncture (MSCs+EA). After 2-8 weeks of MSCs transplantation plus EA treatment, we found that the neurotrophin-3 (NT-3), cAMP level, the differentiation of MSCs, the 5-HT positive and CGRP positive nerve fibers in the lesion site and nearby tissue of injured spinal cord were significantly increased in the MSCs+EA group as compared to the group of the MSCs transplantation or the EA treated alone. Furthermore, behavioral test and spinal cord evoked potentials detection demonstrated a significantly functional recovery in the MSCs +EA group. Conclusion These results suggest that EA treatment may promote grafted MSCs survival and differentiation; MSCs transplantation combined with EA treatment could promote axonal regeneration and partial locomotor functional recovery in the transected spinal cord in rats and indicate a promising avenue of treatment of spinal cord injury. PMID:19374777
Directory of Open Access Journals (Sweden)
Shifen Dong
2014-10-01
Conclusions: These findings demonstrated that ISA promoted adipogenesis by up-regulating expressions of C/EBP β, PPAR γ, C/EBP α, aP2 and FAS, and also stimulated adipokines during adipocyte differentiation. Further study should clarify the relationship between stimulation of adipokines and cognitive enhancing effect of ISA.
Schwann cells promote neuronal differentiation of bone marrow ...
African Journals Online (AJOL)
It has been suggested that the BMSCs have the capacity to differentiate into neurons under specific experimental conditions, using chemical factors. In this study, we showed that BMSCs can be induced to differentiate into neuron-like cells when they are co-cultured with Schwann cells by Brdu pulse label technology.
Fredriksson, Maritha; Li, Yan; Stålman, Anders; Haldosén, Lars-Arne; Felländer-Tsai, Li
2013-09-02
Tendinopathies are often empirically treated with oral/topical nonsteroidal anti-inflammatory medications and corticosteroid injections despite their unclear effects on tendon regeneration. Recent studies indicate that tendon progenitors exhibit stem cell-like properties, i.e., differentiation to osteoblasts, adipocytes, and chondrocytes, in addition to tenocytes. Our present study aims at understanding the effects of triamcinolone acetonide and diclofenac on tenocytic differentiation of mesenchymal stem cells. The murine fibroblast C3H10T1/2 cell line was induced to tenocytic differentiation by growth differentiation factor-7. Cell proliferation and differentiation with the exposure of different concentrations of triamcinolone acetonide and diclofenac were measured by WST-1 assay and real-time polymerase chain reaction analysis, respectively. Cell proliferation was decreased in a concentration-dependent manner when exposed to triamcinolone acetonide and diclofenac. In addition to tenocytic differentiation, adipocyte formation was observed, both at gene expression and microscopic level, when the cells were exposed to triamcinolone acetonide or high concentrations of diclofenac. Our results indicate that triamcinolone acetonide and diclofenac might alter mesenchymal stem cell differentiation in a nonfavorable way regarding tendon regeneration; therefore, these medications should be used with more caution clinically.
Differentiation of human stem cells is promoted by amphiphilic pluronic block copolymers
Directory of Open Access Journals (Sweden)
Doğan A
2012-09-01
Full Text Available Aysegül Doğan,1 Mehmet E Yalvaç,1,2 Fikrettin Şahin,1 Alexander V Kabanov,3–5 András Palotás,6 Albert A Rizvanov71Department of Genetics and BioEngineering, College of Engineering and Architecture, Yeditepe University, Istanbul, Turkey; 2Center for Gene Therapy, Nationwide Children's Hospital, Ohio State University, Columbus, OH, USA; 3Center for Drug Delivery and Nanomedicine, 4Department of Pharmaceutical Sciences, College of Pharmacy, Durham Research Center, University of Nebraska Medical Center, Omaha, NE, USA; 5Laboratory of Chemical Design of Bio-nano-materials, Department of Chemistry, Mikhail V Lomonosov Moscow State University, Moscow, Russia; 6Asklepios-Med, Szeged, Hungary; 7Institute of Fundamental Medicine and Biology, Kazan (Volga Region Federal University, Kazan, RussiaAbstract: Stem cell usage provides novel avenues of tissue regeneration and therapeutics across disciplines. Apart from ethical considerations, the selection and amplification of donor stem cells remain a challenge. Various biopolymers with a wide range of properties have been used extensively to deliver biomolecules such as drugs, growth factors and nucleic acids, as well as to provide biomimetic surface for cellular adhesion. Using human tooth germ stem cells with high proliferation and transformation capacity, we have investigated a range of biopolymers to assess their potential for tissue engineering. Tolerability, toxicity, and their ability to direct differentiation were evaluated. The majority of pluronics, consisting of both hydrophilic and hydrophobic poly(ethylene oxide chains, either exerted cytotoxicity or had no significant effect on human tooth germ stem cells; whereas F68 increased the multi-potency of stem cells, and efficiently transformed them into osteogenic, chondrogenic, and adipogenic tissues. The data suggest that differentiation and maturation of stem cells can be promoted by selecting the appropriate mechanical and chemical
Hematopoietic differentiation: a coordinated dynamical process towards attractor stable states
Directory of Open Access Journals (Sweden)
Rossi Simona
2010-06-01
Full Text Available Abstract Background The differentiation process, proceeding from stem cells towards the different committed cell types, can be considered as a trajectory towards an attractor of a dynamical process. This view, taking into consideration the transcriptome and miRNome dynamics considered as a whole, instead of looking at few 'master genes' driving the system, offers a novel perspective on this phenomenon. We investigated the 'differentiation trajectories' of the hematopoietic system considering a genome-wide scenario. Results We developed serum-free liquid suspension unilineage cultures of cord blood (CB CD34+ hematopoietic progenitor cells through erythroid (E, megakaryocytic (MK, granulocytic (G and monocytic (Mo pathways. These cultures recapitulate physiological hematopoiesis, allowing the analysis of almost pure unilineage precursors starting from initial differentiation of HPCs until terminal maturation. By analyzing the expression profile of protein coding genes and microRNAs in unilineage CB E, MK, G and Mo cultures, at sequential stages of differentiation and maturation, we observed a coordinated, fully interconnected and scalable character of cell population behaviour in both transcriptome and miRNome spaces reminiscent of an attractor-like dynamics. MiRNome and transcriptome space differed for a still not terminally committed behaviour of microRNAs. Conclusions Consistent with their roles, the transcriptome system can be considered as the state space of a cell population, while the continuously evolving miRNA space corresponds to the tuning system necessary to reach the attractor. The behaviour of miRNA machinery could be of great relevance not only for the promise of reversing the differentiated state but even for tumor biology.
Directory of Open Access Journals (Sweden)
Jin Jiali
2011-07-01
Full Text Available Abstract Background Neural tissue has limited potential to self-renew after neurological damage. Cell therapy using BM-MSCs (bone marrow mesenchymal stromal cells seems like a promising approach for the treatment of neurological diseases. However, the neural differentiation of stem cells influenced by massive factors and interactions is not well studied at present. Results In this work, we isolated and identified MSCs from mouse bone marrow. Co-cultured with CART (0.4 nM for six days, BM-MSCs were differentiated into neuron-like cells by the observation of optical microscopy. Immunofluorescence demonstrated that the differentiated BM-MSCs expressed neural specific markers including MAP-2, Nestin, NeuN and GFAP. In addition, NeuN positive cells could co-localize with TH or ChAT by double-labled immunofluorescence and Nissl bodies were found in several differentiated cells by Nissl stain. Furthermore, BDNF and NGF were increased by CART using RT-PCR. Conclusion This study demonstrated that CART could promote the differentiation of BM-MSCs into neural cells through increasing neurofactors, including BNDF and NGF. Combined application of CART and BM-MSCs may be a promising cell-based therapy for neurological diseases.
Cysticerci drive dendritic cells to promote in vitro and in vivo Tregs differentiation.
Adalid-Peralta, Laura; Arce-Sillas, Asiel; Fragoso, Gladis; Cárdenas, Graciela; Rosetti, Marcos; Casanova-Hernández, Didier; Rangel-Escareño, Claudia; Uribe-Figueroa, Laura; Fleury, Agnes; Sciutto, Edda
2013-01-01
Regulatory T cells (Tregs) play a crucial role in immune homeostasis. Treg induction is a strategy that parasites have evolved to modulate the host's inflammatory environment, facilitating their establishment and permanence. In human Taenia solium neurocysticercosis (NC), the concurrence of increased peripheral and central Treg levels and their capacity to inhibit T cell activation and proliferation support their role in controlling neuroinflammation. This study is aimed at identifing possible mechanisms of Treg induction in human NC. Monocyte-derived dendritic cells (DC) from healthy human donors, cocultivated with autologous CD4(+) naïve cells either in the presence or absence of cysticerci, promoted CD25(high)Foxp3+ Treg differentiation. An increased Treg induction was observed when cysticerci were present. Moreover, an augmentation of suppressive-related molecules (SLAMF1, B7-H1, and CD205) was found in parasite-induced DC differentiation. Increased Tregs and a higher in vivo DC expression of the regulatory molecules SLAMF1 and CD205 in NC patients were also found. SLAMF1 gene was downregulated in NC patients with extraparenchymal cysticerci, exhibiting higher inflammation levels than patients with parenchymal parasites. Our findings suggest that cysticerci may modulate DC to favor a suppressive environment, which may help parasite establishment, minimizing the excessive inflammation, which may lead to tissue damage.
A new diarylheptanoid from Alpinia officinarum promotes the differentiation of 3T3-L1 preadipocytes.
Zhang, Xuguang; Zhang, Xiaopo; Wang, Yong; Chen, Feng; Li, Youbin; Li, Yonghui; Tan, Yinfeng; Gong, Jingwen; Zhong, Xia; Li, Hailong; Zhang, Junqing
2018-03-01
A new diarylheptanoid, namely trans-(4R,5S)-epoxy-1,7-diphenyl-3-heptanone (1), and a new natural product, 7-(4″-hydroxy-3″-methoxyphenyl)-1-phenyl-hepta-4E,6E-dien-3-one (2), were obtained from the aqueous extract of Alpinia officinarum Hance, together with three other diarylheptanoids, 5-hydroxy-1,7-diphenyl-3-heptanone (3), 1,7-diphenyl-4E-en-3-heptanone (4) and 5-methoxy-1,7-diphenyl-3-heptanone (5). The structures were characterised mainly by analysing their physical data including IR, NMR and HRMS. This study highlights that the 4,5-epoxy moiety in 1 is rarely seen in diarylheptanoids. In addition, the five isolates were tested for their differentiation activity of 3T3-L1 preadipocytes. The results showed that these compounds could dose-dependently promote adipocyte differentiation without cytotoxicity (IC 50 > 100 μM).
International Nuclear Information System (INIS)
Fujii, Tomomi; Shimada, Keiji; Tatsumi, Yoshihiro; Hatakeyama, Kinta; Obayashi, Chiho; Fujimoto, Kiyohide; Konishi, Noboru
2015-01-01
A new molecular marker of carcinoma in the urinary bladder is needed as a diagnostic tool or as a therapeutic target. Potential markers include microRNAs (miRNAs), which are short, low molecular weight RNAs 19–24 nt long that regulate genes associated with cell proliferation, differentiation, and development in various cancers. In this study, we investigated the molecular mechanisms by which miR-145 promotes survival of urothelial carcinoma cells and differentiation into multiple lineages. We found miR-145 to regulate expression of syndecan-1, a heparin sulfate proteoglycan. Cell proliferation in the human urothelial carcinoma cell lines T24 and KU7 was assessed by MTS assay. Cellular senescence and apoptosis were measured by senescence-associated β-galactosidase (SA-β-gal) and TUNEL assay, respectively. Quantitative RT-PCR was used to measure mRNA expression of various genes, including syndecan-1, stem cell factors, and markers of differentiation into squamous, glandular, or neuroendocrine cells. Overexpression of miR-145 induced cell senescence, and thus significantly inhibited cell proliferation in T24 and KU7 cells. Syndecan-1 expression diminished, whereas stem cell markers such as SOX2, NANOG, OCT4, and E2F3 increased. miR-145 also up-regulated markers of differentiation into squamous (p63, TP63, and CK5), glandular (MUC-1, MUC-2, and MUC-5 AC), and neuroendocrine cells (NSE and UCHL-1). Finally, expression of miR-145 was down-regulated in high-grade urothelial carcinomas, but not in low-grade tumors. Results indicate that miR-145 suppresses syndecan-1 and, by this mechanism, up-regulates stem cell factors and induces cell senescence and differentiation. We propose that miR-145 may confer stem cell-like properties on urothelial carcinoma cells and thus facilitate differentiation into multiple cell types. The online version of this article (doi:10.1186/s12885-015-1846-0) contains supplementary material, which is available to authorized users
Directory of Open Access Journals (Sweden)
Qian Zhao
Full Text Available Low magnitude high frequency vibration (LMHFV has been mainly reported for its influence on the musculoskeletal system, particularly the bone tissue. In the bone structure, osteogenic activity is the main focus of study with regards to LMHFV. However, adipogenesis, another important mode of differentiation in the bone marrow cavity that might be affected by LMHFV, is much less researched. Furthermore, the molecular mechanism of how LMHFV influences adipogenesis still needs to be understood. Here, we tested the effect of LMHFV (0.3g, 40 Hz, amplitude: 50μm, 15min/d, on multipotent stem cells (MSCs, which are the common progenitors of osteogenic, chondrogenic, adipogenic and myogenic cells. It is previously shown that LMHFV promotes osteogenesis of MSCs. In this study, we further revealed its effect on adipo-differentiation of bone marrow stem cells (BMSCs and studied the underlying signaling pathway. We found that when treated with LMHFV, the cells showed a higher expression of PPARγ, C/EBPα, adiponectin and showed more oil droplets. After vibration, the protein expression of PPARγ increased, and the phosphorylation of p38 MAPK was enhanced. After treating cells with SB203580, a specific p38 inhibitor, both the protein level of PPARγ illustrated by immunofluorescent staining and the oil droplets number, were decreased. Altogether, this indicates that p38 MAPK is activated during adipogenesis of BMSCs, and this is promoted by LMHFV. Our results demonstrating that specific parameters of LMHFV promotes adipogenesis of MSCs and enhances osteogenesis, highlights an unbeneficial side effect of vibration therapy used for preventing obesity and osteoporosis.
International Nuclear Information System (INIS)
Kreja, Ludwika; Baltschukat, Klaus; Nothdurft, Wilhelm
1989-01-01
The radiosensitivity of the early erythroid progenitor cells (BFU-E) and the progenitor cells of the stroma (CFU-F) in canine bone marrow was studied under steady-state conditions by in vitro irradiation with 280 kV X-rays. The dose-effect relationship for colony formation was determined for BFU-E obtained from the iliac crest marrow, and for CFU-F in bone marrow collected from the iliac crest and the humerus of adult beagles. The BFU-E were adequately stimulated with serum from lethally irradiated dogs to obtain a source of BPA (burst-promoting activity). The BFU-E proved to be extremely radiosensitive, (the survival curve was exponential (D o 15.3 ± 1.8 cGY)). Buffy-coat leukocytes separated from bone marrow leukocytes obtained by aspiration were an optimum source of CFU-F. A curve was fitted to data obtained for CFU-F obtained from iliac crest or humerus, resulting in D o = 241 ± 38 cGY and an extrapolation number n = 1.38 ± 0.62 or D o = 261 ± 40 cGY and n = 1.04 ± 0.42, respectively. (author)
Hossain, Mohammad Motarab; Ray, Swapan Kumar
2014-10-01
Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.
Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong
2014-08-01
The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.
Kim, Jong Hyun; Kim, Hyung Woo; Cha, Kyoung Je; Han, Jiyou; Jang, Yu Jin; Kim, Dong Sung; Kim, Jong-Hoon
2016-03-22
Although previous studies suggest that nanotopographical features influence properties and behaviors of stem cells, only a few studies have attempted to derive clinically useful somatic cells from human pluripotent stem cells using nanopatterned surfaces. In the present study, we report that polystyrene nanopore-patterned surfaces significantly promote the pancreatic differentiation of human embryonic and induced pluripotent stem cells. We compared different diameters of nanopores and showed that 200 nm nanopore-patterned surfaces highly upregulated the expression of PDX1, a critical transcription factor for pancreatic development, leading to an approximately 3-fold increase in the percentage of differentiating PDX1(+) pancreatic progenitors compared with control flat surfaces. Furthermore, in the presence of biochemical factors, 200 nm nanopore-patterned surfaces profoundly enhanced the derivation of pancreatic endocrine cells producing insulin, glucagon, or somatostatin. We also demonstrate that nanopore-patterned surface-induced upregulation of PDX1 is associated with downregulation of TAZ, suggesting the potential role of TAZ in nanopore-patterned surface-mediated mechanotransduction. Our study suggests that appropriate cytokine treatments combined with nanotopographical stimulation could be a powerful tool for deriving a high purity of desired cells from human pluripotent stem cells.
Pei, Ming; Chen, Demeng; Li, Jingting; Wei, Lei
2009-12-01
The transforming growth factor-beta (TGF-beta) superfamily members play diverse roles in cartilage development and maintenance. TGF-beta up-regulates chondrogenic gene expression by enhancing transcription factor SRY (sex determining region Y)-box 9 (Sox9) and inhibits osteoblast differentiation by repressing runt-related transcription factor 2 (Runx2). Recently, histone deacetylases (HDACs) were reported to act as negative regulators of chondrocyte hypertrophy. It was speculated that HDAC4 may promote TGF-beta1-induced MSC chondrogenesis. In this study, the adenovirus-mediated HDAC4 gene (Ad.HDAC4) was utilized to infect synovium-derived stem cells (SDSCs). Adenovirus-mediated LacZ (Ad.LacZ) served as a control. The infected cells were centrifuged to form SDSC pellets followed by incubation in a serum-free chondrogenic medium for 15 days with or without 10ng/mL TGF-beta1. Transfection efficiency was determined in SDSCs using Ad.LacZ. Cytotoxicity was measured using lactate dehydrogenase assay. Histology, immunostaining, biochemical analysis, and real-time polymerase chain reaction were performed to assess chondrogenesis at protein and mRNA levels in infected SDSCs. Our data demonstrated that supplementation with TGF-beta1 could initiate and promote SDSC chondrogenesis; however, TGF-beta1 alone was insufficient to fully differentiate SDSCs into chondrocytes. Ad.HDAC4 could be efficiently transfected into SDSCs. Without TGF-beta1 treatment, HDAC4 had no effect on SDSC chondrogenesis; however, in the presence of TGF-beta1, HDAC4 could speed up and maintain a high level of chondrogenesis while down-regulating the hypertrophic marker - type X collagen expression. This study is the first report showing that HDAC4 overexpression promotes TGF-beta1-induced SDSC chondrogenesis but inhibits chondrogenically differentiated stem cell hypertrophy. The mechanism underlying this process needs further investigation.
Unexpected macrophage-independent dyserythropoiesis in Gaucher disease.
