WorldWideScience

Sample records for proliferator response element

  1. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  2. Platelet-released growth factors can accelerate tenocyte proliferation and activate the anti-oxidant response element.

    Science.gov (United States)

    Tohidnezhad, M; Varoga, D; Wruck, C J; Brandenburg, L O; Seekamp, A; Shakibaei, M; Sönmez, T T; Pufe, Thomas; Lippross, S

    2011-05-01

    Little is know about the pathophysiology of acute and degenerative tendon injuries. Although most lesions are uncomplicated, treatment is long and unsatisfactory in a considerable number of cases. Besides the common growth factors that were shown to be relevant for tendon integrity more recently protection against oxidative stress was shown to promote tendon healing. To improve tendon regeneration, many have advocated the use of platelet-rich plasma (PRP), a thrombocyte concentrate that can serve as an autologous source of growth factors. In this study, we investigated the effect of platelet-released growth factors (PRGF) on tenocytes. Tenocytes were isolated from the Achilles tendon of postnatal rats. Tenocyte cell cultures were stimulated with PRGF. We used a CyQuant assay and WST assay to analyse tendon cell growth and viability in different concentrations of PRGF. Migration and proliferation of cells grown in PRGF were assessed by a scratch test. A dual-luciferase assay was used to demonstrate the activation of the anti-oxidant response element (ARE) in tenocytes. A positive effect of PRGF could be shown on tendon cell growth and migratory capacity. PRGF activated the Nrf2-ARE pathway in a dose-dependent manner. Here, we provide evidence of a biological effect of PRGF on tenocytes by the promotion of tenocyte growth and activation of the Nrf2-ARE pathway. This is a novel aspect of the action of platelet concentrates on tendon growth.

  3. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  4. Elements of safety and non proliferation

    International Nuclear Information System (INIS)

    Jalouneix, Jean; Aurelle, Jacques; Funk, Pierre; Ladsous, David; Bon Nguyen, Romuald; Goue, Georges; Lefevre, Odile

    2015-01-01

    This book on nuclear safety and non proliferation is based on knowledge and expertise of the IRSN. The first chapter addresses the safety of nuclear materials, of their installations and of their transportations. It proposes some contextual elements, presents the general guidelines of the French nuclear safety arrangement, the approach to take risks into account, the involved governmental and public bodies, the legal framework, and the protection and control arrangement (in terms of planning of safety-related activities, in terms of operator obligations, in terms of exercises and management crisis). The second part addresses the safety of radioactive sources: context (peculiarity, losses and thefts), international framework (source categories, Euratom directive), and the French organisation. The third chapter addresses nuclear non proliferation: historical background (creation and role of the IAEA and of the EAEC, definitions), principle of statements, inspection process, and French organisation (legal framework, governmental bodies, the IRSN). The last chapter addresses the issue of chemical non proliferation: historical background, international context (Convention on chemical weapons, organisation for their ban), and the French organisation

  5. Note: How Does Product Proliferation Affect Responsiveness?

    OpenAIRE

    Diwakar Gupta; Mandyam M. Srinivasan

    1998-01-01

    In this note we consider some strategies that a manufacturing firm may use to deal with an increase in the variety of products it offers. We indicate how alternate strategies for dealing with product proliferation impact the firm's responsiveness, measured in terms of average production lead time and average work-in-process inventory. Focusing on the make-to-order environment and using queueing models, we derive conditions under which an increase in product variety can improve both individual...

  6. Lawyer Proliferation and the Social Responsibility Model.

    Science.gov (United States)

    Wines, William A.

    1989-01-01

    Drawing on the model of social responsibility that colleges of business have been teaching, the boom in lawyer education is examined. It is argued that law schools are irresponsible in overselling the benefits of law school graduation, creating a surplus of lawyers whose abilities could be used as well elsewhere. (MSE)

  7. Lymphocyte Proliferation Response in Patients with Acute and Chronic Brucellosis

    Directory of Open Access Journals (Sweden)

    Khadijeh Khosravi

    2016-05-01

    Full Text Available Abstract Background: Brucella is an intracellular bacterium that causes chronic infection in humans and domestic animals. The underlying mechanisms that cause prolonged illness are complex and not fully understood. Immune responses may have an important role in the chronicity of infection. Here, we evaluated the lymphocyte proliferation responses in patients with chronic and acute brucellosis. Materials and Methods: This descriptive - analytical study was performed on 22 patients with acute brucellosis, 21 patients with chronic brucellosis and 21 healthy people with the similar age, sex and genetic background as control group. Peripheral lymphocytes were isolated using Ficoll and the cellular proliferation was quantified in presence of antigen and phytohemaglutinin-A by MTT method. Results: The brucella antigen-specific stimulation index in patients with chronic brucellosis was significantly lower than the acute brucellosis patients (p=0.001. Also, stimulating the lymphocytes with phytohemaglutinin-A has shown that proliferative response in patients with chronic brucellosis was lower than the other groups (p=0.04. Conclusion: The results indicated that chronic brucellosis inhibits lymphocyte proliferation. This inhibition of lymphocyte proliferation may be due to the induction of anergy.

  8. Nuclear responses in INTOR plasma stabilization elements

    International Nuclear Information System (INIS)

    Gohar, Y.; Gilligan, J.; Jung, J.; Mattas, R.F.; Miley, G.H.; Wiffen, F.W.; Yang, S.

    1985-01-01

    Nuclear responses in the plasma stabilization elements were studied in a parametric fashion as a part of the transient electromagnetics critical issue C of ETR/INTOR activity. The main responses are neutron fluence and radiation dose in the insulator material, induced resistivity and atomic displacement in the conductor material, nuclear heating and life analysis for the elements. Copper and aluminum conductors with either MgAl 2 O 4 or MgO insulating material were investigated. Radiation damage and life analysis for these elements were also discussed

  9. The finite element response matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-02-01

    A new technique is developed with an alternative formulation of the response matrix method implemented with the finite element scheme. Two types of response matrices are generated from the Galerkin solution to the weak form of the diffusion equation subject to an arbitrary current and source. The piecewise polynomials are defined in two levels, the first for the local (assembly) calculations and the second for the global (core) response matrix calculations. This finite element response matrix technique was tested in two 2-dimensional test problems, 2D-IAEA benchmark problem and Biblis benchmark problem, with satisfatory results. The computational time, whereas the current code is not extensively optimized, is of the same order of the well estabilished coarse mesh codes. Furthermore, the application of the finite element technique in an alternative formulation of response matrix method permits the method to easily incorporate additional capabilities such as treatment of spatially dependent cross-sections, arbitrary geometrical configurations, and high heterogeneous assemblies. (Author) [pt

  10. Integrating Responsive Building Elements in Buildings

    DEFF Research Database (Denmark)

    Haase, Matthias; Amato, Alex; Heiselberg, Per

    2006-01-01

    energy strategies to develop guidelines and procedures for estimation of environmental performance of responsive building elements and integrated building concepts This paper introduces the ideas of this collaborative work and discusses its usefulness for Hong Kong and China. Special focus was put...

  11. The finite element response Matrix method

    International Nuclear Information System (INIS)

    Nakata, H.; Martin, W.R.

    1983-01-01

    A new method for global reactor core calculations is described. This method is based on a unique formulation of the response matrix method, implemented with a higher order finite element method. The unique aspects of this approach are twofold. First, there are two levels to the overall calculational scheme: the local or assembly level and the global or core level. Second, the response matrix scheme, which is formulated at both levels, consists of two separate response matrices rather than one response matrix as is generally the case. These separate response matrices are seen to be quite beneficial for the criticality eigenvalue calculation, because they are independent of k /SUB eff/. The response matrices are generated from a Galerkin finite element solution to the weak form of the diffusion equation, subject to an arbitrary incoming current and an arbitrary distributed source. Calculational results are reported for two test problems, the two-dimensional International Atomic Energy Agency benchmark problem and a two-dimensional pressurized water reactor test problem (Biblis reactor), and they compare well with standard coarse mesh methods with respect to accuracy and efficiency. Moreover, the accuracy (and capability) is comparable to fine mesh for a fraction of the computational cost. Extension of the method to treat heterogeneous assemblies and spatial depletion effects is discussed

  12. Hepatocellular proliferation in response to agonists of peroxisome proliferator-activated receptor alpha: a role for kupffer cells?

    Directory of Open Access Journals (Sweden)

    Cunningham Michael

    2006-01-01

    Full Text Available Abstract Background It has been proposed that PPARα agonists stimulate Kupffer cells in rodents which in turn, release mitogenic factors leading to hepatic hyperplasia, and eventually cancer. However, Kupffer cells do not express PPARα receptors, and PPARα agonists stimulate hepatocellular proliferation in both TNFα- and TNFα receptor-null mice, casting doubt on the involvement of Kupffer cells in the mitogenic response to PPARα agonists. This study was therefore designed to investigate whether the PPARα agonist PFOA and the Kupffer cell inhibitor methylpalmitate produce opposing effects on hepatocellular proliferation and Kupffer cell activity in vivo, in a manner that would implicate these cells in the mitogenic effects of PPARα agonists. Methods Male Sprague-Dawley rats were treated intravenously via the tail vein with methylpalmitate 24 hrs prior to perfluorooctanoic acid (PFOA, and were sacrificed 24 hrs later, one hr after an intraperitoneal injection of bromodeoxyuridine (BrdU. Sera were analyzed for TNFα and IL-1β. Liver sections were stained immunohistochemically and quantified for BrdU incorporated into DNA. Results Data show that PFOA remarkably stimulated hepatocellular proliferation in the absence of significant changes in the serum levels of either TNFα or IL-1β. In addition, methylpalmitate did not alter the levels of these mitogens in PFOA-treated animals, despite the fact that it significantly blocked the hepatocellular proliferative effect of PFOA. Correlation between hepatocellular proliferation and serum levels of TNFα or IL-1β was extremely poor. Conclusion It is unlikely that mechanisms involving Kupffer cells play an eminent role in the hepatic hyperplasia, and consequently hepatocarcinogenicity attributed to PPARα agonists. This conclusion is based on the above mentioned published data and the current findings showing animals treated with PFOA alone or in combination with methylpalmitate to have similar

  13. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno......Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie...

  14. Equine peripheral blood mononuclear cells proliferate in response to tetanus toxoid antigen.

    Science.gov (United States)

    McKelvie, J; Little, S; Foster, A P; Cunningham, F M; Hamblin, A

    1998-01-01

    It has been reported that equine peripheral blood mononuclear cells (PBMNs) do not proliferate in response to tetanus toxoid (TT) (Frayne and Stokes 1995, Research in Veterinary Science 59, 79-81). Here we demonstrate that lymphocyte proliferation responses to TT, which are characteristic of a recall antigen, may be achieved under certain culture conditions. Given that TT vaccination is routinely applied to many horses, TT is a suitable antigen for the investigation of cellular immune responses by peripheral blood mononuclear cells in the horse.

  15. Microglial recruitment, activation, and proliferation in response to primary demyelination

    DEFF Research Database (Denmark)

    Remington, Leah T; Babcock, Alicia A; Zehntner, Simone P

    2007-01-01

    We have characterized the cellular response to demyelination/remyelination in the central nervous system using the toxin cuprizone, which causes reproducible demyelination in the corpus callosum. Microglia were distinguished from macrophages by relative CD45 expression (CD45(dim)) using flow cyto...

  16. Specificity of the peroxisome proliferation response in mussels exposed to environmental pollutants

    International Nuclear Information System (INIS)

    Cajaraville, Miren P.; Ortiz-Zarragoitia, Maren

    2006-01-01

    Peroxisome proliferation has been proposed as novel biomarker of exposure to organic pollutants in aquatic organisms. Peroxisome proliferator compounds comprise a heterogeneous group of substances known for their ability to cause massive proliferation of peroxisomes and liver carcinogenesis in sensitive species such as rodents. Recently, several marine organisms (mussels and fish) have been shown as target species of peroxisome proliferators. In the present work, we aimed to investigate the specificity of the peroxisome proliferation response in mussels. For this purpose, mussels (Mytilus edulis) were exposed for three weeks to North Sea crude oil (NSO), a mixture of NSO, alkylphenols and extra PAHs (MIX), diallylphthalate (DAP), bisphenol-A (BPA) and tetrabromodiphenylether (TBDE), or transplanted for three weeks to four stations showing different copper concentrations in a copper mine. Peroxisome proliferation was assessed by measuring the activity of the peroxisomal β-oxidation enzyme acyl-CoA oxidase (AOX) and the volume density occupied by peroxisomes (V VP ) in the digestive gland. Mussels exposed to NSO and MIX showed significantly increased AOX activities and V VP compared to control animals. Significantly higher V VP was also found in DAP and TBDE exposed mussels. V VP did not vary in mussels transplanted into a copper concentration gradient. Our results confirm the usefulness and specificity of peroxisome proliferation as a suitable biomarker of exposure to organic contaminants such as oil derived hydrocarbons, phthalate plasticizers and polybrominated flame retardants in mussels

  17. n-Alkane and clofibrate, a peroxisome proliferator, activate transcription of ALK2 gene encoding cytochrome P450alk2 through distinct cis-acting promoter elements in Candida maltosa

    International Nuclear Information System (INIS)

    Kogure, Takahisa; Takagi, Masamichi; Ohta, Akinori

    2005-01-01

    The ALK2 gene, encoding one of the n-alkane-hydroxylating cytochromes P450 in Candida maltosa, is induced by n-alkanes and a peroxisome proliferator, clofibrate. Deletion analysis of this gene's promoter revealed two cis-acting elements-an n-alkane-responsive element (ARE2) and a clofibrate-responsive element (CRE2)-that partly overlap in sequence but have distinct functions. ARE2-mediated activation responded to n-alkanes but not to clofibrate and was repressed by glucose. CRE2-mediated activation responded to polyunsaturated fatty acids and steroid hormones as well as to peroxisome proliferators but not to n-alkanes, and it was not repressed by glucose. Both elements mediated activation by oleic acid. Mutational analysis demonstrated that three CCG sequences in CRE2 were critical to the activation by clofibrate as well as to the in vitro binding of a specific protein to this element. These findings suggest that ALK2 is induced by peroxisome proliferators and steroid hormones through a specific CRE2-mediated regulatory mechanism

  18. Regenerative responses after mild heart injuries for cardiomyocyte proliferation in zebrafish

    Science.gov (United States)

    Itou, Junji; Akiyama, Ryutaro; Pehoski, Steve; Yu, Xiaodan; Kawakami, Hiroko; Kawakami, Yasuhiko

    2014-01-01

    Background The zebrafish heart regenerates after various severe injuries. Common processes of heart regeneration are cardiomyocyte proliferation, activation of epicardial tissue and neovascularization. In order to further characterize heart regeneration processes, we introduced milder injuries and compared responses to those induced by ventricular apex resection, a widely used injury method. We used scratching of the ventricular surface and puncturing of the ventricle with a fine tungsten needle as injury inducing techniques. Results Scratching the ventricular surface induced subtle cardiomyocyte proliferation and responses of the epicardium. Endothelial cell accumulation was limited to the surface of the heart. Ventricular puncture induced cardiomyocyte proliferation, endocardial and epicardial activation and neo-vascularization, similar to the resection method. However, the degree of the responses was milder, correlating with milder injury. Sham operation induced epicardial aldh1a2 expression but not tbx18 and WT1. Conclusions Puncturing the ventricle induces responses equivalent to resection at milder degrees in a shorter time frame and would be used as simple injury model. Scratching the ventricle did not induce heart regeneration and would be used for studying wound responses to epicardium. PMID:25074230

  19. Fibroblast response to initial attachment and proliferation on titanium and zirconium surfaces.

    Directory of Open Access Journals (Sweden)

    Araceli Meza-Rodríguez

    2016-08-01

    Full Text Available Introduction: In recent decades, dental implants have become one of the best options for comprehensive dental restoration; their placement is a multidisciplinary task that requires a solid understanding of biological, periodontal, surgical and prosthetic principles. Objective: The aim of this study was to quantify in vitro the adhesion and proliferation of human gingival fibroblasts (HGF response on titanium (Ti and zirconia (Zr surfaces. Methodology: Samples of Ti and Zr were observed under atomic force microscopy (AFM. HGFs were inoculated in each sample to determine adhesion and cell proliferation. The reagent MTT was mixed with medium DMEM and inoculated in each plate; formazan was dissolved with dimethyl sulfoxide and analyzed at 540nm in a microplate spectrophotometer. The test was performed with three independent experiments. Data were analyzed with Kolmogorov-Smirnov tests (Lilliefors, Kruskal-Wallis tests and Mann-Whitney test comparisons. Results: Topography of the Zr plates showed greater roughness (Ra=0.39μm than Ti (Ra=0.049μm. Quantification of HGF adhesion was significantly higher (p<0.05 in Ti, while proliferation showed no statistically significant differences between the groups. Conclusion: It is noteworthy that, even though Ti initially showed increased cell adhesion on the surface, after 24h Zr samples showed similar proliferation; this demonstrates that both surfaces have a comparable biological response.

  20. Dissecting the T Cell Response: Proliferation Assays vs. Cytokine Signatures by ELISPOT

    Directory of Open Access Journals (Sweden)

    Magdalena Tary-Lehmann

    2012-05-01

    Full Text Available Chronic allograft rejection is in part mediated by host T cells that recognize allogeneic antigens on transplanted tissue. One factor that determines the outcome of a T cell response is clonal size, while another is the effector quality. Studies of alloimmune predictors of transplant graft survival have most commonly focused on only one measure of the alloimmune response. Because differing qualities and frequencies of the allospecific T cell response may provide distinctly different information we analyzed the relationship between frequency of soluble antigen and allo-antigen specific memory IFN-g secreting CD4 and CD8 T cells, their ability to secrete IL-2, and their proliferative capacity, while accounting for cognate and bystander proliferation. The results show proliferative responses primarily reflect on IL-2 production by antigen-specific T cells, and that proliferating cells in such assays entail a considerable fraction of bystander cells. On the other hand, proliferation (and IL-2 production did not reflect on the frequency of IFN-γ producing memory cells, a finding particularly accentuated in the CD8 T cell compartment. These data provide rationale for considering both frequency and effector function of pre-transplant T cell reactivity when analyzing immune predictors of graft rejection.

  1. Dissecting the T Cell Response: Proliferation Assays vs. Cytokine Signatures by ELISPOT

    Science.gov (United States)

    Anthony, Donald D.; Milkovich, Kimberly A.; Zhang, Wenji; Rodriguez, Benigno; Yonkers, Nicole L.; Tary-Lehmann, Magdalena; Lehmann, Paul V.

    2012-01-01

    Chronic allograft rejection is in part mediated by host T cells that recognize allogeneic antigens on transplanted tissue. One factor that determines the outcome of a T cell response is clonal size, while another is the effector quality. Studies of alloimmune predictors of transplant graft survival have most commonly focused on only one measure of the alloimmune response. Because differing qualities and frequencies of the allospecific T cell response may provide distinctly different information we analyzed the relationship between frequency of soluble antigen and allo-antigen specific memory IFN-γ secreting CD4 and CD8 T cells, their ability to secrete IL-2, and their proliferative capacity, while accounting for cognate and bystander proliferation. The results show proliferative responses primarily reflect on IL-2 production by antigen-specific T cells, and that proliferating cells in such assays entail a considerable fraction of bystander cells. On the other hand, proliferation (and IL-2 production) did not reflect on the frequency of IFN-γ producing memory cells, a finding particularly accentuated in the CD8 T cell compartment. These data provide rationale for considering both frequency and effector function of pre-transplant T cell reactivity when analyzing immune predictors of graft rejection. PMID:24710419

  2. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    Science.gov (United States)

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  3. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila

    Science.gov (United States)

    Shapiro, Lori R.; Scully, Erin D.; Straub, Timothy J.; Park, Jihye; Stephenson, Andrew G.; Beattie, Gwyn A.; Gleason, Mark L.; Kolter, Roberto; Coelho, Miguel C.; De Moraes, Consuelo M.; Mescher, Mark C.; Zhaxybayeva, Olga

    2016-01-01

    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila’s current ecological niche. PMID:26992913

  4. Seagrass proliferation precedes mortality during hypo-salinity events: a stress-induced morphometric response.

    Directory of Open Access Journals (Sweden)

    Catherine J Collier

    Full Text Available Halophytes, such as seagrasses, predominantly form habitats in coastal and estuarine areas. These habitats can be seasonally exposed to hypo-salinity events during watershed runoff exposing them to dramatic salinity shifts and osmotic shock. The manifestation of this osmotic shock on seagrass morphology and phenology was tested in three Indo-Pacific seagrass species, Halophila ovalis, Halodule uninervis and Zostera muelleri, to hypo-salinity ranging from 3 to 36 PSU at 3 PSU increments for 10 weeks. All three species had broad salinity tolerance but demonstrated a moderate hypo-salinity stress response--analogous to a stress induced morphometric response (SIMR. Shoot proliferation occurred at salinities <30 PSU, with the largest increases, up to 400% increase in shoot density, occurring at the sub-lethal salinities <15 PSU, with the specific salinity associated with peak shoot density being variable among species. Resources were not diverted away from leaf growth or shoot development to support the new shoot production. However, at sub-lethal salinities where shoots proliferated, flowering was severely reduced for H. ovalis, the only species to flower during this experiment, demonstrating a diversion of resources away from sexual reproduction to support the investment in new shoots. This SIMR response preceded mortality, which occurred at 3 PSU for H. ovalis and 6 PSU for H. uninervis, while complete mortality was not reached for Z. muelleri. This is the first study to identify a SIMR in seagrasses, being detectable due to the fine resolution of salinity treatments tested. The detection of SIMR demonstrates the need for caution in interpreting in-situ changes in shoot density as shoot proliferation could be interpreted as a healthy or positive plant response to environmental conditions, when in fact it could signal pre-mortality stress.

  5. Implication of unfolded protein response in resveratrol-induced inhibition of K562 cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Bao-Qin; Gao, Yan-Yan; Niu, Xiao-Fang [Department of Biochemistry and Molecular Biology, China Medical University, Shenyang 110001 (China); Xie, Ji-Sheng [Youjiang Medical College for Nationalities, Guangxi 533000 (China); Meng, Xin; Guan, Yifu [Department of Biochemistry and Molecular Biology, China Medical University, Shenyang 110001 (China); Wang, Hua-Qin, E-mail: wanghq_doctor@hotmail.com [Department of Biochemistry and Molecular Biology, China Medical University, Shenyang 110001 (China)

    2010-01-01

    Resveratrol (RES), a natural plant polyphenol, is an effective inducer of cell cycle arrest and apoptosis in a variety of carcinoma cell types. In addition, RES has been reported to inhibit tumorigenesis in several animal models suggesting that it functions as a chemopreventive and anti-tumor agent in vivo. The chemopreventive and chemotherapeutic properties associated with resveratrol offer promise for the design of new chemotherapeutic agents. However, the mechanisms by which RES mediates its effects are not yet fully understood. In this study, we showed that RES caused cell cycle arrest and proliferation inhibition via induction of unfolded protein response (UPR) in human leukemia K562 cell line. Treatment of K562 cells with RES induced a number of signature UPR markers, including transcriptional induction of GRP78 and CHOP, phosphorylation of eukaryotic initiation factor 2{alpha} (eIF2{alpha}), ER stress-specific XBP-1 splicing, suggesting the induction of UPR by RES. RES inhibited proliferation of K562 in a concentration-dependent manner. Flow cytometric analyses revealed that K562 cells were arrested in G1 phase upon RES treatment. Salubrinal, an eIF2{alpha} inhibitor, or overexpression of dominant negative mutants of PERK or eIF2{alpha}, effectively restored RES-induced cell cycle arrest, underscoring the important role of PERK/eIF2{alpha} branch of UPR in RES-induced inhibition of cell proliferation.

  6. Implication of unfolded protein response in resveratrol-induced inhibition of K562 cell proliferation

    International Nuclear Information System (INIS)

    Liu, Bao-Qin; Gao, Yan-Yan; Niu, Xiao-Fang; Xie, Ji-Sheng; Meng, Xin; Guan, Yifu; Wang, Hua-Qin

    2010-01-01

    Resveratrol (RES), a natural plant polyphenol, is an effective inducer of cell cycle arrest and apoptosis in a variety of carcinoma cell types. In addition, RES has been reported to inhibit tumorigenesis in several animal models suggesting that it functions as a chemopreventive and anti-tumor agent in vivo. The chemopreventive and chemotherapeutic properties associated with resveratrol offer promise for the design of new chemotherapeutic agents. However, the mechanisms by which RES mediates its effects are not yet fully understood. In this study, we showed that RES caused cell cycle arrest and proliferation inhibition via induction of unfolded protein response (UPR) in human leukemia K562 cell line. Treatment of K562 cells with RES induced a number of signature UPR markers, including transcriptional induction of GRP78 and CHOP, phosphorylation of eukaryotic initiation factor 2α (eIF2α), ER stress-specific XBP-1 splicing, suggesting the induction of UPR by RES. RES inhibited proliferation of K562 in a concentration-dependent manner. Flow cytometric analyses revealed that K562 cells were arrested in G1 phase upon RES treatment. Salubrinal, an eIF2α inhibitor, or overexpression of dominant negative mutants of PERK or eIF2α, effectively restored RES-induced cell cycle arrest, underscoring the important role of PERK/eIF2α branch of UPR in RES-induced inhibition of cell proliferation.

  7. Characteristic and analysis of structural elements of corporate social responsibility

    Directory of Open Access Journals (Sweden)

    J. S. Bilonog

    2015-04-01

    Full Text Available In this article attention is focused on social responsibility of business and on necessity to estimate its condition in Ukraine. Materials regarding elements and the principles of corporate social responsibility are structured. On this basis unification of quantitative elements of business social responsibility is offered according to which it is possible to carry out the analysis of the non­financial reporting. It is proposed to use not only quantitative techniques of data analysis but also refer to the qualitative ones. As a result of this, the analysis of social reports will be more productive and would minimize subjectivity of the researcher or representatives of the company which are responsible for presenting the information to the general public. The basic principles by which the companies can realize the strategy of corporate social responsibility are considered. Due to the empirical analysis of corporate reports expediency to use specified elements is proved. Reports of the companies in producing and non­productive sector are analyzed in more detail; features of displaying information on corporate social responsibility are defined. The attention to need of carrying out monitoring researches in the sphere of the corporate social reporting is updated.

  8. Phosphatidylinositol response and proliferation of oxidative enzyme-activated human T lymphocytes: suppression by plasma lipoproteins

    International Nuclear Information System (INIS)

    Akeson, A.L.; Scupham, D.W.; Harmony, J.A.

    1984-01-01

    The phosphatidylinositol (PI) response and DNA synthesis of neuraminidase and galactose oxidase (NAGO)-stimulated human T lymphocytes are suppressed by low density lipoproteins (LDL). To understand the mechanism of lymphocyte activation more fully, the PI response and DNA synthesis and suppression of these events by LDL in NAGO-stimulated T lymphocytes were characterized. Between 30 min and 6 hr after NAGO stimulation, there was an increase of 32 Pi incorporation into PI without increased incorporation into the phosphorylated forms of PI or into other phospholipids. DNA synthesis as determined by [ 3 H]thymidine incorporation depended on the lymphocyte-accessory monocyte ratio and total cell density. Optimal stimulation of the PI response and DNA synthesis occurred at the same concentration of neuraminidase and galactose oxidase. While the PI response was only partially suppressed by LDL with optimal suppression at 10 to 20 micrograms of protein/ml, DNA synthesis was completely suppressed although at much higher LDL concentrations, greater than 100 micrograms protein/ml. As monocyte numbers are increased, LDL suppression of DNA synthesis is decreased. The ability of NAGO to stimulate the PI response and DNA synthesis in a similar way, and the suppression of both events by LDL, suggests the PI response is important for lymphocyte activation and proliferation. Stimulation of human T lymphocytes by oxidative mitogens, neuraminidase, and galactose oxidase caused increased phosphatidylinositol metabolism and increased DNA synthesis. Both responses were suppressed by low density lipoproteins

  9. Modelling the interplay between hypoxia and proliferation in radiotherapy tumour response

    International Nuclear Information System (INIS)

    Jeong, J; Deasy, J O; Shoghi, K I

    2013-01-01

    A tumour control probability computational model for fractionated radiotherapy was developed, with the goal of incorporating the fundamental interplay between hypoxia and proliferation, including reoxygenation over a course of radiotherapy. The fundamental idea is that the local delivery of oxygen and glucose limits the amount of proliferation and metabolically-supported cell survival a tumour sub-volume can support. The model has three compartments: a proliferating compartment of cells receiving oxygen and glucose; an intermediate, metabolically-active compartment receiving glucose; and a highly hypoxic compartment of starving cells. Following the post-mitotic cell death of proliferating cells, intermediate cells move into the proliferative compartment and hypoxic cells move into the intermediate compartment. A key advantage of the proposed model is that the initial compartmental cell distribution is uniquely determined from the assumed local growth fraction (GF) and volume doubling time (T D ) values. Varying initial cell state distributions, based on the local (voxel) GF and T D , were simulated. Tumour response was simulated for head and neck squamous cell carcinoma using relevant parameter values based on published sources. The tumour dose required to achieve a 50% local control rate (TCD 50 ) was found for various GFs and T D ’s, and the effect of fraction size on TCD 50 was also evaluated. Due to the advantage of reoxygenation over a course of radiotherapy, conventional fraction sizes (2–2.4 Gy fx −1 ) were predicted to result in smaller TCD 50 's than larger fraction sizes (4–5 Gy fx –1 ) for a 10 cc tumour with GFs of around 0.15. The time to eliminate hypoxic cells (the reoxygenation time) was estimated for a given GF and decreased as GF increased. The extra dose required to overcome accelerated stem cell accumulation in longer treatment schedules was estimated to be 0.68 Gy/day (in EQD2 6.6 ), similar to published values derived from clinical

  10. Elements of a national emergency response system for nuclear accidents

    International Nuclear Information System (INIS)

    Dickerson, M.H.

    1987-01-01

    The purpose of this paper is to suggest elements for a general emergency response system, employed at a national level, to detect, evaluate and assess the consequences of a radiological atmospheric release occurring within or outside of national boundaries. These elements are focused on the total aspect of emergency response ranging from providing an initial alarm to a total assessment of the environmental and health effects. Elements of the emergency response system are described in such a way that existing resources can be directly applied if appropriate; if not, newly developed or an expansion of existing resources can be employed. The major thrust of this paper is toward a philosophical discussion and general description of resources that would be required to implementation. If the major features of this proposal system are judged desirable for implementation, then the next level of detail can be added. The philosophy underlying this paper is preparedness - preparedness through planning, awareness and the application of technology. More specifically, it is establishment of reasonable guidelines including the definition of reference and protective action levels for public exposure to accidents involving nuclear material; education of the public, government officials and the news media; and the application of models and measurements coupled to computer systems to address a series of questions related to emergency planning, response and assessment. It is the role of a proven national emergency response system to provide reliable, quality-controlled information to decision makers for the management of environmental crises

  11. Specificity determinants for the abscisic acid response element ?

    OpenAIRE

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interac...

  12. ABFs, a family of ABA-responsive element binding factors.

    Science.gov (United States)

    Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y

    2000-01-21

    Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.

  13. Regulation of Cancer Cell Responsiveness to Ionizing Radiation Treatment by Cyclic AMP Response Element Binding Nuclear Transcription Factor

    Directory of Open Access Journals (Sweden)

    Francesca D’Auria

    2017-05-01

    Full Text Available Cyclic AMP response element binding (CREB protein is a member of the CREB/activating transcription factor (ATF family of transcription factors that play an important role in the cell response to different environmental stimuli leading to proliferation, differentiation, apoptosis, and survival. A number of studies highlight the involvement of CREB in the resistance to ionizing radiation (IR therapy, demonstrating a relationship between IR-induced CREB family members’ activation and cell survival. Consistent with these observations, we have recently demonstrated that CREB and ATF-1 are expressed in leukemia cell lines and that low-dose radiation treatment can trigger CREB activation, leading to survival of erythro-leukemia cells (K562. On the other hand, a number of evidences highlight a proapoptotic role of CREB following IR treatment of cancer cells. Since the development of multiple mechanisms of resistance is one key problem of most malignancies, including those of hematological origin, it is highly desirable to identify biological markers of responsiveness/unresponsiveness useful to follow-up the individual response and to adjust anticancer treatments. Taking into account all these considerations, this mini-review will be focused on the involvement of CREB/ATF family members in response to IR therapy, to deepen our knowledge of this topic, and to pave the way to translation into a therapeutic context.

  14. Spectral response of multi-element silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Ludewigt, B.A.; Rossington, C.S.; Chapman, K. [Univ. of California, Berkeley, CA (United States)

    1997-04-01

    Multi-element silicon strip detectors, in conjunction with integrated circuit pulse-processing electronics, offer an attractive alternative to conventional lithium-drifted silicon Si(Li) and high purity germanium detectors (HPGe) for high count rate, low noise synchrotron x-ray fluorescence applications. One of the major differences between the segmented Si detectors and the commercially available single-element Si(Li) or HPGe detectors is that hundreds of elements can be fabricated on a single Si substrate using standard silicon processing technologies. The segmentation of the detector substrate into many small elements results in very low noise performance at or near, room temperature, and the count rate of the detector is increased many-fold due to the multiplication in the total number of detectors. Traditionally, a single channel of detector with electronics can handle {approximately}100 kHz count rates while maintaining good energy resolution; the segmented detectors can operate at greater than MHz count rates merely due to the multiplication in the number of channels. One of the most critical aspects in the development of the segmented detectors is characterizing the charge sharing and charge loss that occur between the individual detector strips, and determining how these affect the spectral response of the detectors.

  15. Finite element simulation of impact response of wire mesh screens

    Directory of Open Access Journals (Sweden)

    Wang Caizheng

    2015-01-01

    Full Text Available In this paper, the response of wire mesh screens to low velocity impact with blunt objects is investigated using finite element (FE simulation. The woven wire mesh is modelled with homogeneous shell elements with equivalent smeared mechanical properties. The mechanical behaviour of the woven wire mesh was determined experimentally with tensile tests on steel wire mesh coupons to generate the data for the smeared shell material used in the FE. The effects of impacts with a low mass (4 kg and a large mass (40 kg providing the same impact energy are studied. The joint between the wire mesh screen and the aluminium frame surrounding it is modelled using contact elements with friction between the corresponding elements. Damage to the screen of different types compromising its structural integrity, such as mesh separation and pulling out from the surrounding frame is modelled. The FE simulation is validated with results of impact tests conducted on woven steel wire screen meshes.

  16. A proliferation saturation index to predict radiation response and personalize radiotherapy fractionation

    International Nuclear Information System (INIS)

    Prokopiou, Sotiris; Moros, Eduardo G.; Poleszczuk, Jan; Caudell, Jimmy; Torres-Roca, Javier F.; Latifi, Kujtim; Lee, Jae K.; Myerson, Robert; Harrison, Louis B.; Enderling, Heiko

    2015-01-01

    Although altered protocols that challenge conventional radiation fractionation have been tested in prospective clinical trials, we still have limited understanding of how to select the most appropriate fractionation schedule for individual patients. Currently, the prescription of definitive radiotherapy is based on the primary site and stage, without regard to patient-specific tumor or host factors that may influence outcome. We hypothesize that the proportion of radiosensitive proliferating cells is dependent on the saturation of the tumor carrying capacity. This may serve as a prognostic factor for personalized radiotherapy (RT) fractionation. We introduce a proliferation saturation index (PSI), which is defined as the ratio of tumor volume to the host-influenced tumor carrying capacity. Carrying capacity is as a conceptual measure of the maximum volume that can be supported by the current tumor environment including oxygen and nutrient availability, immune surveillance and acidity. PSI is estimated from two temporally separated routine pre-radiotherapy computed tomography scans and a deterministic logistic tumor growth model. We introduce the patient-specific pre-treatment PSI into a model of tumor growth and radiotherapy response, and fit the model to retrospective data of four non-small cell lung cancer patients treated exclusively with standard fractionation. We then simulate both a clinical trial hyperfractionation protocol and daily fractionations, with equal biologically effective dose, to compare tumor volume reduction as a function of pretreatment PSI. With tumor doubling time and radiosensitivity assumed constant across patients, a patient-specific pretreatment PSI is sufficient to fit individual patient response data (R 2 = 0.98). PSI varies greatly between patients (coefficient of variation >128 %) and correlates inversely with radiotherapy response. For this study, our simulations suggest that only patients with intermediate PSI (0.45–0.9) are

  17. Antioxidant response elements: Discovery, classes, regulation and potential applications

    Directory of Open Access Journals (Sweden)

    Azhwar Raghunath

    2018-07-01

    Full Text Available Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs, which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Keywords: Antioxidant response elements, Antioxidant genes, ARE-reporter constructs, ARE SNPs, Keap1/Nrf2/ARE pathway, Oxidative stress

  18. A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

    Science.gov (United States)

    Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

    2012-01-01

    Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

  19. Role of the peroxisome proliferator-activated receptor α in responses to diisononyl phthalate

    International Nuclear Information System (INIS)

    Valles, Edith G.; Laughter, Ashley R.; Dunn, Corrie S.; Cannelle, Sabine; Swanson, Cynthia L.; Cattley, Russell C.; Corton, J. Christopher

    2003-01-01

    Diisononyl phthalate (DINP) is a compound widely used as a plasticizer in the production of polyvinyl chloride products. Chronic exposure to DINP leads to liver cancer in rats and mice. Many phthalates are considered to be relatively weak peroxisome proliferators (PP), a group of rodent hepatocarcinogens that cause a variety of adaptive responses in liver through the PP-activated receptor alpha (PPARα). The objectives of this study were to determine whether DINP-induced effects in the liver associated with carcinogenesis are mediated by PPARα and to identify novel gene targets of DINP. Male and female SV129 wild-type, SV129 PPARα-null, and B6C3F1 mice were administered DINP by gavage or in the feed. Transcript profile technology and reverse transcriptase (RT)-polymerase chain reaction (PCR) were used to identify gene targets. Dose-dependent increases in relative liver weights were dependent on PPARα in 10- or 12-week-old male and female mice and 30-week-old male mice. Female 30-week-old mice exhibited PPARα-independent increases in relative liver weights. Increases in hepatocyte proliferation, palmitoyl-CoA oxidase (PCO) activity, and levels of enzymes involved in β- and ω-oxidation of fatty acids were shown to be dependent on PPARα. Five novel genes were shown to be altered in the livers of female wild-type mice after a 3-week exposure, but not in PPARα-null, mice. These genes included those involved in DNA repair and recombination (ATP-dependent helicase and Endonuclease III homolog), drug metabolism (Cyp2a4) and protein trafficking (FKBP-1, FKBP-13). An additional gene (Cyp2d9) was shown to be down-regulated in wild-type mice but up-regulated in PPARα-null mice indicating more complex regulation by PPARα and additional factors. These data support the hypothesis that PPARα plays a dominant role in mediating the effects associated with hepatocarcinogenesis after DINP exposure

  20. Phosphorylation at tyrosine 114 of Proliferating Cell Nuclear Antigen (PCNA) is required for adipogenesis in response to high fat diet

    Energy Technology Data Exchange (ETDEWEB)

    Lo, Yuan-Hung; Ho, Po-Chun; Chen, Min-Shan; Hugo, Eric; Ben-Jonathan, Nira [Department of Cancer Biology, University of Cincinnati College of Medicine, 3125 Eden Avenue, Cincinnati, OH 45267-0521 (United States); Department of Environmental Health, University of Cincinnati College of Medicine, 3223 Eden Avenue, Kettering Laboratory, Cincinnati, OH 45267-0056 (United States); Wang, Shao-Chun, E-mail: shao-chun.wang@uc.edu [Department of Cancer Biology, University of Cincinnati College of Medicine, 3125 Eden Avenue, Cincinnati, OH 45267-0521 (United States); Department of Environmental Health, University of Cincinnati College of Medicine, 3223 Eden Avenue, Kettering Laboratory, Cincinnati, OH 45267-0056 (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Proliferating Cell Nuclear Antigen (PCNA) is phosphorylated at Y114. Black-Right-Pointing-Pointer Phospho-Y114 of PCNA is not required for cell proliferation for normal growth. Black-Right-Pointing-Pointer MCE during adipogenesis is abolished in the lack of the phosphorylation. Black-Right-Pointing-Pointer Homozygous Y114F mice are resistant to high fat diet induced obesity. Black-Right-Pointing-Pointer Our results shed light on the interface between proliferation and differentiation. -- Abstract: Clonal proliferation is an obligatory component of adipogenesis. Although several cell cycle regulators are known to participate in the transition between pre-adipocyte proliferation and terminal adipocyte differentiation, how the core DNA synthesis machinery is coordinately regulated in adipogenesis remains elusive. PCNA (Proliferating Cell Nuclear Antigen) is an indispensable component for DNA synthesis during proliferation. Here we show that PCNA is subject to phosphorylation at the highly conserved tyrosine residue 114 (Y114). Replacing the Y114 residue with phenylalanine (Y114F), which is structurally similar to tyrosine but cannot be phosphorylated, does not affect normal animal development. However, when challenged with high fat diet, mice carrying homozygous Y114F alleles (PCNA{sup F/F}) are resistant to adipose tissue enlargement in comparison to wild-type (WT) mice. Mouse embryonic fibroblasts (MEFs) harboring WT or Y114F mutant PCNA proliferate at similar rates. However, when subjected to adipogenesis induction in culture, PCNA{sup F/F} MEFs are not able to re-enter the cell cycle and fail to form mature adipocytes, while WT MEFs undergo mitotic clonal expansion in response to the adipogenic stimulation, accompanied by enhanced Y114 phosphorylation of PCNA, and differentiate to mature adipocytes. Consistent with the function of Y114 phosphorylation in clonal proliferation in adipogenesis, fat tissues isolated from WT

  1. Antioxidant response elements: Discovery, classes, regulation and potential applications.

    Science.gov (United States)

    Raghunath, Azhwar; Sundarraj, Kiruthika; Nagarajan, Raju; Arfuso, Frank; Bian, Jinsong; Kumar, Alan P; Sethi, Gautam; Perumal, Ekambaram

    2018-07-01

    Exposure to antioxidants and xenobiotics triggers the expression of a myriad of genes encoding antioxidant proteins, detoxifying enzymes, and xenobiotic transporters to offer protection against oxidative stress. This articulated universal mechanism is regulated through the cis-acting elements in an array of Nrf2 target genes called antioxidant response elements (AREs), which play a critical role in redox homeostasis. Though the Keap1/Nrf2/ARE system involves many players, AREs hold the key in transcriptional regulation of cytoprotective genes. ARE-mediated reporter constructs have been widely used, including xenobiotics profiling and Nrf2 activator screening. The complexity of AREs is brought by the presence of other regulatory elements within the AREs. The diversity in the ARE sequences not only bring regulatory selectivity of diverse transcription factors, but also confer functional complexity in the Keap1/Nrf2/ARE pathway. The different transcription factors either homodimerize or heterodimerize to bind the AREs. Depending on the nature of partners, they may activate or suppress the transcription. Attention is required for deeper mechanistic understanding of ARE-mediated gene regulation. The computational methods of identification and analysis of AREs are still in their infancy. Investigations are required to know whether epigenetics mechanism plays a role in the regulation of genes mediated through AREs. The polymorphisms in the AREs leading to oxidative stress related diseases are warranted. A thorough understanding of AREs will pave the way for the development of therapeutic agents against cancer, neurodegenerative, cardiovascular, metabolic and other diseases with oxidative stress. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Specificity determinants for the abscisic acid response element.

    Science.gov (United States)

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  3. Increased cellular proliferation in rat skeletal muscle and tendon in response to exercise

    DEFF Research Database (Denmark)

    Skovgaard, Dorthe; Bayer, Monika L; Mackey, Abigail

    2010-01-01

    PURPOSE: The purpose of this study is to investigate exercise-induced cellular proliferation in rat skeletal muscle/tendon with the use of 3'-[F-18]fluoro-3'deoxythymidine (FLT) and to quantitatively study concomitant changes in the proliferation-associated factor, Ki67. PROCEDURES: Wistar rats (...... = 13) performed 3 days of treadmill running. Cellular proliferation was investigated 3 days before and 48 h after the running exercise with the use of FLT and positron emission tomography/computed tomography (PET/CT). Results were compared to a sedentary control group (n = 10). Image......-derived results were supported by a correlation in calf muscle to Ki67 (protein and mRNA level), while this coherence was not found in tendon. CONCLUSION: FLT-PET seems to be a promising tool for imaging of exercise-induced cellular proliferation in musculo-tendinous tissue....

  4. The yeast genome may harbor hypoxia response elements (HRE).

    Science.gov (United States)

    Ferreira, Túlio César; Hertzberg, Libi; Gassmann, Max; Campos, Elida Geralda

    2007-01-01

    The hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription factor activated when cells are submitted to hypoxia. The heterodimer is composed of two subunits, HIF-1alpha and the constitutively expressed HIF-1beta. During normoxia, HIF-1alpha is degraded by the 26S proteasome, but hypoxia causes HIF-1alpha to be stabilized, enter the nucleus and bind to HIF-1beta, thus forming the active complex. The complex then binds to the regulatory sequences of various genes involved in physiological and pathological processes. The specific regulatory sequence recognized by HIF-1 is the hypoxia response element (HRE) that has the consensus sequence 5'BRCGTGVBBB3'. Although the basic transcriptional regulation machinery is conserved between yeast and mammals, Saccharomyces cerevisiae does not express HIF-1 subunits. However, we hypothesized that baker's yeast has a protein analogous to HIF-1 which participates in the response to changes in oxygen levels by binding to HRE sequences. In this study we screened the yeast genome for HREs using probabilistic motif search tools. We described 24 yeast genes containing motifs with high probability of being HREs (p-value<0.1) and classified them according to biological function. Our results show that S. cerevisiae may harbor HREs and indicate that a transcription factor analogous to HIF-1 may exist in this organism.

  5. Nuclear fuel cycle industry. A responsible approach supporting non proliferation efforts in global perspective

    International Nuclear Information System (INIS)

    Jorant, Caroline

    2005-01-01

    This paper presents the reasons why and the manner in which nuclear industry is a stakeholder in non proliferation efforts. It then presents some recent proposals on multinational approaches to the fuel cycle industry and offers some comments and an industry view on these issues. A parallel is established with fundamental concepts in the field of radiation protection. Our industry, involved in 'nuclear technology development' (activities) qualified of 'sensitive' from a non proliferation standpoint, has major interests at stake in the evolution of the international non proliferation regime and is genuinely committed to the spreading of a non proliferation culture. The international community and in particular the nuclear community have been recently reflecting on ways to strengthen the non-proliferation regime in reaction to new threats or the perception thereof. Multilateral approaches regarding the nuclear fuel cycle are being discussed or proposed in this regard. Our approach as an industrial may be illustrated using the three basic principles developed in the field of radiation protection, namely limitation, justification and optimization. a) an overall limitation of sensitive facilities worldwide may be judicious, b) however no prohibition should be imposed if justified needs can be demonstrated on objective criteria, c) optimized used for existing facilities should be promoted through strengthened guarantees of supply where it may be necessary. (author)

  6. Autocrine regulation of human urothelial cell proliferation and migration during regenerative responses in vitro

    International Nuclear Information System (INIS)

    Varley, Claire; Hill, Gemma; Pellegrin, Stephanie; Shaw, Nicola J.; Selby, Peter J.; Trejdosiewicz, Ludwik K.; Southgate, Jennifer

    2005-01-01

    Regeneration of the urothelium is rapid and effective in order to maintain a barrier to urine following tissue injury. Whereas normal human urothelial (NHU) cells are mitotically quiescent and G0 arrested in situ, they rapidly enter the cell cycle upon seeding in primary culture and show reversible growth arrest at confluency. We have used this as a model to investigate the role of EGF receptor signaling in urothelial regeneration and wound-healing. Transcripts for HER-1, HER-2, and HER-3 were expressed by quiescent human urothelium in situ. Expression of HER-1 was upregulated in proliferating cultures, whereas HER-2 and HER-3 were more associated with a growth-arrested phenotype. NHU cells could be propagated in the absence of exogenous EGF, but autocrine signaling through HER-1 via the MAPK and PI3-kinase pathways was essential for proliferation and migration during urothelial wound repair. HB-EGF was expressed by urothelium in situ and HB-EGF, epiregulin, TGF-α, and amphiregulin were expressed by proliferating NHU cells. Urothelial wound repair in vitro was attenuated by neutralizing antibodies against HER-1 ligands, particularly amphiregulin. By contrast, the same ligands applied exogenously promoted migration, but inhibited proliferation, implying that HER-1 ligands provoke differential effects in NHU cells depending upon whether they are presented as soluble or juxtacrine ligands. We conclude that proliferation and migration during wound healing in NHU cells are mediated through an EGFR autocrine signalling loop and our results implicate amphiregulin as a key mediator

  7. Atractylenolide I restores HO-1 expression and inhibits Ox-LDL-induced VSMCs proliferation, migration and inflammatory responses in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weifeng, E-mail: liwf@mail.xjtu.edu.cn; Zhi, Wenbing; Liu, Fang; He, Zehong; Wang, Xiuei; Niu, Xiaofeng, E-mail: niuxf@mail.xjtu.edu.cn

    2017-04-01

    Pathogenesis of atherosclerosis is characterized by the proliferation and migration of vascular smooth muscle cells (VSMCs) and inflammatory lesions. The aim of this study is to elucidate the effect of atractylenolide I (AO-I) on smooth muscle cell inflammation, proliferation and migration induced by oxidized modified low density lipoprotein (Ox-LDL). Here, We found that atractylenolide I inhibited Ox-LDL-induced VSMCs proliferation and migration in a dose-dependent manner, and decreased the production of inflammatory cytokines and the expression of monocyte chemoattractant protein-1 (MCP-1) in VSMCs. The study also identified that AO-I prominently inhibited p38-MAPK and NF-κB activation. More importantly, the specific heme oxygenase-1 (HO-1) inhibitor zinc protoporphyrin (ZnPP) IX partially abolished the beneficial effects of atractylenolide I on Ox-LDL-induced VSMCs. Furthermore, atractylenolide I blocked the foam cell formation in macrophages induced by Ox-LDL. In summary, inhibitory roles of AO-I in VSMCs proliferation and migration, lipid peroxidation and subsequent inflammatory responses might contribute to the anti-atherosclerotic property of AO-I. - Highlights: • AO-I inhibited Ox-LDL-induced VSMCs proliferation and migration. • AO-I alleviated inflammatory response via inhibiting TNF-α, IL-6 and NO production. • AO-I restored HO-1 expression and down-regulated PCNA expression. • MCP-1 overexpression is potentially regulated by NF-κB and p38 MAPK pathway. • AO-I possesses strong anti-lipid peroxidation effect.

  8. Lichen Parmelia sulcata time response model to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Transplants of lichen Parmelia sulcata collected in an area previously identified as non polluted, were placed at six stations, five of which were near Power Plants and the other in an area expected to be a remote station. Together with the lichen transplants, two total deposition collection buckets and an aerosol sampler were installed. Lichens were recollected two every month from each station. At the same time the water collection buckets were replaced by new ones. The aerosol sampler filter was replaced every week, collection being effective only for 10 minutes out of every two hours; in the remote station aerosol filters were replaced only once a month, the collection rate being kept. Each station was run for a period of one year. Both lichens and aerosol filters were analysed by PIXE and INAA at ITN. Total deposition samples were dried under an infrared lamp, and afterwards acid digested and analysed by ICP-MS at the National Geological Survey of The Netherlands. Data for the three types of samples were then produced for a total of 16 elements. In this work we used the data set thus obtained to test a model for the time response of lichen Parmelia sulcata to a new environment. (author)

  9. Nutrient-Deprived Retinal Progenitors Proliferate in Response to Hypoxia: Interaction of the HIF-1 and mTOR Pathway

    Directory of Open Access Journals (Sweden)

    Helena Khaliullina

    2016-05-01

    Full Text Available At a cellular level, nutrients are sensed by the mechanistic Target of Rapamycin (mTOR. The response of cells to hypoxia is regulated via action of the oxygen sensor Hypoxia-Inducible Factor 1 (HIF-1. During development, injury and disease, tissues might face conditions of both low nutrient supply and low oxygen, yet it is not clear how cells adapt to both nutrient restriction and hypoxia, or how mTOR and HIF-1 interact in such conditions. Here we explore this question in vivo with respect to cell proliferation using the ciliary marginal zone (CMZ of Xenopus. We found that both nutrient-deprivation and hypoxia cause retinal progenitors to decrease their proliferation, yet when nutrient-deprived progenitors are exposed to hypoxia there is an unexpected rise in cell proliferation. This increase, mediated by HIF-1 signalling, is dependent on glutaminolysis and reactivation of the mTOR pathway. We discuss how these findings in non-transformed tissue may also shed light on the ability of cancer cells in poorly vascularised solid tumours to proliferate.

  10. LXR signaling couples sterol metabolism to proliferation in the acquired immune response

    NARCIS (Netherlands)

    Bensinger, Steven J.; Bradley, Michelle N.; Joseph, Sean B.; Zelcer, Noam; Janssen, Edith M.; Hausner, Mary Ann; Shih, Roger; Parks, John S.; Edwards, Peter A.; Jamieson, Beth D.; Tontonoz, Peter

    2008-01-01

    Cholesterol is essential for membrane synthesis; however, the mechanisms that link cellular lipid metabolism to proliferation are incompletely understood. We demonstrate here that cellular cholesterol levels in dividing T cells are maintained in part through reciprocal regulation of the LXR and

  11. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters.

    Science.gov (United States)

    Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo

    2005-02-01

    cis-Acting regulatory elements are important molecular switches involved in the transcriptional regulation of a dynamic network of gene activities controlling various biological processes, including abiotic stress responses, hormone responses and developmental processes. In particular, understanding regulatory gene networks in stress response cascades depends on successful functional analyses of cis-acting elements. The ever-improving accuracy of transcriptome expression profiling has led to the identification of various combinations of cis-acting elements in the promoter regions of stress-inducible genes involved in stress and hormone responses. Here we discuss major cis-acting elements, such as the ABA-responsive element (ABRE) and the dehydration-responsive element/C-repeat (DRE/CRT), that are a vital part of ABA-dependent and ABA-independent gene expression in osmotic and cold stress responses.

  12. ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent.

    Science.gov (United States)

    Hobo, T; Asada, M; Kowyama, Y; Hattori, T

    1999-09-01

    ACGT-containing ABA response elements (ABREs) have been functionally identified in the promoters of various genes. In addition, single copies of ABRE have been found to require a cis-acting, coupling element to achieve ABA induction. A coupling element 3 (CE3) sequence, originally identified as such in the barley HVA1 promoter, is found approximately 30 bp downstream of motif A (ACGT-containing ABRE) in the promoter of the Osem gene. The relationship between these two elements was further defined by linker-scan analyses of a 55 bp fragment of the Osem promoter, which is sufficient for ABA-responsiveness and VP1 activation. The analyses revealed that both motif A and CE3 sequence were required not only for ABA-responsiveness but also for VP1 activation. Since the sequences of motif A and CE3 were found to be similar, motif-exchange experiments were carried out. The experiments demonstrated that motif A and CE3 were interchangeable by each other with respect to both ABA and VP1 regulation. In addition, both sequences were shown to be recognized by a VP1-interacting, ABA-responsive bZIP factor TRAB1. These results indicate that ACGT-containing ABREs and CE3 are functionally equivalent cis-acting elements. Furthermore, TRAB1 was shown to bind two other non-ACGT ABREs. Based on these results, all these ABREs including CE3 are proposed to be categorized into a single class of cis-acting elements.

  13. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Directory of Open Access Journals (Sweden)

    Cheng Wang

    Full Text Available The proliferating cell nuclear antigen (PCNA is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2 enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2.Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays.We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  14. Two estrogen response element sequences near the PCNA gene are not responsible for its estrogen-enhanced expression in MCF7 cells.

    Science.gov (United States)

    Wang, Cheng; Yu, Jie; Kallen, Caleb B

    2008-01-01

    The proliferating cell nuclear antigen (PCNA) is an essential component of DNA replication, cell cycle regulation, and epigenetic inheritance. High expression of PCNA is associated with poor prognosis in patients with breast cancer. The 5'-region of the PCNA gene contains two computationally-detected estrogen response element (ERE) sequences, one of which is evolutionarily conserved. Both of these sequences are of undocumented cis-regulatory function. We recently demonstrated that estradiol (E2) enhances PCNA mRNA expression in MCF7 breast cancer cells. MCF7 cells proliferate in response to E2. Here, we demonstrate that E2 rapidly enhanced PCNA mRNA and protein expression in a process that requires ERalpha as well as de novo protein synthesis. One of the two upstream ERE sequences was specifically bound by ERalpha-containing protein complexes, in vitro, in gel shift analysis. Yet, each ERE sequence, when cloned as a single copy, or when engineered as two tandem copies of the ERE-containing sequence, was not capable of activating a luciferase reporter construct in response to E2. In MCF7 cells, neither ERE-containing genomic region demonstrated E2-dependent recruitment of ERalpha by sensitive ChIP-PCR assays. We conclude that E2 enhances PCNA gene expression by an indirect process and that computational detection of EREs, even when evolutionarily conserved and when near E2-responsive genes, requires biochemical validation.

  15. Potential role of peroxisome proliferator activated receptor gamma activation on serum visfatin and trace elements in high fat diet induced type 2 diabetes mellitus.

    Science.gov (United States)

    Tabassum, Arshia; Zaidi, Syeda Nuzhat Fatima; Yasmeen, Kausar; Mahboob, Tabassum

    2018-07-15

    Electrolytes and trace elements dysregulation play an important role in the progression of obesity and diabetes complications. The present study was designed to evaluate the insulin sensitizing effects of peroxisomes proliferators activated receptor gamma (PPAR-γ) agonist on trace elements in obesity induced type 2 diabetes mellitus and correlate with serum visfatin. Wistar rats were categorized into five groups. Group I served as control; Group II fed on high fat diet (HFD); Group III fed on HFD and treated with rosiglitazone (3 mg/kg) for 7 days; Group IV were T2DM rats induce by HFD and low dose of streptozotocin (i.p. 35 mg/kg); Group V was T2DM rats treated with rosiglitazone (3 mg/kg) for 7 days. Serum and tissues electrolytes levels and renal, hepatic and cardiac tissues trace elements were estimated by flame photometer and atomic absorption spectroscopy. Serum visfatin was estimated by ELISA. Pearson correlations were analyzed among fasting blood glucose (FBG), serum visfatin and tissues trace elements. Results of the current study showed hyponatremia, hyperkalemia, hypomagnesemia and hypercalcemia in HFD and T2DM groups. HFD and T2DM also showed elevated copper and iron levels; however, zinc and selenium levels were decreased. Rosiglitazone treatment increased the insulin sensitization and altered these changes. A Strong association was observed among FBG, serum visfatin and trace elements levels of HFD and T2DM. Obesity and diabetes mellitus disturbed visfatin, electrolytes and trace elements homeostasis. Rosiglitazone treatment restored these changes. The results of the study could serve as a basis for further studies for the prevention of diabetic complications. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. 33 CFR Appendix C to Part 155 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    .... 155, App. C Appendix C to Part 155—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is... included training as one of the sections required in a vessel or facility response plan. In reviewing...