Reihani, Nelly; Arlet, Jean-Benoit; Dussiot, Michael; de Villemeur, Thierry Billette; Belmatoug, Nadia; Rose, Christian; Colin-Aronovicz, Yves; Hermine, Olivier; Le Van Kim, Caroline; Franco, Melanie
2016-12-01
Gaucher disease is a rare inherited disease caused by a deficiency in glucocerebrosidase leading to lipid accumulation in cells of mononuclear-macrophage lineage known as Gaucher cells. Visceral enlargement, bone involvement, mild anemia and thrombocytopenia are the major manifestations of Gaucher disease. We have previously demonstrated that the red blood cells from patients exhibit abnormal properties, which indicates a new role in Gaucher disease pathophysiology. To investigate whether erythroid progenitors are affected, we examined the in vitro erythropoiesis from the peripheral CD34 + cells of patients and controls. CD34- cells were differentiated into macrophages and co-cultivated with erythroblasts. We showed an accelerated differentiation of erythroid progenitors without maturation arrest from patients compared to controls. This abnormal differentiation persisted in the patients when the same experiments were performed without macrophages, which strongly suggested that dyserythropoiesis in Gaucher disease is secondary to an inherent defect in the erythroid progenitors. The accelerated differentiation was associated with reduced cell proliferation. As a result, less mature erythroid cells were generated in vitro in the Gaucher disease cultures compared to the control. We then compared the biological characteristics of untreated patients according to their anemic status. Compared to the non-anemic group, the anemic patients exhibit higher plasma levels of growth differentiation factor-15, a marker of ineffective erythropoiesis, but they had no indicators of hemolysis and similar reticulocyte counts. Taken together, these results demonstrated an unsuspected dyserythropoiesis that was independent of the macrophages and could participate, at least in part, to the basis of anemia in Gaucher disease. Copyright© Ferrata Storti Foundation.
Lin, Jinpiao; Zhou, Zhou; Huo, Rongfen; Xiao, Lianbo; Ouyang, Guilin; Wang, Li; Sun, Yue; Shen, Baihua; Li, Dangsheng; Li, Ningli
2012-06-01
Cysteine-rich protein 61 (Cyr61)/CCN1 is a product of an immediate early gene and functions in mediating cell adhesion and inducing cell migration. We previously showed that increased production of Cyr61 by fibroblast-like synoviocytes (FLS) in rheumatoid arthritis (RA) promotes FLS proliferation and participates in RA pathogenesis with the IL-17-dependent pathway. However, whether Cyr61 in turn regulates Th17 cell differentiation and further enhances inflammation of RA remained unknown. In the current study, we explored the potential role of Cyr61 as a proinflammatory factor in RA pathogenesis. We found that Cyr61 treatment dramatically induced IL-6 production in FLS isolated from RA patients. Moreover, IL-6 production was attenuated by Cyr61 knockdown in FLS. Mechanistically, we showed that Cyr61 activated IL-6 production via the αvβ5/Akt/NF-κB signaling pathway. Further, using a coculture system consisting of purified CD4(+) T cells and RA FLS, we found that RA FLS stimulated Th17 differentiation, and the pro-Th17 differentiation effect of RA FLS can be attenuated or stimulated by Cyr61 RNA interference or addition of exogenous Cyr61, respectively. Finally, using the collagen-induced arthritis animal model, we showed that treatment with the anti-Cyr61 mAb led to reduction of IL-6 levels, decrease of Th17 response, and attenuation of inflammation and disease progression in vivo. Taken together, our results reveal a novel role of Cyr61 in promoting Th17 development in RA via upregulation of IL-6 production by FLS, thus adding a new layer into the functional interplay between FLS and Th17 in RA pathogenesis. Our study also suggests that targeting of Cyr61 may represent a novel strategy in RA treatment.
Scholl, Annika; Sassenrath, Claudia; Sassenberg, Kai
2015-01-01
Depending on their motivation, individuals prefer different group contexts for social interactions. The present research sought to provide more insight into this relationship. More specifically, we tested how challenge/threat and a promotion/prevention focus predict attraction to groups with high- or low-power. As such, we examined differential outcomes of threat and prevention focus as well as challenge and promotion focus that have often been regarded as closely related. According to regulatory focus, individuals should prefer groups that they expect to “feel right” for them to join: Low-power groups should be more attractive in a prevention (than a promotion) focus, as these groups suggest security-oriented strategies, which fit a prevention focus. High-power groups should be more attractive in a promotion (rather than a prevention) focus, as these groups are associated with promotion strategies fitting a promotion focus (Sassenberg et al., 2007). In contrast, under threat (vs. challenge), groups that allow individuals to restore their (perceived) lack of control should be preferred: Low-power groups should be less attractive under threat (than challenge) because they provide low resources which threatened individuals already perceive as insufficient and high-power groups might be more attractive under threat (than under challenge), because their high resources allow individuals to restore control. Two experiments (N = 140) supported these predictions. The attractiveness of a group often depends on the motivation to engage in what fits (i.e., prefer a group that feels right in the light of one’s regulatory focus). However, under threat the striving to restore control (i.e., prefer a group allowing them to change the status quo under threat vs. challenge) overrides the fit effect, which may in turn guide individuals’ behavior in social interactions. PMID:25904887
Essential and Unexpected Role of YY1 to Promote Mesodermal Cardiac Differentiation
Gregoire, Serge; Karra, Ravi; Passer, Derek; Deutsch, Marcus-Andre; Krane, Markus; Feistritzer, Rebecca; Sturzu, Anthony; Domian, Ibrahim; Saga, Yumiko; Wu, Sean M.
2013-01-01
Rational Cardiogenesis is regulated by a complex interplay between transcription factors. However, little is known about how these interactions regulate the transition from mesodermal precursors to cardiac progenitor cells (CPCs). Objective To identify novel regulators of mesodermal cardiac lineage commitment. Methods and Results We performed a bioinformatic-based transcription factor binding site analysis on upstream promoter regions of genes that are enriched in embryonic stem cell (ESC)-derived CPCs. From 32 candidate transcription factors screened, we found that YY1, a repressor of sarcomeric gene expression, is present in CPCs in vivo. Interestingly, we uncovered the ability of YY1 to transcriptionally activate Nkx2.5, a key marker of early cardiogenic commitment. YY1 regulates Nkx2.5 expression via a 2.1 kb cardiac-specific enhancer as demonstrated by in vitro luciferase-based assays and in vivo chromatin immunoprecipitation (ChIP) and genome-wide sequencing analysis. Furthermore, the ability of YY1 to activate Nkx2.5 expression depends on its cooperative interaction with Gata4 at a nearby chromatin. Cardiac mesoderm-specific loss-of-function of YY1 resulted in early embryonic lethality. This was corroborated in vitro by ESC-based assays where we show that the overexpression of YY1 enhanced the cardiogenic differentiation of ESCs into CPCs. Conclusion These results demonstrate an essential and unexpected role for YY1 to promote cardiogenesis as a transcriptional activator of Nkx2.5 and other CPC-enriched genes. PMID:23307821
Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong
2018-03-01
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.
Ghaderi, Shima; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Davari, Maliheh; Jahromi, Fatemeh Sanie; Samie, Shahram; Rezaie-Kanavi, Mozhgan; Pakravesh, Jalil; Deezagi, Abdolkhalegh
2011-09-01
To evaluate the effect of human amniotic fluid (HAF) on retinal pigmented epithelial cells growth and trans-differentiation into retinal neurons, retinal pigmented epithelium (RPE) cells were isolated from neonatal human cadaver eye globes and cultured in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal bovine serum (FBS). Confluent monolayer cultures were trypsinized and passaged using FBS-containing or HAF-containing media. Amniotic fluid samples were received from pregnant women in the first trimester of gestation. Cell proliferation and death enzyme-linked immunosorbent assays were performed to assess the effect of HAF on RPE cell growth. Trans-differentiation into rod photoreceptors and retinal ganglion cells was also studied using immunocytochemistry and real-time polymerase chain reaction techniques. Primary cultures of RPE cells were successfully established under FBS-containing or HAF-containing media leading to rapid cell growth and proliferation. When RPE cells were moved to in vitro culture system, they began to lose their differentiation markers such as pigmentation and RPE65 marker and trans-differentiated neural-like cells followed by spheroid colonies pertaining to stem/progenitor cells were morphologically detected. Immunocytochemistry (ICC) analysis of HAF-treated cultures showed a considerable expression of Rhodopsin gene (30% Rhodopsin-positive cells) indicating trans-differentiation of RPE cells to rod photoreceptors. Real-time polymerase chain reaction revealed an HAF-dose-dependant expression of Thy-1 gene (RGC marker) and significant promoting effect of HAF on RGCs generation. The data presented here suggest that HAF possesses invaluable stimulatory effect on RPE cells growth and trans-differentiation into retinal neurons. It can be regarded as a newly introduced enriched supplement in serum-free kinds of media used in neuro-retinal regeneration studies.
Energy Technology Data Exchange (ETDEWEB)
Takemura, Kenichi [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan); Department of Orthopaedic and Neuro-Musculoskeletal Surgery, Graduate School of Medical Sciences, Kumamoto University, Kumamoto (Japan); Sakashita, Naomi; Fujiwara, Yukio; Komohara, Yoshihiro; Lei, XiaoFeng; Ohnishi, Koji [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan); Suzuki, Hiroshi [National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Hokkaido (Japan); Kodama, Tatsuhiko [Department of Molecular Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo (Japan); Mizuta, Hiroshi [Department of Orthopaedic and Neuro-Musculoskeletal Surgery, Graduate School of Medical Sciences, Kumamoto University, Kumamoto (Japan); Takeya, Motohiro, E-mail: takeya@kumamoto-u.ac.jp [Department of Cell Pathology, Graduate School of Medical Sciences, Kumamoto University, 1-1-1 Honjo, Kumamoto 860-8556 (Japan)
2010-01-22
Osteoclasts originate from bone marrow monocyte/macrophage lineage cells, and their differentiation depends on macrophage colony-stimulating factor (M-CSF) and receptor activator nuclear factor kappa B (RANK) ligand. Class A scavenger receptor (SR-A) is one of the principal functional molecules of macrophages, and its level of expression declines during osteoclast differentiation. To investigate the role of SR-A in osteoclastogenesis, we examined pathological changes in femoral bone and the expression levels of osteoclastogenesis-related molecules in SR-A{sup -/-} mice. The femoral osseous density of SR-A{sup -/-} mice was higher than that of SR-A{sup +/+} mice, and the number of multinucleated osteoclasts was significantly decreased. An in vitro differentiation assay revealed that the differentiation of multinucleated osteoclasts from bone marrow-derived progenitor cells is impaired in SR-A{sup -/-} mice. Elimination of SR-A did not alter the expression level of the M-CSF receptor, c-fms; however, the expression levels of RANK and RANK-related osteoclast-differentiation molecules such as nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1 (NFATc1) and microphthalmia-associated transcription factor (MITF) significantly decreased. Furthermore, acetylated low-density lipoprotein (AcLDL), an SR-A ligand, significantly increased the expression level of RANK and MITF during osteoclast differentiation. These data indicate that SR-A promotes osteoclastogenesis via augmentation of the expression level of RANK and its related molecules.
Directory of Open Access Journals (Sweden)
Xiao Feng
2015-01-01
inhibited by the ERK1/2-specific inhibitor U0126. Conclusions: RIP140 overexpression promotes N2a cell neuronal differentiation by activating the ERK1/2 pathway.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Cunzhen; Chen, Xiaochang; Wu, Wenjing; Wang, Wusu; Pang, Weijun; Yang, Gongshe, E-mail: gsyang999@hotmail.com
2016-05-15
Intramuscular fat (IMF) has been demonstrated as one of the crucial factors of livestock meat quality. The MAT2B protein with MAT2α catalyzes the formation of methyl donor S- adenosylmethionine (SAMe) to mediate cell metabolism including proliferation and apoptosis. However, the regulatory effect of MAT2B on IMF deposition is still unclear. In this study, the effect of MAT2B on adipogenesis and its potential mechanism during porcine intramuscular preadipocyte differentiation was studied. The results showed that overexpression of MAT2B promoted adipogenesis and significantly up-regulated the mRNA and protein levels of adipogenic marker genes including FASN, PPARγ and aP2, consistently, knockdown of MAT2B inhibited lipid accumulation and down-regulated the mRNA and protein levels of the above genes. Furthermore, flow cytometry and EdU-labeling assay indicated that MAT2B regulate adipogenesis was partly due to influence intracellular SAMe levels and further affect cell clonal expansion. Also, increased expression of MAT2B activated the phosphorylations of AKT and ERK1/2, whereas knockdown of MAT2B blocked AKT signaling and repressed the phosphorylation of ERK1/2. Moreover, the inhibitory effect of LY294002 (a specific PI3K inhibitor) on the activities of AKT and ERK1/2 was partially recovered by overexpression of MAT2B in porcine intramuscular adipocytes. Finally, Co-IP experiments showed that MAT2B can directly interact with AKT. Taken together, our findings suggested that MAT2B acted as a positive regulator through modifying SAMe levels as well as activating AKT/ERK signaling pathway to promote porcine intramuscular adipocyte differentiation. - Highlights: • MAT2B up-regulates the expression of adipogenic marker genes and promotes porcine intramuscular preadipocyte differentiation. • MAT2B influences intracellular SAMe levels and further affects cell clonal expansion. • MAT2B interacts with AKT and activates AKT/ERK signaling pathway.
Cysticerci Drive Dendritic Cells to Promote In Vitro and In Vivo Tregs Differentiation
Directory of Open Access Journals (Sweden)
Laura Adalid-Peralta
2013-01-01
Full Text Available Regulatory T cells (Tregs play a crucial role in immune homeostasis. Treg induction is a strategy that parasites have evolved to modulate the host’s inflammatory environment, facilitating their establishment and permanence. In human Taenia solium neurocysticercosis (NC, the concurrence of increased peripheral and central Treg levels and their capacity to inhibit T cell activation and proliferation support their role in controlling neuroinflammation. This study is aimed at identifing possible mechanisms of Treg induction in human NC. Monocyte-derived dendritic cells (DC from healthy human donors, cocultivated with autologous CD4+ naïve cells either in the presence or absence of cysticerci, promoted CD25highFoxp3+ Treg differentiation. An increased Treg induction was observed when cysticerci were present. Moreover, an augmentation of suppressive-related molecules (SLAMF1, B7-H1, and CD205 was found in parasite-induced DC differentiation. Increased Tregs and a higher in vivo DC expression of the regulatory molecules SLAMF1 and CD205 in NC patients were also found. SLAMF1 gene was downregulated in NC patients with extraparenchymal cysticerci, exhibiting higher inflammation levels than patients with parenchymal parasites. Our findings suggest that cysticerci may modulate DC to favor a suppressive environment, which may help parasite establishment, minimizing the excessive inflammation, which may lead to tissue damage.
Park, Joo-Hung; Lee, Jeong-Min; Lee, Eun-Jin; Kim, Da-Jeong; Hwang, Won-Bhin
2018-04-01
Various amino acids regulate cell growth and differentiation. In the present study, we examined the ability of HT-29 cells to differentiate into goblet cells in RPMI and DMEM which are largely different in the amounts of numerous amino acids. Most of the HT-29 cells differentiated into goblet cells downregulating the stem cell marker Lgr5 when cultured in DMEM, but remained undifferentiated in RPMI. The goblet cell differentiation in DMEM was inhibited by 1-methyl-tryptophan (1-MT), an inhibitor of indoleamine 2,3 dioxygenase-1 which is the initial enzyme in tryptophan metabolism along the kynurenine (KN) pathway, whereas tryptophan and KN induced goblet cell differentiation in RPMI. The levels of Notch1 and its activation product Notch intracytoplasmic domain in HT-29 cells were lower in DMEM than those in RPMI and were increased by 1-MT in both media. HT-29 cells grown in both media expressed β-catenin at the same level on day 2 when goblet cell differentiation was not observed. β-catenin expression, which was increased by 1-MT in both media, was decreased by KN. DMEM reduced Hes1 expression while enhancing Hath1 expression. Finally, aryl hydrocarbon receptor (AhR) activation moderately induced goblet cell differentiation. Our results suggest that KN promotes goblet cell differentiation by regulating Wnt, Notch, and AhR signals and expression of Hes1 and Hath1.
Apolipoprotein E promotes lipid accumulation and differentiation in human adipocytes
Energy Technology Data Exchange (ETDEWEB)
Lasrich, Dorothee; Bartelt, Alexander [Department of Biochemistry and Molecular Cell Biology, University Medical Center Hamburg-Eppendorf, Martinistr. 52, 20246 Hamburg (Germany); Grewal, Thomas, E-mail: thomas.grewal@sydney.edu.au [Faculty of Pharmacy A15, The University of Sydney, Sydney, NSW 2006 (Australia); Heeren, Joerg, E-mail: heeren@uke.de [Department of Biochemistry and Molecular Cell Biology, University Medical Center Hamburg-Eppendorf, Martinistr. 52, 20246 Hamburg (Germany)
2015-09-10
Several studies in mice indicate a role for apolipoprotein E (APOE) in lipid accumulation and adipogenic differentiation in adipose tissue. However, little is yet known if APOE functions in a similar manner in human adipocytes. This prompted us to compare lipid loading and expression of adipocyte differentiation markers in APOE-deficient and control adipocytes using the differentiated human mesenchymal stem cell line hMSC-Tert as well as primary human and mouse adipocytes as model systems. Differentiated hMSC-Tert were stably transduced with or without siRNA targeting APOE while murine adipocytes were isolated from wild type and Apoe knockout mice. Human APOE knockdown hMSC-Tert adipocytes accumulated markedly less triglycerides compared to control cells. This correlated with strongly decreased gene expression levels of adipocyte markers such as adiponectin (ADIPOQ) and fatty acid binding protein 4 (FABP4) as well as the key transcription factor driving adipocyte differentiation, peroxisome proliferator activator receptor gamma (PPARG), in particular the PPARG2 isoform. Similarly, differentiation of murine Apoe-deficient adipocytes was characterized by reduced gene expression of Adipoq, Fabp4 and Pparg. Interestingly, incubation of APOE-deficient hMSC-Tert adipocytes with conditioned media from APOE3-overexpressing adipocytes or APOE-containing Very Low Density Lipoprotein (VLDL) partially restored triglyceride accumulation, but were unable to induce adipocyte differentiation, as judged by expression of adipocyte markers. Taken together, depletion of endogenous APOE in human adipocytes severely impairs lipid accumulation, which is associated with an inability to initiate differentiation. - Highlights: • Immortalized human mesenchymal stem cells were used to study adipocyte development. • Knockdown of endogenous APOE lead to impaired lipid accumulation and adipogenesis. • APOE supplementation partially restored lipid accumulation but not differentiation.
Directory of Open Access Journals (Sweden)
Takeshi Takarada
Full Text Available BACKGROUND: Neural progenitor is a generic term used for undifferentiated cell populations of neural stem, neuronal progenitor and glial progenitor cells with abilities for proliferation and differentiation. We have shown functional expression of ionotropic N-methyl-D-aspartate (NMDA and gamma-aminobutyrate type-A receptors endowed to positively and negatively regulate subsequent neuronal differentiation in undifferentiated neural progenitors, respectively. In this study, we attempted to evaluate the possible functional expression of nicotinic acetylcholine receptor (nAChR by undifferentiated neural progenitors prepared from neocortex of embryonic rodent brains. METHODOLOGY/PRINCIPAL FINDINGS: Reverse transcription polymerase chain reaction analysis revealed mRNA expression of particular nAChR subunits in undifferentiated rat and mouse progenitors prepared before and after the culture with epidermal growth factor under floating conditions. Sustained exposure to nicotine significantly inhibited the formation of neurospheres composed of clustered proliferating cells and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide reduction activity at a concentration range of 1 µM to 1 mM without affecting cell survival. In these rodent progenitors previously exposed to nicotine, marked promotion was invariably seen for subsequent differentiation into cells immunoreactive for a neuronal marker protein following the culture of dispersed cells under adherent conditions. Both effects of nicotine were significantly prevented by the heteromeric α4β2 nAChR subtype antagonists dihydro-β-erythroidine and 4-(5-ethoxy-3-pyridinyl-N-methyl-(3E-3-buten-1-amine, but not by the homomeric α7 nAChR subtype antagonist methyllycaconitine, in murine progenitors. Sustained exposure to nicotine preferentially increased the expression of Math1 among different basic helix-loop-helix proneural genes examined. In undifferentiated progenitors from embryonic mice
An Alu-like RNA promotes cell differentiation and reduces malignancy of human neuroblastoma cells.