  17. cAMP-response-element-binding protein positively regulates breast cancer metastasis and subsequent bone destruction

    Energy Technology Data Exchange (ETDEWEB)

    Son, Jieun; Lee, Jong-Ho; Kim, Ha-Neui; Ha, Hyunil, E-mail: hyunil74@hotmail.com; Lee, Zang Hee, E-mail: zang1959@snu.ac.kr

    2010-07-23

    Research highlights: {yields} CREB is highly expressed in advanced breast cancer cells. {yields} Tumor-related factors such as TGF-{beta} further elevate CREB expression. {yields} CREB upregulation stimulates metastatic potential of breast cancer cells. {yields} CREB signaling is required for breast cancer-induced bone destruction. -- Abstract: cAMP-response-element-binding protein (CREB) signaling has been reported to be associated with cancer development and poor clinical outcome in various types of cancer. However, it remains to be elucidated whether CREB is involved in breast cancer development and osteotropism. Here, we found that metastatic MDA-MB-231 breast cancer cells exhibited higher CREB expression than did non-metastatic MCF-7 cells and that CREB expression was further increased by several soluble factors linked to cancer progression, such as IL-1, IGF-1, and TGF-{beta}. Using wild-type CREB and a dominant-negative form (K-CREB), we found that CREB signaling positively regulated the proliferation, migration, and invasion of MDA-MB-231 cells. In addition, K-CREB prevented MDA-MB-231 cell-induced osteolytic lesions in a mouse model of cancer metastasis. Furthermore, CREB signaling in cancer cells regulated the gene expression of PTHrP, MMPs, and OPG, which are closely involved in cancer metastasis and bone destruction. These results indicate that breast cancer cells acquire CREB overexpression during their development and that this CREB upregulation plays an important role in multiple steps of breast cancer bone metastasis.

  18. Local fibroblast proliferation but not influx is responsible for synovial hyperplasia in a murine model of rheumatoid arthritis

    Energy Technology Data Exchange (ETDEWEB)

    Matsuo, Yusuke; Mizoguchi, Fumitaka; Saito, Tetsuya [Department of Rheumatology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University (TMDU), 1-5-45 Yushima, Bunkyo-ku, Tokyo, 113-8519 (Japan); Japan Science and Technology Agency (JST), Core Research for Evolutional Science and Technology (CREST) Program, Sanbancho, Chiyoda-ku, Tokyo, 102-0075 (Japan); Kawahata, Kimito [Department of Rheumatology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University (TMDU), 1-5-45 Yushima, Bunkyo-ku, Tokyo, 113-8519 (Japan); Ueha, Satoshi; Matsushima, Kouji [Japan Science and Technology Agency (JST), Core Research for Evolutional Science and Technology (CREST) Program, Sanbancho, Chiyoda-ku, Tokyo, 102-0075 (Japan); Department of Molecular Preventive Medicine, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo, 113-0033 (Japan); Inagaki, Yutaka [Japan Science and Technology Agency (JST), Core Research for Evolutional Science and Technology (CREST) Program, Sanbancho, Chiyoda-ku, Tokyo, 102-0075 (Japan); Center for Matrix Biology and Medicine, Graduate School of Medicine and the Institute of Medical Sciences, Tokai University, 143 Shimo-kasuya, Isehara, Kanagawa, 259-1193 (Japan); Miyasaka, Nobuyuki [Department of Rheumatology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University (TMDU), 1-5-45 Yushima, Bunkyo-ku, Tokyo, 113-8519 (Japan); Kohsaka, Hitoshi, E-mail: kohsaka.rheu@tmd.ac.jp [Department of Rheumatology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University (TMDU), 1-5-45 Yushima, Bunkyo-ku, Tokyo, 113-8519 (Japan); Japan Science and Technology Agency (JST), Core Research for Evolutional Science and Technology (CREST) Program, Sanbancho, Chiyoda-ku, Tokyo, 102-0075 (Japan)

    2016-02-12

    Synovial fibroblasts play crucial roles in inflammation and joint destruction in rheumatoid arthritis (RA). How they accumulate in the RA joints remains unclear. This study was conducted to discern whether cellular influx from the outside of the joints and local proliferation are responsible for synovial fibroblast accumulation in an animal model of RA. We found that synovial fibroblasts were identified as GFP+ cells using collagen type I alpha 2 (Col1a2)-GFP transgenic reporter mice. Then, bone marrow transplantation and parabiosis techniques were utilized to study the cellular influx. Irradiated wild-type mice were transplanted with bone marrow from Col1a2-GFP mice. Col1a2-GFP and wild-type mice were conjoined for parabiosis. The transplanted mice and the parabionts were subjected to collagen antibody-induced arthritis (CAIA). We found no GFP+ cells in the hyperplastic synovial tissues from the transplanted mice with CAIA and from the wild-type parabionts with CAIA. Furthermore, normal and CAIA synovial tissues from Col1a2-GFP mice and from fluorescent ubiquitination-based cell cycle indicator (Fucci) transgenic mice, in which cells in S/G{sub 2}/M phases of the cell cycle express Azami-Green, were studied for Ki67, a cellular proliferation marker, and vimentin, a fibroblast marker, expression. The percentages of Ki67+/GFP+ and Azami-Green+/vimentin+ cells in the CAIA synovial tissues were higher than those in the untreated synovial tissues (34% vs. 0.40% and 19% vs. 0.26%, respectively). These findings indicate that local fibroblast proliferation but not cellular influx is responsible for the synovial hyperplasia in CAIA. Suppression of proliferation of the local synovial fibroblasts should be a promising treatment for RA. - Highlights: • We studied how synovial fibroblasts accumulate in joints in a murine model of RA. • Bone marrow-derived cells did not accumulate in arthritic joints. • Synovial fibroblasts did not accumulate in arthritic joints via

  19. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

    Directory of Open Access Journals (Sweden)

    Yan Wang

    2015-01-01

    Full Text Available Rheumatoid arthritis (RA is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

  20. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes.

    Science.gov (United States)

    Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

    2015-01-01

    Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdown of cGAS inhibited the proliferation of RA FLS. cGAS overexpression enhanced the production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. In contrast, cGAS silencing inhibited production of proinflammatory cytokines and matrix metalloproteinases (MMPs) as well as AKT and ERK phosphorylation in TNFα-stimulated FLS. These results suggest that cGAS activates the AKT and ERK pathways to promote the inflammatory response of RA FLS, and the development of strategies targeting cGAS may have therapeutic potential for human RA.

  1. Proliferation: myth or reality?

    International Nuclear Information System (INIS)

    2005-01-01

    This article analyzes the proliferation approach, its technical condition and political motivation, and the share between the myth (political deception, assumptions and extrapolations) and the reality of proliferation. Its appreciation is complicated by the irrational behaviour of some political actors and by the significant loss of the non-use taboo. The control of technologies is an important element for proliferation slowing down but an efficient and autonomous intelligence system remains indispensable. (J.S.)

  2. 3-dimensional earthquake response analysis of embedded reactor building using hybrid model of boundary elements and finite elements

    International Nuclear Information System (INIS)

    Muto, K.; Motosaka, M.; Kamata, M.; Masuda, K.; Urao, K.; Mameda, T.

    1985-01-01

    In order to investigate the 3-dimensional earthquake response characteristics of an embedded structure with consideration for soil-structure interaction, the authors have developed an analytical method using 3-dimensional hybrid model of boundary elements (BEM) and finite elements (FEM) and have conducted a dynamic analysis of an actual nuclear reactor building. This paper describes a comparative study between two different embedment depths in soil as elastic half-space. As the results, it was found that the earthquake response intensity decreases with the increase of the embedment depth and that this method was confirmed to be effective for investigating the 3-D response characteristics of embedded structures such as deflection pattern of each floor level, floor response spectra in high frequency range. (orig.)

  3. Isoniazid suppresses antioxidant response element activities and impairs adipogenesis in mouse and human preadipocytes

    International Nuclear Information System (INIS)

    Chen, Yanyan; Xue, Peng; Hou, Yongyong; Zhang, Hao; Zheng, Hongzhi; Zhou, Tong; Qu, Weidong; Teng, Weiping; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Transcriptional signaling through the antioxidant response element (ARE), orchestrated by the Nuclear factor E2-related factor 2 (Nrf2), is a major cellular defense mechanism against oxidative or electrophilic stress. Here, we reported that isoniazid (INH), a widely used antitubercular drug, displays a substantial inhibitory property against ARE activities in diverse mouse and human cells. In 3T3-L1 preadipocytes, INH concentration-dependently suppressed the ARE-luciferase reporter activity and mRNA expression of various ARE-dependent antioxidant genes under basal and oxidative stressed conditions. In keeping with our previous findings that Nrf2-ARE plays a critical role in adipogenesis by regulating expression of CCAAT/enhancer-binding protein β (C/EBPβ) and peroxisome proliferator-activated receptor γ (PPARγ), suppression of ARE signaling by INH hampered adipogenic differentiation of 3T3-L1 cells and human adipose-derived stem cells (ADSCs). Following adipogenesis induced by hormonal cocktails, INH-treated 3T3-L1 cells and ADSCs displayed significantly reduced levels of lipid accumulation and attenuated expression of C/EBPα and PPARγ. Time-course studies in 3T3-L1 cells revealed that inhibition of adipogenesis by INH occurred in the early stage of terminal adipogenic differentiation, where reduced expression of C/EBPβ and C/EBPδ was observed. To our knowledge, the present study is the first to demonstrate that INH suppresses ARE signaling and interrupts with the transcriptional network of adipogenesis, leading to impaired adipogenic differentiation. The inhibition of ARE signaling may be a potential underlying mechanism by which INH attenuates cellular antioxidant response contributing to various complications. - Highlights: • Isoniazid suppresses ARE-mediated transcriptional activity. • Isoniazid inhibits adipogenesis in preadipocytes. • Isoniazid suppresses adipogenic gene expression during adipogenesis

  4. Lichens (Parmelia sulcata) time response model to environmental elemental availability

    NARCIS (Netherlands)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.T.

    1999-01-01

    Parmelia sulcata transplants, collected in a non-polluted area, were exposed to new atmospheric conditions at six stations, of which five were located near power plants and one at an unpolluted area. Data were collected for a 1-year period, on rainfall, airborne particulates, elemental deposition

  5. 33 CFR Appendix D to Part 154 - Training Elements for Oil Spill Response Plans

    Science.gov (United States)

    2010-07-01

    ... Appendix D to Part 154—Training Elements for Oil Spill Response Plans 1. General 1.1The portion of the plan dealing with training is one of the key elements of a response plan. This concept is clearly expressed by... that the plans often do not provide sufficient information in the training section of the plan for...

  6. The third-world response to anti-nuclear proliferation strategy

    International Nuclear Information System (INIS)

    Poulose, T.T.

    1978-01-01

    The discriminatory aspect of the NPT and its implications for the nuclear have-nots are discussed. India's refusal to sign the NPT and misgivings it has created in the 'Nuclear haves' are explained. It is emphasised that India should retain the nuclear option, even though the option at present stands renounced voluntarily, in order to bargain with the nuclear weapons powers for nuclear disarmament. India may even give up PNEs as a price in return for Comprehensive Test Ban Treaty. It has also been pointed out that the nuclear weapons powers and other nuclear suppliers are using the NPT as a political weapon, to deny technical details to the developing nations. The approach of the nuclear haves to the NPT is technical and that of the nuclear have-nots is political. Third world's demand is that nuclear proliferation must be differentiated from the dissemination of nuclear technology. (M.G.B.)

  7. Proliferation of maize (Zea mays L.) roots in response to localized supply of nitrate

    Science.gov (United States)

    Granato, T. C.; Raper, C. D. Jr; Raper CD, J. r. (Principal Investigator)

    1989-01-01

    Maize (Zea mays L.) plants with two primary nodal root axes were grown for 8 d in flowing nutrient culture with each axis independently supplied with NO3-. Dry matter accumulation by roots was similar whether 1.0 mol m-3 NO3- was supplied to one or both axes. When NO3- was supplied to only one axis, however, accumulation of dry matter within the root system was significantly greater in the axis supplied with NO3-. The increased dry matter accumulation by the +N-treated axis was attributable entirely to increased density and growth of lateral branches and not to a difference in growth of the primary axis. Proliferation of lateral branches for the +N axis was associated with the capacity for in situ reduction and utilization of a portion of the absorbed NO3-, especially in the apical region where lateral primordia are initiated. Although reduced nitrogen was translocated to the -N axis, concentrations in the -N axis remained significantly lower than in the +N axis. The concentration of reduced nitrogen, as well as in vitro NO3- reductase activity, was greater in apical than in more basal regions of the +N axis. The enhanced proliferation of lateral branches in the +N axis was accompanied by an increase in total respiration rate of the axis. Part of the increased respiration was attributable to increased mass of roots. The specific respiration rate (micromoles CO2 evolved per hour per gram root dry weight) was also greater for the +N than for the -N axis. If respiration rate is taken as representative of sink demand, stimulation of initiation and growth of laterals by in situ utilization of a localized exogenous supply of NO3- establishes an increased sink demand through enhanced metabolic activity and the increased partitioning of assimilates to the +N axis responds to the difference in sink demand between +N and -N axes.

  8. Response of turkey muscle satellite cells to thermal challenge. I. transcriptome effects in proliferating cells.

    Science.gov (United States)

    Reed, Kent M; Mendoza, Kristelle M; Abrahante, Juan E; Barnes, Natalie E; Velleman, Sandra G; Strasburg, Gale M

    2017-05-06

    Climate change poses a multi-dimensional threat to food and agricultural systems as a result of increased risk to animal growth, development, health, and food product quality. This study was designed to characterize transcriptional changes induced in turkey muscle satellite cells cultured under cold or hot thermal challenge to better define molecular mechanisms by which thermal stress alters breast muscle ultrastructure. Satellite cells isolated from the pectoralis major muscle of 7-weeks-old male turkeys from two breeding lines (16 weeks body weight-selected and it's randombred control) were proliferated in culture at 33 °C, 38 °C or 43 °C for 72 h. Total RNA was isolated and 12 libraries subjected to RNAseq analysis. Statistically significant differences in gene expression were observed among treatments and between turkey lines with a greater number of genes altered by cold treatment than by hot and fewer differences observed between lines than between temperatures. Pathway analysis found that cold treatment resulted in an overrepresentation of genes involved in cell signaling/signal transduction and cell communication/cell signaling as compared to control (38 °C). Heat-treated muscle satellite cells showed greater tendency towards expression of genes related to muscle system development and differentiation. This study demonstrates significant transcriptome effects on turkey skeletal muscle satellite cells exposed to thermal challenge. Additional effects on gene expression could be attributed to genetic selection for 16 weeks body weight (muscle mass). New targets are identified for further research on the differential control of satellite cell proliferation in poultry.

  9. Monitoring T-Cell Responses in Translational Studies: Optimization of Dye-Based Proliferation Assay for Evaluation of Antigen-Specific Responses

    Directory of Open Access Journals (Sweden)

    Anja Ten Brinke

    2017-12-01

    Full Text Available Adoptive therapy with regulatory T cells or tolerance-inducing antigen (Ag-presenting cells is innovative and promising therapeutic approach to control undesired and harmful activation of the immune system, as observed in autoimmune diseases, solid organ and bone marrow transplantation. One of the critical issues to elucidate the mechanisms responsible for success or failure of these therapies and define the specificity of the therapy is the evaluation of the Ag-specific T-cell responses. Several efforts have been made to develop suitable and reproducible assays. Here, we focus on dye-based proliferation assays. We highlight with practical examples the fundamental issues to take into consideration for implementation of an effective and sensitive dye-based proliferation assay to monitor Ag-specific responses in patients. The most critical points were used to design a road map to set up and analyze the optimal assay to assess Ag-specific T-cell responses in patients undergoing different treatments. This is the first step to optimize monitoring of tolerance induction, allowing comparison of outcomes of different clinical studies. The road map can also be applied to other therapeutic interventions, not limited to tolerance induction therapies, in which Ag-specific T-cell responses are relevant such as vaccination approaches and cancer immunotherapy.

  10. Gender Differences in Response to Prolonged Every-Other-Day Feeding on the Proliferation and Apoptosis of Hepatocytes in Mice.

    Science.gov (United States)

    Piotrowska, Katarzyna; Tarnowski, Maciej; Zgutka, Katarzyna; Pawlik, Andrzej

    2016-03-19

    Intermittent fasting decreases glucose and insulin levels and increases insulin sensitivity and lifespan. Decreased food intake influences the liver. Previous studies have shown gender differences in response to various types of caloric restriction, including every-other-day (EOD) feeding, in humans and rodents. Our goal was to show the influence of prolonged EOD feeding on the morphology, proliferation and apoptosis of livers from male and female mice. After nine months of an EOD diet, the livers from male and female mice were collected. We examined their morphology on histological slides using the Hematoxilin and Eosine (H_E) method and Hoechst staining of cell nuclei to evaluate the nuclear area of hepatocytes. We also evaluated the expression of mRNA for proto-oncogens, pro-survival proteins and apoptotic markers using Real Time Polimerase Chain Reaction (PCR). We noted increased lipid content in the livers of EOD fed female mice. EOD feeding lead to a decrease of proliferation and apoptosis in the livers of female and male mice, which suggest that tissue maintenance occurred during EOD feeding. Our experiment revealed sex-specific expression of mRNA for proto-oncogenes and pro-survival and pro-apoptotic genes in mice as well as sex-specific responses to the EOD treatment.

  11. Th17 cell-mediated immune responses promote mast cell proliferation by triggering stem cell factor in keratinocytes

    International Nuclear Information System (INIS)

    Cho, Kyung-Ah; Park, Minhwa; Kim, Yu-Hee; Woo, So-Youn

    2017-01-01

    Although mast cells are traditionally thought to function as effector cells in allergic responses, they have increasingly been recognized as important regulators of various immune responses. Mast cells mature locally; thus, tissue-specific influences are important for promoting mast cell accumulation and survival in the skin and the gastrointestinal tract. In this study, we determined the effects of keratinocytes on mast cell accumulation during Th17-mediated skin inflammation. We observed increases in dermal mast cells in imiquimod-induced psoriatic dermatitis in mice accompanied by the expression of epidermal stem cell factor (SCF), a critical mast cell growth factor. Similar to mouse epidermal keratinocytes, SCF was highly expressed in the human HaCaT keratinocyte cell line following stimulation with IL−17. Further, keratinocytes promoted mast cell proliferation following stimulation with IL−17 in vitro. However, the effects of keratinocytes on mast cells were significantly diminished in the presence of anti−CD117 (stem cell factor receptor) blocking antibodies. Taken together, our results revealed that the Th17-mediated inflammatory environment promotes mast cell accumulation through keratinocyte-derived SCF. - Highlights: • Psoriasis-like skin inflammation increase dermal mast cells. • Keratinocyte produce stem cell factor in psoriasis-like skin inflammation. • Keratinocyte promote mast cell proliferation by stem cell factor dependent manner

  12. Gender Differences in Response to Prolonged Every-Other-Day Feeding on the Proliferation and Apoptosis of Hepatocytes in Mice

    Directory of Open Access Journals (Sweden)

    Katarzyna Piotrowska

    2016-03-01

    Full Text Available Intermittent fasting decreases glucose and insulin levels and increases insulin sensitivity and lifespan. Decreased food intake influences the liver. Previous studies have shown gender differences in response to various types of caloric restriction, including every-other-day (EOD feeding, in humans and rodents. Our goal was to show the influence of prolonged EOD feeding on the morphology, proliferation and apoptosis of livers from male and female mice. After nine months of an EOD diet, the livers from male and female mice were collected. We examined their morphology on histological slides using the Hematoxilin and Eosine (H_E method and Hoechst staining of cell nuclei to evaluate the nuclear area of hepatocytes. We also evaluated the expression of mRNA for proto-oncogens, pro-survival proteins and apoptotic markers using Real Time Polimerase Chain Reaction (PCR. We noted increased lipid content in the livers of EOD fed female mice. EOD feeding lead to a decrease of proliferation and apoptosis in the livers of female and male mice, which suggest that tissue maintenance occurred during EOD feeding. Our experiment revealed sex-specific expression of mRNA for proto-oncogenes and pro-survival and pro-apoptotic genes in mice as well as sex-specific responses to the EOD treatment.

  13. Helicobacter pylori Disrupts Host Cell Membranes, Initiating a Repair Response and Cell Proliferation

    Directory of Open Access Journals (Sweden)

    Hsueh-Fen Juan

    2012-08-01

    Full Text Available Helicobacter pylori (H. pylori, the human stomach pathogen, lives on the inner surface of the stomach and causes chronic gastritis, peptic ulcer, and gastric cancer. Plasma membrane repair response is a matter of life and death for human cells against physical and biological damage. We here test the hypothesis that H. pylori also causes plasma membrane disruption injury, and that not only a membrane repair response but also a cell proliferation response are thereby activated. Vacuolating cytotoxin A (VacA and cytotoxin-associated gene A (CagA have been considered to be major H. pylori virulence factors. Gastric cancer cells were infected with H. pylori wild type (vacA+/cagA+, single mutant (ΔvacA or ΔcagA or double mutant (ΔvacA/ΔcagA strains and plasma membrane disruption events and consequent activation of membrane repair components monitored. H. pylori disrupts the host cell plasma membrane, allowing localized dye and extracellular Ca2+ influx. Ca2+-triggered members of the annexin family, A1 and A4, translocate, in response to injury, to the plasma membrane, and cell surface expression of an exocytotic maker of repair, LAMP-2, increases. Additional forms of plasma membrane disruption, unrelated to H. pylori exposure, also promote host cell proliferation. We propose that H. pylori activation of a plasma membrane repair is pro-proliferative. This study might therefore provide new insight into potential mechanisms of H. pylori-induced gastric carcinogenesis.

  14. Design Process for Integrated Concepts with Responsive Building Elements

    DEFF Research Database (Denmark)

    Aa, Van der A.; Heiselberg, Per

    2008-01-01

    An integrated building concept is a prerequisite to come to an energy efficient building with a good and healthy IAQ indoor comfort. A design process that defines the targets and boundary conditions in the very first stage of the design and guarantees them until the building is finished and used...... is needed. The hard question is however: how to make the right choice of the combination of individual measures from building components and building services elements. Within the framework of IEA-ECBCS Annex 44 research has been conducted about the design process for integrated building concepts...

  15. Role of early growth response 1 in arteriogenesis: impact on vascular cell proliferation and leukocyte recruitment in vivo.

    Science.gov (United States)

    Pagel, Judith-Irina; Ziegelhoeffer, Tibor; Heil, Matthias; Fischer, Silvia; Fernández, Borja; Schaper, Wolfgang; Preissner, Klaus T; Deindl, Elisabeth

    2012-03-01

    Based on previous findings that early growth response 1 (Egr-1) participates in leukocyte recruitment and cell proliferation in vitro, this study was designed to investigate its mode of action during arteriogenesis in vivo. In a model of peripheral arteriogenesis, Egr-1 was significantly upregulated in growing collaterals of wild-type (WT) mice, both on mRNA and protein level. Egr-1(-/-) mice demonstrated delayed arteriogenesis after femoral artery ligation. They further showed increased levels of monocytes and granulocytes in the circulation, but reduced levels in adductor muscles under baseline conditions. After femoral artery ligation, elevated numbers of macrophages were detected in the perivascular zone of collaterals in Egr-1(-/-) mice and mRNA of leukocyte recruitment mediators was upregulated. Other Egr family members (Egr-2 to -4) were significantly upregulated only in Egr-1(-/-) mice, suggesting a mechanism of counterbalancing Egr-1 deficiency. Moreover, splicing factor-1, downregulated in WT mice after femoral artery ligation in the process of increased vascular cell proliferation, was upregulated in Egr-1(-/-) mice. αSM-actin on the other hand, significantly downregulated in WT mice, showed no differential expression in Egr-1(-/-) mice. While cell cycle regulator cyclin E and cdc20 were upregulated in Egr-1(-/-) mice, cyclin D1 expression decreased below the detection limit in collaterals, and the proliferation marker ki67 was not differentially expressed. In conclusion, compensation for deficiency in Egr-1 function in leukocyte recruitment can presumably be mediated by other transcription factors; however, Egr-1 is indispensable for effective vascular cell cycle progression in arteriogenesis.

  16. Effect of long interval between hyperthermochemoradiation therapy and surgery for rectal cancer on apoptosis, proliferation and tumor response.

    Science.gov (United States)

    Kato, Toshihide; Fujii, Takaaki; Ide, Munenori; Takada, Takahiro; Sutoh, Toshinaga; Morita, Hiroki; Yajima, Reina; Yamaguchi, Satoru; Tsutsumi, Soichi; Asao, Takayuki; Oyama, Tetsunari; Kuwano, Hiroyuki

    2014-06-01

    Neoadjuvant chemoradiotherapy is commonly used to improve the local control and resectability of locally advanced rectal cancer, with surgery performed after an interval of a number of weeks. We have been conducting a clinical trial of preoperative chemoradiotherapy in combination with regional hyperthermia (hyperthermo-chemoradiation therapy; HCRT) for locally advanced rectal cancer. In the current study we assessed the effect of a longer (>10 weeks) interval after neoadjuvant HCRT on pathological response, oncological outcome and especially on apoptosis, proliferation and p53 expression in patients with rectal cancer. Forty-eight patients with proven rectal adenocarcinoma who underwent HCRT followed by surgery were identified for inclusion in this study. Patients were divided into two groups according to the interval between HCRT and surgery, ≤ 10 weeks (short-interval group) and >10 weeks (long-interval group). Patients in the long-interval group had a significantly higher rate of pathological complete response (pCR) (43.5% vs. 16.0%) than patients of the short-interval group. Patients of the long-interval group had a significantly higher rate of down-staging of T-stage (78.3% vs. 36.0%) and relatively higher rate of that of N-stage (52.2% vs. 36.0%) than patients of the short-interval group. Furthermore, apoptosis in the long-interval group was relatively higher compared to that of the short-interval group, without a significant difference in the Ki-67 proliferative index and expression of p53 in the primary tumor. In conclusion, we demonstrated that a longer interval after HCRT (>10 weeks) seemed to result in a better chance of a pCR, a result confirmed by the trends in tumor response markers, including apoptosis, proliferation and p53 expression. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Keratin23 (KRT23 knockdown decreases proliferation and affects the DNA damage response of colon cancer cells.

    Directory of Open Access Journals (Sweden)

    Karin Birkenkamp-Demtröder

    Full Text Available Keratin 23 (KRT23 is strongly expressed in colon adenocarcinomas but absent in normal colon mucosa. Array based methylation profiling of 40 colon samples showed that the promoter of KRT23 was methylated in normal colon mucosa, while hypomethylated in most adenocarcinomas. Promoter methylation correlated with absent expression, while increased KRT23 expression in tumor samples correlated with promoter hypomethylation, as confirmed by bisulfite sequencing. Demethylation induced KRT23 expression in vitro. Expression profiling of shRNA mediated stable KRT23 knockdown in colon cancer cell lines showed that KRT23 depletion affected molecules of the cell cycle and DNA replication, recombination and repair. In vitro analyses confirmed that KRT23 depletion significantly decreased the cellular proliferation of SW948 and LS1034 cells and markedly decreased the expression of genes involved in DNA damage response, mainly molecules of the double strand break repair homologous recombination pathway. KRT23 knockdown decreased the transcript and protein expression of key molecules as e.g. MRE11A, E2F1, RAD51 and BRCA1. Knockdown of KRT23 rendered colon cancer cells more sensitive to irradiation and reduced proliferation of the KRT23 depleted cells compared to irradiated control cells.

  18. Homeostatic 'bystander' proliferation of human peripheral blood B cells in response to polyclonal T-cell stimulation in vitro.

    Science.gov (United States)

    Jasiulewicz, Aleksandra; Lisowska, Katarzyna A; Pietruczuk, Krzysztof; Frąckowiak, Joanna; Fulop, Tamas; Witkowski, Jacek M

    2015-11-01

    The mechanisms of maintenance of adequate numbers of B lymphocytes and of protective levels of immunoglobulins in the absence of antigenic (re)stimulation remain not fully understood. Meanwhile, our results presented here show that both peripheral blood naive and memory B cells can be activated strongly and non-specifically (in a mitogen-like fashion) in 5-day in vitro cultures of anti-CD3- or concanavalin A (Con A)-stimulated peripheral blood mononuclear cells of healthy people. This polyclonal, bystander activation of the B cells includes multiple divisions of most of them (assessed here by the flow cytometric technique of dividing cell tracking) and significant antibody [immunoglobulin M (IgM) and IgG] secretion. Observed proliferation of the CD19(+) B cells depends on contact with stimulated T helper (Th) cells (via CD40-CD40L interaction) and on the response of B cells to secreted interleukins IL-5, IL-10 and IL-4, and is correlated with the levels of these Th-derived molecules, while it does not involve the ligation of the BCR/CD19 complex. We suggest that the effect might reflect the situation occurring in vivo as the homeostatic proliferation of otherwise non-stimulated, peripheral B lymphocytes, providing an always ready pool for efficient antibody production to any new (or cognate) antigen challenge. © The Japanese Society for Immunology. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. The effect of Platelet Lysate on osteoblast proliferation associated with a transient increase of the inflammatory response in bone regeneration.