Castelnuovo, Manuele; Massone, Sara; Tasso, Roberta; Fiorino, Gloria; Gatti, Monica; Robello, Mauro; Gatta, Elena; Berger, Audrey; Strub, Katharina; Florio, Tullio; Dieci, Giorgio; Cancedda, Ranieri; Pagano, Aldo
2010-10-01
Neuroblastoma (NB) is a pediatric cancer characterized by remarkable cell heterogeneity within the tumor nodules. Here, we demonstrate that the synthesis of a pol III-transcribed noncoding (nc) RNA (NDM29) strongly restricts NB development by promoting cell differentiation, a drop of malignancy processes, and a dramatic reduction of the tumor initiating cell (TIC) fraction in the NB cell population. Notably, the overexpression of NDM29 also confers to malignant NB cells an unpredicted susceptibility to the effects of antiblastic drugs used in NB therapy. Altogether, these results suggest the induction of NDM29 expression as possible treatment to increase cancer cells vulnerability to therapeutics and the measure of its synthesis in NB explants as prognostic factor of this cancer type.
Differential SLC1A2 Promoter Methylation in Bipolar Disorder With or Without Addiction
Directory of Open Access Journals (Sweden)
Yun-Fang Jia
2017-07-01
Full Text Available While downregulation of excitatory amino acid transporter 2 (EAAT2, the main transporter removing glutamate from the synapse, has been recognized in bipolar disorder (BD, the underlying mechanisms of downregulation have not been elucidated. BD is influenced by environmental factors, which may, via epigenetic modulation of gene expression, differentially affect illness presentation. This study thus focused on epigenetic DNA methylation regulation of SLC1A2, encoding for EAAT2, in BD with variable environmental influences of addiction. High resolution melting PCR (HRM-PCR and thymine–adenine (TA cloning with sequence analysis were conducted to examine methylation of the promoter region of the SLC1A2. DNA was isolated from blood samples drawn from BD patients (N = 150 with or without addiction to alcohol, nicotine, or food, defined as binge eating, and matched controls (N = 32. In comparison to controls, the SLC1A2 promoter region was hypermethylated in BD without addiction but was hypomethylated in BD with addiction. After adjusting for age and sex, the association of methylation levels with nicotine addiction (p = 0.0009 and binge eating (p = 0.0002 remained significant. Consistent with HRM-PCR, direct sequencing revealed increased methylation in CpG site 6 in BD, but decreased methylation in three CpG sites (6, 48, 156 in BD with alcohol and nicotine addictions. These results suggest that individual point methylation within the SLC1A2 promoter region may be modified by exogenous addiction and may have a potential for developing clinically valuable epigenetic biomarkers for BD diagnosis and monitoring.
Hasaneen, Nadia A; Cao, Jian; Pulkoski-Gross, Ashleigh; Zucker, Stanley; Foda, Hussein D
2016-02-17
Idiopathic pulmonary fibrosis (IPF) is a chronic progressively fatal disease. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN) is a glycosylated transmembrane protein that induces the expression of some matrix metalloproteinase (MMP) in neighboring stromal cells through direct epithelial-stromal interactions. EMMPRIN is highly expressed in type II alveolar epithelial cells at the edges of the fibrotic areas in IPF lung sections. However, the exact role of EMMPRIN in IPF is unknown. To determine if EMMPRIN contributes to lung fibroblast proliferation, resistance to apoptosis, and differentiation to myofibroblasts, normal Human lung fibroblasts (NHLF) transiently transfected with either EMMPRIN/GFP or GFP were treated with TGF- β1 from 0 to 10 ng/ml for 48 h and examined for cell proliferation (thymidine incorporation), apoptosis (FACS analysis and Cell Death Detection ELISA assay), cell migration (Modified Boyden chamber) and differentiation to myofibroblasts using Western blot for α-smooth actin of cell lysates. The effect of EMMPRIN inhibition on NHLF proliferation, apoptosis, migration and differentiation to myofibroblasts after TGF- β1 treatment was examined using EMMPRIN blocking antibody. We examined the mechanism by which EMMPRIN induces its effects on fibroblasts by studying the β-catenin/canonical Wnt signaling pathway using Wnt luciferase reporter assays and Western blot for total and phosphorylated β-catenin. Human lung fibroblasts overexpressing EMMPRIN had a significant increase in cell proliferation and migration compared to control fibroblasts. Furthermore, EMMPRIN promoted lung fibroblasts resistance to apoptosis. Lung fibroblasts overexpressing EMMPRIN showed a significantly increased expression of α- smooth muscle actin, a marker of differentiation to myofibroblasts compared to control cells. TGF-β1 increased the expression of EMMPRIN in lung fibroblasts in a dose-dependent manner. Attenuation of EMMPRIN expression with the use of an
Hydroxyurea inhibits parvovirus B19 replication in erythroid progenitor cells.
Bonvicini, Francesca; Bua, Gloria; Conti, Ilaria; Manaresi, Elisabetta; Gallinella, Giorgio
2017-07-15
Parvovirus B19 (B19V) infection is restricted to erythroid progenitor cells (EPCs) of the human bone marrow, leading to transient arrest of erythropoiesis and severe complications mainly in subjects with underlying hematological disorders or with immune system deficits. Currently, there are no specific antiviral drugs for B19V treatment, but identification of compounds inhibiting B19V replication can be pursued by a drug repositioning strategy. In this frame, the present study investigates the activity of hydroxyurea (HU), the only disease-modifying therapy approved for sickle cell disease (SCD), towards B19V replication in the two relevant cellular systems, the UT7/EpoS1 cell line and EPCs. Results demonstrate that HU inhibits B19V replication with EC 50 values of 96.2µM and 147.1µM in UT7/EpoS1 and EPCs, respectively, providing experimental evidence of the antiviral activity of HU towards B19V replication, and confirming the efficacy of a drug discovery process by drug repositioning strategy. The antiviral activity occurs in vitro at concentrations lower than those affecting cellular DNA replication and viability, and at levels measured in plasma samples of SCD patients undergoing HU therapy. HU might determine a dual beneficial effect on SCD patients, not only for the treatment of the disease but also towards a virus responsible for severe complications. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yao, Yingjia [School of Pharmacy, Liaoning University of Traditional Chinese Medicine, Dalian 116600 (China); Gao, Zhong [Department of Interventional Therapy, Dalian Municipal Central Hospital, Dalian 116033 (China); Liang, Wenbo [Medical College of Dalian University, Dalian 116600, Liaoning (China); Kong, Liang; Jiao, Yanan; Li, Shaoheng; Tao, Zhenyu; Yan, Yuhui [School of Pharmacy, Liaoning University of Traditional Chinese Medicine, Dalian 116600 (China); Yang, Jingxian, E-mail: jingxianyang@yahoo.com [School of Pharmacy, Liaoning University of Traditional Chinese Medicine, Dalian 116600 (China)
2015-12-15
Neurogenesis is the process by which neural stem cells (NSCs) proliferate and differentiate into neurons. This is diminished in several neurodegenerative disorders such as Alzheimer's disease (AD), which is characterized by the deposition of amyloid (A)β peptides and neuronal loss. Stimulating NSCs to replace lost neurons is therefore a promising approach for AD treatment. Our previous study demonstrated that osthole modulates NSC proliferation and differentiation, and may reduce Aβ protein expression in nerve cells. Here we investigated the mechanism underlying the effects of osthole on NSCs. We found that osthole enhances NSC proliferation and neuronal differentiation while suppressing apoptosis, effects that were exerted via activation of Wnt/β-catenin signaling. These results provide evidence that osthole can potentially be used as a therapeutic agent in the treatment of AD and other neurodegenerative disorders. - Highlights: • An Alzheimer's disease model was successfully established by transfecting APP gene into neural stem cells in vitro. • Roles of osthole in experimental AD cells were studied. • Osthole promotes proliferation and differentiation into neurons and inhibits accumulation of Aβ{sub 1–42} peptide and apoptosis. • Osthole exerts protection via Wnt/β-catenin signaling pathway.
International Nuclear Information System (INIS)
Yao, Yingjia; Gao, Zhong; Liang, Wenbo; Kong, Liang; Jiao, Yanan; Li, Shaoheng; Tao, Zhenyu; Yan, Yuhui; Yang, Jingxian
2015-01-01
Neurogenesis is the process by which neural stem cells (NSCs) proliferate and differentiate into neurons. This is diminished in several neurodegenerative disorders such as Alzheimer's disease (AD), which is characterized by the deposition of amyloid (A)β peptides and neuronal loss. Stimulating NSCs to replace lost neurons is therefore a promising approach for AD treatment. Our previous study demonstrated that osthole modulates NSC proliferation and differentiation, and may reduce Aβ protein expression in nerve cells. Here we investigated the mechanism underlying the effects of osthole on NSCs. We found that osthole enhances NSC proliferation and neuronal differentiation while suppressing apoptosis, effects that were exerted via activation of Wnt/β-catenin signaling. These results provide evidence that osthole can potentially be used as a therapeutic agent in the treatment of AD and other neurodegenerative disorders. - Highlights: • An Alzheimer's disease model was successfully established by transfecting APP gene into neural stem cells in vitro. • Roles of osthole in experimental AD cells were studied. • Osthole promotes proliferation and differentiation into neurons and inhibits accumulation of Aβ 1–42 peptide and apoptosis. • Osthole exerts protection via Wnt/β-catenin signaling pathway.
LDB1-mediated enhancer looping can be established independent of mediator and cohesin.
Krivega, Ivan; Dean, Ann
2017-08-21
Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Energy Technology Data Exchange (ETDEWEB)
Zhang Lingli; Fan Hongsong; Zhang Xingdong [National Engineering Research Center for Biomaterials, Sichuan University, Chengdu, Sichuan 610064 (China); Hanagata, Nobutaka; Ikoma, Toshiyuki [Biomaterials Center, National Institute for Materials Science, Tsukuba, Ibaraki 305-0047 (Japan); Maeda, Megumi; Minowa, Takashi, E-mail: HANAGATA.Nobutaka@nims.go.j [Nanotechnology Innovation Center, National Institute for Materials Science, Tsukuba, Ibaraki 305-0047 (Japan)
2009-04-15
Because calcium phosphate (Ca-P) ceramics have been used as bone substitutes, it is necessary to investigate what effects the ceramics have on osteoblast maturation. We prepared three types of Ca-P ceramics with different Ca-P ratios, i.e. hydroxyapatite (HA), beta-tricalcium phosphate ({beta}-TCP), and biphasic calcium phosphate (BCP) ceramics with dense-smooth and porous structures. Comprehensive gene expression microarray analysis of mouse osteoblast-like cells cultured on these ceramics revealed that porous Ca-P ceramics considerably affected the gene expression profiles, having a higher potential for osteoblast maturation. In the in vivo study that followed, porous Ca-P ceramics were implanted into rat skeletal muscle. Sixteen weeks after the implantation, more alkaline-phosphatase-positive cells were observed in the pores of hydroxyapatite and BCP, and the expression of the osteocalcin gene (an osteoblast-specific marker) in tissue grown in pores was also higher in hydroxyapatite and BCP than in {beta}-TCP. In the pores of any Ca-P ceramics, 16 weeks after the implantation, we detected the expressions of marker genes of the early differentiation stage of chondrocytes and the complete differentiation stage of adipocytes, which originate from mesenchymal stem cells, as well as osteoblasts. These marker gene expressions were not observed in the muscle tissue surrounding the implanted Ca-P ceramics. These observations indicate that porous hydroxyapatite and BCP had a greater potential for promoting the differentiation of mesenchymal stem cells into osteoblasts than {beta}-TCP.
Vera-Sánchez, Mar; Aznar-Cervantes, Salvador; Jover, Eva; García-Bernal, David; Oñate-Sánchez, Ricardo E; Hernández-Romero, Diana; Moraleda, Jose M; Collado-González, Mar; Rodríguez-Lozano, Francisco Javier; Cenis, Jose Luis
2016-11-15
Graphene represents one of the most interesting additions to the tissue engineering toolbox. Novel graphene-based composites are required to improve the beneficial graphene properties in terms of tridimensional polymeric structure, conferring a higher mechanical strength and favoring the differentiation of human mesenchymal stem cells. Here, we have demonstrated in a wide range of composite combinations, the successful use of graphene and silk-fibroin constructs for future bioengineering applications in the field of clinical regenerative dentistry using human periodontal ligament stem cells. Our results provide exciting new data for the development of suitable scaffolds that allow good cell engrafting, preservation of cell viability and proliferation, promotion of spontaneous osteoblastic differentiation, and importantly, stimulation of a higher cementum physiological synthesis than using other different available biomaterials.
[Clinical roles of vitamins in hematopoietic disorders].
Matsuda, M; Kanamaru, A
1999-10-01
Vitamins are essential organisms which promote various metabolisms and physiological systems. Several vitamins play important roles in hematopoietic system. Vitamin B12, C and folic acid are associated with DNA synthesis of erythroid nucleus, the deficiency of which causes the megaloblastic anemia. Some megaloblatic anemia and sideroblastic anemia might response to vitamin B1 and B6, respectively. Vitamin K participates in some coagulation factors in coagulation-fibrinogenolysis system. It has been reported that vitamins A, D and K potentially differentiate leukemic cells and then induce the apoptosis, suggesting that they would be new therapeutic agents in acute leukemia.
Aguilera, Valeria; Briceño, Luis; Contreras, Hector; Lamperti, Liliana; Sepúlveda, Esperanza; Díaz-Perez, Francisca; León, Marcelo; Veas, Carlos; Maura, Rafael; Toledo, Jorge Roberto; Fernández, Paulina; Covarrubias, Ambart; Zuñiga, Felipe Andrés; Radojkovic, Claudia; Escudero, Carlos; Aguayo, Claudio
2014-01-01
Mesenchymal stem cells have a high capacity for trans-differentiation toward many adult cell types, including endothelial cells. Feto-placental tissue, such as Wharton's jelly is a potential source of mesenchymal stem cells with low immunogenic capacity; make them an excellent source of progenitor cells with a potential use for tissue repair. We evaluated whether administration of endothelial cells derived from mesenchymal stem cells isolated from Wharton's jelly (hWMSCs) can accelerate tissue repair in vivo. Mesenchymal stem cells were isolated from human Wharton's jelly by digestion with collagenase type I. Endothelial trans-differentiation was induced for 14 (hWMSC-End14d) and 30 (hWMSC-End30d) days. Cell phenotyping was performed using mesenchymal (CD90, CD73, CD105) and endothelial (Tie-2, KDR, eNOS, ICAM-1) markers. Endothelial trans-differentiation was demonstrated by the expression of endothelial markers and their ability to synthesize nitric oxide (NO). hWMSCs can be differentiated into adipocytes, osteocytes, chondrocytes and endothelial cells. Moreover, these cells show high expression of CD73, CD90 and CD105 but low expression of endothelial markers prior to differentiation. hWMSCs-End express high levels of endothelial markers at 14 and 30 days of culture, and also they can synthesize NO. Injection of hWMSC-End30d in a mouse model of skin injury significantly accelerated wound healing compared with animals injected with undifferentiated hWMSC or injected with vehicle alone. These effects were also observed in animals that received conditioned media from hWMSC-End30d cultures. These results demonstrate that mesenchymal stem cells isolated from Wharton's jelly can be cultured in vitro and trans-differentiated into endothelial cells. Differentiated hWMSC-End may promote neovascularization and tissue repair in vivo through the secretion of soluble pro-angiogenic factors.
The Differentiation and Promotion of Students' Rights in Portugal
Veiga, Feliciano; Garcia, Fernando; Neto, Felix; Almeida, Leandro
2009-01-01
This investigation includes a differential study (Study 1) and a quasi-experimental research (Study 2). In Study 1, the objective was to establish to what extent students' rights existed and analyse the differentiation between students' rights with Portuguese and immigrant mothers, throughout school years. The sample consisted of 537 students with…
Tay, Christopher; Liu, Yu-Han; Kanellakis, Peter; Kallies, Axel; Li, Yi; Cao, Anh; Hosseini, Hamid; Tipping, Peter; Toh, Ban-Hock; Bobik, Alex; Kyaw, Tin
2018-05-01
B cells promote or protect development of atherosclerosis. In this study, we examined the role of MHCII (major histocompatibility II), CD40 (cluster of differentiation 40), and Blimp-1 (B-lymphocyte-induced maturation protein) expression by follicular B (FO B) cells in development of atherosclerosis together with the effects of IgG purified from atherosclerotic mice. Using mixed chimeric Ldlr -/- mice whose B cells are deficient in MHCII or CD40, we demonstrate that these molecules are critical for the proatherogenic actions of FO B cells. During development of atherosclerosis, these deficiencies affected T-B cell interactions, germinal center B cells, plasma cells, and IgG. As FO B cells differentiating into plasma cells require Blimp-1, we also assessed its role in the development of atherosclerosis. Blimp-1-deficient B cells greatly attenuated atherosclerosis and immunoglobulin-including IgG production, preventing IgG accumulation in atherosclerotic lesions; Blimp-1 deletion also attenuated lesion proinflammatory cytokines, apoptotic cell numbers, and necrotic core. To determine the importance of IgG for atherosclerosis, we purified IgG from atherosclerotic mice. Their transfer but not IgG from nonatherosclerotic mice into Ldlr -/- mice whose B cells are Blimp-1-deficient increased atherosclerosis; transfer was associated with IgG accumulating in atherosclerotic lesions, increased lesion inflammatory cytokines, apoptotic cell numbers, and necrotic core size. The mechanism by which FO B cells promote atherosclerosis is highly dependent on their expression of MHCII, CD40, and Blimp-1. FO B cell differentiation into IgG-producing plasma cells also is critical for their proatherogenic actions. Targeting B-T cell interactions and pathogenic IgG may provide novel therapeutic strategies to prevent atherosclerosis and its adverse cardiovascular complications. © 2018 American Heart Association, Inc.
The T-ALL related gene BCL11B regulates the initial stages of human T-cell differentiation.
Ha, V L; Luong, A; Li, F; Casero, D; Malvar, J; Kim, Y M; Bhatia, R; Crooks, G M; Parekh, C
2017-11-01
The initial stages of T-cell differentiation are characterized by a progressive commitment to the T-cell lineage, a process that involves the loss of alternative (myelo-erythroid, NK, B) lineage potentials. Aberrant differentiation during these stages can result in T-cell acute lymphoblastic leukemia (T-ALL). However, the mechanisms regulating the initial stages of human T-cell differentiation are obscure. Through loss of function studies, we showed BCL11B, a transcription factor recurrently mutated T-ALL, is essential for T-lineage commitment, particularly the repression of NK and myeloid potentials, and the induction of T-lineage genes, during the initial stages of human T-cell differentiation. In gain of function studies, BCL11B inhibited growth of and induced a T-lineage transcriptional program in T-ALL cells. We found previously unknown differentiation stage-specific DNA binding of BCL11B at multiple T-lineage genes; target genes showed BCL11B-dependent expression, suggesting a transcriptional activator role for BCL11B at these genes. Transcriptional analyses revealed differences in the regulatory actions of BCL11B between human and murine thymopoiesis. Our studies show BCL11B is a key regulator of the initial stages of human T-cell differentiation and delineate the BCL11B transcriptional program, enabling the dissection of the underpinnings of normal T-cell differentiation and providing a resource for understanding dysregulations in T-ALL.
Luo, Zuyuan; Deng, Yi; Zhang, Ranran; Wang, Mengke; Bai, Yanjie; Zhao, Qiang; Lyu, Yalin; Wei, Jie; Wei, Shicheng
2015-07-01
Combination of mesoporous silica materials and bioactive factors is a promising niche-mimetic solution as a hybrid bone substitution for bone tissue engineering. In this work, we have synthesized biocompatible silica-based nanoparticles with abundant mesoporous structure, and incorporated bone-forming peptide (BFP) derived from bone morphogenetic protein-7 (BMP-7) into the mesoporous silica nanoparticles (MSNs) to obtain a slow-release system for osteogenic factor delivery. The chemical characterization demonstrates that the small osteogenic peptide is encapsulated in the mesoporous successfully, and the nitrogen adsorption-desorption isotherms suggest that the peptide encapsulation has no influence on mesoporous structure of MSNs. In the cell experiment, the peptide-laden MSNs (p-MSNs) show higher MG-63 cell proliferation, spreading and alkaline phosphatase (ALP) activity than the bare MSNs, indicating good in vitro cytocompatibility. Simultaneously, the osteogenesis-related proteins expression and calcium mineral deposition disclose enhanced osteo-differentiation of human mesenchymal stem cells (hMSCs) under the stimulation of the p-MSNs, confirming that BFP released from MSNs could significantly promote the osteogenic differentiation of hMSCs, especially at 500μg/mL of p-MSNs concentration. The peptide-modified MSNs with better bioactivity and osteogenic differentiation make it a potential candidate as bioactive material for bone repairing, bone regeneration, and bio-implant coating applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Song, Juhyun; Kumar, Bokara Kiran; Kang, Somang; Park, Kyung Ah; Lee, Won Taek; Lee, Jong Eun
2013-12-01
Differentiation of neural progenitor cells (NPCs) is important for protecting neural cells and brain tissue during inflammation. Interleukin-1 beta (IL-1β) is the most common pro- inflammatory cytokine in brain inflammation, and increased IL-1β levels can decrease the proliferation of NPCs. We aimed to investigate whether agmatine (Agm), a primary polyamine that protects neural cells, could trigger differentiation of NPCs by activating IL-1β in vitro. The cortex of ICR mouse embryos (E14) was dissociated to culture NPCs. NPCs were stimulated by lipopolysaccharide (LPS). After 6 days, protein expression of stem cell markers and differentiation signal factors was confirmed by using western blot analysis. Also, immunocytochemistry was used to confirm the cell fate. Agm treatment activated NPC differentiation significantly more than in the control group, which was evident by the increased expression of a neuronal marker, MAP2, in the LPS-induced, Agm-treated group. Differentiation of LPS-induced, Agm-treated NPCs was regulated by the MAPK pathway and is thought to be related to IL-1β activation and decreased expression of TLX, a transcription factor that regulates NPC differentiation. Our results reveal that Agm can promote NPC differentiation to neural stem cells by modulating IL-1β expression under inflammatory condition, and they suggest that Agm may be a novel therapeutic strategy for neuroinflammatory diseases.
The onset of hemoglobin synthesis in spleens of irradiated mice after bone marrow transplantation
International Nuclear Information System (INIS)
Ponka, P.; Fuchs, O.; Borova, J.; Necas, E.
1977-01-01
Messenger RNA (mRNA) for globin was isolated from spleens of irradiated mice in which erythroid differentiation was induced by a bone marrow graft. The globin mRNA was isolated either by means of sucrose gradients of reticulocyte polysomal RNA or by affinity chromatography of total spleen RNA on poly (U)-sepharose. The globin mRNA was tested in a wheat embryo cell-free system. The appearance of mRNA in the spleen erythroid colonies was correlated with other parameters of erythroid differentiation such as globin synthesis, activity of delta-aminolevulinic acid synthetase and iron uptake. Poly(A) containing mRNA did appear already on the 3rd day after grafting. However, significant translational activity of globin mRNA could be demonstrated only one day later together with increase in globin synthesis and delta-aminolevulinic acid synthetase and enhanced iron uptake. In the second part of this study mouse spleen cells rich in erythroid elements were incubated with a specific heme synthesis inhibitor (isonicotinic acid hydrazide, INH) and the synthesis of 9 S RNA was estimated. It was found that a 40-minute incubation with INH reduced uridine incorporation into 9 S RNA fraction by about 40%. (author)
Tsuchiya, Shuhei; Sugimoto, Keisuke; Kamio, Hisanobu; Okabe, Kazuto; Kuroda, Kensuke; Okido, Masazumi; Hibi, Hideharu
2018-01-01
Surface modification of titanium dioxide (TiO 2 ) implants promotes bone formation and shortens the osseointegration period. Kaempferol is a flavonoid that has the capacity to promote osteogenic differentiation in bone marrow stromal cells. The aim of this study was to promote bone formation around kaempferol immobilized on TiO 2 implants. There were four experimental groups. Alkali-treated TiO 2 samples (implants and discs) were used as a control and immersed in Dulbecco's phosphate-buffered saline (DPBS) (Al-Ti). For the coprecipitation sample (Al-cK), the control samples were immersed in DPBS containing 50 µg kaempferol/100% ethanol. For the adsorption sample (Al-aK), 50 µg kaempferol/100% ethanol was dropped onto control samples. The surface topography of the TiO 2 implants was observed by scanning electron microscopy with energy-dispersive X-ray spectroscopy, and a release assay was performed. For in vitro experiments, rat bone marrow stromal cells (rBMSCs) were cultured on each of the TiO 2 samples to analyze cell proliferation, alkaline phosphatase activity, calcium deposition, and osteogenic differentiation. For in vivo experiments, TiO 2 implants placed on rat femur bones were analyzed for bone-implant contact by histological methods. Kaempferol was detected on the surface of Al-cK and Al-aK. The results of the in vitro study showed that rBMSCs cultured on Al-cK and Al-aK promoted alkaline phosphatase activity, calcium deposition, and osteogenic differentiation. The in vivo histological analysis revealed that Al-cK and Al-aK stimulated new bone formation around implants. TiO 2 implant-immobilized kaempferol may be an effective tool for bone regeneration around dental implants.
Liang, Li; Zhou, Wei; Yang, Nan; Yu, Jifeng; Liu, Hongchen
2016-01-01
Periodontitis is a kind of chronic inflammatory disease that affects the tooth-supporting tissues. ET-1 is related to periodontitis and involved in the regulation of cytokines, but the mechanisms remain unclear. The aim of this study is to investigate how ET-1 affects proinflammatory cytokine expression and differentiation in human periodontal ligament stem cells (PDLSCs). PDLSCs were isolated from the periodontal ligament tissues of periodontitis patients and then treated with ET-1 (1, 10, or 100 nM) for 12 h, 24 h, or 72 h. The osteogenic potential of PDLSCs was tested using ALP staining. TNF-α, IL-1β, and IL-6 levels were evaluated by ELISA and western blot. Runx2, OCN, and COL1 mRNA and western levels were detected by RT-PCR and western blot, respectively. To examine the signaling pathways and molecular mechanisms involved in ET-1-mediated cytokine expression and osteogenic differentiation, ETR pathway, MAPKs pathway, Wnt/β-catenin pathway, and Wnt/Ca2+ pathway were detected by RT-PCR and western blot, respectively. ET-1 promoted differentiation of PDLSCs into osteoblasts by increasing secretion of TNF-α, IL-1β, and IL-6 in a dose- and time-dependent manner. ET-1 also increased expression of Runx2, OCN, and COL1. ET-1 promotes differentiation of PDLSCs into osteoblasts through ETR, MAPK, and Wnt/β-catenin signaling pathways under inflammatory microenvironment. PMID:26884650
Directory of Open Access Journals (Sweden)
Li Liang
2016-01-01
Full Text Available Periodontitis is a kind of chronic inflammatory disease that affects the tooth-supporting tissues. ET-1 is related to periodontitis and involved in the regulation of cytokines, but the mechanisms remain unclear. The aim of this study is to investigate how ET-1 affects proinflammatory cytokine expression and differentiation in human periodontal ligament stem cells (PDLSCs. PDLSCs were isolated from the periodontal ligament tissues of periodontitis patients and then treated with ET-1 (1, 10, or 100 nM for 12 h, 24 h, or 72 h. The osteogenic potential of PDLSCs was tested using ALP staining. TNF-α, IL-1β, and IL-6 levels were evaluated by ELISA and western blot. Runx2, OCN, and COL1 mRNA and western levels were detected by RT-PCR and western blot, respectively. To examine the signaling pathways and molecular mechanisms involved in ET-1-mediated cytokine expression and osteogenic differentiation, ETR pathway, MAPKs pathway, Wnt/β-catenin pathway, and Wnt/Ca2+ pathway were detected by RT-PCR and western blot, respectively. ET-1 promoted differentiation of PDLSCs into osteoblasts by increasing secretion of TNF-α, IL-1β, and IL-6 in a dose- and time-dependent manner. ET-1 also increased expression of Runx2, OCN, and COL1. ET-1 promotes differentiation of PDLSCs into osteoblasts through ETR, MAPK, and Wnt/β-catenin signaling pathways under inflammatory microenvironment.
Xiao, Li; Ide, Ryoji; Saiki, Chikako; Kumazawa, Yasuo; Okamura, Hisashi
2017-08-11
The adult mammalian central nerve system has fundamental difficulties regarding effective neuroregeneration. The aim of this study is to investigate whether human dental pulp cells (DPCs) can promote neuroregeneration by (i) being differentiated toward neuronal cells and/or (ii) stimulating local neurogenesis in the adult hippocampus. Using immunostaining, we demonstrated that adult human dental pulp contains multipotent DPCs, including STRO-1, CD146 and P75-positive stem cells. DPC-formed spheroids were able to differentiate into neuronal, vascular, osteogenic and cartilaginous lineages under osteogenic induction. However, under neuronal inductive conditions, cells in the DPC-formed spheroids differentiated toward neuronal rather than other lineages. Electrophysiological study showed that these cells consistently exhibit the capacity to produce action potentials, suggesting that they have a functional feature in neuronal cells. We further co-cultivated DPCs with adult mouse hippocampal slices on matrigel in vitro. Immunostaining and presto blue assay showed that DPCs were able to stimulate the growth of neuronal cells (especially neurons) in both the CA1 zone and the edges of the hippocampal slices. Brain-derived neurotrophic factor (BDNF), was expressed in co-cultivated DPCs. In conclusion, our data demonstrated that DPCs are well-suited to differentiate into the neuronal lineage. They are able to stimulate neurogenesis in the adult mouse hippocampus through neurotrophic support in vitro.
Satué, María; Ramis, Joana M; Monjo, Marta
2016-01-01
Vitamin D metabolites are essential for bone regeneration and mineral homeostasis. The vitamin D precursor 7-dehydrocholesterol can be used after UV irradiation to locally produce active vitamin D by osteoblastic cells. Furthermore, UV-irradiated 7-dehydrocholesterol is a biocompatible coating for titanium implants with positive effects on osteoblast differentiation. In this study, we examined the impact of titanium implants surfaces coated with UV-irradiated 7-dehydrocholesterol on the osteogenic differentiation of human umbilical cord mesenchymal stem cells. First, the synthesis of cholecalciferol (D3) was achieved through the incubation of the UV-activated 7-dehydrocholesterol coating for 48 h at 23℃. Further, we investigated in vitro the biocompatibility of this coating in human umbilical cord mesenchymal stem cells and its potential to enhance their differentiation towards the osteogenic lineage. Human umbilical cord mesenchymal stem cells cultured onto UV-irradiated 7-dehydrocholesterol-coated titanium implants surfaces, combined with osteogenic supplements, upregulated the gene expression of several osteogenic markers and showed higher alkaline phosphatase activity and calcein blue staining, suggesting increased mineralization. Thus, our results show that the use of UV irradiation on 7-dehydrocholesterol -treated titanium implants surfaces generates a bioactive coating that promotes the osteogenic differentiation of human umbilical cord mesenchymal stem cells, with regenerative potential for improving osseointegration in titanium-based bone anchored implants. © The Author(s) 2015.
Transcriptional control of megakaryocyte development.
Goldfarb, A N
2007-10-15
Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.
Directory of Open Access Journals (Sweden)
Xiaohu Wang
2017-11-01
Full Text Available The molecular mechanisms that govern differential T cell development into pro-inflammatory Th17 vs. regulatory T (Treg cells remain unclear. Here, we show that selective deletion of CREB in T cells or Th17 cells impaired Th17 cell differentiation in vitro and in vivo, and led to resistance to autoimmune diseases. Mechanistically, CREB, activated by CD3-PKC-ϴ signaling, plays a key role in regulating Th17 cell differentiation, at least in part through directly binding to the Il17-Il17f gene locus. Unexpectedly, although dispensable for FOXP3 expression and for the homeostasis and suppressive function of thymus-derived Treg cells, CREB negatively regulates the survival of TGF-β-induced Treg cells, and deletion of CREB resulted in increased FOXP3+ Treg cells in the intestine and protection in a colitis model. Thus, CREB is critical in autoimmune diseases by promoting Th17 cell and inhibiting de novo Treg cell generation.
Wessely, O.; Mellitzer, G.; von Lindern, M.; Levitzki, A.; Gazit, A.; Ischenko, I.; Hayman, M. J.; Beug, H.
1997-01-01
In the bone marrow, multipotent and committed hematopoietic progenitors have to closely regulate their balance between sustained proliferation without differentiation (self renewal) and entering a terminal differentiation pathway. A useful model to analyze this regulation at the molecular level is
Directory of Open Access Journals (Sweden)
Takahiro Ishimoto
Full Text Available The aim of the present study is to clarify the functional expression and physiological role in neural progenitor cells (NPCs of carnitine/organic cation transporter OCTN1/SLC22A4, which accepts the naturally occurring food-derived antioxidant ergothioneine (ERGO as a substrate in vivo. Real-time PCR analysis revealed that mRNA expression of OCTN1 was much higher than that of other organic cation transporters in mouse cultured cortical NPCs. Immunocytochemical analysis showed colocalization of OCTN1 with the NPC marker nestin in cultured NPCs and mouse embryonic carcinoma P19 cells differentiated into neural progenitor-like cells (P19-NPCs. These cells exhibited time-dependent [(3H]ERGO uptake. These results demonstrate that OCTN1 is functionally expressed in murine NPCs. Cultured NPCs and P19-NPCs formed neurospheres from clusters of proliferating cells in a culture time-dependent manner. Exposure of cultured NPCs to ERGO or other antioxidants (edaravone and ascorbic acid led to a significant decrease in the area of neurospheres with concomitant elimination of intracellular reactive oxygen species. Transfection of P19-NPCs with small interfering RNA for OCTN1 markedly promoted formation of neurospheres with a concomitant decrease of [(3H]ERGO uptake. On the other hand, exposure of cultured NPCs to ERGO markedly increased the number of cells immunoreactive for the neuronal marker βIII-tubulin, but decreased the number immunoreactive for the astroglial marker glial fibrillary acidic protein (GFAP, with concomitant up-regulation of neuronal differentiation activator gene Math1. Interestingly, edaravone and ascorbic acid did not affect such differentiation of NPCs, in contrast to the case of proliferation. Knockdown of OCTN1 increased the number of cells immunoreactive for GFAP, but decreased the number immunoreactive for βIII-tubulin, with concomitant down-regulation of Math1 in P19-NPCs. Thus, OCTN1-mediated uptake of ERGO in NPCs inhibits
Wang, Tao; Ren, Xiaobao; Xiong, Jianqiong; Zhang, Lei; Qu, Jifu; Xu, Wenyue
2011-04-01
Spinal cord injury (SCI) remains a formidable challenge in the clinic. In the current study, we examined the effects of the TLX gene on the proliferation and neuronal differentiation of dermal multipotent stem cells (DMSCs) in vitro and the potential of these cells to improve SCI in rats in vivo. DMSCs were stably transfected with TLX-expressing plasmid (TLX/DMSCs). Cell proliferation was examined using the MTT assay, and neuronal differentiation was characterized by morphological observation combined with immunocytochemical/immunofluorescent staining. The in vivo functions of these cells were evaluated by transplantation into rats with SCI, followed by analysis of hindlimb locomotion and post-mortem histology. Compared to parental DMSCs, TLX/DMSCs showed enhanced proliferation and preferential differentiation into NF200-positive neurons in contrast to GFAP-positive astrocytes. When the undifferentiated cells were transplanted into rats with SCI injury, TLX/DMSCs led to significant improvement in locomotor recovery and healing of SCI, as evidenced by reduction in scar tissues and cavities, increase in continuous nerve fibers/axons and enrichment of NF200-positive neurons on the histological level. In conclusion, TLX promotes the proliferation and neuronal differentiation of DMSCs and thus, may serve as a promising therapy for SCI in the clinic.
International Nuclear Information System (INIS)
Einspenner, M.; Boulton, J.E.; Borsa, J.
1984-01-01
Differentiation of Friend erythroleukemia cells (FELC) was induced with 1.5% dimethyl sulfoxide (DMSO) in the culture medium. Cell growth, erythroid differentiation, and radiosensitivity of the proliferative capacity of the cells were measured and compared to a noninduced control culture of identical age. Induced cells first appeared on Day 2 after DMSO addition, and increased to a maximum of 80 to 90% of the cell population on Day 5, whereas in the control culture, induction was less than 2% of the cells. Radiosensitivity of the cells in the induced culture relative to that of cells in the control culture, showed an age-dependent variation. On days 1 and 2 after DMSO addition, the cells in the induced culture were less radiosensitive than those in the control culture. At later times, this relationship was reversed, and between days 3 and 5 the clonable cells in the induced culture were less radiosensitive than those in the control culture. These results suggest that the metabolic events associated with commitment of FELC to differentiate affect their ability to cope with the radiation-induced lesions underlying the loss of division capacity
Borax-Loaded PLLA for Promotion of Myogenic Differentiation.
Rico, Patricia; Rodrigo-Navarro, Aleixandre; Salmerón-Sánchez, Manuel
2015-11-01
Boron is an essential metalloid, which plays a key role in plant and animal metabolisms. It has been reported that boron is involved in bone mineralization, has some uses in synthetic chemistry, and its potential has been only recently exploited in medicinal chemistry. However, in the area of tissue engineering, the use of boron is limited to works involving certain bioactive glasses. In this study, we engineer poly(l-lactic acid) (PLLA) substrates with sustained release of boron. Then, we analyze for the first time the uniqueness effects of boron in cell differentiation using murine C2C12 myoblasts and discuss a potential mechanism of action in cooperation with Ca(2+). Our results demonstrate that borax-loaded materials strongly enhance myotube formation at initial steps of myogenesis. Furthermore, we demonstrate that Ca(2+) plays an essential role in combination with borax as chelating or blocking Ca(2+) entry into the cell leads to a detrimental effect on myoblast differentiation observed on borax-loaded materials. This research identifies borax-loaded materials to trigger differentiation mechanisms and it establishes a new tool to engineer microenvironments with applications in regenerative medicine for muscular diseases.
Liu, Yanli; Yang, Fen; Liang, Shengying; Liu, Qing; Fu, Sulei; Wang, Zhenyu; Yang, Ciqing; Lin, Juntang
2018-01-01
Peripheral nerve injuries are typically caused by either trauma or medical disorders, and recently, stem cell-based therapies have provided a promising treatment approach. Menstrual blood-derived endometrial stem cells (MenSCs) are considered an ideal therapeutic option for peripheral nerve repair due to a noninvasive collection procedure and their high proliferation rate and immunological tolerance. Here, we successfully isolated MenSCs and examined their biological characteristics including their morphology, multipotency, and immunophenotype. Subsequent in vitro studies demonstrated that MenSCs express high levels of neurotrophic factors, such as NT3, NT4, BDNF, and NGF, and are capable of transdifferentiating into glial-like cells under conventional induction conditions. Moreover, upregulation of N-cadherin (N-cad) mRNA and protein expression was observed after neurogenic differentiation. In vivo studies clearly showed that N-cad knockdown via in utero electroporation perturbed the migration and maturation of mouse neural precursor cells (NPCs). Finally, a further transfection assay also confirmed that N-cad upregulation in MenSCs results in the expression of S100. Collectively, our results confirmed the paracrine effect of MenSCs on neuroprotection as well as their potential for transdifferentiation into glial-like cells and demonstrated that N-cad upregulation promotes the neurogenic differentiation of MenSCs, thereby providing support for transgenic MenSC-based therapy for peripheral nerve injury.