    Science.gov (United States)

    Ruggiu, Alessandra; Ulivi, Valentina; Sanguineti, Francesca; Cancedda, Ranieri; Descalzi, Fiorella

    2013-12-01

    Platelet Lysate (PL) contains a cocktail of growth factors and cytokines, which actively participates in tissue repair and its clinical application has been broadly described. The aim of this study was to assess the regenerative potential of PL for bone repair. We demonstrated that PL stimulation induces a transient increase of the inflammatory response in quiescent human osteoblasts, via NF-kB activation, COX-2 induction, PGE2 production and secretion of pro-inflammatory cytokines. Furthermore, we showed that long-term PL stimulation enhances proliferation of actively replicating osteoblasts, without affecting their differentiation potential, along with changes of cell morphology, resulting in increased cell density at confluence. In confluent resting osteoblasts, PL treatment induced resumption of proliferation, change in cell morphology and increase of cell density at confluence. A burst of PL treatment (24-h) was sufficient to trigger such processes in both conditions. These results correlated with up-regulation of the proliferative and survival pathways ERKs and Akt and with cell cycle re-activation via induction of CyclinD1 and phosphorylation of Rb, following PL stimulation. Our findings demonstrate that PL treatment results in activation and expansion of resting osteoblasts, without affecting their differentiation potential. Therefore PL represents a good therapeutic candidate in regenerative medicine for bone repair. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Design of responsive materials using topologically interlocked elements

    International Nuclear Information System (INIS)

    Molotnikov, A; Gerbrand, R; Qi, Y; Simon, G P; Estrin, Y

    2015-01-01

    In this work we present a novel approach to designing responsive structures by segmentation of monolithic plates into an assembly of topologically interlocked building blocks. The particular example considered is an assembly of interlocking osteomorphic blocks. The results of this study demonstrate that the constraining force, which is required to hold the blocks together, can be viewed as a design parameter that governs the bending stiffness and the load bearing capacity of the segmented structure. In the case where the constraining forces are provided laterally using an external frame, the maximum load the assembly can sustain and its stiffness increase linearly with the magnitude of the lateral load applied. Furthermore, we show that the segmented plate with integrated shape memory wires employed as tensioning cables can act as a smart structure that changes its flexural stiffness and load bearing capacity in response to external stimuli, such as heat generated by the switching on and off an electric current. (paper)

  1. Specific modulation of mucosal immune response, tolerance and proliferation in mice colonized with A. muciniphila

    NARCIS (Netherlands)

    Derrien, M.M.N.; Baarlen, van Peter; Hooiveld, Guido; Norin, Elisabeth; Muller, Michael; Vos, de Willem

    2011-01-01

    Epithelial cells of the mammalian intestine are covered with a mucus layer that prevents direct contact with intestinal microbes but also constitutes a substrate for mucus-degrading bacteria. To study the effect of mucus degradation on the host response, germ-free mice were colonized with

  2. LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

    Science.gov (United States)

    Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

    2017-11-15

    Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Assessment of chitosan-affected metabolic response by peroxisome proliferator-activated receptor bioluminescent imaging-guided transcriptomic analysis.

    Directory of Open Access Journals (Sweden)

    Chia-Hung Kao

    Full Text Available Chitosan has been widely used in food industry as a weight-loss aid and a cholesterol-lowering agent. Previous studies have shown that chitosan affects metabolic responses and contributes to anti-diabetic, hypocholesteremic, and blood glucose-lowering effects; however, the in vivo targeting sites and mechanisms of chitosan remain to be clarified. In this study, we constructed transgenic mice, which carried the luciferase genes driven by peroxisome proliferator-activated receptor (PPAR, a key regulator of fatty acid and glucose metabolism. Bioluminescent imaging of PPAR transgenic mice was applied to report the organs that chitosan acted on, and gene expression profiles of chitosan-targeted organs were further analyzed to elucidate the mechanisms of chitosan. Bioluminescent imaging showed that constitutive PPAR activities were detected in brain and gastrointestinal tract. Administration of chitosan significantly activated the PPAR activities in brain and stomach. Microarray analysis of brain and stomach showed that several pathways involved in lipid and glucose metabolism were regulated by chitosan. Moreover, the expression levels of metabolism-associated genes like apolipoprotein B (apoB and ghrelin genes were down-regulated by chitosan. In conclusion, these findings suggested the feasibility of PPAR bioluminescent imaging-guided transcriptomic analysis on the evaluation of chitosan-affected metabolic responses in vivo. Moreover, we newly identified that downregulated expression of apoB and ghrelin genes were novel mechanisms for chitosan-affected metabolic responses in vivo.

  4. T-helper cell-mediated proliferation and cytokine responses against recombinant Merkel cell polyomavirus-like particles.

    Directory of Open Access Journals (Sweden)

    Arun Kumar

    Full Text Available The newly discovered Merkel Cell Polyomavirus (MCPyV resides in approximately 80% of Merkel cell carcinomas (MCC. Causal role of MCPyV for this rare and aggressive skin cancer is suggested by monoclonal integration and truncation of large T (LT viral antigen in MCC cells. The mutated MCPyV has recently been found in highly purified leukemic cells from patients with chronic lymphocytic leukemia (CLL, suggesting a pathogenic role also in CLL. About 50-80% of adults display MCPyV-specific antibodies. The humoral immunity does not protect against the development of MCC, as neutralizing MCPyV antibodies occur in higher levels among MCC patients than healthy controls. Impaired T-cell immunity has been linked with aggressive MCC behavior. Therefore, cellular immunity appears to be important in MCPyV infection surveillance. In order to elucidate the role of MCPyV-specific Th-cell immunity, peripheral blood mononuclear cells (PBMC of healthy adults were stimulated with MCPyV VP1 virus-like particles (VLPs, using human bocavirus (HBoV VLPs and Candida albicans antigen as positive controls. Proliferation, IFN-γ, IL-13 and IL-10 responses were examined in 15 MCPyV-seropositive and 15 seronegative volunteers. With the MCPyV antigen, significantly stronger Th-cell responses were found in MCPyV-seropositive than MCPyV-seronegative subjects, whereas with the control antigens, the responses were statistically similar. The most readily detectable cytokine was IFN-γ. The MCPyV antigen tended to induce stronger IFN-γ responses than HBoV VLP antigen. Taken together, MCPyV-specific Th-cells elicit vigorous IFN-γ responses. IFN-γ being a cytokine with major antiviral and tumor suppressing functions, Th-cells are suggested to be important mediators of MCPyV-specific immune surveillance.

  5. State-of-the-art Review : Vol. 2A. Responsive Building Elements

    DEFF Research Database (Denmark)

    Blümel, Ernst; Haghighat, Fariborz; Li, Yuguo

    This report resumes and presents the activity done in Subtask A of IEA-ECBCS Annex 44 “Integrating Environmentally Responsive Elements in Buildings” concerning the state of the art review of Responsive Building Elements. It is based on the contributions from the participating countries...... at researchers in the field and gives an overview of how these elements work together with available performance data. It is hoped, that this report will be helpful for researchers in their search for new solutions to the problem of designing and constructing sustainable buildings....

  6. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.

    Science.gov (United States)

    Lisse, Thomas S; Hewison, Martin; Adams, John S

    2011-03-01

    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Cell proliferation kinetics and radiation response in 9L tumor spheroids

    Energy Technology Data Exchange (ETDEWEB)

    Sweigert, S.E.

    1984-05-01

    Cell kinetic parameters, including population doubling-time, cell cycle time, and growth fraction, were measured in 9L gliosarcoma spheroids. These parameters were studied as the spheroids grew from 50 ..mu..m to over 900 ..mu..m in diameter. Experiments relating the cell kinetic parameters to the radiation response of 9L spheroids were also carried out. The major findings were that the average cell cycle time (T/sub c/), is considerably longer in large spheroids than in exponentially-growing monolayers, the radiosensitivity of noncycling (but still viable) cells in spheroids is not significantly different from that of cycling spheroid cells, and the radiation-induced division delay is approximately twice as long in spheroid cells as in monolayer cells given equal radiation doses. The cell loss factor for spheroids of various sizes was calculated, by using the measured kinetic parameters in the basic equations for growth of a cell population. 157 references, 6 figures, 3 tables.

  8. Cell proliferation kinetics and radiation response in 9L tumor spheroids

    International Nuclear Information System (INIS)

    Sweigert, S.E.

    1984-05-01

    Cell kinetic parameters, including population doubling-time, cell cycle time, and growth fraction, were measured in 9L gliosarcoma spheroids. These parameters were studied as the spheroids grew from 50 μm to over 900 μm in diameter. Experiments relating the cell kinetic parameters to the radiation response of 9L spheroids were also carried out. The major findings were that the average cell cycle time (T/sub c/), is considerably longer in large spheroids than in exponentially-growing monolayers, the radiosensitivity of noncycling (but still viable) cells in spheroids is not significantly different from that of cycling spheroid cells, and the radiation-induced division delay is approximately twice as long in spheroid cells as in monolayer cells given equal radiation doses. The cell loss factor for spheroids of various sizes was calculated, by using the measured kinetic parameters in the basic equations for growth of a cell population. 157 references, 6 figures, 3 tables

  9. Evidence for a role of Collapsin response mediator protein-2 in signaling pathways that regulate the proliferation of non-neuronal cells

    International Nuclear Information System (INIS)

    Tahimic, Candice Ginn T.; Tomimatsu, Nozomi; Nishigaki, Ryuichi; Fukuhara, Akiko; Toda, Tosifusa; Kaibuchi, Kozo; Shiota, Goshi; Oshimura, Mitsuo; Kurimasa, Akihiro

    2006-01-01

    Collapsin response mediator protein-2 or Crmp-2 plays a critical role in the establishment of neuronal polarity. In this study, we present evidence that apart from its functions in neurodevelopment, Crmp-2 is also involved in pathways that regulate the proliferation of non-neuronal cells through its phosphorylation by regulatory proteins. We show that Crmp-2 undergoes dynamic phosphorylation changes in response to contact inhibition-induced quiescence and that hyperphosphorylation of Crmp-2 occurs in a tumor. We further suggest that de-regulation of Crmp-2 phosphorylation levels at certain amino acid residues may lead to aberrant cell proliferation and consequently, tumorigenesis

  10. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  11. Effect of Large Negative Phase of Blast Loading on Structural Response of RC Elements

    Directory of Open Access Journals (Sweden)

    Syed Zubair Iman

    2016-01-01

    Full Text Available Structural response of reinforced concrete (RC elements for analysis and design are often obtained using the positive phase of the blast pressure curve disregarding the negative phase assuming insignificant contribution from the negative phase of the loading. Although, some insight on the effect of negative phase of blast pressure based on elastic single-degree-of-freedom (SDOF analysis was presented before, the influence of negative phase on different types of resistance functions of SDOF models and on realistic finite element analysis has not been explored. In this study, the effects of inclusion of pulse negative phase on structural response of RC elements from SDOF analysis and from more detailed finite element analysis have been investigated. Investigation of SDOF part has been conducted using MATLAB code that utilizes non-linear resistance functions of SDOF model. Detailed numerical investigation using finite element code DIANA was conducted on the significance of the negative phase on structural response. In the FE model, different support stiffness was used to explore the effect of support stiffness on the structural response due to blast negative phase. Results from SDOF and FE analyses present specific situations where the effect of large negative phase was found to be significant on the structural response of RC elements.

  12. Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle.

    Science.gov (United States)

    Lyons, John D; Klingensmith, Nathan J; Otani, Shunsuke; Mittal, Rohit; Liang, Zhe; Ford, Mandy L; Coopersmith, Craig M

    2017-12-01

    Cell production and death are tightly regulated in the rapidly renewing gut epithelium, with proliferation confined to crypts and apoptosis occurring in villi and crypts. This study sought to determine how stress alters these compartmentalized processes. Wild-type mice made septic via cecal ligation and puncture had decreased crypt proliferation and increased crypt and villus apoptosis. Fabpi -TAg mice expressing large T-antigen solely in villi had ectopic enterocyte proliferation with increased villus apoptosis in unmanipulated animals. Septic fabpi -TAg mice had an unexpected increase in villus proliferation compared with unmanipulated littermates, whereas crypt proliferation was decreased. Cell cycle regulators cyclin D1 and cyclin D2 were decreased in jejunal tissue in septic transgenic mice. In contrast, villus and crypt apoptosis were increased in septic fabpi -TAg mice. To examine the relationship between apoptosis and proliferation in a compartment-specific manner, fabpi -TAg mice were crossed with fabpl -Bcl-2 mice, resulting in expression of both genes in the villus but Bcl-2 alone in the crypt. Septic bi-transgenic animals had decreased crypt apoptosis but had a paradoxical increase in villus apoptosis compared with septic fabpi -TAg mice, associated with decreased proliferation in both compartments. Thus, sepsis unmasks compartment-specific proliferative and apoptotic regulation that is not present under homeostatic conditions.-Lyons, J. D., Klingensmith, N. J., Otani, S., Mittal, R., Liang, Z., Ford, M. L., Coopersmith, C. M. Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle. © FASEB.

  13. Epstein-barr virus latent membrane protein 1 (EBV-LMP1) and tumor proliferation rate as predictive factors of nasopharyngeal cancer (NPC) radiation response

    Energy Technology Data Exchange (ETDEWEB)

    Gondhowiardjo, S. [Univ. of Indonesia, Jakarta (Indonesia). Faculty of Medicine

    2000-05-01

    Irradiation is still the treatment of choice in NPC treatment as one of highest malignancy in Indonesia as well as in Southeast Asia. Up to now there is no accurate predictor on radiation response, since that the similar histo-morphological pattern, as a well-known prognostic factor can revealed a wide range of treatment outcomes. Purpose of the study is to established the influence of EBV-LMP 1 as the most important protein expressed by EBV oncogenes in cellular behavior such as proliferation rate, tumor aggressivity in NPC and to find out the role of both, proliferation rate and EBV-LMP1 expression as a predictor on NPC radiation response. One-hundred seventy-two paraffin-embedded biopsy specimens from NPC patients were analysed flow-cytometrically to obtain the S-phase fraction value as the proliferation parameter. From this group of patients, 81 fresh specimen biopsies could be collected, and the EBV-LMP 1 expression were detected by western blotting technique (mAB S12-Karolinska Institute) could be done. Several variables such as clinical stage, pathology pattern and radiation response were also collected. The radiation responses were established clinically (by nasopharyngoscopy), by CT scanning and pathologically. Sixty-five percent of our patients belong to the T3 and T4, whereby the N2-3 group consists 75% of them. Fourteen percent of the patients are Hsu type I, 48% are Hs type II and the rest belong to Hsu type III. Our study revealed that the mean SPF value was 14.62% (10.18%, which correlated (p<0.05) with the tumor and nodal sizes). The rate of positive expression of the EBV-LMP1 was 50%, and did not show a correlation with the proliferation activity as well as the radiation response. However, it showed a significant correlation with the tumor and nodal size. There was a significant correlation between this proliferation value with the radiation response calculated by both, bivariate as well as by multivariate analysis. The complete and incomplete

  14. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  15. Implementation of structural response sensitivity calculations in a large-scale finite-element analysis system

    Science.gov (United States)

    Giles, G. L.; Rogers, J. L., Jr.

    1982-01-01

    The implementation includes a generalized method for specifying element cross-sectional dimensions as design variables that can be used in analytically calculating derivatives of output quantities from static stress, vibration, and buckling analyses for both membrane and bending elements. Limited sample results for static displacements and stresses are presented to indicate the advantages of analytically calclating response derivatives compared to finite difference methods. Continuing developments to implement these procedures into an enhanced version of the system are also discussed.

  16. Effects of segregation of primary alloying elements on the creep response in magnesium alloys

    DEFF Research Database (Denmark)

    Huang, Y.D.; Dieringa, H.; Hort, N.

    2008-01-01

    The segregation of primary alloying elements deteriorates the high temperature creep resistance of magnesium alloys. Annealing at high temperatures alleviating their segregations can improve the creep resistance. Present investigation on the effect of segregation of primary alloying elements...... on the creep response may provide some useful information about how to improve the creep resistance of magnesium alloys in the future. (c) 2008 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved....

  17. Functional Genomic investigation of Peroxisome Proliferator-Activated Receptor Gamma (PPARG mediated transcription response in gastric cancer

    Directory of Open Access Journals (Sweden)

    Karthikeyan Selvarasu

    2017-10-01

    Full Text Available Cancer is a complex and progressive multi-step disorder that results from the transformation of normal cells to malignant derivatives. Several oncogenic signaling pathways are involved in this transformation. PPARG (Peroxisome proliferator-activated receptor gamma mediated transcription and signaling is involved in few cancers. We have investigated the PPARG in gastric tumors. The objective of the present study was to investigate the PPARG mediated transcriptional response in gastric tumors. Gene-set based and pathway focused gene-set enrichment analysis of available PPARG signatures in gastric tumor mRNA profiles shows that PPARG mediated transcription is highly activated in intestinal sub-type of gastric tumors. Further, we have derived the PPARG associated genes in gastric cancer and their expression was identified for the association with the better survival of the patients. Analysis of the PPARG associated genes reveals their involvement in mitotic cell cycle process, chromosome organization and nuclear division. Towards identifying the association with other oncogenic signaling process, E2F regulated genes were found associated with PPARG mediated transcription. The current results reveal the possible stratification of gastric tumors based on the PPARG gene expression and the possible development of PPARG targeted gastric cancer therapeutics. The identified PPARG regulated genes were identified to be targetable by pioglitazone and rosiglitazone. The identification of PPARG genes also in the normal stomach tissues reveal the possible involvement of these genes in the normal physiology of stomach and needs to be investigated.

  18. Etanercept blocks inflammatory responses orchestrated by TNF-α to promote transplanted cell engraftment and proliferation in rat liver

    Science.gov (United States)

    Viswanathan, Preeti; Kapoor, Sorabh; Kumaran, Vinay; Joseph, Brigid; Gupta, Sanjeev

    2014-01-01

    Engraftment of transplanted cells is critical for liver-directed cell therapy but most transplanted cells are rapidly cleared from liver sinusoids by proinflammatory cytokines/chemokines/receptors after activation of neutrophils or Kupffer cells. To define whether TNF-α served roles in cell-transplantation-induced hepatic inflammation, we used TNF-α antagonist, etanercept, for studies in syngeneic rat hepatocyte transplantation systems. After cell transplantation, multiple cytokines/chemokines/receptors were overexpressed, whereas etanercept prior to cell transplantation essentially normalized these responses. Moreover, ETN downregulated cell transplantation-induced intrahepatic release of secretory cytokines, such as high mobility group box 1. These effects of etanercept decreased cell transplantation-induced activation of neutrophils but not of Kupffer cells. Transplanted cell engraftment improved by several-fold in etanercept-treated animals. These gains in cell engraftment were repeatedly realized after pretreatment of animals with etanercept before multiple cell transplantation sessions. Transplanted cell numbers did not change over time indicating absence of cell proliferation after etanercept alone. By contrast, in animals preconditioned with retrorsine and partial hepatectomy, cell transplantation after etanercept pretreatment significantly accelerated liver repopulation compared with control rats. We concluded that TNF-α played a major role in orchestrating cell transplantation-induced inflammation through regulation of multiple cytokines/chemokines/receptor expression. As TNF-α antagonism by etanercept decreased transplanted cell clearance, improved cell engraftment and accelerated liver repopulation, this pharmacological approach to control hepatic inflammation will help optimize clinical strategies for liver cell therapy. PMID:24844924

  19. Regulation of Cox-2 by Cyclic AMP Response Element Binding Protein in Prostate Cancer: Potential Role for Nexrutine

    Directory of Open Access Journals (Sweden)

    Rita Ghosh

    2007-11-01

    Full Text Available We recently showed that NexrutineR, a Phellodendron amurense bark extract, suppresses proliferation of prostate cancer cell lines and tumor development in the transgenic adenocarcinoma of mouse prostate (TRAMP model. Our data also indicate that the antiproliferative effects of NexrutineR are mediated in part by Akt and Cyclic AMP response element binding protein (CREB. Cyclooxygenase (Cox-2, a pro-inflammatory mediator, is a CREB target that induces prostaglandin E2 (PGE2 and suppresses apoptosis. Treatment of LNCaP cells with NexrutineR reduced tumor necrosis factor α-induced enzymatic as well as promoter activities of Cox-2. NexrutineR also reduced the expression and promoter activity of Cox-2 in PC-3 cells that express high constitutive levels of Cox-2. Deletion analysis coupled with mutational analysis of the Cox-2 promoter identified CRE as being sufficient for mediating NexrutineR response. Immunohistochemical analysis of human prostate tumors show increased expression of CREB and DNA binding activity in high-grade tumors (three-fold higher in human prostate tumors compared to normal prostate; P = .01. We have identified CREB-mediated activation of Cox-2 as a potential signaling pathway in prostate cancer which can be blocked with a nontoxic, cost-effective dietary supplement like NexrutineR, demonstrating a prospective for development of NexrutineR for prostate cancer management.

  20. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    Science.gov (United States)

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  1. Magnolol Alleviates Inflammatory Responses and Lipid Accumulation by AMP-Activated Protein Kinase-Dependent Peroxisome Proliferator-Activated Receptor α Activation

    Directory of Open Access Journals (Sweden)

    Ye Tian

    2018-02-01

    Full Text Available Magnolol (MG is a kind of lignin isolated from Magnolia officinalis, which serves several different biological functions, such as antifungal, anticancer, antioxidant, and hepatoprotective functions. This study aimed to evaluate the protective effect of MG against oleic acid (OA-induced hepatic steatosis and inflammatory damage in HepG2 cells and in a tyloxapol (Ty-induced hyperlipidemia mouse model. Our findings indicated that MG can effectively inhibit OA-stimulated tumor necrosis factor α (TNF-α secretion, reactive oxygen species generation, and triglyceride (TG accumulation. Further study manifested that MG significantly suppressed OA-activated mitogen-activated protein kinase (MAPK and nuclear factor-kappa B (NF-κB signaling pathways and that these inflammatory responses can be negated by pretreatment with inhibitors of extracellular regulated protein kinase and c-Jun N-terminal kinase (U0126 and SP600125, respectively. In addition, MG dramatically upregulated peroxisome proliferator-activated receptor α (PPARα translocation and reduced sterol regulatory element-binding protein 1c (SREBP-1c protein synthesis and excretion, both of which are dependent upon the phosphorylation of adenosine monophosphate (AMP-activated protein kinase (AMPK, acetyl-CoA carboxylase, and AKT kinase (AKT. However, MG suspended the activation of PPARα expression and was thus blocked by pretreatment with LY294002 and compound c (specific inhibitors of AKT and AMPK. Furthermore, MG clearly alleviated serum TG and total cholesterol release; upregulated AKT, AMPK, and PPARα expression; suppressed SREBP-1c generation; and alleviated hepatic steatosis and dyslipidemia in Ty-induced hyperlipidemia mice. Taken together, these results suggest that MG exerts protective effects against steatosis, hyperlipidemia, and the underlying mechanism, which may be closely associated with AKT/AMPK/PPARα activation and MAPK/NF-κB/SREBP-1c inhibition.

  2. Future non-proliferation challenges

    International Nuclear Information System (INIS)

    Yelchenko, Volodymyr

    2008-01-01

    Having chaired the Second Session of the Preparatory Committee Mr. Volodymyr Yelchenko noted that the NPT States parties reaffirmed the important role of the Treaty as the cornerstone of the global non-proliferation regime. They stressed that non-compliance with the Treaty provisions by States parties undermined non-proliferation and placed emphasis on the mutually reinforcing nature of disarmament and non-proliferation, and due respect for the right of States parties to the peaceful use of nuclear energy in conformity with the treaty. They reaffirmed the importance of promoting the peaceful uses of nuclear energy and international nuclear cooperation for peaceful purposes in ways consistent with the non-proliferation goal of the Treaty. The universality aspect was brought to the front with the lack of progress in this area. States parties called upon India, Israel and Pakistan to accede to the Treaty as non-nuclear-weapons states, promptly and without conditions and to bring into force comprehensive safeguards agreements, together with Additional Protocols, for ensuring non-proliferation. There is concern that non-States actors could gain access to weapons of mass destruction. One of the underlying themes at the Second Prepcom was the total elimination of nuclear weapons as the only absolute guarantee against their proliferation. Negative consequences to nuclear non-proliferation were also mentioned in the context of the abrogation of the Anti-Ballistic Missile Treaty and the development of missile defense systems, with the risk of a new arms race on Earth and in outer space. The importance of the immediate commencement of negotiations in the Conference of Disarmament on a treaty concerning fissile material for nuclear weapons or other nuclear explosive devices and the urgent conclusion of such a treaty as a beneficial step towards non-proliferation was stressed. The NPT states parties reaffirmed the role of the IAEA as the sole competent authority responsible for

  3. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    OpenAIRE

    Lee, M O; Liu, Y; Zhang, X K

    1995-01-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid re...

  4. Proliferation: myth or reality?; La proliferation: mythe ou realite?

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This article analyzes the proliferation approach, its technical condition and political motivation, and the share between the myth (political deception, assumptions and extrapolations) and the reality of proliferation. Its appreciation is complicated by the irrational behaviour of some political actors and by the significant loss of the non-use taboo. The control of technologies is an important element for proliferation slowing down but an efficient and autonomous intelligence system remains indispensable. (J.S.)

  5. Application of ADINA fluid element for transient response analysis of fluid-structure system

    International Nuclear Information System (INIS)

    Sakurai, Y.; Kodama, T.; Shiraishi, T.

    1985-01-01

    Pressure propagation and Fluid-Structure Interaction (FSI) in 3D space were simulated by general purpose finite element program ADINA using the displacement-based fluid element which presumes inviscid and compressible fluid with no net flow. Numerical transient solution was compared with the measured data of an FSI experiment and was found to fairly agree with the measured. In the next step, post analysis was conducted for a blowdown experiment performed with a 1/7 scaled reactor pressure vessel and a flexible core barrel and the code performance was found to be satisfactory. It is concluded that the transient response of the core internal structure of a PWR during the initial stage of LOCA can be analyzed by the displacement-based finite fluid element and the structural element. (orig.)

  6. Development of Finite Element Response Model for Mechanistic - Empirical Design of Flexible Pavement

    Directory of Open Access Journals (Sweden)

    Mujtaba A. AHMED

    2012-08-01

    Full Text Available The focus of this work is to present a finite element method (FEM-based program of the M-E design on MATLAB protocol. The response output generated at critical locations are presented. The results were then compared with those from a locally available program called ‘NEMPADS’ and a reasonable comparison were achieved.

  7. A retinoic acid response element that overlaps an estrogen response element mediates multihormonal sensitivity in transcriptional activation of the lactoferrin gene.

    Science.gov (United States)

    Lee, M O; Liu, Y; Zhang, X K

    1995-08-01

    The lactoferrin gene is highly expressed in many different tissues, and its expression is controlled by different regulators. In this report, we have defined a retinoic acid response element (RARE) in the 5'-flanking region of the lactoferrin gene promoter. The lactoferrin-RARE is composed of two AGGTCA-like motifs arranged as a direct repeat with 1-bp spacing (DR-1). A gel retardation assay demonstrated that it bound strongly with retinoid X receptor (RXR) homodimers and RXR-retinoic acid receptor (RAR) heterodimers as well as chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan receptor. In CV-1 cells, the lactoferrin-RARE linked with a heterologous thymidine kinase promoter was strongly activated by RXR homodimers in response to 9-cis-retinoic acid (9-cis-RA) but not to all-trans-RA. When the COUP-TF orphan receptor was cotransfected, the 9-cis-RA-induced RXR homodimer activity was strongly repressed. A unique feature of the lactoferrin-RARE is that it has an AGGTCA-like motif in common with an estrogen-responsive element (ERE). The composite RARE/ERE contributes to the functional interaction between retinoid receptors and the estrogen receptor (ER) and their ligands. In CV-1 cells, cotransfection of the retinoid and estrogen receptors led to mutual inhibition of the other's activity, while an RA-dependent inhibition of ER activity was observed in breast cancer cells. Furthermore, the lactoferrin-RARE/ERE showed differential transactivation activity in different cell types. RAs could activate the lactoferrin-RARE/ERE in human leukemia HL-60 cells and U937 cells but not in human breast cancer cells. By gel retardation analyses, we demonstrated that strong binding of the endogenous COUP-TF in breast cancer cells to the composite element contributed to diminished RA response in these cells. Thus, the lactoferrin-RARE/ERE functions as a signaling switch module that mediates multihormonal responsiveness in the regulation of lactoferrin gene

  8. Functional analysis of the stress response element and its role in the multistress response of Saccharomyces cerevisiae.

    Science.gov (United States)

    Treger, J M; Magee, T R; McEntee, K

    1998-02-04

    The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.

  9. miR-24 inhibits cell proliferation by suppressing expression of E2F2, MYC and other cell cycle regulatory genes by binding to “seedless” 3′UTR microRNA recognition elements

    Science.gov (United States)

    Lal, Ashish; Navarro, Francisco; Maher, Christopher; Maliszewski, Laura E.; Yan, Nan; O'Day, Elizabeth; Chowdhury, Dipanjan; Dykxhoorn, Derek M.; Tsai, Perry; Hofman, Oliver; Becker, Kevin G.; Gorospe, Myriam; Hide, Winston; Lieberman, Judy

    2009-01-01

    Summary miR-24, up-regulated during terminal differentiation of multiple lineages, inhibits cell cycle progression. Antagonizing miR-24 restores post-mitotic cell proliferation and enhances fibroblast proliferation, while over-expressing miR-24 increases the G1 compartment. The 248 mRNAs down-regulated upon miR-24 over-expression are highly enriched for DNA repair and cell cycle regulatory genes that form a direct interaction network with prominent nodes at genes that enhance (MYC, E2F2, CCNB1, CDC2) or inhibit (p27Kip1, VHL) cell cycle progression. miR-24 directly regulates MYC and E2F2 and some genes they transactivate. Enhanced proliferation from antagonizing miR-24 is abrogated by knocking down E2F2, but not MYC, and cell proliferation, inhibited by miR-24 over-expression, is rescued by miR-24-insensitive E2F2. Therefore, E2F2 is a critical miR-24 target. The E2F2 3′UTR lacks a predicted miR-24 recognition element. In fact, miR-24 regulates expression of E2F2, MYC, AURKB, CCNA2, CDC2, CDK4 and FEN1 by recognizing seedless, but highly complementary, sequences. PMID:19748357

  10. The effect of loading time on flexible pavement dynamic response: a finite element analysis

    Science.gov (United States)

    Yin, Hao; Solaimanian, Mansour; Kumar, Tanmay; Stoffels, Shelley

    2007-12-01

    Dynamic response of asphalt concrete (AC) pavements under moving load is a key component for accurate prediction of flexible pavement performance. The time and temperature dependency of AC materials calls for utilizing advanced material characterization and mechanistic theories, such as viscoelasticity and stress/strain analysis. In layered elastic analysis, as implemented in the new Mechanistic-Empirical Pavement Design Guide (MEPDG), the time dependency is accounted for by calculating the loading times at different AC layer depths. In this study, the time effect on pavement response was evaluated by means of the concept of “pseudo temperature.” With the pavement temperature measured from instrumented thermocouples, the time and temperature dependency of AC materials was integrated into one single factor, termed “effective temperature.” Via this effective temperature, pavement responses under a transient load were predicted through finite element analysis. In the finite element model, viscoelastic behavior of AC materials was characterized through relaxation moduli, while the layers with unbound granular material were assumed to be in an elastic mode. The analysis was conducted for two different AC mixtures in a simplified flexible pavement structure at two different seasons. Finite element analysis results reveal that the loading time has a more pronounced impact on pavement response in the summer for both asphalt types. The results indicate that for reasonable prediction of dynamic response in flexible pavements, the effect of the depth-dependent loading time on pavement temperature should be considered.