Qing, Hua; Aono, Jun; Findeisen, Hannes M; Jones, Karrie L; Heywood, Elizabeth B; Bruemmer, Dennis
2016-06-01
Telomerase reverse transcriptase (TERT) maintains telomeres and is rate limiting for replicative life span. While most somatic tissues silence TERT transcription resulting in telomere shortening, cells derived from cancer or cardiovascular diseases express TERT and activate telomerase. In the present study, we demonstrate that histone deacetylase (HDAC) inhibition induces TERT transcription and promoter activation. At the protein level in contrast, HDAC inhibition decreases TERT protein abundance through enhanced degradation, which decreases telomerase activity and induces senescence. Finally, we demonstrate that HDAC inhibition decreases TERT expression during vascular remodeling in vivo. These data illustrate a differential regulation of TERT transcription and protein stability by HDAC inhibition and suggest that TERT may constitute an important target for the anti-proliferative efficacy of HDAC inhibitors. © 2015 Wiley Periodicals, Inc.
YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway
International Nuclear Information System (INIS)
Lin, Yi-Ting; Ding, Jing-Ya; Li, Ming-Yang; Yeh, Tien-Shun; Wang, Tsu-Wei; Yu, Jenn-Yah
2012-01-01
Tight regulation of cell numbers by controlling cell proliferation and apoptosis is important during development. Recently, the Hippo pathway has been shown to regulate tissue growth and organ size in Drosophila. In mammalian cells, it also affects cell proliferation and differentiation in various tissues, including the nervous system. Interplay of several signaling cascades, such as Notch, Wnt, and Sonic Hedgehog (Shh) pathways, control cell proliferation during neuronal differentiation. However, it remains unclear whether the Hippo pathway coordinates with other signaling cascades in regulating neuronal differentiation. Here, we used P19 cells, a mouse embryonic carcinoma cell line, as a model to study roles of YAP, a core component of the Hippo pathway, in neuronal differentiation. P19 cells can be induced to differentiate into neurons by expressing a neural bHLH transcription factor gene Ascl1. Our results showed that YAP promoted cell proliferation and inhibited neuronal differentiation. Expression of Yap activated Shh but not Wnt or Notch signaling activity during neuronal differentiation. Furthermore, expression of Yap increased the expression of Patched homolog 1 (Ptch1), a downstream target of the Shh signaling. Knockdown of Gli2, a transcription factor of the Shh pathway, promoted neuronal differentiation even when Yap was over-expressed. We further demonstrated that over-expression of Yap inhibited neuronal differentiation in primary mouse cortical progenitors and Gli2 knockdown rescued the differentiation defect in Yap over-expressing cells. In conclusion, our study reveals that Shh signaling acts downstream of YAP in regulating neuronal differentiation. -- Highlights: ► YAP promotes cell proliferation and inhibits neuronal differentiation in P19 cells. ► YAP promotes Sonic hedgehog signaling activity during neuronal differentiation. ► Knockdown of Gli2 rescues the Yap-overexpression phenotype in P19 cells. ► Knockdown of Gli2 rescues the Yap
YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway
Energy Technology Data Exchange (ETDEWEB)
Lin, Yi-Ting; Ding, Jing-Ya [Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei 112, Taiwan (China); Li, Ming-Yang [Department of Life Science, National Taiwan Normal University, Taipei 116, Taiwan (China); Yeh, Tien-Shun [Department of Anatomy and Cell Biology, National Yang-Ming University, Taipei 112, Taiwan (China); Wang, Tsu-Wei [Department of Life Science, National Taiwan Normal University, Taipei 116, Taiwan (China); Yu, Jenn-Yah [Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei 112, Taiwan (China); Brain Research Center, National Yang-Ming University, Taipei 112, Taiwan (China)
2012-09-10
Tight regulation of cell numbers by controlling cell proliferation and apoptosis is important during development. Recently, the Hippo pathway has been shown to regulate tissue growth and organ size in Drosophila. In mammalian cells, it also affects cell proliferation and differentiation in various tissues, including the nervous system. Interplay of several signaling cascades, such as Notch, Wnt, and Sonic Hedgehog (Shh) pathways, control cell proliferation during neuronal differentiation. However, it remains unclear whether the Hippo pathway coordinates with other signaling cascades in regulating neuronal differentiation. Here, we used P19 cells, a mouse embryonic carcinoma cell line, as a model to study roles of YAP, a core component of the Hippo pathway, in neuronal differentiation. P19 cells can be induced to differentiate into neurons by expressing a neural bHLH transcription factor gene Ascl1. Our results showed that YAP promoted cell proliferation and inhibited neuronal differentiation. Expression of Yap activated Shh but not Wnt or Notch signaling activity during neuronal differentiation. Furthermore, expression of Yap increased the expression of Patched homolog 1 (Ptch1), a downstream target of the Shh signaling. Knockdown of Gli2, a transcription factor of the Shh pathway, promoted neuronal differentiation even when Yap was over-expressed. We further demonstrated that over-expression of Yap inhibited neuronal differentiation in primary mouse cortical progenitors and Gli2 knockdown rescued the differentiation defect in Yap over-expressing cells. In conclusion, our study reveals that Shh signaling acts downstream of YAP in regulating neuronal differentiation. -- Highlights: Black-Right-Pointing-Pointer YAP promotes cell proliferation and inhibits neuronal differentiation in P19 cells. Black-Right-Pointing-Pointer YAP promotes Sonic hedgehog signaling activity during neuronal differentiation. Black-Right-Pointing-Pointer Knockdown of Gli2 rescues the Yap
Carrillo-García, Carmen; Prochnow, Sebastian; Simeonova, Ina K; Strelau, Jens; Hölzl-Wenig, Gabriele; Mandl, Claudia; Unsicker, Klaus; von Bohlen Und Halbach, Oliver; Ciccolini, Francesca
2014-02-01
The activation of epidermal growth factor receptor (EGFR) affects multiple aspects of neural precursor behaviour, including proliferation and migration. Telencephalic precursors acquire EGF responsiveness and upregulate EGFR expression at late stages of development. The events regulating this process and its significance are still unclear. We here show that in the developing and postnatal hippocampus (HP), growth/differentiation factor (GDF) 15 and EGFR are co-expressed in primitive precursors as well as in more differentiated cells. We also provide evidence that GDF15 promotes responsiveness to EGF and EGFR expression in hippocampal precursors through a mechanism that requires active CXC chemokine receptor (CXCR) 4. Besides EGFR expression, GDF15 ablation also leads to decreased proliferation and migration. In particular, lack of GDF15 impairs both processes in the cornu ammonis (CA) 1 and only proliferation in the dentate gyrus (DG). Importantly, migration and proliferation in the mutant HP were altered only perinatally, when EGFR expression was also affected. These data suggest that GDF15 regulates migration and proliferation by promoting EGFR signalling in the perinatal HP and represent a first description of a functional role for GDF15 in the developing telencephalon.
Yap, Jin Yan; Wirasinha, Rushika C; Chan, Anna; Howard, Debbie R; Goodnow, Christopher C; Daley, Stephen R
2018-02-07
Acquisition of T-cell central tolerance involves distinct pathways of self-antigen presentation to thymocytes. One pathway termed indirect presentation requires a self-antigen transfer step from thymic epithelial cells (TECs) to bone marrow-derived cells before the self-antigen is presented to thymocytes. The role of indirect presentation in central tolerance is context-dependent, potentially due to variation in self-antigen expression, processing and presentation in the thymus. Here, we report experiments in mice in which TECs expressed a membrane-bound transgenic self-antigen, hen egg lysozyme (HEL), from either the insulin (insHEL) or thyroglobulin (thyroHEL) promoter. Intrathymic HEL expression was less abundant and more confined to the medulla in insHEL mice compared with thyroHEL mice. When indirect presentation was impaired by generating mice lacking MHC class II expression in bone marrow-derived antigen-presenting cells, insHEL-mediated thymocyte deletion was abolished, whereas thyroHEL-mediated deletion occurred at a later stage of thymocyte development and Foxp3 + regulatory T-cell differentiation increased. Indirect presentation increased the strength of T-cell receptor signalling that both self-antigens induced in thymocytes, as assessed by Helios expression. Hence, indirect presentation limits the differentiation of naive and regulatory T cells by promoting deletion of self-reactive thymocytes. © 2018 John Wiley & Sons Ltd.
Mies, Anna; Platzbecker, Uwe
2017-07-01
Patients with lower-risk myelodysplastic syndromes (MDS) are mainly affected by chronic anemia and fatigue. Treatment strategies aim to improve anemia and quality of life, as well as iron overload due to red blood cell transfusion support. To promote proliferation and differentiation of erythropoiesis, erythropoiesis-stimulating agents (ESAs) such as erythropoietin (EPO) and mimetics are applied as first-line therapy in a large fraction of lower-risk MDS patients. In general, ESAs yield favorable responses in about half of the patients, although responses are often short-lived. In fact, many ESA-refractory patients harbor defects in late-stage erythropoiesis downstream of EPO action. Novel transforming growth factor (TGF)-β superfamily inhibitors sotatercept and luspatercept represent a promising approach to alleviate anemia by stimulating erythroid differentiation. Copyright © 2017 Elsevier Inc. All rights reserved.
Endo, Satoshi; Iwamoto, Kuninori; Fukuda, Hiroo
2018-02-01
Tissue-specific overexpression of useful genes, which we can design according to their cause-and-effect relationships, often gives valuable gain-of-function phenotypes. To develop genetic tools in woody biomass engineering, we produced a collection of Arabidopsis lines that possess chimeric genes of a promoter of an early xylem differentiation stage-specific gene, Arabidopsis Tracheary Element Differentiation-related 4 (AtTED4) and late xylem development-associated genes, many of which are uncharacterized. The AtTED4 promoter directed the expected expression of transgenes in developing vascular tissues from young to mature stage. Of T2 lines examined, 42%, 49% and 9% were judged as lines with the nonrepeat type insertion, the simple repeat type insertion and the other repeat type insertion of transgenes. In 174 T3 lines, overexpression lines were confirmed for 37 genes, whereas only cosuppression lines were produced for eight genes. The AtTED4 promoter activity was high enough to overexpress a wide range of genes over wild-type expression levels, even though the wild-type expression is much higher than AtTED4 expression for several genes. As a typical example, we investigated phenotypes of pAtTED4::At5g60490 plants, in which both overexpression and cosuppression lines were included. Overexpression but not cosuppression lines showed accelerated xylem development, suggesting the positive role of At5g60490 in xylem development. Taken together, this study provides valuable results about behaviours of various genes expressed under an early xylem-specific promoter and about usefulness of their lines as genetic tools in woody biomass engineering. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Timiras, Paola S; Yaghmaie, Farzin; Saeed, Omar; Thung, Elaine; Chinn, Garrett
2005-01-01
The phenome represents the observable properties of an organism that have developed under the continued influences of both genome and environmental factors. Phenotypic properties are expressed through the functions of cells, organs and body systems that operate optimally, close to equilibrium. In complex organisms, maintenance of the equilibrium is achieved by the interplay of several regulatory mechanisms. In the elderly, dynamic instability may lead to progressive loss of normal function, failure of adaptation and increased pathology. Extensive research (reported elsewhere in this journal) has demonstrated that genetic manipulations of endocrine signaling in flies, worms and mice increase longevity. Another effective strategy for prolonging the lifespan is caloric restriction: in data presented here, the persistence of estrogen-sensitive cells in the hypothalamus of caloric restricted 22-month-old female mice, may explain the persistence of reproductive function at an age, when reproductive function has long ceased in ad libitum fed controls. Still another strategy utilizes the effects of epidermal growth factor (EGF) to promote in vitro proliferation of neuroglia, astrocytes and oligodendrocytes. Their subsequent de-differentiation generates immature precursor cells potentially capable of differentiating into neuroblasts and neurons. These and other examples suggest that, in terms of functional outcomes, "the genome proposes but the phenome disposes".
Glass promotes the differentiation of neuronal and non-neuronal cell types in the Drosophila eye
Morrison, Carolyn A.; Chen, Hao; Cook, Tiffany; Brown, Stuart
2018-01-01
Transcriptional regulators can specify different cell types from a pool of equivalent progenitors by activating distinct developmental programs. The Glass transcription factor is expressed in all progenitors in the developing Drosophila eye, and is maintained in both neuronal and non-neuronal cell types. Glass is required for neuronal progenitors to differentiate as photoreceptors, but its role in non-neuronal cone and pigment cells is unknown. To determine whether Glass activity is limited to neuronal lineages, we compared the effects of misexpressing it in neuroblasts of the larval brain and in epithelial cells of the wing disc. Glass activated overlapping but distinct sets of genes in these neuronal and non-neuronal contexts, including markers of photoreceptors, cone cells and pigment cells. Coexpression of other transcription factors such as Pax2, Eyes absent, Lozenge and Escargot enabled Glass to induce additional genes characteristic of the non-neuronal cell types. Cell type-specific glass mutations generated in cone or pigment cells using somatic CRISPR revealed autonomous developmental defects, and expressing Glass specifically in these cells partially rescued glass mutant phenotypes. These results indicate that Glass is a determinant of organ identity that acts in both neuronal and non-neuronal cells to promote their differentiation into functional components of the eye. PMID:29324767
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com
2016-04-22
miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5p might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2 are down
Liao, Feng-Ling; Tan, Lin; Liu, Hua; Wang, Jin-Ju; Ma, Xiao-Tang; Zhao, Bin; Chen, Yanfang; Bihl, Ji; Yang, Yi; Chen, Ri-Ling
2018-04-01
Cell-derived exosomes (EXs) can modulate target cell differentiation via microRNAs (miRs) that they carried. Previous studies have shown that miR126 is highly expressed in hematopoietic stem cells (HSCs) and plays a role in hematopoiesis via modulating the Notch pathway that participates in progenitors' cell fate decisions. In this study we investigated whether HSC-derived EXs (HSC-EXs) could affect the differentiation of mouse embryonic stem cells (ESCs) into HSCs. We prepared HSC-EXs con , HSC-EXs sc and HSC-EXs miR126 from control HSCs and the HSCs transfected with scramble control or miR126 mimics, respectively. HSC-EXs were isolated by ultracentrifugation and analyzed using nanoparticle tracking analysis. We incubated the collected EXs with mouse ESCs over a 10-d differentiation induction period, during which HSC-EXs and a Notch pathway activator (Jagged1, 100 ng/mL) were added to the cultures every 3 d. After the 10-d differentiation period, the expression levels of miR126, SSEA1, CD117, Sca1, Notch1 and Hes1 in ESCs were assessed. The generated HSCs were validated by flow cytometry using antibodies against HSC markers (CD117, CD34 and Sca1). Our results revealed that: (1) transfection with miR126 mimics significantly increased miR126 levels in HSC-EXs miR126 . (2) HSC-EX co-culture promoted mouse ESCs differentiation into HSCs with the most prominent effect found in the HSC-EXs miR126 co-culture. (3) HSC differentiation was verified by reduced SSEA1 expression and increased CD117 and Sca1 expression. (4) All the effects caused by HSC-EXs were accompanied by significant reduction of Notch1 and Hes1 expression, thus inhibition of the Notch1/Hes1 pathway, whereas activation of Notch by Jagged1 abolished the effects of HSC-EXs miR126 . In conclusion, HSC-EXs promote hematopoietic differentiation of mouse ESCs in vitro by inhibiting the miR126/Notch1 pathway.
Tao, Zui; Zhao, Chen; Jian, Qian; Gillies, Mark; Xu, Haiwei; Yin, Zheng Qin
2016-01-01
Retinal regeneration and repair are severely impeded in higher mammalian animals. Although Müller cells can be activated and show some characteristics of progenitor cells when injured or under pathological conditions, they quickly form gliosis scars. Unfortunately, the basic mechanisms that impede retinal regeneration remain unknown. We studied retinas from Royal College of Surgeon (RCS) rats and found that let-7 family molecules, let-7e and let-7i, were significantly overexpressed in Müller cells of degenerative retinas. It demonstrated that down-regulation of the RNA binding protein Lin28B was one of the key factors leading to the overexpression of let-7e and let-7i. Lin28B ectopic expression in the Müller cells suppressed overexpression of let-7e and let-7i, stimulated and mobilized Müller glia de-differentiation, proliferation, promoted neuronal commitment, and inhibited glial fate acquisition of de-differentiated Müller cells. ERG recordings revealed that the amplitudes of a-wave and b-wave were improved significantly after Lin28B was delivered into the subretinal space of RCS rats. In summary, down-regulation of Lin28B as well as up-regulation of let-7e and let-7i may be the main factors that impede Müller cell de-differentiation and proliferation in the retina of RCS rats. PMID:27384999
Chu, Weihua; Yuan, Jichao; Huang, Lei; Xiang, Xin; Zhu, Haitao; Chen, Fei; Chen, Yanyan; Lin, Jiangkai; Feng, Hua
2015-07-01
Although the adult spinal cord contains a population of multipotent neural stem/precursor cells (NSPCs) exhibiting the potential to replace neurons, endogenous neurogenesis is very limited after spinal cord injury (SCI) because the activated NSPCs primarily differentiate into astrocytes rather than neurons. Valproic acid (VPA), a histone deacetylase inhibitor, exerts multiple pharmacological effects including fate regulation of stem cells. In this study, we cultured adult spinal NSPCs from chronic compressive SCI rats and treated with VPA. In spite of inhibiting the proliferation and arresting in the G0/G1 phase of NSPCs, VPA markedly promoted neuronal differentiation (β-tubulin III(+) cells) as well as decreased astrocytic differentiation (GFAP(+) cells). Cell cycle regulator p21(Cip/WAF1) and proneural genes Ngn2 and NeuroD1 were increased in the two processes respectively. In vivo, to minimize the possible inhibitory effects of VPA to the proliferation of NSPCs as well as avoid other neuroprotections of VPA in acute phase of SCI, we carried out a delayed intraperitoneal injection of VPA (150 mg/kg/12 h) to SCI rats from day 15 to day 22 after injury. Both of the newborn neuron marker doublecortin and the mature neuron marker neuron-specific nuclear protein were significantly enhanced after VPA treatment in the epicenter and adjacent segments of the injured spinal cord. Although the impaired corticospinal tracks had not significantly improved, Basso-Beattie-Bresnahan scores in VPA treatment group were better than control. Our study provide the first evidence that administration of VPA enhances the neurogenic potential of NSPCs after SCI and reveal the therapeutic value of delayed treatment of VPA to SCI.
MEK5 suppresses osteoblastic differentiation
Energy Technology Data Exchange (ETDEWEB)
Kaneshiro, Shoichi [Department of Orthopaedic Surgery, Japan Community Health Care Organization Osaka Hospital, 4-2-78 Fukushima, Fukushima Ward, Osaka City, Osaka 553-0003 (Japan); Department of Orthopaedic Surgery, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Otsuki, Dai; Yoshida, Kiyoshi; Yoshikawa, Hideki [Department of Orthopaedic Surgery, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Higuchi, Chikahisa, E-mail: c-higuchi@umin.ac.jp [Department of Orthopaedic Surgery, Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2015-07-31
Extracellular signal-regulated kinase 5 (ERK5) is a member of the mitogen-activated protein kinase (MAPK) family and is activated by its upstream kinase, MAPK kinase 5 (MEK5), which is a member of the MEK family. Although the role of MEK5 has been investigated in several fields, little is known about its role in osteoblastic differentiation. In this study, we have demonstrated the role of MEK5 in osteoblastic differentiation in mouse preosteoblastic MC3T3-E1 cells and bone marrow stromal ST2 cells. We found that treatment with BIX02189, an inhibitor of MEK5, increased alkaline phosphatase (ALP) activity and the gene expression of ALP, osteocalcin (OCN) and osterix, as well as it enhanced the calcification of the extracellular matrix. Moreover, osteoblastic cell proliferation decreased at a concentration of greater than 0.5 μM. In addition, knockdown of MEK5 using siRNA induced an increase in ALP activity and in the gene expression of ALP, OCN, and osterix. In contrast, overexpression of wild-type MEK5 decreased ALP activity and attenuated osteoblastic differentiation markers including ALP, OCN and osterix, but promoted cell proliferation. In summary, our results indicated that MEK5 suppressed the osteoblastic differentiation, but promoted osteoblastic cell proliferation. These results implied that MEK5 may play a pivotal role in cell signaling to modulate the differentiation and proliferation of osteoblasts. Thus, inhibition of MEK5 signaling in osteoblasts may be of potential use in the treatment of osteoporosis. - Highlights: • MEK5 inhibitor BIX02189 suppresses proliferation of osteoblasts. • MEK5 knockdown and MEK5 inhibitor promote differentiation of osteoblasts. • MEK5 overexpression inhibits differentiation of osteoblasts.
Liu, Peng-Cheng; Liu, Kuan; Liu, Jun-Feng; Xia, Kuo; Chen, Li-Yang; Wu, Xing
2016-09-27
The effect of overexpressing the Indian hedgehog (IHH) gene on the chondrogenic differentiation of rabbit bone marrow-derived mesenchymal stem cells (BMSCs) was investigated in a simulated microgravity environment. An adenovirus plasmid encoding the rabbit IHH gene was constructed in vitro and transfected into rabbit BMSCs. Two large groups were used: conventional cell culture and induction model group and simulated microgravity environment group. Each large group was further divided into blank control group, GFP transfection group, and IHH transfection group. During differentiation induction, the expression levels of cartilage-related and cartilage hypertrophy-related genes and proteins in each group were determined. In the conventional model, the IHH transfection group expressed high levels of cartilage-related factors (Coll2 and ANCN) at the early stage of differentiation induction and expressed high levels of cartilage hypertrophy-related factors (Coll10, annexin 5, and ALP) at the late stage. Under the simulated microgravity environment, the IHH transfection group expressed high levels of cartilage-related factors and low levels of cartilage hypertrophy-related factors at all stages of differentiation induction. Under the simulated microgravity environment, transfection of the IHH gene into BMSCs effectively promoted the generation of cartilage and inhibited cartilage aging and osteogenesis. Therefore, this technique is suitable for cartilage tissue engineering.
Energy Technology Data Exchange (ETDEWEB)
Lo, Raymond; Matthews, Jason, E-mail: jason.matthews@utoronto.ca
2013-07-15
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
International Nuclear Information System (INIS)
Lo, Raymond; Matthews, Jason
2013-01-01
Nuclear factor erythroid-2-related factor 2 (NRF2; NFE2L2) plays an important role in mediating cellular protection against reactive oxygen species. NRF2 signaling is positively modulated by the aryl hydrocarbon receptor (AHR) but inhibited by estrogen receptor alpha (ERα). In this study we investigated the crosstalk among NRF2, AHR and ERα in MCF-7 breast cancer cells treated with the NRF2 activator sulforaphane (SFN), a dual AHR and ERα activator, 3,3′-diindolylmethane (DIM), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) or 17β-estradiol (E2). SFN-dependent increases in NADPH-dependent oxidoreductase 1 (NQO1) and heme oxygenase I (HMOX1) mRNA levels were significantly reduced after co-treatment with E2. E2-dependent repression of NQO1 and HMOX1 was associated with increased ERα but reduced p300 recruitment and reduced histone H3 acetylation at both genes. In contrast, DIM + SFN or TCDD + SFN induced NQO1 and HMOX1 mRNA expression to levels higher than SFN alone, which was prevented by RNAi-mediated knockdown of AHR. DIM + SFN but not TCDD + SFN also induced recruitment of ERα to NQO1 and HMOX1. However, the presence of AHR at NQO1 and HMOX1 restored p300 recruitment and histone H3 acetylation, thereby reversing the ERα-dependent repression of NRF2. Taken together, our study provides further evidence of functional interplay among NRF2, AHR and ERα signaling pathways through altered p300 recruitment to NRF2-regulated target genes. - Highlights: • We examined crosstalk among ERα, AHR, and NRF2 in MCF-7 breast cancer cells. • AHR enhanced the mRNA expression levels of two NRF2 target genes – HMOX1 and NQO1. • ERα repressed HMOX1 and NQO1 expression via decreased histone acetylation. • AHR prevented ERα-dependent repression of HMOX1 and NQO1.
Sugita, Daisuke; Yayama, Takafumi; Uchida, Kenzo; Kokubo, Yasuo; Nakajima, Hideaki; Yamagishi, Atsushi; Takeura, Naoto; Baba, Hisatoshi
2013-10-15
indicated that overexpression of Ihh signaling promotes abnormal chondrocyte differentiation in enchondral ossification and enhances bone formation in OPLL.
Vav promotes differentiation of human tumoral myeloid precursors
International Nuclear Information System (INIS)
Bertagnolo, Valeria; Brugnoli, Federica; Mischiati, Carlo; Sereni, Alessia; Bavelloni, Alberto; Carini, Cinzia; Capitani, Silvano
2005-01-01
Vav is one of the genetic markers that correlate with the differentiation of hematopoietic cells. In T and B cells, it appears crucial for both development and functions, while, in non-lymphoid hematopoietic cells, Vav seems not involved in cell maturation, but rather in the response of mature cells to agonist-dependent proliferation and phagocytosis. We have previously demonstrated that the amount and the tyrosine phosphorylation of Vav are up-regulated in both whole cells and nuclei of tumoral promyelocytes induced to granulocytic maturation by ATRA and that tyrosine-phosphorylated Vav does not display any ATRA-induced GEF activity but contributes to the regulation of PI 3-K activity. In this study, we report that Vav accumulates in nuclei of ATRA-treated APL-derived cells and that the down-modulation of Vav prevents differentiation of tumoral promyelocytes, indicating that it is a key molecule in ATRA-dependent myeloid maturation. On the other hand, the overexpression of Vav induces an increased expression of surface markers of granulocytic differentiation without affecting the maturation-related changes of the nuclear morphology. Consistent with an effect of Vav on the transcriptional machinery, array profiling shows that the inhibition of the Syk-dependent tyrosine phosphorylation of Vav reduces the number of ATRA-induced genes. Our data support the unprecedented notion that Vav plays crucial functions in the maturation process of myeloid cells, and suggest that Vav can be regarded as a potential target for the therapeutic treatment of myeloproliferative disorders
Directory of Open Access Journals (Sweden)
Dario Nicetto
Full Text Available Post-translational modifications (PTMs of histones exert fundamental roles in regulating gene expression. During development, groups of PTMs are constrained by unknown mechanisms into combinatorial patterns, which facilitate transitions from uncommitted embryonic cells into differentiated somatic cell lineages. Repressive histone modifications such as H3K9me3 or H3K27me3 have been investigated in detail, but the role of H4K20me3 in development is currently unknown. Here we show that Xenopus laevis Suv4-20h1 and h2 histone methyltransferases (HMTases are essential for induction and differentiation of the neuroectoderm. Morpholino-mediated knockdown of the two HMTases leads to a selective and specific downregulation of genes controlling neural induction, thereby effectively blocking differentiation of the neuroectoderm. Global transcriptome analysis supports the notion that these effects arise from the transcriptional deregulation of specific genes rather than widespread, pleiotropic effects. Interestingly, morphant embryos fail to repress the Oct4-related Xenopus gene Oct-25. We validate Oct-25 as a direct target of xSu4-20h enzyme mediated gene repression, showing by chromatin immunoprecipitaton that it is decorated with the H4K20me3 mark downstream of the promoter in normal, but not in double-morphant, embryos. Since knockdown of Oct-25 protein significantly rescues the neural differentiation defect in xSuv4-20h double-morphant embryos, we conclude that the epistatic relationship between Suv4-20h enzymes and Oct-25 controls the transit from pluripotent to differentiation-competent neural cells. Consistent with these results in Xenopus, murine Suv4-20h1/h2 double-knockout embryonic stem (DKO ES cells exhibit increased Oct4 protein levels before and during EB formation, and reveal a compromised and biased capacity for in vitro differentiation, when compared to normal ES cells. Together, these results suggest a regulatory mechanism, conserved
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
Defining the Minimal Factors Required for Erythropoiesis through Direct Lineage Conversion
Directory of Open Access Journals (Sweden)
Sandra Capellera-Garcia
2016-06-01
Full Text Available Erythroid cell commitment and differentiation proceed through activation of a lineage-restricted transcriptional network orchestrated by a group of well characterized genes. However, the minimal set of factors necessary for instructing red blood cell (RBC development remains undefined. We employed a screen for transcription factors allowing direct lineage reprograming from fibroblasts to induced erythroid progenitors/precursors (iEPs. We show that Gata1, Tal1, Lmo2, and c-Myc (GTLM can rapidly convert murine and human fibroblasts directly to iEPs. The transcriptional signature of murine iEPs resembled mainly that of primitive erythroid progenitors in the yolk sac, whereas addition of Klf1 or Myb to the GTLM cocktail resulted in iEPs with a more adult-type globin expression pattern. Our results demonstrate that direct lineage conversion is a suitable platform for defining and studying the core factors inducing the different waves of erythroid development.
Djati, Muhammad Sasmito; Habibu, Hindun; Jatiatmaja, Nabilah A.; Rifa'i, Muhaimin
2017-11-01
Tapak Liman (Elephantopus scaber L) is a traditional medicinal plant containing several active compounds that potentially affecting hematopoietic stem cells, such as epifrieelinol, lupeol, stigmasterol, triacontane-1-ol, dotriacontane-1-ol, lupeol acetate, deoxyelephan-topin, isodeoxyelephantopin, polyphenol luteolin-7, as well as various flavonoids and glucosides. The aim of this study was to elucidate the effect of leaf extract of Tapak Liman on hematopoietic stem cells in mice BALB/c, by observation of the relative number of cells expressing CD4/CD8, CD4/CD62L, and TER119/B220 in the spleen, and TER119/B220, TER119/VLA-4 and TER119/CD34 in bone marrow, after being administered leaf extract for 2 weeks. This experiment used 12 female mice, which were divided into three treatment groups, P1= 0.5 g.g bw-1.day-1, P2= 1.0 g.g bw-1.day-1 and P3=2.0 g.g bw-1.day-1 Tapak Liman leaf extract as well as a control. The relative numbers of cells expressing surface molecules were analyzed by flowcytometry and quantitative data were tested using one-way ANOVA. The results showed that the leaf extract of Tapak Liman has no significant effect on erythrocyte proliferation; on the other hand, it had a significant effect on both proliferation and differentiation of B lymphocytes (B220+) in bone marrow (p=0.044) and increased the expression of CD4+, CD8+ molecule in B cells (p=0.026) and erythroid cells in spleen and bone marrow, based on the estimation of cells that expressed TER119+VLA-4+, identified as important in the development pathway of erythrocytes. An increased cell percentage of TER11+VLA-4+ occurred for treatment P2, 12% higher than the control. The increased expression of TER119+VLA-4+ was assumed to be due to the iron content in Tapak Liman, which functioned to stimulate the progenitor hematopoietic cells to proliferate and differentiate into a precursor of erythroid cells (TER119+VLA-4+). There was an increasing number of cells expressing the surface molecules TER119
International Nuclear Information System (INIS)
Qu, Bo; Ma, Yuan; Yan, Ming; Gong, Kai; Liang, Feng; Deng, Shaolin; Jiang, Kai; Ma, Zehui; Pan, Xianming
2016-01-01
osteoporosis. - Highlights: • Sirt1 inhibits PPARγ signaling in MC3T3-E1 cells. • PPARγ negatively regulates osteogenic differentiation of MC3T3-E1 cells. • Sirt1 promotes osteogenic differentiation through downregulation of PPARγ.
Energy Technology Data Exchange (ETDEWEB)
Qu, Bo [Department of Orthopaedics, Chengdu Military General Hospital, Chengdu 610083 (China); Ma, Yuan [Department of Neurosurgery, Chengdu Military General Hospital, Chengdu 610083 (China); Yan, Ming [Department of Orthopaedics, Xijing Hospital of The Fourth Military Medical University, Xi’an 710032 (China); Gong, Kai; Liang, Feng; Deng, Shaolin; Jiang, Kai; Ma, Zehui [Department of Orthopaedics, Chengdu Military General Hospital, Chengdu 610083 (China); Pan, Xianming, E-mail: xianmingpanxj@163.com [Department of Orthopaedics, Chengdu Military General Hospital, Chengdu 610083 (China)
2016-09-09
of osteoporosis. - Highlights: • Sirt1 inhibits PPARγ signaling in MC3T3-E1 cells. • PPARγ negatively regulates osteogenic differentiation of MC3T3-E1 cells. • Sirt1 promotes osteogenic differentiation through downregulation of PPARγ.
DEFF Research Database (Denmark)
Peng, Nan; Xia, Qiu; Chen, Zhengjun
2009-01-01
S gene encoding an arabinose binding protein was characterized using an Sulfolobus islandicus reporter gene system. The minimal active araS promoter (P(araS)) was found to be 59 nucleotides long and harboured four promoter elements: an ara-box, an upstream transcription factor B-responsive element (BRE......), a TATA-box and a proximal promoter element, each of which contained important nucleotides that either greatly decreased or completely abolished promoter activity upon mutagenesis. The basal araS promoter was virtually inactive due to intrinsically weak BRE element, and the upstream activating sequence...... (UAS) ara-box activated the basal promoter by recruiting transcription factor B to its BRE. While this UAS ensured a general expression from an inactive or weak basal promoter in the presence of other tested carbon resources, it exhibited a strong arabinose-responsive transcriptional activation. To our...
Single-Cell Network Analysis Identifies DDIT3 as a Nodal Lineage Regulator in Hematopoiesis
Directory of Open Access Journals (Sweden)
Cristina Pina
2015-06-01
Full Text Available We explore cell heterogeneity during spontaneous and transcription-factor-driven commitment for network inference in hematopoiesis. Since individual genes display discrete OFF states or a distribution of ON levels, we compute and combine pairwise gene associations from binary and continuous components of gene expression in single cells. Ddit3 emerges as a regulatory node with positive linkage to erythroid regulators and negative association with myeloid determinants. Ddit3 loss impairs erythroid colony output from multipotent cells, while forcing Ddit3 in granulo-monocytic progenitors (GMPs enhances self-renewal and impedes differentiation. Network analysis of Ddit3-transduced GMPs reveals uncoupling of myeloid networks and strengthening of erythroid linkages. RNA sequencing suggests that Ddit3 acts through development or stabilization of a precursor upstream of GMPs with inherent Meg-E potential. The enrichment of Gata2 target genes in Ddit3-dependent transcriptional responses suggests that Ddit3 functions in an erythroid transcriptional network nucleated by Gata2.
FHL2 interacts with CALM and is highly expressed in acute erythroid leukemia
International Nuclear Information System (INIS)
Pašaliç, Z; Greif, P A; Jurinoviç, V; Mulaw, M; Kakadia, P M; Tizazu, B; Fröhlich-Archangelo, L; Krause, A; Bohlander, S K
2011-01-01
The t(10;11)(p13;q14) translocation results in the fusion of the CALM (clathrin assembly lymphoid myeloid leukemia protein) and AF10 genes. This translocation is observed in acute myeloblastic leukemia (AML M6), acute lymphoblastic leukemia (ALL) and malignant lymphoma. Using a yeast two-hybrid screen, the four and a half LIM domain protein 2 (FHL2) was identified as a CALM interacting protein. Recently, high expression of FHL2 in breast, gastric, colon, lung as well as in prostate cancer was shown to be associated with an adverse prognosis. The interaction between CALM and FHL2 was confirmed by glutathione S-transferase-pulldown assay and co-immunoprecipitation experiments. The FHL2 interaction domain of CALM was mapped to amino acids 294–335 of CALM. The transcriptional activation capacity of FHL2 was reduced by CALM, but not by CALM/AF10, which suggests that regulation of FHL2 by CALM might be disturbed in CALM/AF10-positive leukemia. Extremely high expression of FHL2 was seen in acute erythroid leukemia (AML M6). FHL2 was also highly expressed in chronic myeloid leukemia and in AML with complex aberrant karyotype. These results suggest that FHL2 may play an important role in leukemogenesis, especially in the case of AML M6
International Nuclear Information System (INIS)
Nandi, A.K.; Roginski, R.S.; Gregg, R.G.; Smithies, O.; Skoultchi, A.I.
1988-01-01
The authors have examined the effect of the site of integration on the expression of cloned genes introduced into cultured erythroid cells. Smithies et al. reported the targeted integration of DNA into the human β-globin locus on chromosome 11 in a mouse erythroleukemia-human cell hybrid. These hybrid cells can undergo erythroid differentiation leading to greatly increased mouse and human β-globin synthesis. By transfection of these hybrid cells with a plasmid carrying a modified human β-globin gene and a foreign gene composed of the coding sequence of the bacterial neomycin-resistance gene linked to simian virus 40 transcription signals (SVneo), cells were obtained in which the two genes are integrated at the β-globin locus on human chromosome 11 or at random sites. When they examined the response of the integrated genes to cell differentation, they found that the genes inserted at the β-globin locus were induced during differentiation, whereas randomly positioned copies were not induced. Even the foreign SVneo gene was inducible when it had been integrated at the β-globin locus. The results show that genes introduced at the β-globin locus acquire some of the regulatory properties of globin genes during erythroid differentiation
International Nuclear Information System (INIS)
Yan, Jidong; Xu, Jing; Fei, Yao; Jiang, Congshan; Zhu, Wenhua; Han, Yan; Lu, Shemin
2016-01-01
Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of
Energy Technology Data Exchange (ETDEWEB)
Yan, Jidong [Department of Human Anatomy, Histology and Embryology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Xu, Jing [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Fei, Yao [College of Life Sciences, Northwest University, Xi’an, Shaanxi Province 710069 (China); Jiang, Congshan; Zhu, Wenhua; Han, Yan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Lu, Shemin, E-mail: lushemin@xjtu.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Key Laboratory of Environment and Genes Related to Diseases, Xi’an Jiaotong University, Ministry of Education of China (China)
2016-05-15
Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of
Li, Yao; Yan, Ming; Wang, Zilu; Zheng, Yangyu; Li, Junjun; Ma, Shu; Liu, Genxia; Yu, Jinhua
2014-11-17
Estrogen plays an important role in the osteogenic differentiation of mesenchymal stem cells, while stem cells from apical papilla (SCAP) can contribute to the formation of dentin/bone-like tissues. To date, the effects of estrogen on the differentiation of SCAP remain unclear. SCAP was isolated and treated with 10⁻⁷ M 17beta-estradiol (E2). The odonto/osteogenic potency and the involvement of mitogen-activated protein kinase (MAPK) signaling pathway were subsequently investigated by using methyl-thiazolyl-tetrazolium (MTT) assay, and other methods. MTT and flow cytometry results demonstrated that E2 treatment had no effect on the proliferation of SCAP in vitro, while alkaline phosphatase (ALP) assay and alizarin red staining showed that E2 can significantly promote ALP activity and mineralization ability in SCAP. Real-time reverse transcription polymerase chain reaction (RT-PCR) and western blot assay revealed that the odonto/osteogenic markers (ALP, DMP1/DMP1, DSPP/DSP, RUNX2/RUNX2, OSX/OSX and OCN/OCN) were significantly upregulated in E2-treated SCAP. In addition, the expression of phosphor-p38 and phosphor-JNK in these stem cells was enhanced by E2 treatment, as was the expression of the nuclear downstream transcription factors including phosphor-Sp1, phosphor-Elk-1, phosphor-c-Jun and phosphor-c-Fos, indicating the activation of MAPK signaling pathway during the odonto/osteogenic differentiation of E2-treated SCAP. Conversely, the differentiation of E2-treated SCAP was inhibited in the presence of MAPK specific inhibitors. The ondonto/osteogenic differentiation of SCAP is enhanced by 10⁻⁷ M 17beta-estradiol via the activation of MAPK signaling pathway.