  11. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  12. Unique proliferation response in odontoblastic cells derived from human skeletal muscle stem cells by cytokine-induced matrix metalloproteinase-3

    International Nuclear Information System (INIS)

    Ozeki, Nobuaki; Hase, Naoko; Kawai, Rie; Yamaguchi, Hideyuki; Hiyama, Taiki; Kondo, Ayami; Nakata, Kazuhiko; Mogi, Makio

    2015-01-01

    A pro-inflammatory cytokine mixture (CM: interleukin (IL)-1β, tumor necrosis factor-α and interferon-γ) and IL-1β-induced matrix metalloproteinase (MMP)-3 activity have been shown to increase the proliferation of rat dental pulp cells and murine stem cell-derived odontoblast-like cells. This suggests that MMP-3 may regulate wound healing and regeneration in the odontoblast-rich dental pulp. Here, we determined whether these results can be extrapolated to human dental pulp by investigating the effects of CM-induced MMP-3 up-regulation on the proliferation and apoptosis of purified odontoblast-like cells derived from human skeletal muscle stem cells. We used siRNA to specifically reduce MMP-3 expression. We found that CM treatment increased MMP-3 mRNA and protein levels as well as MMP-3 activity. Cell proliferation was also markedly increased, with no changes in apoptosis, upon treatment with CM and following the application of exogenous MMP-3. Endogenous tissue inhibitors of metalloproteinases were constitutively expressed during all experiments and unaffected by MMP-3. Although treatment with MMP-3 siRNA suppressed cell proliferation, it also unexpectedly increased apoptosis. This siRNA-mediated increase in apoptosis could be reversed by exogenous MMP-3. These results demonstrate that cytokine-induced MMP-3 activity regulates cell proliferation and suppresses apoptosis in human odontoblast-like cells. - Highlights: • Pro-inflammatory cytokines induce MMP-3 activity in human odontoblast-like cells. • Increased MMP-3 activity can promote cell proliferation in odontoblasts. • Specific loss of MMP-3 increases apoptosis in odontoblasts. • MMP-3 has potential as a promising new target for pupal repair and regeneration

  13. Unique proliferation response in odontoblastic cells derived from human skeletal muscle stem cells by cytokine-induced matrix metalloproteinase-3

    Energy Technology Data Exchange (ETDEWEB)

    Ozeki, Nobuaki; Hase, Naoko; Kawai, Rie; Yamaguchi, Hideyuki; Hiyama, Taiki [Department of Endodontics, School of Dentistry, Aichi Gakuin University, 2-11 Suemori-dori, Chikusa-ku, Nagoya 464-8651, Aichi (Japan); Kondo, Ayami [Department of Medicinal Biochemistry, School of Pharmacy, Aichi Gakuin University, 1-100 Kusumoto, Chikusa-ku, Nagoya 464-8650 (Japan); Nakata, Kazuhiko [Department of Endodontics, School of Dentistry, Aichi Gakuin University, 2-11 Suemori-dori, Chikusa-ku, Nagoya 464-8651, Aichi (Japan); Mogi, Makio, E-mail: makio@dpc.agu.ac.jp [Department of Medicinal Biochemistry, School of Pharmacy, Aichi Gakuin University, 1-100 Kusumoto, Chikusa-ku, Nagoya 464-8650 (Japan)

    2015-02-01

    A pro-inflammatory cytokine mixture (CM: interleukin (IL)-1β, tumor necrosis factor-α and interferon-γ) and IL-1β-induced matrix metalloproteinase (MMP)-3 activity have been shown to increase the proliferation of rat dental pulp cells and murine stem cell-derived odontoblast-like cells. This suggests that MMP-3 may regulate wound healing and regeneration in the odontoblast-rich dental pulp. Here, we determined whether these results can be extrapolated to human dental pulp by investigating the effects of CM-induced MMP-3 up-regulation on the proliferation and apoptosis of purified odontoblast-like cells derived from human skeletal muscle stem cells. We used siRNA to specifically reduce MMP-3 expression. We found that CM treatment increased MMP-3 mRNA and protein levels as well as MMP-3 activity. Cell proliferation was also markedly increased, with no changes in apoptosis, upon treatment with CM and following the application of exogenous MMP-3. Endogenous tissue inhibitors of metalloproteinases were constitutively expressed during all experiments and unaffected by MMP-3. Although treatment with MMP-3 siRNA suppressed cell proliferation, it also unexpectedly increased apoptosis. This siRNA-mediated increase in apoptosis could be reversed by exogenous MMP-3. These results demonstrate that cytokine-induced MMP-3 activity regulates cell proliferation and suppresses apoptosis in human odontoblast-like cells. - Highlights: • Pro-inflammatory cytokines induce MMP-3 activity in human odontoblast-like cells. • Increased MMP-3 activity can promote cell proliferation in odontoblasts. • Specific loss of MMP-3 increases apoptosis in odontoblasts. • MMP-3 has potential as a promising new target for pupal repair and regeneration.

  14. Cyclic GMP-AMP Synthase Is Required for Cell Proliferation and Inflammatory Responses in Rheumatoid Arthritis Synoviocytes

    OpenAIRE

    Wang, Yan; Su, Guo-Hua; Zhang, Fang; Chu, Jing-Xue; Wang, Yun-Shan

    2015-01-01

    Rheumatoid arthritis (RA) is characterized by inflammatory cell infiltration, fibroblast-like synoviocytes (FLS) invasive proliferation, and joint destruction. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces immune activation. In this study, we examined whether cGAS plays a role in RA FLS. In this study, cGAS was overexpressed in RA-FLS compared with OA FLS. TNFα stimulation induced cGAS expression in RA FLS. Overexpression of cGAS promoted the proliferation and knockdow...

  15. Dynamic Response of a Planetary Gear System Using a Finite Element/Contact Mechanics Model

    Science.gov (United States)

    Parker, Robert G.; Agashe, Vinayak; Vijayakar, Sandeep M.

    2000-01-01

    The dynamic response of a helicopter planetary gear system is examined over a wide range of operating speeds and torques. The analysis tool is a unique, semianalytical finite element formulation that admits precise representation of the tooth geometry and contact forces that are crucial in gear dynamics. Importantly, no a priori specification of static transmission error excitation or mesh frequency variation is required; the dynamic contact forces are evaluated internally at each time step. The calculated response shows classical resonances when a harmonic of mesh frequency coincides with a natural frequency. However, peculiar behavior occurs where resonances expected to be excited at a given speed are absent. This absence of particular modes is explained by analytical relationships that depend on the planetary configuration and mesh frequency harmonic. The torque sensitivity of the dynamic response is examined and compared to static analyses. Rotation mode response is shown to be more sensitive to input torque than translational mode response.

  16. Creating diversified response profiles from a single quenchometric sensor element by using phase-resolved luminescence.

    Science.gov (United States)

    Tehan, Elizabeth C; Bukowski, Rachel M; Chodavarapu, Vamsy P; Titus, Albert H; Cartwright, Alexander N; Bright, Frank V

    2015-01-05

    We report a new strategy for generating a continuum of response profiles from a single luminescence-based sensor element by using phase-resolved detection. This strategy yields reliable responses that depend in a predictable manner on changes in the luminescent reporter lifetime in the presence of the target analyte, the excitation modulation frequency, and the detector (lock-in amplifier) phase angle. In the traditional steady-state mode, the sensor that we evaluate exhibits a linear, positive going response to changes in the target analyte concentration. Under phase-resolved conditions the analyte-dependent response profiles: (i) can become highly non-linear; (ii) yield negative going responses; (iii) can be biphasic; and (iv) can exhibit super sensitivity (e.g., sensitivities up to 300 fold greater in comparison to steady-state conditions).

  17. Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element.

    Science.gov (United States)

    Watanabe, Kenneth A; Homayouni, Arielle; Gu, Lingkun; Huang, Kuan-Ying; Ho, Tuan-Hua David; Shen, Qingxi J

    2017-09-01

    Seeds serve as a great model to study plant responses to drought stress, which is largely mediated by abscisic acid (ABA). The ABA responsive element (ABRE) is a key cis-regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA-induced genes in rice aleurone cells, suggesting other ABREs may exist. To identify novel ABREs, RNA sequencing was performed on aleurone cells of rice seeds treated with 20 μM ABA. Gibbs sampling was used to identify enriched elements, and particle bombardment-mediated transient expression studies were performed to verify the function. Gene ontology analysis was performed to predict the roles of genes containing the novel ABREs. This study revealed 2443 ABA-inducible genes and a novel ABRE, designated as ABREN, which was experimentally verified to mediate ABA signalling in rice aleurone cells. Many of the ABREN-containing genes are predicted to be involved in stress responses and transcription. Analysis of other species suggests that the ABREN may be monocot specific. This study also revealed interesting expression patterns of genes involved in ABA metabolism and signalling. Collectively, this study advanced our understanding of diverse cis-regulatory sequences and the transcriptomes underlying ABA responses in rice aleurone cells. © 2017 John Wiley & Sons Ltd.

  18. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  19. Seismic response of three-dimensional rockfill dams using the Indirect Boundary Element Method

    International Nuclear Information System (INIS)

    Sanchez-Sesma, Francisco J; Arellano-Guzman, Mauricio; Perez-Gavilan, Juan J; Suarez, Martha; Marengo-Mogollon, Humberto; Chaillat, Stephanie; Jaramillo, Juan Diego; Gomez, Juan; Iturraran-Viveros, Ursula; Rodriguez-Castellanos, Alejandro

    2010-01-01

    The Indirect Boundary Element Method (IBEM) is used to compute the seismic response of a three-dimensional rockfill dam model. The IBEM is based on a single layer integral representation of elastic fields in terms of the full-space Green function, or fundamental solution of the equations of dynamic elasticity, and the associated force densities along the boundaries. The method has been applied to simulate the ground motion in several configurations of surface geology. Moreover, the IBEM has been used as benchmark to test other procedures. We compute the seismic response of a three-dimensional rockfill dam model placed within a canyon that constitutes an irregularity on the surface of an elastic half-space. The rockfill is also assumed elastic with hysteretic damping to account for energy dissipation. Various types of incident waves are considered to analyze the physical characteristics of the response: symmetries, amplifications, impulse response and the like. Computations are performed in the frequency domain and lead to time response using Fourier analysis. In the present implementation a symmetrical model is used to test symmetries. The boundaries of each region are discretized into boundary elements whose size depends on the shortest wavelength, typically, six boundary segments per wavelength. Usually, the seismic response of rockfill dams is simulated using either finite elements (FEM) or finite differences (FDM). In most applications, commercial tools that combine features of these methods are used to assess the seismic response of the system for a given motion at the base of model. However, in order to consider realistic excitation of seismic waves with different incidence angles and azimuth we explore the IBEM.

  20. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Science.gov (United States)

    Bi, Rong; Ismar, Stefanie M. H.; Sommer, Ulrich; Zhao, Meixun

    2018-02-01

    Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs) in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C), three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1) and two pCO2 levels (560 and 2400 µatm). Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON) and low ratios of PON vs. particulate organic phosphorus (PON : POP) in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC) and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2) on elemental cellular contents and docosahexaenoic acid (DHA) proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2). Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  1. Central canal ependymal cells proliferate extensively in response to traumatic spinal cord injury but not demyelinating lesions.

    Directory of Open Access Journals (Sweden)

    Steve Lacroix

    Full Text Available The adult mammalian spinal cord has limited regenerative capacity in settings such as spinal cord injury (SCI and multiple sclerosis (MS. Recent studies have revealed that ependymal cells lining the central canal possess latent neural stem cell potential, undergoing proliferation and multi-lineage differentiation following experimental SCI. To determine whether reactive ependymal cells are a realistic endogenous cell population to target in order to promote spinal cord repair, we assessed the spatiotemporal dynamics of ependymal cell proliferation for up to 35 days in three models of spinal pathologies: contusion SCI using the Infinite Horizon impactor, focal demyelination by intraspinal injection of lysophosphatidylcholine (LPC, and autoimmune-mediated multi-focal demyelination using the active experimental autoimmune encephalomyelitis (EAE model of MS. Contusion SCI at the T9-10 thoracic level stimulated a robust, long-lasting and long-distance wave of ependymal proliferation that peaked at 3 days in the lesion segment, 14 days in the rostral segment, and was still detectable at the cervical level, where it peaked at 21 days. This proliferative wave was suppressed distal to the contusion. Unlike SCI, neither chemical- nor autoimmune-mediated demyelination triggered ependymal cell proliferation at any time point, despite the occurrence of demyelination (LPC and EAE, remyelination (LPC and significant locomotor defects (EAE. Thus, traumatic SCI induces widespread and enduring activation of reactive ependymal cells, identifying them as a robust cell population to target for therapeutic manipulation after contusion; conversely, neither demyelination, remyelination nor autoimmunity appears sufficient to trigger proliferation of quiescent ependymal cells in models of MS-like demyelinating diseases.

  2. Verification of Advective Bar Elements Implemented in the Aria Thermal Response Code.

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Brantley [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-01-01

    A verification effort was undertaken to evaluate the implementation of the new advective bar capability in the Aria thermal response code. Several approaches to the verification process were taken : a mesh refinement study to demonstrate solution convergence in the fluid and the solid, visually examining the mapping of the advective bar element nodes to the surrounding surfaces, and a comparison of solutions produced using the advective bars for simple geometries with solutions from commercial CFD software . The mesh refinement study has shown solution convergence for simple pipe flow in both temperature and velocity . Guidelines were provided to achieve appropriate meshes between the advective bar elements and the surrounding volume. Simulations of pipe flow using advective bars elements in Aria have been compared to simulations using the commercial CFD software ANSYS Fluent (r) and provided comparable solutions in temperature and velocity supporting proper implementation of the new capability. Verification of Advective Bar Elements iv Acknowledgements A special thanks goes to Dean Dobranich for his guidance and expertise through all stages of this effort . His advice and feedback was instrumental to its completion. Thanks also goes to Sam Subia and Tolu Okusanya for helping to plan many of the verification activities performed in this document. Thank you to Sam, Justin Lamb and Victor Brunini for their assistance in resolving issues encountered with running the advective bar element model. Finally, thanks goes to Dean, Sam, and Adam Hetzler for reviewing the document and providing very valuable comments.

  3. Frequency response analysis of cylindrical shells conveying fluid using finite element method

    International Nuclear Information System (INIS)

    Seo, Young Soo; Jeong, Weui Bong; Yoo, Wan Suk; Jeong, Ho Kyeong

    2005-01-01

    A finite element vibration analysis of thin-walled cylindrical shells conveying fluid with uniform velocity is presented. The dynamic behavior of thin-walled shell is based on the Sanders' theory and the fluid in cylindrical shell is considered as inviscid and incompressible so that it satisfies the Laplace's equation. A beam-like shell element is used to reduce the number of degree-of-freedom by restricting to the circumferential modes of cylindrical shell. An estimation of frequency response function of the pipe considering of the coupled effects of the internal fluid is presented. A dynamic coupling condition of the interface between the fluid and the structure is used. The effective thickness of fluid according to circumferential modes is also discussed. The influence of fluid velocity on the frequency response function is illustrated and discussed. The results by this method are compared with published results and those by commercial tools

  4. Prediction of elastic-plastic response of structural elements subjected to cyclic loading

    International Nuclear Information System (INIS)

    El Haddad, M.H.; Samaan, S.

    1985-01-01

    A simplified elastic-plastic analysis is developed to predict stress strain and force deformation response of structural metallic elements subjected to irregular cyclic loadings. In this analysis a simple elastic-plastic method for predicting the skeleton force deformation curve is developed. In this method, elastic and fully plastic solutions are first obtained for unknown quantities, such as deflection or local strains. Elastic and fully plastic contributions are then combined to obtain an elastic-plastic solution. The skeleton curve is doubled to establish the shape of the hysteresis loop. The complete force deformation response can therefore be simulated through reversal by reversal in accordance with hysteresis looping and material memory. Several examples of structural elements with various cross sections made from various materials and subjected to irregular cyclic loadings, are analysed. A close agreement is obtained between experimental results found in the literature and present predictions. (orig.)

  5. Reactor calculation in coarse mesh by finite element method applied to matrix response method

    International Nuclear Information System (INIS)

    Nakata, H.

    1982-01-01

    The finite element method is applied to the solution of the modified formulation of the matrix-response method aiming to do reactor calculations in coarse mesh. Good results are obtained with a short running time. The method is applicable to problems where the heterogeneity is predominant and to problems of evolution in coarse meshes where the burnup is variable in one same coarse mesh, making the cross section vary spatially with the evolution. (E.G.) [pt

  6. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    OpenAIRE

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by ...

  7. Nuclear non-proliferation

    International Nuclear Information System (INIS)

    Anon.

    1984-01-01

    DOE's nuclear non-proliferation responsibilities are defined by the provisions of the Atomic Energy Act of 1954, as amended, and of the Nuclear Non-Proliferation Act of 1978 (NNPA). The Department's major responsibilities in this area are to: (1) provide technical assistance to the Department of State in negotiating agreements for civil cooperation in the peaceful uses of nuclear energy with other countries and international organizations; (2) join with other agencies to reach executive branch judgments with respect to the issuance of export licenses by the Nuclear Regulatory Commission; (3) be responsible for processing subsequent arrangements with other agencies as required by the Nuclear Non-Proliferation Act; (4) control the distribution of special nuclear materials, components, equipment, and nuclear technology exports; (5) participate in bilateral and multilateral cooperation with foreign governments and organizations to promote the peaceful uses of nuclear energy; and (6) act as a primary technical resource with respect to US participation in the International Atomic Energy Agency

  8. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress Response.

    Science.gov (United States)

    Horváth, Vivien; Merenciano, Miriam; González, Josefa

    2017-11-01

    A relationship between transposable elements (TEs) and the eukaryotic stress response was suggested in the first publications describing TEs. Since then, it has often been assumed that TEs are activated by stress, and that this activation is often beneficial for the organism. In recent years, the availability of new high-throughput experimental techniques has allowed further interrogation of the relationship between TEs and stress. By reviewing the recent literature, we conclude that although there is evidence for a beneficial effect of TE activation under stress conditions, the relationship between TEs and the eukaryotic stress response is quite complex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Effect of randomness on multi-frequency aeroelastic responses resolved by Unsteady Adaptive Stochastic Finite Elements

    International Nuclear Information System (INIS)

    Witteveen, Jeroen A.S.; Bijl, Hester

    2009-01-01

    The Unsteady Adaptive Stochastic Finite Elements (UASFE) method resolves the effect of randomness in numerical simulations of single-mode aeroelastic responses with a constant accuracy in time for a constant number of samples. In this paper, the UASFE framework is extended to multi-frequency responses and continuous structures by employing a wavelet decomposition pre-processing step to decompose the sampled multi-frequency signals into single-frequency components. The effect of the randomness on the multi-frequency response is then obtained by summing the results of the UASFE interpolation at constant phase for the different frequency components. Results for multi-frequency responses and continuous structures show a three orders of magnitude reduction of computational costs compared to crude Monte Carlo simulations in a harmonically forced oscillator, a flutter panel problem, and the three-dimensional transonic AGARD 445.6 wing aeroelastic benchmark subject to random fields and random parameters with various probability distributions.

  10. Transitional change in rat fetal cell proliferation in response to ghrelin and des-acyl ghrelin during the last stage of pregnancy

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, Yoshiyuki; Nakahara, Keiko [Department of Veterinary Physiology, Faculty of Agriculture, University of Miyazaki, Miyazaki 889-2192 (Japan); Kangawa, Kenji [Department of Biochemistry, National Cardiovascular Center Research Institute, Fujishirodai 5-7-1, Suita, Osaka 565-8565 (Japan); Murakami, Noboru, E-mail: a0d201u@cc.miyazaki-u.ac.jp [Department of Veterinary Physiology, Faculty of Agriculture, University of Miyazaki, Miyazaki 889-2192 (Japan)

    2010-03-12

    Expression of mRNA for the ghrelin receptor, GHS-R1a, was detected in various peripheral and central tissues of fetal rats, including skin, bone, heart, liver, gut, brain and spinal cord, on embryonic day (ED)15 and ED17. However, its expression in skin, bone, heart and liver, but not in gut, brain and spinal cord, became relatively weak on ED19 and disappeared after birth (ND2). Ghrelin and des-acyl ghrelin facilitated the proliferation of cultured fetal (ED17, 19), but not neonatal (ND2), skin cells. On the other hand, with regard to cells from the spinal cord and hypothalamus, the proliferative effect of ghrelin continued after birth, whereas the effect of des-acyl ghrelin on neurogenesis in these tissues was lost at the ED19 fetal and ND2 neonatal stages. Immunohistochemistry revealed that the cells in the hypothalamus induced to proliferate by ghrelin at the ND2 stage were positive for nestin and glial fibrillary acidic protein. These results suggest that in the period immediately prior to, and after birth, rat fetal cells showing proliferation in response to ghrelin and des-acyl ghrelin are at a transitional stage characterized by alteration of the expression of GHS-R1a and an undefined des-acyl ghrelin receptor, their responsiveness varying among different tissues.

  11. Transitional change in rat fetal cell proliferation in response to ghrelin and des-acyl ghrelin during the last stage of pregnancy

    International Nuclear Information System (INIS)

    Inoue, Yoshiyuki; Nakahara, Keiko; Kangawa, Kenji; Murakami, Noboru

    2010-01-01

    Expression of mRNA for the ghrelin receptor, GHS-R1a, was detected in various peripheral and central tissues of fetal rats, including skin, bone, heart, liver, gut, brain and spinal cord, on embryonic day (ED)15 and ED17. However, its expression in skin, bone, heart and liver, but not in gut, brain and spinal cord, became relatively weak on ED19 and disappeared after birth (ND2). Ghrelin and des-acyl ghrelin facilitated the proliferation of cultured fetal (ED17, 19), but not neonatal (ND2), skin cells. On the other hand, with regard to cells from the spinal cord and hypothalamus, the proliferative effect of ghrelin continued after birth, whereas the effect of des-acyl ghrelin on neurogenesis in these tissues was lost at the ED19 fetal and ND2 neonatal stages. Immunohistochemistry revealed that the cells in the hypothalamus induced to proliferate by ghrelin at the ND2 stage were positive for nestin and glial fibrillary acidic protein. These results suggest that in the period immediately prior to, and after birth, rat fetal cells showing proliferation in response to ghrelin and des-acyl ghrelin are at a transitional stage characterized by alteration of the expression of GHS-R1a and an undefined des-acyl ghrelin receptor, their responsiveness varying among different tissues.

  12. Development of a Rapidly Deployed Department of Energy Emergency Response Element

    International Nuclear Information System (INIS)

    Riland, C.A.; Hopkins, R.C.; Tighe, R.J.

    1999-01-01

    The Federal Radiological Emergency Response Plan (FRERP) directs the Department of Energy (DOE) to maintain a viable, timely, and fully documented response option capable of supporting the responsible Lead Federal Agency in the event of a radiological emergency impacting any state or US territory (e.g., CONUS). In addition, the DOE maintains a response option to support radiological emergencies outside the continental US (OCONUS). While the OCUNUS mission is not governed by the FREP, this response is operationally similar to that assigned to the DOE by the FREP. The DOE is prepared to alert, activate, and deploy radiological response teams to augment the Radiological Assistance Program and/or local responders. The Radiological Monitoring and Assessment Center (RMAC) is a phased response that integrates with the Federal Radiological Monitoring and Assessment Center (FRMAC) in CONUS environments and represents a stand-alone DOE response for OCONUS environments. The FRMAC/RMAC Phase I was formally ''stood up'' as an operational element in April 1999. The FRMAC/RMAC Phase II proposed ''stand-up'' date is midyear 2000

  13. Proliferation risks

    International Nuclear Information System (INIS)

    Carchon, R.

    1998-09-01

    The report gives an overview of different aspects related to safeguards of fissile materials. Existing treaties including the Non-Proliferation Treaty, and the Tlatelolco and the Rarotonga Treaties are discussed. An overview of safeguards systems for the control of fissile materials as well as the role of various authorities is given. An overall overview of proliferation risks, the physical protection of fissile materials and the trade in fissile materials is given. Finally, the status in problem countries and de facto nuclear weapon states is discussed

  14. Cytokine production but lack of proliferation in peripheral blood mononuclear cells from chronic Chagas' disease cardiomyopathy patients in response to T. cruzi ribosomal P proteins.

    Directory of Open Access Journals (Sweden)

    Silvia A Longhi

    2014-06-01

    Full Text Available BACKGROUND: Trypanosoma cruzi ribosomal P proteins, P2β and P0, induce high levels of antibodies in patients with chronic Chagas' disease Cardiomyopathy (CCC. It is well known that these antibodies alter the beating rate of cardiomyocytes and provoke apoptosis by their interaction with β1-adrenergic and M2-muscarinic cardiac receptors. Based on these findings, we decided to study the cellular immune response to these proteins in CCC patients compared to non-infected individuals. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated proliferation, presence of surface activation markers and cytokine production in peripheral blood mononuclear cells (PBMC stimulated with P2β, the C-terminal portion of P0 (CP0 proteins and T. cruzi lysate from CCC patients predominantly infected with TcVI lineage. PBMC from CCC patients cultured with P2β or CP0 proteins, failed to proliferate and express CD25 and HLA-DR on T cell populations. However, multiplex cytokine assays showed that these antigens triggered higher secretion of IL-10, TNF-α and GM-CSF by PBMC as well as both CD4+ and CD8+ T cells subsets of CCC subjects. Upon T. cruzi lysate stimulation, PBMC from CCC patients not only proliferated but also became activated within the context of Th1 response. Interestingly, T. cruzi lysate was also able to induce the secretion of GM-CSF by CD4+ or CD8+ T cells. CONCLUSIONS/SIGNIFICANCE: Our results showed that although the lack of PBMC proliferation in CCC patients in response to ribosomal P proteins, the detection of IL-10, TNF-α and GM-CSF suggests that specific T cells could have both immunoregulatory and pro-inflammatory potential, which might modulate the immune response in Chagas' disease. Furthermore, it was possible to demonstrate for the first time that GM-CSF was produced by PBMC of CCC patients in response not only to recombinant ribosomal P proteins but also to parasite lysate, suggesting the value of this cytokine to evaluate T cells responses in T

  15. Analysis of Resonance Response Performance of C-Band Antenna Using Parasitic Element

    Science.gov (United States)

    Islam, M. T.; Misran, N.; Mandeep, J. S.

    2014-01-01

    Analysis of the resonance response improvement of a planar C-band (4–8 GHz) antenna is proposed using parasitic element method. This parasitic element based method is validated for change in the active and parasitic antenna elements. A novel dual-band antenna for C-band application covering 5.7 GHz and 7.6 GHz is designed and fabricated. The antenna is composed of circular parasitic element with unequal microstrip lines at both sides and a rectangular partial ground plane. A fractional bandwidth of 13.5% has been achieved from 5.5 GHz to 6.3 GHz (WLAN band) for the lower band. The upper band covers from 7.1 GHz to 8 GHz with a fractional bandwidth of 12%. A gain of 6.4 dBi is achieved at the lower frequency and 4 dBi is achieved at the upper frequency. The VSWR of the antenna is less than 2 at the resonance frequency. PMID:24895643

  16. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    Directory of Open Access Journals (Sweden)

    Marinus F van Batenburg

    2010-01-01

    Full Text Available Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs, but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  17. Effects of rare earth elements and REE-binding proteins on physiological responses in plants.

    Science.gov (United States)

    Liu, Dongwu; Wang, Xue; Chen, Zhiwei

    2012-02-01

    Rare earth elements (REEs), which include 17 elements in the periodic table, share chemical properties related to a similar external electronic configuration. REEs enriched fertilizers have been used in China since the 1980s. REEs could enter the cell and cell organelles, influence plant growth, and mainly be bound with the biological macromolecules. REE-binding proteins have been found in some plants. In addition, the chlorophyll activities and photosynthetic rate can be regulated by REEs. REEs could promote the protective function of cell membrane and enhance the plant resistance capability to stress produced by environmental factors, and affect the plant physiological mechanism by regulating the Ca²⁺ level in the plant cells. The focus of present review is to describe how REEs and REE-binding proteins participate in the physiological responses in plants.