Directory of Open Access Journals (Sweden)
Zhang Henggui
2011-06-01
Full Text Available Abstract Background It is of growing interest to develop novel approaches to initiate differentiation of mesenchymal stem cells (MSCs into cardiomyocytes. The purpose of this investigation was to determine if Sphingosine-1-phosphate (S1P, a native circulating bioactive lipid metabolite, plays a role in differentiation of human umbilical cord mesenchymal stem cells (HUMSCs into cardiomyocytes. We also developed an engineered cell sheet from these HUMSCs derived cardiomyocytes by using a temperature-responsive polymer, poly(N-isopropylacrylamide (PIPAAm cell sheet technology. Methods Cardiomyogenic differentiation of HUMSCs was performed by culturing these cells with either designated cardiomyocytes conditioned medium (CMCM alone, or with 1 μM S1P; or DMEM with 10% FBS + 1 μM S1P. Cardiomyogenic differentiation was determined by immunocytochemical analysis of expression of cardiomyocyte markers and patch clamping recording of the action potential. Results A cardiomyocyte-like morphology and the expression of α-actinin and myosin heavy chain (MHC proteins can be observed in both CMCM culturing or CMCM+S1P culturing groups after 5 days' culturing, however, only the cells in CMCM+S1P culture condition present cardiomyocyte-like action potential and voltage gated currents. A new approach was used to form PIPAAm based temperature-responsive culture surfaces and this successfully produced cell sheets from HUMSCs derived cardiomyocytes. Conclusions This study for the first time demonstrates that S1P potentiates differentiation of HUMSCs towards functional cardiomyocytes under the designated culture conditions. Our engineered cell sheets may provide a potential for clinically applicable myocardial tissues should promote cardiac tissue engineering research.
Heme and erythropoieis: more than a structural role
Chiabrando, Deborah; Mercurio, Sonia; Tolosano, Emanuela
2014-01-01
Erythropoiesis is the biological process that consumes the highest amount of body iron for heme synthesis. Heme synthesis in erythroid cells is finely coordinated with that of alpha (α) and beta (β)-globin, resulting in the production of hemoglobin, a tetramer of 2α- and 2β-globin chains, and heme as the prosthetic group. Heme is not only the structural component of hemoglobin, but it plays multiple regulatory roles during the differentiation of erythroid precursors since it controls its own ...
Differential effect of L3T4+ cells on recovery from total-body irradiation
International Nuclear Information System (INIS)
Pantel, K.; Nakeff, A.
1990-01-01
We have examined the importance of L3T4+ (murine equivalent to CD4+) cells for hematopoietic regulation in vivo in unperturbed mice and mice recovering from total-body irradiation (TBI) using a cytotoxic monoclonal antibody (MoAb) raised with the GK 1.5 hybridoma. Ablating L3T4+ cells in normal (unperturbed) B6D2F1 mice substantially decreased the S-phase fraction (determined by in vivo hydroxyurea suicide) of erythroid progenitor cells (erythroid colony-forming units, CFU-E) as compared to the pretreatment level (10% +/- 14.1% [day 3 following depletion] vs 79.8% +/- 15.9%, respectively) with a corresponding decrease in the marrow content of CFU-E at this time to approximately 1% of the pretreatment value. Although the S-phase fraction of CFU-GM was decreased to 2.2% +/- 3.1% 3 days after L3T4+ cell ablation from the 21.3% +/- 8.3% pretreatment value, CFU-GM cellularity showed little change over the 3 days following anti-L3T4 treatment. Anti-L3T4 MoAb treatment had little or no effect on either the S-phase fraction or the marrow content of hematopoietic stem cells (spleen colony-forming units, CFU-S) committed to myeloerythroid differentiation. Ablating L3T4+ cells prior to a single dose of 2 Gy TBI resulted in significantly reduced marrow contents of CFU-S on day 3 and granulocyte-macrophage colony-forming units (CFU-GM) on day 6 following TBI, with little or no effect on the corresponding recovery of CFU-E. The present findings provide the first in vivo evidence that L3T4+ cells are involved in: (1) maintaining the proliferative activity of CFU-E and CFU-GM in unperturbed mice and (2) supporting the restoration of CFU-S and CFU-GM following TBI-induced myelosuppression
DEFF Research Database (Denmark)
Alexopoulou, Annika N; Couchman, John R; Whiteford, James
2008-01-01
BACKGROUND: Mouse embryonic stem cells cultured in vitro have the ability to differentiate into cells of the three germ layers as well as germ cells. The differentiation mimics early developmental events, including vasculogenesis and early angiogenesis and several differentiation systems are being...... used to identify factors that are important during the formation of the vascular system. Embryonic stem cells are difficult to transfect, while downregulation of promoter activity upon selection of stable transfectants has been reported, rendering the study of proteins by overexpression difficult....... RESULTS: CCE mouse embryonic stem cells were differentiated on collagen type IV for 4-5 days, Flk1+ mesodermal cells were sorted and replated either on collagen type IV in the presence of VEGFA to give rise to endothelial cells and smooth muscle cells or in collagen type I gels for the formation...
DEFF Research Database (Denmark)
Tseng, Kuan-Yin; Anttila, Jenni E; Khodosevich, Konstantin
2018-01-01
die shortly after injury or are unable to arrive at the infarct boundary. In this study, we demonstrate for the first time that endogenous mesencephalic astrocyte-derived neurotrophic factor (MANF) protects NSCs against oxygen-glucose-deprivation-induced injury and has a crucial role in regulating NPC...... migration. In NSC cultures, MANF protein administration did not affect growth of cells but triggered neuronal and glial differentiation, followed by activation of STAT3. In SVZ explants, MANF overexpression facilitated cell migration and activated the STAT3 and ERK1/2 pathway. Using a rat model of cortical...... stroke, intracerebroventricular injections of MANF did not affect cell proliferation in the SVZ, but promoted migration of doublecortin (DCX)+ cells toward the corpus callosum and infarct boundary on day 14 post-stroke. Long-term infusion of MANF into the peri-infarct zone increased the recruitment...
ISL1 protein transduction promotes cardiomyocyte differentiation from human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Hananeh Fonoudi
Full Text Available BACKGROUND: Human embryonic stem cells (hESCs have the potential to provide an unlimited source of cardiomyocytes, which are invaluable resources for drug or toxicology screening, medical research, and cell therapy. Currently a number of obstacles exist such as the insufficient efficiency of differentiation protocols, which should be overcome before hESC-derived cardiomyocytes can be used for clinical applications. Although the differentiation efficiency can be improved by the genetic manipulation of hESCs to over-express cardiac-specific transcription factors, these differentiated cells are not safe enough to be applied in cell therapy. Protein transduction has been demonstrated as an alternative approach for increasing the efficiency of hESCs differentiation toward cardiomyocytes. METHODS: We present an efficient protocol for the differentiation of hESCs in suspension by direct introduction of a LIM homeodomain transcription factor, Islet1 (ISL1 recombinant protein into the cells. RESULTS: We found that the highest beating clusters were derived by continuous treatment of hESCs with 40 µg/ml recombinant ISL1 protein during days 1-8 after the initiation of differentiation. The treatment resulted in up to a 3-fold increase in the number of beating areas. In addition, the number of cells that expressed cardiac specific markers (cTnT, CONNEXIN 43, ACTININ, and GATA4 doubled. This protocol was also reproducible for another hESC line. CONCLUSIONS: This study has presented a new, efficient, and reproducible procedure for cardiomyocytes differentiation. Our results will pave the way for scaled up and controlled differentiation of hESCs to be used for biomedical applications in a bioreactor culture system.
Piccand, Julie; Meunier, Aline; Merle, Carole; Jia, Zhengping; Barnier, Jean-Vianney; Gradwohl, Gérard
2014-01-01
The transcription factor neurogenin3 (Ngn3) triggers islet cell differentiation in the developing pancreas. However, little is known about the molecular mechanisms coupling cell cycle exit and differentiation in Ngn3(+) islet progenitors. We identified a novel effector of Ngn3 endocrinogenic function, the p21 protein-activated kinase Pak3, known to control neuronal differentiation and implicated in X-linked intellectual disability in humans. We show that Pak3 expression is initiated in Ngn3(+) endocrine progenitor cells and next maintained in maturing hormone-expressing cells during pancreas development as well as in adult islet cells. In Pak3-deficient embryos, the proliferation of Ngn3(+) progenitors and β-cells is transiently increased concomitantly with an upregulation of Ccnd1. β-Cell differentiation is impaired at E15.5 but resumes at later stages. Pak3-deficient mice do not develop overt diabetes but are glucose intolerant under high-fat diet (HFD). In the intestine, Pak3 is expressed in enteroendocrine cells but is not necessary for their differentiation. Our results indicate that Pak3 is a novel regulator of β-cell differentiation and function. Pak3 acts downstream of Ngn3 to promote cell cycle exit and differentiation in the embryo by a mechanism that might involve repression of Ccnd1. In the adult, Pak3 is required for the proper control of glucose homeostasis under challenging HFD.
Directory of Open Access Journals (Sweden)
Kai-Hsin Chang
2011-01-01
Full Text Available Because of the imbalance in the supply and demand of red blood cells (RBCs, especially for alloimmunized patients or patients with rare blood phenotypes, extensive research has been done to generate therapeutic quantities of mature RBCs from hematopoietic stem cells of various sources, such as bone marrow, peripheral blood, and cord blood. Since human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs can be maintained indefinitely in vitro, they represent potentially inexhaustible sources of donor-free RBCs. In contrast to other ex vivo stem-cell-derived cellular therapeutics, tumorigenesis is not a concern, as RBCs can be irradiated without marked adverse effects on in vivo function. Here, we provide a comprehensive review of the recent publications relevant to the generation and characterization of hESC- and iPSC-derived erythroid cells and discuss challenges to be met before the eventual realization of clinical usage of these cells.
Elevation, Not Deforestation, Promotes Genetic Differentiation in a Pioneer Tropical Tree.
Castilla, Antonio R; Pope, Nathaniel; Jaffé, Rodolfo; Jha, Shalene
2016-01-01
The regeneration of disturbed forest is an essential part of tropical forest ecology, both with respect to natural disturbance regimes and large-scale human-mediated logging, grazing, and agriculture. Pioneer tree species are critical for facilitating the transition from deforested land to secondary forest because they stabilize terrain and enhance connectivity between forest fragments by increasing matrix permeability and initiating disperser community assembly. Despite the ecological importance of early successional species, little is known about their ability to maintain gene flow across deforested landscapes. Utilizing highly polymorphic microsatellite markers, we examined patterns of genetic diversity and differentiation for the pioneer understory tree Miconia affinis across the Isthmus of Panama. Furthermore, we investigated the impact of geographic distance, forest cover, and elevation on genetic differentiation among populations using circuit theory and regression modeling within a landscape genetics framework. We report marked differences in historical and contemporary migration rates and moderately high levels of genetic differentiation in M. affinis populations across the Isthmus of Panama. Genetic differentiation increased significantly with elevation and geographic distance among populations; however, we did not find that forest cover enhanced or reduced genetic differentiation in the study region. Overall, our results reveal strong dispersal for M. affinis across human-altered landscapes, highlighting the potential use of this species for reforestation in tropical regions. Additionally, this study demonstrates the importance of considering topography when designing programs aimed at conserving genetic diversity within degraded tropical landscapes.
Product and Quotient Rules from Logarithmic Differentiation
Chen, Zhibo
2012-01-01
A new application of logarithmic differentiation is presented, which provides an alternative elegant proof of two basic rules of differentiation: the product rule and the quotient rule. The proof can intrigue students, help promote their critical thinking and rigorous reasoning and deepen their understanding of previously encountered concepts. The…
Collagen Promotes Higher Adhesion, Survival and Proliferation of Mesenchymal Stem Cells.
Directory of Open Access Journals (Sweden)
Chinnapaka Somaiah
Full Text Available Mesenchymal stem cells (MSC can differentiate into several cell types and are desirable candidates for cell therapy and tissue engineering. However, due to poor cell survival, proliferation and differentiation in the patient, the therapy outcomes have not been satisfactory. Although several studies have been done to understand the conditions that promote proliferation, differentiation and migration of MSC in vitro and in vivo, still there is no clear understanding on the effect of non-cellular bio molecules. Of the many factors that influence the cell behavior, the immediate cell microenvironment plays a major role. In this context, we studied the effect of extracellular matrix (ECM proteins in controlling cell survival, proliferation, migration and directed MSC differentiation. We found that collagen promoted cell proliferation, cell survival under stress and promoted high cell adhesion to the cell culture surface. Increased osteogenic differentiation accompanied by high active RHOA (Ras homology gene family member A levels was exhibited by MSC cultured on collagen. In conclusion, our study shows that collagen will be a suitable matrix for large scale production of MSC with high survival rate and to obtain high osteogenic differentiation for therapy.
Telomerase reverse transcriptase promoter mutations in glandular lesions of the urinary bladder.
Vail, Eric; Zheng, Xiaoyong; Zhou, Ming; Yang, Ximing; Fallon, John T; Epstein, Jonathan I; Zhong, Minghao
2015-10-01
Glandular lesions of the urinary bladder include a broad spectrum of entities ranging from completely benign to primary and secondary malignancies. The accurate diagnosis of these lesions is both important and challenging. Recently, studies suggest that telomerase reverse transcriptase (TERT) promoter mutations could be a biomarker for urothelial carcinoma (UC). We hypothesized that these mutations can distinguish UC with glandular differentiation from nephrogenic adenoma, primary adenocarcinoma of the urinary bladder (PAUB), or secondary malignancies. Twenty-five cases of benign glandular lesions (including nephrogenic adenoma); 29 cases of UC with glandular differentiation; 10 cases of PAUB; and 10 cases each of metastatic colon cancer, prostatic carcinoma, and carcinoma from Mullerian origin were collected. Slides were reviewed and selected to make sure the lesion was at least 10% to 20% of all tissue. Macrodissection was performed in some of cases, and genomic DNA was extracted from the tissue. Telomerase reverse transcriptase promoter mutations were determined by standard polymerase chain reaction sequencing. Twenty-one cases (72%) of UC with glandular differentiation were positive for TERT promoter mutations. However, none of the remaining cases (total 65 cases of benign lesions, PAUB, and metastatic carcinomas) was positive for TERT promoter mutation. Telomerase reverse transcriptase promoter mutations were highly associated with UC including UC with glandular differentiation but not other glandular lesions of bladder. Therefore, in conjunction with morphologic features, Immunohistochemistry stain profile, and clinical information, TERT promoter mutations could distinguish UC with glandular differentiation from other bladder glandular lesions. In addition, lack of TERT promoter mutations in primary adenocarcinoma of bladder suggests that this entity may have different origin or carcinogenesis from those of UC. Published by Elsevier Inc.
Li, Da-Wei; He, Jin; He, Feng-Li; Liu, Ya-Li; Liu, Yang-Yang; Ye, Ya-Jing; Deng, Xudong; Yin, Da-Chuan
2018-04-01
As a biodegradable polymer thin film, silk fibroin/chitosan composite film overcomes the defects of pure silk fibroin and chitosan films, respectively, and shows remarkable biocompatibility, appropriate hydrophilicity and mechanical properties. Silk fibroin/chitosan thin film can be used not only as metal implant coating for bone injury repair, but also as tissue engineering scaffold for skin, cornea, adipose, and other soft tissue injury repair. However, the biocompatibility of silk fibroin/chitosan thin film for mesenchymal stem cells, a kind of important seed cell of tissue engineering and regenerative medicine, is rarely reported. In this study, silk fibroin/chitosan film was prepared by solvent casting method, and the rat bone marrow-derived mesenchymal stem cells were cultured on the silk fibroin/chitosan thin film. Osteogenic and adipogenic differentiation of rat bone marrow-derived mesenchymal stem cells were induced, respectively. The proliferation ability, osteogenic and adipogenic differentiation abilities of rat bone marrow-derived mesenchymal stem cells were systematically compared between silk fibroin/chitosan thin film and polystyrene tissue culture plates. The results showed that silk fibroin/chitosan thin film not only provided a comparable environment for the growth and proliferation of rat bone marrow-derived mesenchymal stem cells but also promoted their osteogenic and adipogenic differentiation. This work provided information of rat bone marrow-derived mesenchymal stem cells behavior on silk fibroin/chitosan thin film and extended the application of silk fibroin/chitosan thin film. Based on the results, we suggested that the silk fibroin/chitosan thin film could be a promising material for tissue engineering of bone, cartilage, adipose, and skin.
Method and cell lines for the production of monoclonal antibodies to human glycophorin A
Bigbee, W.L.; Fong, S.S.N.; Jensen, R.H.; Vanderlaan, M.
Cloned mouse hybridoma cell lines have been established which continuously produce antibodies that differentiate between the M and N forms of human glycophorin A. These antibodies have potential application as human blood group reagents, as markers for terminally differentiated erythroid cells and as immunofluorescent labels of somatically variant human erythrocytes.
Directory of Open Access Journals (Sweden)
Saik-Kia Goh
Full Text Available Embryonic stem cells (ESCs have emerged as potential cell sources for tissue engineering and regeneration owing to its virtually unlimited replicative capacity and the potential to differentiate into a variety of cell types. Current differentiation strategies primarily involve various growth factor/inducer/repressor concoctions with less emphasis on the substrate. Developing biomaterials to promote stem cell proliferation and differentiation could aid in the realization of this goal. Extracellular matrix (ECM components are important physiological regulators, and can provide cues to direct ESC expansion and differentiation. ECM undergoes constant remodeling with surrounding cells to accommodate specific developmental event. In this study, using ESC derived aggregates called embryoid bodies (EB as a model, we characterized the biological nature of ECM in EB after exposure to different treatments: spontaneously differentiated and retinoic acid treated (denoted as SPT and RA, respectively. Next, we extracted this treatment-specific ECM by detergent decellularization methods (Triton X-100, DOC and SDS are compared. The resulting EB ECM scaffolds were seeded with undifferentiated ESCs using a novel cell seeding strategy, and the behavior of ESCs was studied. Our results showed that the optimized protocol efficiently removes cells while retaining crucial ECM and biochemical components. Decellularized ECM from SPT EB gave rise to a more favorable microenvironment for promoting ESC attachment, proliferation, and early differentiation, compared to native EB and decellularized ECM from RA EB. These findings suggest that various treatment conditions allow the formulation of unique ESC-ECM derived scaffolds to enhance ESC bioactivities, including proliferation and differentiation for tissue regeneration applications.
Differential Top10 promoter regulation by six tetracycline analogues in plant cells
Love, John; Allen, George C.; Gatz, Christiane; Thompson, William F.; Brown, C. S. (Principal Investigator)
2002-01-01
The effects of five tetracycline analogues, anhydrotetracycline, doxycycline, minocycline, oxytetracycline, and tetracycline, on Top10 promoter activity in NT1 tobacco tissue culture cells have been analysed. The concentration that repressed Top10 promoter activity, the level of transgene repression and the kinetics of transgene de-repression were determined for each analogue, and could not be predicted from in vitro binding affinity to the tetracycline repressor or from comparison with animal cells. Doxycycline had the most potent effect on the Top10 promoter and completely inhibited transgene expression at 4 nmol l(-1). Tetracycline was the most versatile of the analogues tested; tetracycline inhibited the Top10 promoter at 10 nmol l(-1) and was easily washed out to restore Top10-driven expression in 12-24 h. A study was also made of the suitability for plant research of a novel tetracycline analogue, GR33076X. In animal cells, GR33076X de-repressed Top10 promoter activity in the presence of inhibitory concentrations of anhydrotetracycline. In NT1, it is shown that GR 33076X can antagonize repression of the Top10 promoter in the presence of tetracycline, but not of anhydrotetracycline or of doxycycline. Different tetracycline analogues can therefore be used to regulate the Top10 promoter in plant cells and this property may be exploited in planning an optimum course of transgene regulation.
Raciti, Gregory Alexander; Fiory, Francesca; Campitelli, Michele; Desiderio, Antonella; Spinelli, Rosa; Longo, Michele; Nigro, Cecilia; Pepe, Giacomo; Sommella, Eduardo; Campiglia, Pietro; Formisano, Pietro; Beguinot, Francesco; Miele, Claudia
2018-01-01
Metabolic and/or endocrine dysfunction of the white adipose tissue (WAT) contribute to the development of metabolic disorders, such as Type 2 Diabetes (T2D). Therefore, the identification of products able to improve adipose tissue function represents a valuable strategy for the prevention and/or treatment of T2D. In the current study, we investigated the potential effects of dry extracts obtained from Citrus aurantium L. fruit juice (CAde) on the regulation of 3T3-L1 cells adipocyte differentiation and function in vitro. We found that CAde enhances terminal adipocyte differentiation of 3T3-L1 cells raising the expression of CCAAT/enhancer binding protein beta (C/Ebpβ), peroxisome proliferator activated receptor gamma (Pparγ), glucose transporter type 4 (Glut4) and fatty acid binding protein 4 (Fabp4). CAde improves insulin-induced glucose uptake of 3T3-L1 adipocytes, as well. A focused analysis of the phases occurring in the pre-adipocytes differentiation to mature adipocytes furthermore revealed that CAde promotes the early differentiation stage by up-regulating C/ebpβ expression at 2, 4 and 8 h post the adipogenic induction and anticipating the 3T3-L1 cell cycle entry and progression during mitotic clonal expansion (MCE). These findings provide evidence that the exposure to CAde enhances in vitro fat cell differentiation of pre-adipocytes and functional capacity of mature adipocytes, and pave the way to the development of products derived from Citrus aurantium L. fruit juice, which may improve WAT functional capacity and may be effective for the prevention and/or treatment of T2D.
Sox2 Promotes Malignancy in Glioblastoma by Regulating Plasticity and Astrocytic Differentiation
Directory of Open Access Journals (Sweden)
Artem D. Berezovsky
2014-03-01
Full Text Available The high-mobility group–box transcription factor sex-determining region Y–box 2 (Sox2 is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM, Sox2 is a marker of cancer stemlike cells (CSCs in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pattern in GBM tumors and patient-derived mouse xenografts is not restricted to a small percentage of cells and is coexpressed with various lineage markers, suggesting that its expression extends beyond CSCs to encompass more differentiated neoplastic cells across molecular subtypes. Employing a CSC derived from a patient with GBM and isogenic differentiated cell model, we show that Sox2 knockdown in the differentiated state abolished dedifferentiation and acquisition of CSC phenotype. Furthermore, Sox2 deficiency specifically impaired the astrocytic component of a biphasic gliosarcoma xenograft model while allowing the formation of tumors with sarcomatous phenotype. The expression of genes associated with stem cells and malignancy were commonly downregulated in both CSCs and serum-differentiated cells on Sox2 knockdown. Genes previously shown to be associated with pluripontency and CSCs were only affected in the CSC state, whereas embryonic stem cell self-renewal genes and cytokine signaling were downregulated, and the Wnt pathway activated in differentiated Sox2-deficient cells. Our results indicate that Sox2 regulates the expression of key genes and pathways involved in GBM malignancy, in both cancer stemlike and differentiated cells, and maintains plasticity for bidirectional conversion between the two states, with significant clinical implications.
The first trimester human placenta is a site for terminal maturation of primitive erythroid cells.
Van Handel, Ben; Prashad, Sacha L; Hassanzadeh-Kiabi, Nargess; Huang, Andy; Magnusson, Mattias; Atanassova, Boriana; Chen, Angela; Hamalainen, Eija I; Mikkola, Hanna K A
2010-10-28
Embryonic hematopoiesis starts via the generation of primitive red blood cells (RBCs) that satisfy the embryo's immediate oxygen needs. Although primitive RBCs were thought to retain their nuclei, recent studies have shown that primitive RBCs in mice enucleate in the fetal liver. It has been unknown whether human primitive RBCs enucleate, and what hematopoietic site might support this process. Our data indicate that the terminal maturation and enucleation of human primitive RBCs occurs in first trimester placental villi. Extravascular ζ-globin(+) primitive erythroid cells were found in placental villi between 5-7 weeks of development, at which time the frequency of enucleated RBCs was higher in the villous stroma than in circulation. RBC enucleation was further evidenced by the presence of primitive reticulocytes and pyrenocytes (ejected RBC nuclei) in the placenta. Extravascular RBCs were found to associate with placental macrophages, which contained ingested nuclei. Clonogenic macrophage progenitors of fetal origin were present in the chorionic plate of the placenta before the onset of fetoplacental circulation, after which macrophages had migrated to the villi. These findings indicate that placental macrophages may assist the enucleation process of primitive RBCs in placental villi, implying an unexpectedly broad role for the placenta in embryonic hematopoiesis.
Fang, Qing-Qing; Li, Zhi-Zhong; Zhou, Jian; Shi, Wen-Gui; Yan, Juan-Li; Xie, Yan-Fang; Chen, Ke-Ming
2016-11-20
To study whether low-frequency pulsed electromagnetic fields promotes the differentiation of cultured rat osteoblasts through the cAMP/PKA signal pathway. Rat calvarial osteoblasts isolated by enzyme digestion were exposed to 50 Hz 0.6 mT low-frequency pulsed electromagnetic field for varying lengths of time, and the concentration of cAMP and levels of phosphorylated PKA in the cells were assayed. In cells treated with DDA to inhibit the activity of adenylate cyclase, the changes of ALP activity and transcription of osteogenic gene were detected after exposure to low-frequency pulsed electromagnetic field. The changes of osteogenic gene transcription and protein expression were tested in the osteoblasts pretreated with KT5720 in response to low-frequency pulsed electromagnetic field exposure. The intracellular cAMP concentration in the cells increased significantly at 20 min during exposure to low-frequency pulsed electromagnetic field, began to decrease at 40 min during the exposure, and increased again after a 2-h exposure; the same pattern of variation was also observed in p-PKA level. Application of DDA and KT5720 pretreatment both suppressed the increase in ALP activity and osteogenic gene transcription induced by electromagnetic field exposure. Low- frequency pulsed electromagnetic field exposure improves the differentiation of cultured rat osteoblasts by activating cAMP/PKA signal pathway.
Directory of Open Access Journals (Sweden)
Yanhong Gao
Full Text Available Osteogenic differentiation from mesenchymal progenitor cells (MPCs are initiated and regulated by a cascade of signaling events. Either Wnt/β-catenin or estrogen signaling pathway has been shown to play an important role in regulating skeletal development and maintaining adult tissue homeostasis. Here, we investigate the potential crosstalk and synergy of these two signaling pathways in regulating osteogenic differentiation of MPCs. We find that the activation of estrogen receptor (ER signaling by estradiol (E2 or exogenously expressed ERα in MPCs synergistically enhances Wnt3A-induced early and late osteogenic markers, as well as matrix mineralization. The E2 or ERα-mediated synergy can be effectively blocked by ERα antagonist tamoxifen. E2 stimulation can enhance endochondral ossification of Wnt3A-transduced mouse fetal limb explants. Furthermore, exogenously expressed ERα significantly enhances the maturity and mineralization of Wnt3A-induced subcutaneous and intramuscular ectopic bone formation. Mechanistically, we demonstrate that E2 does not exert any detectable effect on β-catenin/Tcf reporter activity. However, ERα expression is up-regulated within the first 48h in AdWnt3A-transduced MPCs, whereas ERβ expression is significantly inhibited within 24h. Moreover, the key enzyme for the biosynthesis of estrogens aromatase is modulated by Wnt3A in a biphasic manner, up-regulated at 24h but reduced after 48h. Our results demonstrate that, while ER signaling acts synergistically with Wnt3A in promoting osteogenic differentiation, Wnt3A may crosstalk with ER signaling by up-regulating ERα expression and down-regulating ERβ expression in MPCs. Thus, the signaling crosstalk and synergy between these two pathways should be further explored as a potential therapeutic approach to combating bone and skeletal disorders, such as fracture healing and osteoporosis.
Tamaddon, M.; Burrows, M.; Ferreira, S. A.; Dazzi, F.; Apperley, J. F.; Bradshaw, A.; Brand, D. D.; Czernuszka, J.; Gentleman, E.
2017-03-01
Osteoarthritis (OA) is a common cause of pain and disability and is often associated with the degeneration of articular cartilage. Lesions to the articular surface, which are thought to progress to OA, have the potential to be repaired using tissue engineering strategies; however, it remains challenging to instruct cell differentiation within a scaffold to produce tissue with appropriate structural, chemical and mechanical properties. We aimed to address this by driving progenitor cells to adopt a chondrogenic phenotype through the tailoring of scaffold composition and physical properties. Monomeric type-I and type-II collagen scaffolds, which avoid potential immunogenicity associated with fibrillar collagens, were fabricated with and without chondroitin sulfate (CS) and their ability to stimulate the chondrogenic differentiation of human bone marrow-derived mesenchymal stem cells was assessed. Immunohistochemical analyses showed that cells produced abundant collagen type-II on type-II scaffolds and collagen type-I on type-I scaffolds. Gene expression analyses indicated that the addition of CS - which was released from scaffolds quickly - significantly upregulated expression of type II collagen, compared to type-I and pure type-II scaffolds. We conclude that collagen type-II and CS can be used to promote a more chondrogenic phenotype in the absence of growth factors, potentially providing an eventual therapy to prevent OA.
Health Promotion and Related Factors Among Korean Goose Mothers
Directory of Open Access Journals (Sweden)
Chiyoung Cha, PhD, RN
2010-12-01
Conclusions: The findings of this study contributed to the body of knowledge of health promotion among international migrant populations by identifying the differential effects of social support, acculturation attitudes, and perceived family health for six areas of health promotion.
Group I Paks Promote Skeletal Myoblast Differentiation In Vivo and In Vitro
DEFF Research Database (Denmark)
Joseph, Giselle A; Lu, Min; Radu, Maria
2017-01-01
fusion in Drosophila We report that both Pak1 and Pak2 are activated during mammalian myoblast differentiation. One pathway of activation is initiated by N-cadherin ligation and involves the cadherin coreceptor Cdo with its downstream effector, Cdc42. Individual genetic deletion of Pak1 and Pak2 in mice....... Furthermore, primary myoblasts lacking Pak1 and Pak2 display delayed expression of myogenic differentiation markers and myotube formation. These results identify Pak1 and Pak2 as redundant regulators of myoblast differentiation in vitro and in vivo and as components of the promyogenic Ncad/Cdo/Cdc42 signaling...
Tang, H M; Kuay, K T; Koh, P F; Asad, M; Tan, T Z; Chung, V Y; Lee, S C; Thiery, J P; Huang, Ry-J
2016-01-01
Epithelial-mesenchymal transition (EMT), a crucial mechanism in development, mediates aggressiveness during carcinoma progression and therapeutic refractoriness. The reversibility of EMT makes it an attractive strategy in designing novel therapeutic approaches. Therefore, drug discovery pipelines for EMT reversal are in need to discover emerging classes of compounds. Here, we outline a pre-clinical drug screening platform for EMT reversal that consists of three phases of drug discovery and validation. From the Phase 1 epithelial marker promoter induction (EpI) screen on a library consisting of compounds being approved by Food and Drug Administration (FDA), Vorinostat (SAHA), a histone deacetylase inhibitor (HDACi), is identified to exert EMT reversal effects by restoring the expression of an epithelial marker, E-cadherin. An expanded screen on 41 HDACi further identifies 28 compounds, such as class I-specific HDACi Mocetinosat, Entinostat and CI994, to restore E-cadherin and ErbB3 expressions in ovarian, pancreatic and bladder carcinoma cells. Mocetinostat is the most potent HDACi to restore epithelial differentiation with the lowest concentration required for 50% induction of epithelial promoter activity (EpIC-50).The HDACi exerts paradoxical effects on EMT transcriptional factors such as SNAI and ZEB family and the effects are context-dependent in epithelial- and mesenchymal-like cells. In vitro functional studies further show that HDACi induced significant increase in anoikis and decrease in spheroid formation in ovarian and bladder carcinoma cells with mesenchymal features. This study demonstrates a robust drug screening pipeline for the discovery of compounds capable of restoring epithelial differentiation that lead to significant functional lethality.
Directory of Open Access Journals (Sweden)
Luciana Miato Gonçalves Silva
Full Text Available Snakebites is a neglected disease and in Brazil is considered a serious health problem, with the majority of the snakebites caused by the genus Bothrops. Antivenom therapy and other first-aid treatments do not reverse local myonecrose which is the main sequel caused by the envenomation. Several studies have shown the effectiveness of low level laser (LLL therapy in reducing local myonecrosis induced by Bothropic venoms, however the mechanism involved in this effect is unknown. In this in vitro study, we aimed to analyze the effect of LLL irradiation against cytotoxicity induced by Bothrops jararacussu venom on myoblast C2C12 cells.C2C12 were utilized as a model target and were incubated with B. jararacussu venom (12.5 μg/mL and immediately irradiated with LLL at wavelength of red 685 nm or infrared 830 nm with energy density of 2.0, 4.6 and 7.0 J/cm2. Effects of LLL on cellular responses of venom-induced cytotoxicity were examined, including cell viability, measurement of cell damage and intra and extracellular ATP levels, expression of myogenic regulatory factors, as well as cellular differentiation.In non-irradiated cells, the venom caused a decrease in cell viability and a massive release of LDH and CK levels indicating myonecrosis. Infrared and red laser at all energy densities were able to considerably decrease venom-induced cytotoxicity. Laser irradiation induced myoblasts to differentiate into myotubes and this effect was accompanied by up regulation of MyoD and specially myogenin. Moreover, LLL was able to reduce the extracellular while increased the intracellular ATP content after venom exposure. In addition, no difference in the intensity of cytotoxicity was shown by non-irradiated and irradiated venom.LLL irradiation caused a protective effect on C2C12 cells against the cytotoxicity caused by B. jararacussu venom and promotes differentiation of these cells by up regulation of myogenic factors. A modulatory effect of ATP synthesis may
Directory of Open Access Journals (Sweden)
Capretto L
2012-01-01
Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol
Xiao, Bo; Liu, Huazhen; Gu, Zeyun; Liu, Sining; Ji, Cheng
2015-11-01
Cell transplantation of neural stem cells (NSCs) is a promising approach for neurological recovery both structurally and functionally. However, one big obstacle is to promote differentiation of NSCs into neurons and the followed maturation. In the present study, we aimed to investigate the protective effect of taurine on the differentiation of NSCs and subsequent maturation of their neuronal lineage, when exposed to oxygen-glucose deprivation (OGD). The results suggested that taurine (5-20 mM) promoted the viability and proliferation of NSCs, and it protected against 8 h of OGD induced impairments. Furthermore, 20 mM taurine promoted NSCs to differentiate into neurons after 7 days of culture, and it also protected against the suppressive impairments of 8 h of OGD. Consistently, taurine (20 mM) promoted the neurite sprouting and outgrowth of the NSC differentiated neurons after 14 days of differentiation, which were significantly inhibited by OGD (8 h). At D21, the mushroom spines and spine density were promoted or restored by 20 mM taurine. Taken together, the enhanced viability and proliferation of NSCs, more differentiated neurons and the promoted maturation of neurons by 20 mM taurine support its therapeutic application during stem cell therapy to enhance neurological recovery. Moreover, it protected against the impairments induced by OGD, which may highlight its role for a more direct therapeutic application especially in an ischemic stroke environment.
Differential action of glycoprotein hormones: significance in cancer progression.
Govindaraj, Vijayakumar; Arya, Swathy V; Rao, A J
2014-02-01
Growth of multicellular organisms depends on maintenance of proper balance between proliferation and differentiation. Any disturbance in this balance in animal cells can lead to cancer. Experimental evidence is provided to conclude with special reference to the action of follicle-stimulating hormone (FSH) on Sertoli cells, and luteinizing hormone (LH) on Leydig cells that these hormones exert a differential action on their target cells, i.e., stimulate proliferation when the cells are in an undifferentiated state which is the situation with cancer cells and promote only functional parameters when the cell are fully differentiated. Hormones and growth factors play a key role in cell proliferation, differentiation, and apoptosis. There is a growing body of evidence that various tumors express some hormones at high levels as well as their cognate receptors indicating the possibility of a role in progression of cancer. Hormones such as LH, FSH, and thyroid-stimulating hormone have been reported to stimulate cell proliferation and act as tumor promoter in a variety of hormone-dependent cancers including gonads, lung, thyroid, uterus, breast, prostate, etc. This review summarizes evidence to conclude that these hormones are produced by some cancer tissues to promote their own growth. Also an attempt is made to explain the significance of the differential action of hormones in progression of cancer with special reference to prostate cancer.
Ma, Xing; Zhu, Xiujuan; Han, Yingying; Story, Benjamin; Do, Trieu; Song, Xiaoqing; Wang, Su; Zhang, Ying; Blanchette, Marco; Gogol, Madelaine; Hall, Kate; Peak, Allison; Anoja, Perera; Xie, Ting
2017-04-24
Piwi family protein Aubergine (Aub) maintains genome integrity in late germ cells of the Drosophila ovary through Piwi-associated RNA-mediated repression of transposon activities. Although it is highly expressed in germline stem cells (GSCs) and early progeny, it remains unclear whether it plays any roles in early GSC lineage development. Here we report that Aub promotes GSC self-renewal and GSC progeny differentiation. RNA-iCLIP results show that Aub binds the mRNAs encoding self-renewal and differentiation factors in cultured GSCs. Aub controls GSC self-renewal by preventing DNA-damage-induced Chk2 activation and by translationally controlling the expression of self-renewal factors. It promotes GSC progeny differentiation by translationally controlling the expression of differentiation factors, including Bam. Therefore, this study reveals a function of Aub in GSCs and their progeny, which promotes translation of self-renewal and differentiation factors by directly binding to its target mRNAs and interacting with translational initiation factors. Copyright © 2017 Elsevier Inc. All rights reserved.
Overexpression of osteoprotegerin promotes preosteoblast differentiation to mature osteoblasts
Yu, Hongyou; de Vos, Paul; Ren, Yijin
OBJECTIVE: The hypothesis of the present study is that overexpression of osteoprotegerin (OPG) promotes preosteoblast maturation. MATERIALS AND METHODS: The preosteoblast cell line MC3T3-E1 was transfected with OPG overexpression. OPG expression was confirmed by enzyme-linked immunosorbent assay
Shoot Differentiation in Callus Cultures of Datura Innoxia
DEFF Research Database (Denmark)
Engvild, Kjeld Christensen
1973-01-01
promoted shoot differentiation. Gibberellic acid inhibited shoot formation weakly, but inhibited proper leaf blade formation. Root differentiation was rare. The callus cultures of Datura innoxia grew rapidly (100-fold in 4 weeks) on a slightly modified Murashige and Skoog medium (0.5 mg/l thiamin · HCl, p...