  18. Conditionally immortalized human pancreatic stellate cell lines demonstrate enhanced proliferation and migration in response to IGF-I

    Energy Technology Data Exchange (ETDEWEB)

    Rosendahl, Ann H., E-mail: ann.rosendahl@med.lu.se [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden); Lund University and Skåne University Hospital, Department of Clinical Sciences Lund, Division of Oncology and Pathology, Lund (Sweden); Gundewar, Chinmay; Said Hilmersson, Katarzyna [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden); Ni, Lan; Saleem, Moin A. [University of Bristol, School of Clinical Sciences, Children' s Renal Unit and Academic Renal Unit, Bristol (United Kingdom); Andersson, Roland [Lund University, Department of Clinical Sciences Lund, Division of Surgery, Lund (Sweden)

    2015-01-15

    Pancreatic stellate cells (PSCs) play a key role in the dense desmoplastic stroma associated with pancreatic ductal adenocarcinoma. Studies on human PSCs have been minimal due to difficulty in maintaining primary PSC in culture. We have generated the first conditionally immortalized human non-tumor (NPSC) and tumor-derived (TPSC) pancreatic stellate cells via transformation with the temperature-sensitive SV40 large T antigen and human telomerase (hTERT). These cells proliferate at 33°C. After transfer to 37°C, the SV40LT is switched off and the cells regain their primary PSC phenotype and growth characteristics. NPSC contained cytoplasmic vitamin A-storing lipid droplets, while both NPSC and TPSC expressed the characteristic markers αSMA, vimentin, desmin and GFAP. Proteome array analysis revealed that of the 55 evaluated proteins, 27 (49%) were upregulated ≥3-fold in TPSC compared to NPSC, including uPA, pentraxin-3, endoglin and endothelin-1. Two insulin-like growth factor binding proteins (IGFBPs) were inversely expressed. Although discordant IGFBP-2 and IGFBP-3 levels, IGF-I was found to stimulate proliferation of both NPSC and TPSC. Both basal and IGF-I stimulated motility was significantly enhanced in TPSC compared to NPSC. In conclusion, these cells provide a unique resource that will facilitate further study of the active stroma compartment associated with pancreatic cancer. - Highlights: • Generation of human conditionally immortalized human pancreatic stellate cell lines. • Temperature-sensitive SV40LT allows switch to primary PSC phenotype characteristics. • Proteome profiling revealed distinct expression patterns between TPSC and NPSC. • Enhanced IGF-I-stimulated proliferation and motility by TPSC compared to NPSC.

  19. Finite Element Based Response Surface Methodology to Optimize Segmental Tunnel Lining

    Directory of Open Access Journals (Sweden)

    A. Rastbood

    2017-04-01

    Full Text Available The main objective of this paper is to optimize the geometrical and engineering characteristics of concrete segments of tunnel lining using Finite Element (FE based Response Surface Methodology (RSM. Input data for RSM statistical analysis were obtained using FEM. In RSM analysis, thickness (t and elasticity modulus of concrete segments (E, tunnel height (H, horizontal to vertical stress ratio (K and position of key segment in tunnel lining ring (θ were considered as input independent variables. Maximum values of Mises and Tresca stresses and tunnel ring displacement (UMAX were set as responses. Analysis of variance (ANOVA was carried out to investigate the influence of each input variable on the responses. Second-order polynomial equations in terms of influencing input variables were obtained for each response. It was found that elasticity modulus and key segment position variables were not included in yield stresses and ring displacement equations, and only tunnel height and stress ratio variables were included in ring displacement equation. Finally optimization analysis of tunnel lining ring was performed. Due to absence of elasticity modulus and key segment position variables in equations, their values were kept to average level and other variables were floated in related ranges. Response parameters were set to minimum. It was concluded that to obtain optimum values for responses, ring thickness and tunnel height must be near to their maximum and minimum values, respectively and ground state must be similar to hydrostatic conditions.

  20. Simultaneous shifts in elemental stoichiometry and fatty acids of Emiliania huxleyi in response to environmental changes

    Directory of Open Access Journals (Sweden)

    R. Bi

    2018-02-01

    Full Text Available Climate-driven changes in environmental conditions have significant and complex effects on marine ecosystems. Variability in phytoplankton elements and biochemicals can be important for global ocean biogeochemistry and ecological functions, while there is currently limited understanding on how elements and biochemicals respond to the changing environments in key coccolithophore species such as Emiliania huxleyi. We investigated responses of elemental stoichiometry and fatty acids (FAs in a strain of E. huxleyi under three temperatures (12, 18 and 24 °C, three N : P supply ratios (molar ratios 10:1, 24:1 and 63:1 and two pCO2 levels (560 and 2400 µatm. Overall, C : N : P stoichiometry showed the most pronounced response to N : P supply ratios, with high ratios of particulate organic carbon vs. particulate organic nitrogen (POC : PON and low ratios of PON vs. particulate organic phosphorus (PON : POP in low-N media, and high POC : POP and PON : POP in low-P media. The ratio of particulate inorganic carbon vs. POC (PIC : POC and polyunsaturated fatty acid proportions strongly responded to temperature and pCO2, both being lower under high pCO2 and higher with warming. We observed synergistic interactions between warming and nutrient deficiency (and high pCO2 on elemental cellular contents and docosahexaenoic acid (DHA proportion in most cases, indicating the enhanced effect of warming under nutrient deficiency (and high pCO2. Our results suggest differential sensitivity of elements and FAs to the changes in temperature, nutrient availability and pCO2 in E. huxleyi, which is to some extent unique compared to non-calcifying algal classes. Thus, simultaneous changes of elements and FAs should be considered when predicting future roles of E. huxleyi in the biotic-mediated connection between biogeochemical cycles, ecological functions and climate change.

  1. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    containing binding domains for the transcription factors AP-1 and Ets. This DNA sequence (TGCCTCAGTTTCCC) is similar to antioxidant responsive element. X-ray- mediated transcriptional activation of the 5' regulatory region of ICAM-1 required the antioxidant responsive element (ARE). Electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells incubated with the ARE binding domain (5'-GCTGCTGCCTCAGTTTCCC-3') showed increased protein-DNA complexes at 60 and 120 minutes after irradiation. Conclusions: 1) ICAM induction in irradiated tissue occurs in the microvascular endothelium. 2) ICAM expression contributes to the pathogenesis of radiation-mediated tissue injury and the ICAM knockout serves as a model for the study of the pathogenesis of tissue injury. 3) ICAM expression is regulated by a novel radiation-inducible cis-acting element that has homology to previously identified antioxidant responsive elements

  2. Differential effects of β-catenin and NF-κB interplay in the regulation of cell proliferation, inflammation and tumorigenesis in response to bacterial infection.

    Directory of Open Access Journals (Sweden)

    Parthasarathy Chandrakesan

    Full Text Available Both β-catenin and NF-κB have been implicated in our laboratory as candidate factors in driving proliferation in an in vivo model of Citrobacter rodentium (CR-induced colonic crypt hyper-proliferation and hyperplasia. Herein, we test the hypothesis that β-catenin and not necessarily NF-κB regulates colonic crypt hyperplasia or tumorigenesis in response to CR infection. When C57Bl/6 wild type (WT mice were infected with CR, sequential increases in proliferation at days 9 and 12 plateaued off at day 19 and paralleled increases in NF-κB signaling. In Tlr4(-/- (KO mice, a sequential but sustained proliferation which tapered off only marginally at day 19, was associated with TLR4-dependent and independent increases in NF-κB signaling. Similarly, increases in either activated or total β-catenin in the colonic crypts of WT mice as early as day 3 post-infection coincided with cyclinD1 and c-myc expression and associated crypt hyperplasia. In KO mice, a delayed kinetics associated predominantly with increases in non-phosphorylated (active β-catenin coincided with increases in cyclinD1, c-myc and crypt hyperplasia. Interestingly, PKCζ-catalyzed Ser-9 phosphorylation and inactivation of GSK-3β and not loss of wild type APC protein accounted for β-catenin accumulation and nuclear translocation in either strain. In vitro studies with Wnt2b and Wnt5a further validated the interplay between the Wnt/β-catenin and NF-κB pathways, respectively. When WT or KO mice were treated with nanoparticle-encapsulated siRNA to β-catenin (si-β-Cat, almost complete loss of nuclear β-catenin coincided with concomitant decreases in CD44 and crypt hyperplasia without defects in NF-κB signaling. si-β-Cat treatment to Apc(Min/+ mice attenuated CR-induced increases in β-catenin and CD44 that halted the growth of mutated crypts without affecting NF-κB signaling. The predominant β-catenin-induced crypt proliferation was further validated in a Castaneus strain (B6

  3. Characterization of a hypoxia-response element in the Epo locus of the pufferfish, Takifugu rubripes.

    Science.gov (United States)

    Kulkarni, Rashmi P; Tohari, Sumanty; Ho, Adrian; Brenner, Sydney; Venkatesh, Byrappa

    2010-06-01

    Animals respond to hypoxia by increasing synthesis of the glycoprotein hormone erythropoietin (Epo) which in turn stimulates the production of red blood cells. The gene encoding Epo has been recently cloned in teleost fishes such as the pufferfish Takifugu rubripes (fugu) and zebrafish (Danio rerio). It has been shown that the transcription levels of Epo in teleost fishes increase in response to anemia or hypoxia in a manner similar to its human ortholog. However, the cis-regulatory element(s) mediating the hypoxia response of Epo gene in fishes has not been identified. In the present study, using the human hepatoma cell line (Hep3B), we have identified and characterized a hypoxia response element (HRE) in the fugu Epo locus. The sequence of the fugu HRE (ACGTGCTG) is identical to that of the HRE in the human EPO locus. However, unlike the HRE in the mammalian Epo locus, which is located in the 3' region of the gene, the fugu HRE is located in the 5' flanking region and on the opposite strand of DNA. This HRE is conserved in other teleosts such as Tetraodon and zebrafish in a similar location. A 365-bp fragment containing the fugu HRE was able to drive GFP expression in the liver of transgenic zebrafish. However, we could not ascertain if the expression of transgene is induced by hypoxia in vivo due to the low and variable levels of GFP expression in transgenic zebrafish. Our investigations also revealed that the Epo locus has experienced extensive rearrangements during vertebrate evolution. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. The cis decoy against the estrogen response element suppresses breast cancer cells via target disrupting c-fos not mitogen-activated protein kinase activity.

    Science.gov (United States)

    Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L

    2003-05-01

    Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.

  5. Cell Proliferation in Neuroblastoma

    Science.gov (United States)

    Stafman, Laura L.; Beierle, Elizabeth A.

    2016-01-01

    Neuroblastoma, the most common extracranial solid tumor of childhood, continues to carry a dismal prognosis for children diagnosed with advanced stage or relapsed disease. This review focuses upon factors responsible for cell proliferation in neuroblastoma including transcription factors, kinases, and regulators of the cell cycle. Novel therapeutic strategies directed toward these targets in neuroblastoma are discussed. PMID:26771642

  6. Spatially dependent burnup implementation into the nodal program based on the finite element response matrix method

    International Nuclear Information System (INIS)

    Yoriyaz, H.

    1986-01-01

    In this work a spatial burnup scheme and feedback effects has been implemented into the FERM ( 'Finite Element Response Matrix' )program. The spatially dependent neutronic parameters have been considered in three levels: zonewise calculation, assembly wise calculation and pointwise calculation. Flux and power distributions and the multiplication factor were calculated and compared with the results obtained by CITATIOn program. These comparisons showed that processing time in the Ferm code has been hundred of times shorter and no significant difference has been observed in the assembly average power distribution. (Author) [pt

  7. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  8. Nuclear proliferation

    International Nuclear Information System (INIS)

    Stencel, S.

    1978-01-01

    The terms and reactions to President Carter's nuclear policy, culminating in the 1978 Nuclear Non-Proliferation Act, are reviewed and analyzed. The new law increases restrictions on nuclear exports, encourages continued use of light water reactors in preference to plutonium-fueled reactors, and emphasizes technical solutions to proliferation problems. Critics of the law point out that it will hurt U.S. trade unfairly, that other countries do not have as many fuel options as the U.S. has, and that nuclear sales have as many political and economic as technical solutions. Compromise areas include new international safety guidelines, the possibility of an international nuclear fuel bank, and a willingness to consider each case on its merits. 21 references

  9. Integration of growth factor signals at the c-fos serum response element.

    Science.gov (United States)

    Price, M A; Hill, C; Treisman, R

    1996-04-29

    A transcription factor ternary complex composed of serum response factor (SRF) and a second factor, ternary complex factor (TCF), mediates the response of the c-fos Serum Response Element to growth factors and mitogens. In NIH3T3 fibroblasts, TCF binding is required for transcriptional activation by the SRE in response to activation of the Ras-Raf-ERK pathway. We compared the properties of three members of the TCF family, Elk-1, SAP-1 and SAP-2 (ERP/NET). Although all the proteins contain sequences required for ternary complex formation with SRF, only Elk-1 and SAP-1 appear to interact with the c-fos SRE efficiently in vivo. Each TCF contains a C-terminal activation domain capable of transcriptional activation in response to activation of the Ras-Raf-ERK pathway, and this is dependent on the integrity of S/T-P motifs conserved between all the TCF family members. In contrast, activation of the SRE by whole serum and the mitogenic phospholipid LPA requires SRF binding alone. Constitutively activated members of the Rho subfamily of Ras-like GTPases are also capable of inducing activation of the SRE in the absence of TCF; unlike activated Ras itself, these proteins do not activate the TCFs in NIH3T3 cells. At the SRE, SRF- and TCF-linked signalling pathways act synergistically to potentiate transcription.

  10. Mean annual response of lichen Parmelia sulcata to environmental elemental availability

    International Nuclear Information System (INIS)

    Reis, M.A.; Alves, L.C.; Freitas, M.C.; Os, B. van; Wolterbeek, H.Th.

    2000-01-01

    Lichens collected in an area previously identified as unpolluted, were transplanted to six different places located in polluted areas near Power Plants (both fuel and coal powered). A total of 26 lichen transplants were made for each place, each transplant weighing about 2g. Two were analysed as zero or reference and the remain 24 were hanged in nylon net bags in order to be able to collect two transplants each month, out of every station during a one year period. Besides the 24 lichen samples, each station was provided with two total deposition collection 10 litter buckets (with 25 cm diameter funnels) and an aerosol sampler. Concentration in both lichens and aerosols were measured by PIXE and INAA at ITN. Total deposition residues were analysed by ICP-MS at the The Netherlands Geological Survey. On this work we present the results obtained by looking for correlation between lichens elemental concentrations and annual averages of elemental availability variables such as concentration in suspension in the atmosphere and concentration in total deposition samples, for a total of 40 elements. In order to access both the limitations and the reliability of the results a discussion on the details of handling this data set is presented. A mathematical function which tentatively represents the lichen up-take response to water availability is also proposed. (author)

  11. ZAP-70 and p72syk are signaling response elements through MHC class II molecules

    DEFF Research Database (Denmark)

    Kanner, S B; Grosmaire, L S; Blake, J

    1995-01-01

    Ligation of major histocompatibility complex (MHC) class II antigens expressed on antigen-activated human CD4+ T-lymphocytes induces early signal transduction events including the activation of tyrosine kinases, the tyrosine phosphorylation of phospholipase-C gamma 1 and the mobilization...... of intracellular calcium. Similar responses have been observed in B-cells following stimulation of MHC class II molecules, including the increased production of intracellular cAMP. In this report, we demonstrate that the ZAP-70 tyrosine kinase is a responsive signaling element following cross-linking of HLA...... by herbimycin A. MHC class II ligation on B-lymphocytes resulted in cell death, which was both qualitatively distinct from Fas-induced apoptosis and partially protected by herbimycin A pretreatment. Thus, ligation of MHC class II molecules expressed on human lymphocytes stimulates the ZAP-70/p72syk family...

  12. Improvement of dynamic response in an impact absorber by frictional elements

    International Nuclear Information System (INIS)

    Bedolla, Jorge; Szwedowicz, Dariusz; Cortes, Claudia; Gutierrezwing, Enrique S.; Jimenez, Juan; Majewski, Tadeusz

    2014-01-01

    A novel device that uses friction between one or more pairs of elastic conical rings to dissipate the energy from an impacting body is presented. The device consists of one moving and one stationary cylinders coupled to each other using two pairs of conical rings and a spring. The spring is used to restore the system to its original configuration after the impact. The dynamic response of the system to the impact forces during impact events is analysed numerically and experimentally. The effects of several governing parameters, such as the mass ratio between the cylinders, the duration of the transient response of the device, the magnitude of the rest zone of the moving element and the peak impact force are investigated. The proposed system is applicable in sequential impact scenarios, in which remarkable improvements were observed over traditional solid-rod impact absorbers. The present study may serve as a guide for the design of improved damping devices for impact applications.

  13. Calculation of foundation response to spatially varying ground motion by finite element method

    International Nuclear Information System (INIS)

    Wang, F.; Gantenbein, F.

    1995-01-01

    This paper presents a general method to compute the response of a rigid foundation of arbitrary shape resting on a homogeneous or multilayered elastic soil when subjected to a spatially varying ground motion. The foundation response is calculated from the free-field ground motion and the contact tractions between the foundation and the soil. The spatial variation of ground motion in this study is introduced by a coherence function and the contact tractions are obtained numerically using the Finite Element Method in the process of calculating the dynamic compliance of the foundation. Applications of this method to a massless rigid disc supported on an elastic half space and to that founded on an elastic medium consisting of a layer of constant thickness supported on an elastic half space are described. The numerical results obtained are in very good agreement with analytical solutions published in the literature. (authors). 5 refs., 8 figs

  14. Blast response of curved carbon/epoxy composite panels: Experimental study and finite-element analysis

    International Nuclear Information System (INIS)

    Phadnis, V A; Roy, A; Silberschmidt, V V; Kumar, P; Shukla, A

    2013-01-01

    Experimental and numerical studies were conducted to understand the effect of plate curvature on blast response of carbon/epoxy composite panels. A shock-tube system was utilized to impart controlled shock loading to quasi-isotropic composite panels with differing range of radii of curvatures. A 3D Digital Image Correlation (DIC) technique coupled with high-speed photography was used to obtain out-of-plane deflection and velocity, as well as in-plane strain on the back face of the panels. Macroscopic post-mortem analysis was performed to compare yielding and deformation in these panels. A dynamic computational simulation that integrates fluid-structure interaction was conducted to evaluate the panel response in general purpose finite-element software ABAQUS/Explicit. The obtained numerical results were compared to the experimental data and showed a good correlation

  15. Proliferation resistance design of a plutonium cycle (Proliferation Resistance Engineering Program: PREP)

    Energy Technology Data Exchange (ETDEWEB)

    Sorenson, R.J.; Roberts, F.P.; Clark, R.G.

    1979-01-19

    This document describes the proliferation resistance engineering concepts developed to counter the threat of proliferation of nuclear weapons in an International Fuel Service Center (IFSC). The basic elements of an International Fuel Service Center are described. Possible methods for resisting proliferation such as processing alternatives, close-coupling of facilities, process equipment layout, maintenance philosophy, process control, and process monitoring are discussed. Political and institutional issues in providing proliferation resistance for an International Fuel Service Center are analyzed. The conclusions drawn are (1) use-denial can provide time for international response in the event of a host nation takeover. Passive use-denial is more acceptable than active use-denial, and acceptability of active-denial concepts is highly dependent on sovereignty, energy dependence and economic considerations; (2) multinational presence can enhance proliferation resistance; and (3) use-denial must be nonprejudicial with balanced interests for governments and/or private corporations being served. Comparisons between an IFSC as a national facility, an IFSC with minimum multinational effect, and an IFSC with maximum multinational effect show incremental design costs to be less than 2% of total cost of the baseline non-PRE concept facility. The total equipment acquisition cost increment is estimated to be less than 2% of total baseline facility costs. Personnel costs are estimated to increase by less than 10% due to maximum international presence. 46 figures, 9 tables.

  16. Proliferation resistance design of a plutonium cycle (Proliferation Resistance Engineering Program: PREP)

    International Nuclear Information System (INIS)

    Sorenson, R.J.; Roberts, F.P.; Clark, R.G.

    1979-01-01

    This document describes the proliferation resistance engineering concepts developed to counter the threat of proliferation of nuclear weapons in an International Fuel Service Center (IFSC). The basic elements of an International Fuel Service Center are described. Possible methods for resisting proliferation such as processing alternatives, close-coupling of facilities, process equipment layout, maintenance philosophy, process control, and process monitoring are discussed. Political and institutional issues in providing proliferation resistance for an International Fuel Service Center are analyzed. The conclusions drawn are (1) use-denial can provide time for international response in the event of a host nation takeover. Passive use-denial is more acceptable than active use-denial, and acceptability of active-denial concepts is highly dependent on sovereignty, energy dependence and economic considerations; (2) multinational presence can enhance proliferation resistance; and (3) use-denial must be nonprejudicial with balanced interests for governments and/or private corporations being served. Comparisons between an IFSC as a national facility, an IFSC with minimum multinational effect, and an IFSC with maximum multinational effect show incremental design costs to be less than 2% of total cost of the baseline non-PRE concept facility. The total equipment acquisition cost increment is estimated to be less than 2% of total baseline facility costs. Personnel costs are estimated to increase by less than 10% due to maximum international presence. 46 figures, 9 tables

  17. Identification of cell proliferation, immune response and cell migration as critical pathways in a prognostic signature for HER2+:ERα- breast cancer.

    Directory of Open Access Journals (Sweden)

    Jeffrey C Liu

    Full Text Available Multi-gene prognostic signatures derived from primary tumor biopsies can guide clinicians in designing an appropriate course of treatment. Identifying genes and pathways most essential to a signature performance may facilitate clinical application, provide insights into cancer progression, and uncover potentially new therapeutic targets. We previously developed a 17-gene prognostic signature (HTICS for HER2+:ERα- breast cancer patients, using genes that are differentially expressed in tumor initiating cells (TICs versus non-TICs from MMTV-Her2/neu mammary tumors. Here we probed the pathways and genes that underlie the prognostic power of HTICS.We used Leave-One Out, Data Combination Test, Gene Set Enrichment Analysis (GSEA, Correlation and Substitution analyses together with Receiver Operating Characteristic (ROC and Kaplan-Meier survival analysis to identify critical biological pathways within HTICS. Publically available cohorts with gene expression and clinical outcome were used to assess prognosis. NanoString technology was used to detect gene expression in formalin-fixed paraffin embedded (FFPE tissues.We show that three major biological pathways: cell proliferation, immune response, and cell migration, drive the prognostic power of HTICS, which is further tuned by Homeostatic and Glycan metabolic signalling. A 6-gene minimal Core that retained a significant prognostic power, albeit less than HTICS, also comprised the proliferation/immune/migration pathways. Finally, we developed NanoString probes that could detect expression of HTICS genes and their substitutions in FFPE samples.Our results demonstrate that the prognostic power of a signature is driven by the biological processes it monitors, identify cell proliferation, immune response and cell migration as critical pathways for HER2+:ERα- cancer progression, and defines substitutes and Core genes that should facilitate clinical application of HTICS.

  18. The epidermal cell kinetic response to ultraviolet B irradiation combines regenerative proliferation and carcinogen associated cell cycle delay

    Energy Technology Data Exchange (ETDEWEB)

    Olsen, W.M.; Kirkhus, B. (Oslo Univ. (Norway))

    1989-09-01

    The cell cycle traverse of epidermal basal cells 24 h after in vivo exposure of ultraviolet B (UVB) irradiation was studied by immunochemical staining of incorporated bromodeoxyuridine (BrdU) and bivariate BrdU/DNA flow cytometric analysis. The results were compared with the cell kinetic patterns following topical application of the skin carcinogen methylnitrosourea (MNU) as well as the skin irritant cantharidin. The cell cycle traverse in hairless mouse epidermis 24 h after in vivo exposure to UVB seemed to be a combination of the cell kinetic effects following chemical skin carcinogens and skin irritants. UVB irradiation induced both a delay in transit time through S phase, probably due to DNA damage and subsequent repair, as well as a reduction in the total cell cycle time consistent with rapid regenerative proliferation. (author).

  19. Finite element modelling of Plantar Fascia response during running on different surface types

    Science.gov (United States)

    Razak, A. H. A.; Basaruddin, K. S.; Salleh, A. F.; Rusli, W. M. R.; Hashim, M. S. M.; Daud, R.

    2017-10-01

    Plantar fascia is a ligament found in human foot structure located beneath the skin of human foot that functioning to stabilize longitudinal arch of human foot during standing and normal gait. To perform direct experiment on plantar fascia seems very difficult since the structure located underneath the soft tissue. The aim of this study is to develop a finite element (FE) model of foot with plantar fascia and investigate the effect of the surface hardness on biomechanical response of plantar fascia during running. The plantar fascia model was developed using Solidworks 2015 according to the bone structure of foot model that was obtained from Turbosquid database. Boundary conditions were set out based on the data obtained from experiment of ground reaction force response during running on different surface hardness. The finite element analysis was performed using Ansys 14. The results found that the peak of stress and strain distribution were occur on the insertion of plantar fascia to bone especially on calcaneal area. Plantar fascia became stiffer with increment of Young’s modulus value and was able to resist more loads. Strain of plantar fascia was decreased when Young’s modulus increased with the same amount of loading.

  20. The role of hypoxia response element in TGFβ-induced carbonic anhydrase IX expression in Hep3B human hepatoma cells

    Directory of Open Access Journals (Sweden)

    Yildirim Hatice

    2017-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a hypoxia-regulated gene. It is over expressed in a variety of cancers, including hepatocellular cancer. Transforming growth factor β (TGFβ is considered to have an impact on cancer biology due to its important roles in cell proliferation and differentiation. The effect of the TGFβ on CAIX expression under hypoxia and the mechanism underlying the role of the hypoxia response element (HRE on this expression are unknown. In this study, we demonstrate that TGFβ upregulates CAIX expression under hypoxic conditions in the Hep3B hepatoma cell line, indicating that the mitogen-activated protein kinase (MAPK- and phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K-signaling pathways might be responsible for this response. Site-directed mutagenesis of the HRE region in CAIX promoter reduced the TGFβ-induced CAIX promoter activity, pointing to the significance of HRE for this response. Up regulation of TGFβ-stimulated CAIX expression was consistent with the up regulation of promoter activity of five different truncated constructs of the CAIX promoter under hypoxia. Our findings show that the HRE region is critical for TGFβ-induced CAIX expression, which is mainly controlled by MAPK and PI3K pathways.

  1. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize.

    Science.gov (United States)

    Busk, P K; Jensen, A B; Pagès, M

    1997-06-01

    The rab17 gene from maize is transcribed in late embryonic development and is responsive to abscisic acid and water stress in embryo and vegetative tissues. In vivo footprinting and transient transformation of rab17 were performed in embryos and vegetative tissues to characterize the cis-elements involved in regulation of the gene. By in vivo footprinting, protein binding was observed to nine elements in the promoter, which correspond to five putative ABREs (abscisic acid responsive elements) and four other sequences. The footprints indicated that distinct proteins interact with these elements in the two developmental stages. In transient transformation, six of the elements were important for high level expression of the rab17 promoter in embryos, whereas only three elements were important in leaves. The cis-acting sequences can be divided in embryo-specific, ABA-specific and leaf-specific elements on the basis of protein binding and the ability to confer expression of rab17. We found one positive, new element, called GRA, with the sequence CACTGGCCGCCC. This element was important for transcription in leaves but not in embryos. Two other non-ABRE elements that stimulated transcription from the rab17 promoter resemble previously described abscisic acid and drought-inducible elements. There were differences in protein binding and function of the five ABREs in the rab17 promoter. The possible reasons for these differences are discussed. The in vivo data obtained suggest that an embryo-specific pathway regulates transcription of the rab genes during development, whereas another pathway is responsible for induction in response to ABA and drought in vegetative tissues.

  2. Contributions of individual domains to function of the HIV-1 Rev response element.

    Science.gov (United States)

    O'Carroll, Ina P; Thappeta, Yashna; Fan, Lixin; Ramirez-Valdez, Edric A; Smith, Sean; Wang, Yun-Xing; Rein, Alan

    2017-08-16

    The HIV-1 Rev response element (RRE) is a 351-base element in unspliced and partially spliced viral RNA; binding of the RRE by the viral Rev protein induces nuclear export of RRE-containing RNAs, as required for virus replication. It contains one long, imperfect double helix (domain I), one branched domain (domain II) containing a high-affinity Rev-binding site, and two or three additional domains. We previously reported that the RRE assumes an "A" shape in solution and suggested that the location of the Rev binding sites in domains I and II, opposite each other on the two legs of the A, is optimal for Rev binding and explains Rev's specificity for RRE-containing RNAs. Using SAXS and a quantitative functional assay, we have now analyzed a panel of RRE mutants. All the results support the essential role of the A shape for RRE function. Moreover, they suggest that the distal portion of domain I and the three crowning domains all contribute to the maintenance of the A shape. Domains I and II are necessary and sufficient for substantial RRE function, provided they are joined by a flexible linker that allows the two domains to face each other. IMPORTANCE Retroviral replication requires that some of the viral RNAs transcribed in the cell nucleus be exported to the cytoplasm without being spliced. To achieve this, HIV-1 encodes a protein, Rev, which binds to a complex, highly structured element within viral RNA, the Rev Response Element (RRE), and escorts RRE-containing RNAs from the nucleus. We previously reported that the RRE is "A"-shaped and suggested that this architecture, with the 2 legs opposite one another, can explain the specificity of Rev for the RRE. We have analyzed the functional contributions of individual RRE domains, and now report that several domains contribute, with some redundancy, to maintenance of the overall RRE shape. The data strongly support the hypothesis that the opposed placement of the 2 legs is essential for RRE function. Copyright © 2017

  3. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  4. The role of integrin αv in proliferation and differentiation of human dental pulp cell response to calcium silicate cement.

    Science.gov (United States)

    Hung, Chi-Jr; Hsu, Hsin-I; Lin, Chi-Chang; Huang, Tsui-Hsien; Wu, Buor-Chang; Kao, Chia-Tze; Shie, Ming-You

    2014-11-01

    It has been proved that integrin αv activity is related to cell proliferation, differentiation, migration, and organ development. However, the biological functions of integrin αv in human dental pulp cells (hDPCs) cultured on silicate-based materials have not been explored. The aim of this study was to investigate the role of integrin αv in the proliferation and odontogenic differentiation of hDPCs cultured with the effect of calcium silicate (CS) cement and β-tricalcium phosphate (TCP) cement. In this study, hDPCs were cultured on CS and TCP materials, and we evaluated fibronectin (FN) secretion and integrin αv expression during the cell attachment stage. After small interfering RNA transfection targeting integrin αv, the proliferation and odontogenesis differentiation behavior of hDPCs were analyzed. The results indicate that CS releases Si ion-increased FN secretion and adsorption, which promote cell attachment more effectively than TCP. The CS cement facilitates FN and αv subintegrin expression. However, the FN adsorption and integrin expression of TCP are similar to that observed in the control dish. Integrin αv small interfering RNA inhibited odontogenic differentiation of hDPCs with the decreased formation of mineralized nodules on CS. It also down-regulated the protein expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These results establish composition-dependent differences in integrin binding and its effectiveness as a mechanism regulating cellular responses to biomaterial surface. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  5. Mesenchymal phenotype predisposes lung cancer cells to impaired proliferation and redox stress in response to glutaminase inhibition.

    Directory of Open Access Journals (Sweden)

    Danielle B Ulanet

    Full Text Available Recent work has highlighted glutaminase (GLS as a key player in cancer cell metabolism, providing glutamine-derived carbon and nitrogen to pathways that support proliferation. There is significant interest in targeting GLS for cancer therapy, although the gene is not known to be mutated or amplified in tumors. As a result, identification of tractable markers that predict GLS dependence is needed for translation of GLS inhibitors to the clinic. Herein we validate a small molecule inhibitor of GLS and show that non-small cell lung cancer cells marked by low E-cadherin and high vimentin expression, hallmarks of a mesenchymal phenotype, are particularly sensitive to inhibition of the enzyme. Furthermore, lung cancer cells induced to undergo epithelial to mesenchymal transition (EMT acquire sensitivity to the GLS inhibitor. Metabolic studies suggest that the mesenchymal cells have a reduced capacity for oxidative phosphorylation and increased susceptibility to oxidative stress, rendering them unable to cope with the perturbations induced by GLS inhibition. These findings elucidate selective metabolic dependencies of mesenchymal lung cancer cells and suggest novel pathways as potential targets in this aggressive cancer type.

  6. Nuclear non-proliferation

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    This patent describes the treaty on the non-proliferation of nuclear weapons which is the corner-stone of an international non-proliferation regime which has grown to embrace the overwhelming majority of countries in the world in the period since the Treaty. The other elements of the regime include, first of all, the safeguards system of IAEA-which operates to prevent the diversion of nuclear materials to military or other prohibited activities and must be accepted by all non-nuclear-weapon parties to the Treaty and, secondly, the Antarctic Treaty, the Treaty for the Prohibition of Nuclear Weapons in Latin America (Treaty of Tlatelolco) and the south Pacific Nuclear Free zone Treaty (Treaty of Rarotonga)-which serve to extend the regime geographically. The last two Treaties require safeguards agreements with IAEA. In addition, the Treaty of Tlatelolco contains provisions establishing the agency for the Prohibition of Nuclear Weapons in Latin America and the Caribbean to ensure compliance

  7. The transient response for different types of erodable surface thermocouples using finite element analysis

    Directory of Open Access Journals (Sweden)

    Mohammed Hussein

    2007-01-01

    Full Text Available The transient response of erodable surface thermocouples has been numerically assessed by using a two dimensional finite element analysis. Four types of base metal erodable surface thermocouples have been examined in this study, included type-K (alumel-chromel, type-E (chromel-constantan, type-T (copper-constantan, and type-J (iron-constantan with 50 mm thick- ness for each. The practical importance of these types of thermocouples is to be used in internal combustion engine studies and aerodynamics experiments. The step heat flux was applied at the surface of the thermocouple model. The heat flux from the measurements of the surface temperature can be commonly identified by assuming that the heat transfer within these devices is one-dimensional. The surface temperature histories at different positions along the thermocouple are presented. The normalized surface temperature histories at the center of the thermocouple for different types at different response time are also depicted. The thermocouple response to different heat flux variations were considered by using a square heat flux with 2 ms width, a sinusoidal surface heat flux variation width 10 ms period and repeated heat flux variation with 2 ms width. The present results demonstrate that the two dimensional transient heat conduction effects have a significant influence on the surface temperature history measurements made with these devices. It was observed that the surface temperature history and the transient response for thermocouple type-E are higher than that for other types due to the thermal properties of this thermocouple. It was concluded that the thermal properties of the surrounding material do have an impact, but the properties of the thermocouple and the insulation materials also make an important contribution to the net response.

  8. Identification of a growth hormone-responsive STAT5-binding element in the rat insulin 1 gene

    DEFF Research Database (Denmark)

    Galsgaard, E D; Gouilleux, F; Groner, B

    1996-01-01

    promoter activity 2-fold, and this stimulation was abolished by introduction of a block mutation in a gamma-interferon-activated sequence (GAS)-like element (GLE) with the sequence 5'-TTCTGGGAA-3' located in the rat insulin 1 enhancer at position -330 to -322. This element, termed Ins-GLE, was able...... transfected with STAT5 and GH receptor cDNAs, it was found that expression of STAT5 was necessary for GH induction of these two DNA-binding complexes. These results suggest that GH stimulates insulin 1 promoter activity by inducing the binding of STAT5 to Ins-GLE.......GH and PRL stimulate both proliferation and insulin production in pancreatic beta-cells as well as in the rat insulinoma cell line RIN-5AH, We report here that human GH increases insulin mRNA levels in RIN-5AH cells via both somatogenic and lactogenic receptors. GH stimulated the rat insulin 1...

  9. Aeroelastic Response from Indicial Functions with a Finite Element Model of a Suspension Bridge

    Science.gov (United States)

    Mikkelsen, O.; Jakobsen, J. B.

    2017-12-01

    The present paper describes a comprehensive analysis of the aeroelastic bridge response in time-domain, with a finite element model of the structure. The main focus is on the analysis of flutter instability, accounting for the wind forces generated by the bridge motion, including twisting as well as vertical and horizontal translation, i.e. all three global degrees of freedom. The solution is obtained by direct integration of the equations of motion for the bridge-wind system, with motion-dependent forces approximated from flutter derivatives in terms of rational functions. For the streamlined bridge box-girder investigated, the motion dependent wind forces related to the along-wind response are found to have a limited influence on the flutter velocity. The flutter mode shapes in the time-domain and the frequency domain are consistent, and composed of the three lowest symmetrical vertical modes coupled with the first torsional symmetric mode. The method applied in this study provides detailed response estimates and contributes to an increased understanding of the complex aeroelastic behaviour of long-span bridges.

  10. Degradation by radiation of the response of a thermocouple of a fuel element

    International Nuclear Information System (INIS)

    Rodriguez V, A.

    1994-01-01

    In the TRIGA Mark III Reactor of the National Institute of Nuclear Research, is necessary to use an instrumented fuel element for measurement the fuel temperature during pulses of power. This fuel element is exposed to daily temperature gradient of order to 390 Centigrade degrees in normal condition of reactor operation at 1 MW. The experience which this instrumented fuel elements is that useful life of the thermocouples is less then the fuel, because they show important changes in their chemistry composition and electrical specifications, until the point they don't give any response. So is necessary to know the factors that influenced in the shortening of the thermocouples life. The change in composition affects the thermocouple calibration depends on where the changes take place relative to the temperature gradient. The change will be dependent on the neutron flux and so the value of the neutron flux may be used as a measure or the composition change. If there is no neutron flux within the temperature gradient, there will be no composition change, and so the thermocouple calibration will no change. If the neutron flux varies within the region in which a temperature gradients exists, the composition of the thermocouple will vary and the calibration will change. But the maximum change in calibration will occur if the neutron flux is high and constant within the region of the temperature gradient. In this case, a composition change takes place which is uniform throughout the gradient and so the emf output can be expected to change. In this reactor, the thermocouples are in the second case. Then, the relative position of the thermal and neutron flux gradients are the most important factor that explain the composition change after or 2,500 times of exposing the thermocouples to the temperature gradients of order to 390 Centigrade degrees. (Author)

  11. Finite Element Modelling for Static and Free Vibration Response of Functionally Graded Beam

    Directory of Open Access Journals (Sweden)

    Ateeb Ahmad Khan

    Full Text Available Abstract A 1D Finite Element model for static response and free vibration analysis of functionally graded material (FGM beam is presented in this work. The FE model is based on efficient zig-zag theory (ZIGT with two noded beam element having four degrees of freedom at each node. Linear interpolation is used for the axial displacement and cubic hermite interpolation is used for the deflection. Out of a large variety of FGM systems available, Al/SiC and Ni/Al2O3 metal/ceramic FGM system has been chosen. Modified rule of mixture (MROM is used to calculate the young's modulus and rule of mixture (ROM is used to calculate density and poisson's ratio of FGM beam at any point. The MATLAB code based on 1D FE zigzag theory for FGM elastic beams is developed. A 2D FE model for the same elastic FGM beam has been developed using ABAQUS software. An 8-node biquadratic plane stress quadrilateral type element is used for modeling in ABAQUS. Three different end conditions namely simply-supported, cantilever and clamped- clamped are considered. The deflection, normal stress and shear stress has been reported for various models used. Eigen Value problem using subspace iteration method is solved to obtain un-damped natural frequencies and the corresponding mode shapes. The results predicted by the 1D FE model have been compared with the 2D FE results and the results present in open literature. This proves the correctness of the model. Finally, mode shapes have also been plotted for various FGM systems.

  12. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Finite element analysis of structural response of superconducting magnet for a fusion reactor

    International Nuclear Information System (INIS)

    Reich, M.; Powell, J.; Bezler, P.; Chang, T.Y.; Prachuktam, S.

    1975-01-01

    In the proposal Tokamak fusion reactor, the superconducting unit consists of an assembly of D-shaped magnets standing vertically and arranged in a toroidal configuration. Each magnet is a composite structure comprised of Nb-22%Ti and Nb-48%Ti, and stabilizing metals such as copper and aluminum or stainless steel held together by reinforced epoxies which also serve as insulators and spacers. The magnets are quite large, typically 15-20 meters in diameter with rectangular cross sections around 0.93x2m. Under static loading condition, the magnet is subjected to dead weight and large magnetic field forces, which may induce high stresses in the structure. Furthermore, additional stresses due to earthquake must also be considered for the design of the component. Both static and dynamic analyses of a typical field magnet have been performed by use of the finite element method. The magnet was assumed to be linearly elastic with equivalent homogeneous material properties. Various finite element models have been considered in order to better represent the structure for a particular loading case. For earthquake analysis, the magnet was assumed to be subjected to 50% of the El Centro 1940 earthquake and the dynamic response was obtained by the displacement spectrum analysis procedure. In the paper, numerical results are presented and the structure behavior of the magnet under static and dynamic loading conditions is discussed

  14. Tooth Fracture Detection in Spiral Bevel Gears System by Harmonic Response Based on Finite Element Method

    Directory of Open Access Journals (Sweden)

    Yuan Chen

    2017-01-01

    Full Text Available Spiral bevel gears occupy several advantages such as high contact ratio, strong carrying capacity, and smooth operation, which become one of the most widely used components in high-speed stage of the aeronautical transmission system. Its dynamic characteristics are addressed by many scholars. However, spiral bevel gears, especially tooth fracture occurrence and monitoring, are not to be investigated, according to the limited published issues. Therefore, this paper establishes a three-dimensional model and finite element model of the Gleason spiral bevel gear pair. The model considers the effect of tooth root fracture on the system due to fatigue. Finite element method is used to compute the mesh generation, set the boundary condition, and carry out the dynamic load. The harmonic response spectra of the base under tooth fracture are calculated and the influence of main parameters on monitoring failure is investigated as well. The results show that the change of torque affects insignificantly the determination of whether or not the system has tooth fracture. The intermediate frequency interval (200 Hz–1000 Hz is the best interval to judge tooth fracture occurrence. The best fault test region is located in the working area where the system is going through meshing. The simulation calculation provides a theoretical reference for spiral bevel gear system test and fault diagnosis.

  15. Participation of Water in the Binding of Estrogen Receptor with Estrogen Responsive Element in vitro.

    Science.gov (United States)

    Zhu, Guo-Zhang; Tang, Guo-Qing; Ruan, Kang-Cheng; Gong, Yue-Ting; Zhang, Yong-Lian

    1998-01-01

    Many reports have showed that bound water was involved in the interaction between/among the macromolecules. However, it has not been reported whether bound water is also involved in the binding of trans-factors and cis-elements in the regulation of the eukaryotic gene trans-cription or not. Preliminary studies have been made on the effect of bound water on the binding of estrogen receptor with estrogen responsive element in vitro. In the gel retardation assay using the cytosol extract of rat uterus as the supplier of estrogen receptor and 32 bp oligonucleotide containing a concensus vitellogenin A(2) ERE as the probe, various cosolvents, such as glycerol, sucrose, N-dimethylformamide and dimethylsulfoxide, were added respectively to the reaction mixture in varying concentrations to regulate the osmotic pressure. The results indicated that the binding of ER-ERE was enhanced with the increase in the final concentration of these individual cosolvents. On the other hand, when the reaction was carried out under an increasing hydrostatic pressure, the ER-ERE binding was decreased sharply. After decompression the binding of ER-ERE was gradually restored to the normal level with the lapse of time. These results suggested that bound water was directly involved in the binding of ER-ERE and may play an important role in the regulation of the eukaryotic gene transcription.

  16. Functional cooperativity between two TPA responsive elements in undifferentiated F9 embryonic stem cells.

    Science.gov (United States)

    Okuda, A; Imagawa, M; Sakai, M; Muramatsu, M

    1990-01-01

    We have recently identified an enhancer, termed GPEI, in the 5'-flanking region of the rat glutathione transferase P gene, that is composed of two imperfect TPA (phorbol 12-O-tetradecanoate 13-acetate) responsive elements (TREs). Unlike other TRE-containing enhancers, GPEI exhibits a strong transcriptional enhancing activity in F9 embryonic stem cells. Mutational analyses have revealed that the high activity of GPEI is mediated by two imperfect TREs. Each TRE-like sequence has no activity by itself but acts synergistically to form a strong enhancer which is active even in the very low level of AP-1 activity in F9 cells. Furthermore, we show that synthetic DNAs containing two perfect TREs in certain arrangements have strong transcriptional enhancing activities in F9 cells and the activity is greatly influenced by the relative orientation and the distance of two TREs. Images Fig. 1. Fig. 2. Fig. 3. PMID:2323334

  17. A comparative study of finite element methodologies for the prediction of torsional response of bladed rotors

    International Nuclear Information System (INIS)

    Scheepers, R.; Heyns, P. S.

    2016-01-01

    The prevention of torsional vibration-induced fatigue damage to turbo-generators requires determining natural frequencies by either field testing or mathematical modelling. Torsional excitation methods, measurement techniques and mathematical modelling are active fields of research. However, these aspects are mostly considered in isolation and often without experimental verification. The objective of this work is to compare one dimensional (1D), full three dimensional (3D) and 3D cyclic symmetric (3DCS) Finite element (FE) methodologies for torsional vibration response. Results are compared to experimental results for a small-scale test rotor. It is concluded that 3D approaches are feasible given the current computing technology and require less simplification with potentially increased accuracy. Accuracy of 1D models may be reduced due to simplifications but faster solution times are obtained. For high levels of accuracy model updating using field test results is recommended

  18. Giardia muris infection in mice is associated with a protective interleukin 17A response and induction of peroxisome proliferator-activated receptor alpha.

    Science.gov (United States)

    Dreesen, Leentje; De Bosscher, Karolien; Grit, Grietje; Staels, Bart; Lubberts, Erik; Bauge, Eric; Geldhof, Peter

    2014-08-01

    The protozoan parasite Giardia duodenalis (Giardia lamblia) is one of the most commonly found intestinal pathogens in mammals, including humans. In the current study, a Giardia muris-mouse model was used to analyze cytokine transcription patterns and histological changes in intestinal tissue at different time points during infection in C57BL/6 mice. Since earlier work revealed the upregulation of peroxisome proliferator-activated receptors (PPARs) in Giardia-infected calves, a second aim was to investigate the potential activation of PPARs in the intestines of infected mice. The most important observation in all mice was a strong upregulation of il17a starting around 1 week postinfection. The significance of interleukin 17A (IL-17A) in orchestrating a protective immune response was further demonstrated in an infection trial or experiment using IL-17 receptor A (IL-17RA) knockout (KO) mice: whereas in wild-type (WT) mice, cyst secretion dropped significantly after 3 weeks of infection, the IL-17RA KO mice were unable to clear the infection. Analysis of the intestinal response further indicated peroxisome proliferator-activated receptor alpha (PPARα) induction soon after the initial contact with the parasite, as characterized by the transcriptional upregulation of ppara itself and several downstream target genes such as pltp and cpt1. Overall, PPARα did not seem to have any influence on the immune response against G. muris, since PPARα KO animals expressed il-17a and could clear the infection similar to WT controls. In conclusion, this study shows for the first time the importance of IL-17 production in the clearance of a G. muris infection together with an early induction of PPARα. The effect of the latter, however, is still unclear. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Natural killer cell cytokine response to M. bovis BCG Is associated with inhibited proliferation, increased apoptosis and ultimate depletion of NKp44(+CD56(bright cells.

    Directory of Open Access Journals (Sweden)

    Damien Portevin

    Full Text Available Mycobacterium bovis BCG, a live attenuated strain of M. bovis initially developed as a vaccine against tuberculosis, is also used as an adjuvant for immunotherapy of cancers and for treatment of parasitic infections. The underlying mechanisms are thought to rely on its immunomodulatory properties including the recruitment of natural killer (NK cells. In that context, we aimed to study the impact of M. bovis BCG on NK cell functions. We looked at cytotoxicity, cytokine production, proliferation and cell survival of purified human NK cells following exposure to single live particles of mycobacteria. We found that M. bovis BCG mediates apoptosis of NK cells only in the context of IL-2 stimulation during which CD56(bright NK cells are releasing IFN-γ in response to mycobacteria. We found that the presence of mycobacteria prevented the IL-2 induced proliferation and surface expression of NKp44 receptor by the CD56(bright population. In summary, we observed that M. bovis BCG is modulating the functions of CD56(bright NK cells to drive this subset to produce IFN-γ before subsequent programmed cell death. Therefore, IFN-γ production by CD56(bright cells constitutes the main effector mechanism of NK cells that would contribute to the benefits observed for M. bovis BCG as an immunotherapeutic agent.

  20. Preventing proliferation

    International Nuclear Information System (INIS)

    Rathjens, G.

    1983-01-01

    Challenging the argument that nuclear proliferation may be stabilizing, the author cites the Israeli attack on Iraq as evidence that emergent nuclear states may be moved to attack their adversaries.The larger the number of decision makers who can unleash nuclear weapons, the greater the liklihood of their use. Several reasons are cited for nations to seek nuclear capability: the accelerated spread of technology, the deterioration in US-Soviet relations and strength relative to their nations, the high cost of conventional weapons, and a loss of confidence in the international safeguards system. The imposition of constraints, such as a Comprehensive Test Ban Treaty, on nuclear trade and technology transfer are likely to have a high cost. The US position on this issue is likely to be determined by the balance of power with the Soviet Union. 5 references

  1. Meta-analysis of the effect of overexpression of C-repeat/dehydration-responsive element binding family genes on temperature stress tolerance and related responses

    Science.gov (United States)

    C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...

  2. Optimized choice of method for determining proliferation response of peripheral lymphocytes to mitogens in low dose irradiation with cyclotron fast neutrons

    International Nuclear Information System (INIS)

    Refka, Z.; Svec, M.; Aganov, P.; Svoboda, V.; Podzimek, F.

    1989-01-01

    Heparinized venous blood sampled from seven donors was irradiated with doses of 0.1; 0.25; 0.5; 1.0; 2.0 and 3.0 Gy of fast neutrons of a mean energy of 7.6 MeV using the U 120 M isochronous cyclotron. A non-irradiated control sample was also prepared. A lymphoblastic transformation test was conducted with both the intact and irradiated samples. The samples were cultivated in the RPMI-1640 medium with and without a mitogen addition, this in five time variants, viz., for 48, 72, 90, 96 and 120 hours. The proliferation was monitored of lymphocytes stimulated with mitogens PHA, CON-A and PWM in dependence on the time of cultivation and on the radiation dose. The dose dependent relative response was also studied of the irradiated lymphocytes. (E.J.). 8 figs., 1 tab., 18 refs

  3. Assessment of hypoxia and TNF-alpha response by a vector with HRE and NF-kappaB response elements.

    Science.gov (United States)

    Chen, Zhilin; Eadie, Ashley L; Hall, Sean R; Ballantyne, Laurel; Ademidun, David; Tse, M Yat; Pang, Stephen C; Melo, Luis G; Ward, Christopher A; Brunt, Keith R

    2017-01-01

    Hypoxia and inflammatory cytokine activation (H&I) are common processes in many acute and chronic diseases. Thus, a single vector that responds to both hypoxia and inflammatory cytokines, such as TNF-alpha, is useful for assesing the severity of such diseases. Adaptation to hypoxia is regulated primarily by hypoxia inducible transcription factor (HIF alpha) nuclear proteins that engage genes containing a hypoxia response element (HRE). Inflammation activates a multitude of cytokines, including TNF-alpha, that invariably modulate activation of the nuclear factor kappa B (NF-kB) transcription factor. We constructed a vector that encompassed both a hypoxia response element (HRE), and a NF-kappaB responsive element. We show that this vector was functionally responsive to both hypoxia and TNF-alpha, in vitro and in vivo . Thus, this vector might be suitable for the detection and assessment of hypoxia or TNF-alpha.

  4. Numerical Simulation of the Ground Response to the Tire Load Using Finite Element Method

    Science.gov (United States)

    Valaskova, Veronika; Vlcek, Jozef

    2017-10-01

    Response of the pavement to the excitation caused by the moving vehicle is one of the actual problems of the civil engineering practice. The load from the vehicle is transferred to the pavement structure through contact area of the tires. Experimental studies show nonuniform distribution of the pressure in the area. This non-uniformity is caused by the flexible nature and the shape of the tire and is influenced by the tire inflation. Several tire load patterns, including uniform distribution and point load, were involved in the numerical modelling using finite element method. Applied tire loads were based on the tire contact forces of the lorry Tatra 815. There were selected two procedures for the calculations. The first one was based on the simplification of the vehicle to the half-part model. The characteristics of the vehicle model were verified by the experiment and by the numerical model in the software ADINA, when vehicle behaviour during the ride was investigated. Second step involved application of the calculated contact forces for the front axle as the load on the multi-layered half space representing the pavement structure. This procedure was realized in the software Plaxis and considered various stress patterns for the load. The response of the ground to the vehicle load was then analyzed. Axisymmetric model was established for this procedure. The paper presents the results of the investigation of the contact pressure distribution and corresponding reaction of the pavement to various load distribution patterns. The results show differences in some calculated quantities for different load patterns, which need to be verified by the experimental way when also ground response should be observed.

  5. Modulation of Mucosal Immune Response, Tolerance and Proliferation in Mice Colonized by the Mucin-Degrader Akkermansia muciniphila

    Directory of Open Access Journals (Sweden)

    Muriel eDerrien

    2011-08-01

    Full Text Available Epithelial cells of the mammalian intestine are covered with a mucus layer that prevents direct contact with intestinal microbes but also constitutes a substrate for mucus-degrading bacteria. To study the effect of mucus degradation on the host-response, germ-free mice were colonized with Akkermansia muciniphila. This anaerobic bacterium belonging to the Verrucomicrobia is specialized in the degradation of mucin, the glycoprotein present in mucus, and found in high numbers in the intestinal tract of human and other mammalian species. Efficient colonization of A. muciniphila was observed with highest numbers in the cecum, where most mucin is produced. In contrast, following colonization by Lactobacillus plantarum, a facultative anaerobe belonging to the Firmicutes that ferments carbohydrates, similar cell-numbers were found at all intestinal sites. Whereas A. muciniphila was located closely associated with the intestinal cells, L. plantarum was exclusively found in the lumen. The global transcriptional host response was determined in intestinal biopsies and revealed a consistent, site-specific and unique modulation of about 750 genes in mice colonized by A. muciniphila and over 1500 genes after colonization by L. plantarum. Pathway reconstructions showed that colonization by A. muciniphila altered mucosal gene expression profiles towards increased expression of genes involved in immune responses and cell fate determination, while colonization by L. plantarum led to up-regulation of lipid metabolism. These indicate that the colonizers induce host responses that are specific per intestinal location. In conclusion, we propose that A. muciniphila modulates pathways involved in establishing homeostasis for basal metabolism and immune tolerance towards commensal microbiota.

  6. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element

    Directory of Open Access Journals (Sweden)

    Dudley Jaquelin P

    2009-02-01

    Full Text Available Abstract Background Mouse mammary tumor virus (MMTV encodes the Rem protein, an HIV Rev-like protein that enhances nuclear export of unspliced viral RNA in rodent cells. We have shown that Rem is expressed from a doubly spliced RNA, typical of complex retroviruses. Several recent reports indicate that MMTV can infect human cells, suggesting that MMTV might interact with human retroviruses, such as human immunodeficiency virus (HIV, human T-cell leukemia virus (HTLV, and human endogenous retrovirus type K (HERV-K. In this report, we test whether the export/regulatory proteins of human complex retroviruses will increase expression from vectors containing the Rem-responsive element (RmRE. Results MMTV Rem, HIV Rev, and HTLV Rex proteins, but not HERV-K Rec, enhanced expression from an MMTV-based reporter plasmid in human T cells, and this activity was dependent on the RmRE. No RmRE-dependent reporter gene expression was detectable using Rev, Rex, or Rec in HC11 mouse mammary cells. Cell fractionation and RNA quantitation experiments suggested that the regulatory proteins did not affect RNA stability or nuclear export in the MMTV reporter system. Rem had no demonstrable activity on export elements from HIV, HTLV, or HERV-K. Similar to the Rem-specific activity in rodent cells, the RmRE-dependent functions of Rem, Rev, or Rex in human cells were inhibited by a dominant-negative truncated nucleoporin that acts in the Crm1 pathway of RNA and protein export. Conclusion These data argue that many retroviral regulatory proteins recognize similar complex RNA structures, which may depend on the presence of cell-type specific proteins. Retroviral protein activity on the RmRE appears to affect a post-export function of the reporter RNA. Our results provide additional evidence that MMTV is a complex retrovirus with the potential for viral interactions in human cells.

  7. District element modelling of the rock mass response to glaciation at Finnsjoen, central Sweden

    International Nuclear Information System (INIS)

    Rosengren, L.; Stephansson, O.

    1990-12-01

    Six rock mechanics models of a cross section of the Finnsjoen test site have been simulated by means of distinct element analysis and the computer code UDEC. The rock mass response to glaciation, deglaciation, isostatic movements and water pressure from an ice lake have been simulated. Four of the models use a boundary condition with boundary elements at the bottom and sides of the model. This gives a state of stress inside the model which agrees well with the analytical solution where the horizontal and vertical stresses are almost similar. Roller boundaries were applied to two models. This boundary condition cause zero lateral displacement at the model boundaries and the horizontal stress are always less than the vertical stress. Isostatic movements were simulated in one model. Two different geometries of fracture Zone 2 were simulated. Results from modelling the two different geometries show minor changes in stresses, displacements and failure of fracture zones. Under normal pore pressure conditions in the rock mass the weight of the ice load increases the vertical stresses in the models differ depending on the boundary condition. An ice thickness of 3 km and 1 km and an ice wedge of 1 km thickness covering half the top surface of the model have been simulated. For each loading sequence of the six models a complete set of data about normal stress, stress profiles along selected sections, displacements and failure of fracture zones are presented. Based on the results of this study a protection zone of about 100 m width from the outer boundary of stress discontinuity to the repository location is suggested. This value is based on the result that the stress disturbance diminishes at this distance from the outer boundary of the discontinuity. (25 refs.) (authors)

  8. Titanium dioxide nanoparticles induce an adaptive inflammatory response and invasion and proliferation of lung epithelial cells in chorioallantoic membrane

    International Nuclear Information System (INIS)

    Medina-Reyes, Estefany I.; Déciga-Alcaraz, Alejandro; Freyre-Fonseca, Verónica; Delgado-Buenrostro, Norma L.; Flores-Flores, José O.; Gutiérrez-López, Gustavo F.; Sánchez-Pérez, Yesennia; García-Cuéllar, Claudia M.

    2015-01-01

    culture were harvested and seeded on the top of the chorioallantoic membrane (CAM) for 5 days and (C) invasion and proliferation of cells were analyzed in CAM sections. - Highlights: • Hydrodynamic size of TiO2- SP was smaller than TiO2-B in cell culture media • TiO2- SP induced higher decrease in cell size than TiO2-B • TiO2-SP induced a transient cytokine release and TiO2-B a downregulation • TiO2-B caused higher proliferative capability than TiO2-SP

  9. Titanium dioxide nanoparticles induce an adaptive inflammatory response and invasion and proliferation of lung epithelial cells in chorioallantoic membrane

    Energy Technology Data Exchange (ETDEWEB)

    Medina-Reyes, Estefany I.; Déciga-Alcaraz, Alejandro [Unidad de Biomedicina, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, CP 54059 Estado de México (Mexico); Freyre-Fonseca, Verónica [Unidad de Biomedicina, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, CP 54059 Estado de México (Mexico); Doctorado en Ciencias en Alimentos, Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional, CP 11340 México, DF (Mexico); Delgado-Buenrostro, Norma L. [Unidad de Biomedicina, Facultad de Estudios Superiores Iztacala, Universidad Nacional Autónoma de México, CP 54059 Estado de México (Mexico); Flores-Flores, José O. [Centro de Ciencias Aplicadas y Desarrollo Tecnológico, Universidad Nacional Autónoma de México, Circuito Exterior S/N, Ciudad Universitaria AP 70-186, CP 04510 México, DF (Mexico); Gutiérrez-López, Gustavo F. [Escuela Nacional de Ciencias Biológicas del Instituto Politécnico Nacional, CP 11340 México, DF (Mexico); Sánchez-Pérez, Yesennia; García-Cuéllar, Claudia M. [Instituto Nacional de Cancerología, Subdirección de Investigación Básica, San Fernando 22, Tlalpan, CP 14080 México, DF (Mexico); and others

    2015-01-15

    }-SP) and belts (TiO{sub 2}-B) for midterm (7 continuous days) separately. (B) Then, cells from each cell culture were harvested and seeded on the top of the chorioallantoic membrane (CAM) for 5 days and (C) invasion and proliferation of cells were analyzed in CAM sections. - Highlights: • Hydrodynamic size of TiO2- SP was smaller than TiO2-B in cell culture media • TiO2- SP induced higher decrease in cell size than TiO2-B • TiO2-SP induced a transient cytokine release and TiO2-B a downregulation • TiO2-B caused higher proliferative capability than TiO2-SP.

  10. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  11. Predicting the response of high damping rubber bearings using simplified models and finite element analysis

    International Nuclear Information System (INIS)

    Fuller, K.N.G.; Gough, J.; Ahmadi, H.R.

    1993-01-01

    The International Atomic Energy Agency has initiated a co-ordinated research programme on implementation of base-isolation for nuclear structures. This paper discusses two areas relevant to modelling elastomeric base-isolators. These are the use of simplified models to predict the response of isolated structures to earthquake inputs and finite element analysis for calculating the stress distributions within the isolators. In the former, a curvilinear hysteretic model of the high damping natural rubber able to accommodate the stiffening of the rubber at large shear deflections is presented. Its predictions of structural accelerations and bearing displacement produced by design earthquakes and those above the design level are compared with those using a linear spring and dashpot model. A comparison has been made between two finite element analyses using MARC and ABAQUS of the force-deformation behaviour of a single disc of rubber bonded on both sides. The disc was loaded both in compression and shear. Two forms of strain energy functions were used namely Mooney-RivIin and Ogden. The agreement between MARC and ABAQUS for the Mooney-Rivlin model for the material was very good. This was not however the case for the Ogden model and a difference of 25% in the maximum vertical deflection of the disc under 200kN load was observed. The need for a 'benchmark' problem is identified. This could be used to establish the accuracy of the finite element solvers. A problem based on the work of Rivlin on the force-deformation behaviour of cylinder of rubber under torsion is nominated. An appraisal of strain energy functions based on Mooney-RivIin formulations is carried out. It is shown that even for a five term series the strain energy function is incapable of catering for the rapid change of modulus at small strains both for simple and pure shear modes of deformation. This function models tension/compression data much better. The work identifies the need for evaluating other forms

  12. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  13. Interferon-γ and proliferation responses to Salmonella enterica Serotype Typhi proteins in patients with S. Typhi Bacteremia in Dhaka, Bangladesh.

    Directory of Open Access Journals (Sweden)

    Alaullah Sheikh

    2011-06-01

    Full Text Available Salmonella enterica serotype Typhi is a human-restricted intracellular pathogen and the cause of typhoid fever. Cellular immune responses are required to control and clear Salmonella infection. Despite this, there are limited data on cellular immune responses in humans infected with wild type S. Typhi.For this work, we used an automated approach to purify a subset of S. Typhi proteins identified in previous antibody-based immuno-affinity screens and antigens known to be expressed in vivo, including StaF-putative fimbrial protein-STY0202, StbB-fimbrial chaperone-STY0372, CsgF-involved in curli production-STY1177, CsgD- putative regulatory protein-STY1179, OppA-periplasmic oligopeptide binding protein precursor-STY1304, PagC-outer membrane invasion protein-STY1878, and conserved hypothetical protein-STY2195; we also generated and analyzed a crude membrane preparation of S. Typhi (MP. In comparison to samples collected from uninfected Bangladeshi and North American participants, we detected significant interferon-γ responses in PBMCs stimulated with MP, StaF, StbB, CsgF, CsgD, OppA, STY2195, and PagC in patients bacteremic with S. Typhi in Bangladesh. The majority of interferon-γ expressing T cells were CD4 cells, although CD8 responses also occurred. We also assessed cellular proliferation responses in bacteremic patients, and confirmed increased responses in infected individuals to MP, StaF, STY2195, and PagC in convalescent compared to acute phase samples and compared to controls. StaF is a fimbrial protein homologous to E. coli YadK, and contains a Pfam motif thought to be involved in cellular adhesion. PagC is expressed in vivo under the control of the virulence-associated PhoP-regulon required for intra-macrophage survival of Salmonella. STY2195 is a conserved hypothetical protein of unknown function.This is the first analysis of cellular immune responses to purified S. Typhi antigens in patients with typhoid fever. These results indicate

  14. The French national inventory of radioactive waste. Elements of openness and responsibility

    International Nuclear Information System (INIS)

    Faussat, A.; Fernique, J.C.

    1995-01-01

    Article 13 of the Waste Act of 30 December 1991 calls for the Agence nationale pour la gestion des dechets radioactifs (ANDRA) ''to register the condition and location of all radioactive waste on national territory''. The establishment of a national inventory of radioactive waste and the broad distribution of inventory report to ensure that it becomes a matter of public record constitute a new approach to public information and an effective means of fulfilling the responsibility of the present generation vis-a-vis posterity. The National Waste Register goes beyond the low level radioactive waste disposal facilities to encompass 'all' waste, wherever it may be, including waste in storage at sites where waste is produced. As a result, the Register is multi-faceted, containing information on a variety of elements, from highly radioactive waste to hospital waste collected by ANDRA and to repositories with very low level radioactive material. Information must be provided about all of these widely divergent components. ANDRA has already published two inventories, which demonstrates the durability of its new mission. The Register now contains the inventory of radioactive waste generated by some activities connected with the defence programme. Data collection for the Register involves contacting the generators of waste and working with these entities, whether they are nuclear industry companies, defence organizations, non-nuclear industries, or the 25 Regional Directorates of Industry, Research and Environment, the control institutions or the environmental protection organizations. The yearly exchange of information among all partners involved in radioactive waste management is one of the basic tools of ANDRA, allowing it to be recognized as open and responsible, and to be more credible, fulfilling in this way one of the essential criteria for acceptability. (author). 4 refs

  15. Keratin23 (KRT23) knockdown decreases proliferation and affects the DNA damage response of colon cancer cells

    DEFF Research Database (Denmark)

    Birkenkamp-Demtröder, Karin; Hahn, Stephan; Mansilla, Francisco

    2013-01-01

    correlated with absent expression, while increased KRT23 expression in tumor samples correlated with promoter hypomethylation, as confirmed by bisulfite sequencing. Demethylation induced KRT23 expression in vitro. Expression profiling of shRNA mediated stable KRT23 knockdown in colon cancer cell lines showed...... response, mainly molecules of the double strand break repair homologous recombination pathway. KRT23 knockdown decreased the transcript and protein expression of key molecules as e.g. MRE11A, E2F1, RAD51 and BRCA1. Knockdown of KRT23 rendered colon cancer cells more sensitive to irradiation and reduced......Keratin 23 (KRT23) is strongly expressed in colon adenocarcinomas but absent in normal colon mucosa. Array based methylation profiling of 40 colon samples showed that the promoter of KRT23 was methylated in normal colon mucosa, while hypomethylated in most adenocarcinomas. Promoter methylation...

  16. Sublethal red tide toxin exposure in free-ranging manatees (Trichechus manatus) affects the immune system through reduced lymphocyte proliferation responses, inflammation, and oxidative stress

    International Nuclear Information System (INIS)

    Walsh, Catherine J.; Butawan, Matthew; Yordy, Jennifer; Ball, Ray; Flewelling, Leanne; Wit, Martine de; Bonde, Robert K.

    2015-01-01

    Highlights: • Sublethal brevetoxin exposure affects manatee immune function. • Plasma brevetoxin levels correlate with oxidative stress in rescued manatees. • Brevetoxin exposure affects lymphocyte proliferation in rescued manatees. • Plasma brevetoxin concentrations ranged from 0 to 19 ng PbTx-3 eq/mL. - Abstract: The health of many Florida manatees (Trichechus manatus latirostris) is adversely affected by exposure to blooms of the toxic dinoflagellate, Karenia brevis. K. brevis blooms are common in manatee habitats of Florida’s southwestern coast and produce a group of cyclic polyether toxins collectively referred to as red tide toxins, or brevetoxins. Although a large number of manatees exposed to significant levels of red tide toxins die, several manatees are rescued from sublethal exposure and are successfully treated and returned to the wild. Sublethal brevetoxin exposure may potentially impact the manatee immune system. Lymphocyte proliferative responses and a suite of immune function parameters in the plasma were used to evaluate effects of brevetoxin exposure on health of manatees rescued from natural exposure to red tide toxins in their habitat. Blood samples were collected from rescued manatees at Lowry Park Zoo in Tampa, FL and from healthy, unexposed manatees in Crystal River, FL. Peripheral blood leukocytes (PBL) isolated from whole blood were stimulated with T-cell mitogens, ConA and PHA. A suite of plasma parameters, including plasma protein electrophoresis profiles, lysozyme activity, superoxide dismutase (SOD) activity, and reactive oxygen/nitrogen (ROS/RNS) species, was also used to assess manatee health. Significant decreases (p < 0.05) in lymphocyte proliferation were observed in ConA and PHA stimulated lymphocytes from rescued animals compared to non-exposed animals. Significant correlations were observed between oxidative stress markers (SOD, ROS/RNS) and plasma brevetoxin concentrations. Sublethal exposure to brevetoxins in the

  17. Sublethal red tide toxin exposure in free-ranging manatees (Trichechus manatus) affects the immune system through reduced lymphocyte proliferation responses, inflammation, and oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Catherine J., E-mail: cjwalsh@mote.org [Marine Immunology Program, Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236 (United States); Butawan, Matthew, E-mail: mattbutawan@outlook.com [Marine Immunology Program, Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236 (United States); Yordy, Jennifer, E-mail: jennifer.e.balmer@gmail.com [Marine Immunology Program, Mote Marine Laboratory, 1600 Ken Thompson Parkway, Sarasota, FL 34236 (United States); Ball, Ray, E-mail: Ray.Ball@lowryparkzoo.com [Lowry Park Zoo, 1101 W Sligh Ave, Tampa, FL 33604 (United States); Flewelling, Leanne, E-mail: Leanne.Flewelling@MyFWC.com [Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission, 100 8th Ave SE, St. Petersburg, FL 33701 (United States); Wit, Martine de, E-mail: Martine.deWit@MyFWC.com [Fish and Wildlife Research Institute, Florida Fish and Wildlife Conservation Commission, 100 8th Ave SE, St. Petersburg, FL 33701 (United States); Bonde, Robert K., E-mail: rbonde@usgs.gov [U.S. Geological Survey, Sirenia Project, 7920 NE 71st Street, Gainesville, FL 32653 (United States)

    2015-04-15

    Highlights: • Sublethal brevetoxin exposure affects manatee immune function. • Plasma brevetoxin levels correlate with oxidative stress in rescued manatees. • Brevetoxin exposure affects lymphocyte proliferation in rescued manatees. • Plasma brevetoxin concentrations ranged from 0 to 19 ng PbTx-3 eq/mL. - Abstract: The health of many Florida manatees (Trichechus manatus latirostris) is adversely affected by exposure to blooms of the toxic dinoflagellate, Karenia brevis. K. brevis blooms are common in manatee habitats of Florida’s southwestern coast and produce a group of cyclic polyether toxins collectively referred to as red tide toxins, or brevetoxins. Although a large number of manatees exposed to significant levels of red tide toxins die, several manatees are rescued from sublethal exposure and are successfully treated and returned to the wild. Sublethal brevetoxin exposure may potentially impact the manatee immune system. Lymphocyte proliferative responses and a suite of immune function parameters in the plasma were used to evaluate effects of brevetoxin exposure on health of manatees rescued from natural exposure to red tide toxins in their habitat. Blood samples were collected from rescued manatees at Lowry Park Zoo in Tampa, FL and from healthy, unexposed manatees in Crystal River, FL. Peripheral blood leukocytes (PBL) isolated from whole blood were stimulated with T-cell mitogens, ConA and PHA. A suite of plasma parameters, including plasma protein electrophoresis profiles, lysozyme activity, superoxide dismutase (SOD) activity, and reactive oxygen/nitrogen (ROS/RNS) species, was also used to assess manatee health. Significant decreases (p < 0.05) in lymphocyte proliferation were observed in ConA and PHA stimulated lymphocytes from rescued animals compared to non-exposed animals. Significant correlations were observed between oxidative stress markers (SOD, ROS/RNS) and plasma brevetoxin concentrations. Sublethal exposure to brevetoxins in the

  18. Role of the peroxisome proliferator-activated receptor α (PPARα) in responses to trichloroethylene and metabolites, trichloroacetate and dichloroacetate in mouse liver

    International Nuclear Information System (INIS)

    Laughter, Ashley R.; Dunn, Corrie S.; Swanson, Cynthia L.; Howroyd, Paul; Cattley, Russell C.; Christopher Corton, J.

    2004-01-01

    Trichloroethylene (TCE) is an industrial solvent and a widespread environmental contaminant. Induction of liver cancer in mice by TCE is thought to be mediated by two carcinogenic metabolites, dichloroacetate (DCA) and trichloroacetate (TCA). TCE is considered to be a relatively weak peroxisome proliferator (PP), a group of rodent hepatocarcinogens that cause adaptive responses in liver through the PP-activated receptor alpha (PPARα). The objectives of this study were to determine whether effects of TCE, TCA and DCA in the liver associated with carcinogenesis are mediated by PPARα. Male wild-type and PPARα-null mice were given TCE by gavage for 3 days or 3 weeks; TCA or DCA were given in the drinking water for 1 week. Increases in relative liver and kidney weights by TCE were dependent on PPARα whereas liver weight increases by DCA were PPARα-independent. Dose-dependent increases in hepatocyte proliferation observed in wild-type mice after TCE exposure as determined by BrdU-labeling of hepatocytes were PPARα-dependent. Transcript profiling using macroarrays containing ∼1200 genes showed that 93% (40 out of 43) of all expression changes observed in wild-type mice upon TCE exposure were dependent on PPARα and included known targets of PP (Cyp4a12, epidermal growth factor receptor) and additional genes involved in cell growth. Increases in enzymes that catalyze β- and ω-oxidation of fatty acids were dependent on PPARα after exposure to TCE, TCA or DCA. TCE altered a unique set of genes in the livers of PPARα-null mice compared to wild-type mice including those that respond to different forms of stress. These data support the hypothesis that PPARα plays a dominant role in mediating the effects associated with hepatocarcinogenesis upon TCE exposure

  19. The key elements for genetic response in Finnish dairy cattle breeding

    Directory of Open Access Journals (Sweden)

    Jarmo Juga

    1998-01-01

    Full Text Available This paper reviews some key elements of Finnish animal breeding research contributing to the Finnish dairy cattle breeding programme and discusses the possibilities and problems in collecting data for genetic evaluation, prediction of breeding values both within and across countries, estimation of the economic value of important traits, and selection of bulls and cows. Economic values are calculated for fertility, udder health and production traits when one genetic standard deviation unit (gen. sd. is changed in each trait independently and the financial returns from selection response in the Finnish dairy cattle breeding programme are estimated. The following components were used to calculate the economic value of mastitis treatments: 1 cost of mastitis including discarded milk and treatment costs, 2 reduction in milk price due to higher somatic cell count, 3 replacement costs and 4 lower production level of the herd due to involuntary culling of cows because of udder problems. A high somatic cell count lowers the price of milk and eventually leads to involuntary culling. For treatments for fertility disorders the following costs were included: 1 treatment costs 2 higher replacement costs and 3 decreased milk production in the herd. Days open included the following costs: 1 extra insemination, 2 reduced annual milk yield and 3 fewer calves born. Animal breeding was found to be a very cost effective investment, yielding returns of FIM 876.9 per cow from one round of selection when the gene flow was followed for over 25 years in the Finnish dairy cattle breeding programme.

  20. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Hybrid finite element method for describing the electrical response of biological cells to applied fields.

    Science.gov (United States)

    Ying, Wenjun; Henriquez, Craig S

    2007-04-01

    A novel hybrid finite element method (FEM) for modeling the response of passive and active biological membranes to external stimuli is presented. The method is based on the differential equations that describe the conservation of electric flux and membrane currents. By introducing the electric flux through the cell membrane as an additional variable, the algorithm decouples the linear partial differential equation part from the nonlinear ordinary differential equation part that defines the membrane dynamics of interest. This conveniently results in two subproblems: a linear interface problem and a nonlinear initial value problem. The linear interface problem is solved with a hybrid FEM. The initial value problem is integrated by a standard ordinary differential equation solver such as the Euler and Runge-Kutta methods. During time integration, these two subproblems are solved alternatively. The algorithm can be used to model the interaction of stimuli with multiple cells of almost arbitrary geometries and complex ion-channel gating at the plasma membrane. Numerical experiments are presented demonstrating the uses of the method for modeling field stimulation and action potential propagation.

  2. Killing of Brain Tumor Cells by Hypoxia-Responsive Element Mediated Expression of BAX

    Directory of Open Access Journals (Sweden)

    Hangjun Ruan

    1999-11-01

    Full Text Available The presence of radioresistant hypoxic cells in human brain tumors limits the overall effectiveness of conventional fractionated radiation therapy. Tumor-specific therapies that target hypoxic cells are clearly needed. We have investigated the expression of suicide genes under hypoxia by a hypoxia-responsive element (HRE, which can be activated through hypoxia-inducible factor-1 (HIF-1. We transfected plasmids containing multiple copies of HIRE into U-87 MG and U-251 MG-NCI human brain tumor cells and tested their ability to induce LacZ gene expression under anoxia. Gene expression under anoxia versus oxia was increased about 12-fold for U-87 MG cells and about fourfold for U-251 MG-NCI cells. At intermediate hypoxic conditions, increased LacZ gene expression in U-87 MG cells was induced by the plasmid that contained three HREs, but not by the plasmid with two HREs. Lastly, when we placed a suicide gene BAX under the control of HREs, cells transfected with the BAX plasmids were preferentially killed through apoptosis under anoxia. Our studies demonstrate that HRE-regulated gene expression is active in brain tumor cells, and that the amount of increased gene expression obtained is dependent on the cell line, the HIRE copy number, and the degree of hypoxia.

  3. Domain- and nucleotide-specific Rev response element regulation of feline immunodeficiency virus production

    Science.gov (United States)

    Na, Hong; Huisman, Willem; Ellestad, Kristofor K.; Phillips, Tom R.; Power, Christopher

    2010-01-01

    Computational analysis of feline immunodeficiency virus (FIV) RNA sequences indicated that common FIV strains contain a rev response element (RRE) defined by a long unbranched hairpin with 6 stem-loop sub-domains, termed stem-loop A (SLA). To examine the role of the RNA secondary structure of the RRE, mutational analyses were performed in both an infectious FIV molecular clone and a FIV CAT-RRE reporter system. These studies disclosed that the stems within SLA (SA1, 2, 3, 4, and 5) of the RRE were critical but SA6 was not essential for FIV replication and CAT expression. These studies also revealed that the secondary structure rather than an antisense protein (ASP) mediates virus expression and replication in vitro. In addition, a single synonymous mutation within the FIV-RRE, SA3/45, reduced viral reverse transcriptase activity and p24 expression after transfection but in addition also showed a marked reduction in viral expression and production following infection. PMID:20570310

  4. The Role of Carbohydrate Response Element Binding Protein in Intestinal and Hepatic Fructose Metabolism

    Directory of Open Access Journals (Sweden)

    Katsumi Iizuka

    2017-02-01

    Full Text Available Many articles have discussed the relationship between fructose consumption and the incidence of obesity and related diseases. Fructose is absorbed in the intestine and metabolized in the liver to glucose, lactate, glycogen, and, to a lesser extent, lipids. Unabsorbed fructose causes bacterial fermentation, resulting in irritable bowl syndrome. Therefore, understanding the mechanisms underlying intestinal and hepatic fructose metabolism is important for the treatment of metabolic syndrome and fructose malabsorption. Carbohydrate response element binding protein (ChREBP is a glucose-activated transcription factor that controls approximately 50% of de novo lipogenesis in the liver. ChREBP target genes are involved in glycolysis (Glut2, liver pyruvate kinase, fructolysis (Glut5, ketohexokinase, and lipogenesis (acetyl CoA carboxylase, fatty acid synthase. ChREBP gene deletion protects against high sucrose diet-induced and leptin-deficient obesity, because Chrebp−/− mice cannot consume fructose or sucrose. Moreover, ChREBP contributes to some of the physiological effects of fructose on sweet taste preference and glucose production through regulation of ChREBP target genes, such as fibroblast growth factor-21 and glucose-6-phosphatase catalytic subunits. Thus, ChREBP might play roles in fructose metabolism. Restriction of excess fructose intake will be beneficial for preventing not only metabolic syndrome but also irritable bowl syndrome.

  5. Quantitative Analyses of Synergistic Responses between Cannabidiol and DNA-Damaging Agents on the Proliferation and Viability of Glioblastoma and Neural Progenitor Cells in Culture.

    Science.gov (United States)

    Deng, Liting; Ng, Lindsay; Ozawa, Tatsuya; Stella, Nephi

    2017-01-01

    Evidence suggests that the nonpsychotropic cannabis-derived compound, cannabidiol (CBD), has antineoplastic activity in multiple types of cancers, including glioblastoma multiforme (GBM). DNA-damaging agents remain the main standard of care treatment available for patients diagnosed with GBM. Here we studied the antiproliferative and cell-killing activity of CBD alone and in combination with DNA-damaging agents (temozolomide, carmustine, or cisplatin) in several human GBM cell lines and in mouse primary GBM cells in cultures. This activity was also studied in mouse neural progenitor cells (NPCs) in culture to assess for potential central nervous system toxicity. We found that CBD induced a dose-dependent reduction of both proliferation and viability of all cells with similar potencies, suggesting no preferential activity for cancer cells. Hill plot analysis indicates an allosteric mechanism of action triggered by CBD in all cells. Cotreatment regimens combining CBD and DNA-damaging agents produced synergistic antiproliferating and cell-killing responses over a limited range of concentrations in all human GBM cell lines and mouse GBM cells as well as in mouse NPCs. Remarkably, antagonistic responses occurred at low concentrations in select human GBM cell lines and in mouse GBM cells. Our study suggests limited synergistic activity when combining CBD and DNA-damaging agents in treating GBM cells, along with little to no therapeutic window when considering NPCs. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  6. Third-generation Ah receptor-responsive luciferase reporter plasmids: amplification of dioxin-responsive elements dramatically increases CALUX bioassay sensitivity and responsiveness.

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S

    2011-10-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene-based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts.

  7. The Indirect Boundary Element Method (IBEM) for Seismic Response of Topographical Irregularities in Layered Media

    Science.gov (United States)

    Contreras Zazueta, M. A.; Perton, M.; Sanchez-Sesma, F. J.; Sánchez-Alvaro, E.

    2013-12-01

    The seismic hazard assessment of extended developments, such as a dam, a bridge or a pipeline, needs the strong ground motion simulation taking into account the effects of surface geology. In many cases the incoming wave field can be obtained from attenuation relations or simulations for layered media using Discrete Wave Number (DWN). Sometimes there is a need to include in simulations the seismic source as well. A number of methods to solve these problems have been developed. Among them the Finite Element and Finite Difference Methods (FEM and FDM) are generally preferred because of the facility of use. Nevertheless, the analysis of realistic dynamic loading induced by earthquakes requires a thinner mesh of the entire domain to consider high frequencies. Consequently this may imply a high computational cost. The Indirect Boundary Element Method (IBEM) can also be employed. Here it is used to study the response of a site to historical seismic activity. This method is particularly suited to model wave propagation through wide areas as it requires only the meshing of boundaries. Moreover, it is well suited to represent finely the diffraction that can occur on a fault. However, the IBEM has been applied mainly to simple geometrical configurations. In this communication significant refinements of the formulation are presented. Using IBEM we can simulate wave propagation in complex geometrical configurations such as a stratified medium crossed by thin faults or having a complex topography. Two main developments are here described; one integrates the DWN method inside the IBEM in order to represent the Green's functions of stratified media with relatively low computational cost but assuming unbounded parallel flat layers, and the other is the extension of IBEM to deal with multi-regions in contact which allows more versatility with a higher computational cost compared to the first one but still minor to an equivalent FEM formulation. The two approaches are fully

  8. Gene targeting by the vitamin D response element binding protein reveals a role for vitamin D in osteoblast mTOR signaling.

    Science.gov (United States)

    Lisse, Thomas S; Liu, Ting; Irmler, Martin; Beckers, Johannes; Chen, Hong; Adams, John S; Hewison, Martin

    2011-03-01

    Transcriptional regulation by hormonal 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)] involves occupancy of vitamin D response elements (VDREs) by the VDRE binding protein (VDRE-BP) or 1,25(OH)(2)D(3)-bound vitamin D receptor (VDR). This relationship is disrupted by elevated VDRE-BP, causing a form of hereditary vitamin D-resistant rickets (HVDRR). DNA array analysis showed that of 114 genes regulated by 1,25(OH)(2)D(3) in control cells, almost all (113) were rendered insensitive to the hormone in VDRE-BP-overexpressing HVDRR cells. Among these was the gene for DNA-damage-inducible transcript 4 (DDIT4), an inhibitor of mammalian target of rapamycin (mTOR) signaling. Chromatin immunoprecipitation PCR using 1,25(OH)(2)D(3)-treated osteoblasts confirmed that VDR and VDRE-BP compete for binding to the DDIT4 gene promoter. Expression of DDIT4 mRNA in these cells was induced (1.6-6 fold) by 1,25(OH)(2)D(3) (10-100 nM), and Western blot and flow cytometry analysis showed that this response involved suppression of phosphorylated S6K1(T389) (a downstream target of mTOR) similar to rapamycin treatment. siRNA knockdown of DDIT4 completely abrogated antiproliferative responses to 1,25(OH)(2)D(3), whereas overexpression of VDRE-BP exerted a dominant-negative effect on transcription of 1,25(OH)(2)D(3)-target genes. DDIT4, an inhibitor of mTOR signaling, is a direct target for 1,25(OH)(2)D(3) and VDRE-BP, and functions to suppress cell proliferation in response to vitamin D.

  9. Trace elements in the sea surface microlayer: rapid responses to changes in aerosol deposition

    Directory of Open Access Journals (Sweden)

    Alina M. Ebling

    2017-08-01

    Full Text Available Natural and anthropogenic aerosols are a significant source of trace elements to oligotrophic ocean surface waters, where they provide episodic pulses of limiting micronutrients for the microbial community. However, little is known about the fate of trace elements at the air-sea interface, i.e. the sea surface microlayer. In this study, samples of aerosols, sea surface microlayer, and underlying water column were collected in the Florida Keys during a dusty season (July 2014 and non-dusty season (May 2015 and analyzed for the dissolved and particulate elements Al, Fe, Ni, Cu, Zn, and Pb. Microlayer samples were collected using a cylinder of ultra-pure SiO2 (quartz glass, a novel adaptation of the glass plate technique. A significant dust deposition event occurred during the 2014 sampling period which resulted in elevated concentrations of trace elements in the microlayer. Residence times in the microlayer from this event ranged from 12 to 94 minutes for dissolved trace elements and from 1.3 to 3.4 minutes for particulate trace elements. These residence times are potentially long enough for the atmospherically derived trace elements to undergo chemical and biological alterations within the microlayer. Characterizing the trace element distributions within the three regimes is an important step towards our overall goals of understanding the rates and mechanisms of the solubilization of trace elements following aeolian dust deposition and how this might affect microorganisms in surface waters.

  10. 1ST-ORDER NONADIABATIC COUPLING MATRIX-ELEMENTS FROM MULTICONFIGURATIONAL SELF-CONSISTENT-FIELD RESPONSE THEORY

    DEFF Research Database (Denmark)

    Bak, Keld L.; Jørgensen, Poul; Jensen, H.J.A.

    1992-01-01

    A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response of a ref......A new scheme for obtaining first-order nonadiabatic coupling matrix elements (FO-NACME) for multiconfigurational self-consistent-field (MCSCF) wave functions is presented. The FO-NACME are evaluated from residues of linear response functions. The residues involve the geometrical response...... to the full configuration interaction limit. Comparisons are made with state-averaged MCSCF results for MgH2 and finite-difference configuration interaction by perturbation with multiconfigurational zeroth-order wave function reflected by interactive process (CIPSI) results for BH....

  11. Essential role for cyclic-AMP responsive element binding protein 1 (CREB) in the survival of acute lymphoblastic leukemia

    NARCIS (Netherlands)

    van der Sligte, Naomi E.; Kampen, Kim R.; ter Elst, Arja; Scherpen, Frank J. G.; Meeuwsen-de Boer, Tiny G. J.; Guryev, Victor; van Leeuwen, Frank N.; Kornblau, Steven M.; de Bont, Eveline S. J. M.

    2015-01-01

    Acute lymphoblastic leukemia (ALL) relapse remains a leading cause of cancer related death in children, therefore, new therapeutic options are needed. Recently, we showed that a peptide derived from Cyclic-AMP Responsive Element Binding Protein (CREB) was highly phosphorylated in pediatric

  12. Soil solution chemistry and element fluxes in three European heathlands and their responses to warming and drought

    DEFF Research Database (Denmark)

    Schmidt, I.K.; Tietema, A.; Williams, D.

    2004-01-01

    Soil water chemistry and element budgets were studied at three northwestern European Calluna vulgaris heathland sites in Denmark (DK), The Netherlands (NL), and Wales (UK). Responses to experimental nighttime warming and early summer drought were followed during a two-year period. Soil solution...

  13. Elemental cycling response of an Adirondack subalpine spruce-fir forest to atmospheric and environmental change

    Science.gov (United States)

    Andrew J. Friedland; Eric K. Miller

    1996-01-01

    Patterns and trends in forest elemental cycling can become more apparent in the presence of atmospheric perturbations. High-elevation forests of the northeastern United States have received large amounts of atmospheric deposition of pollutants, which have altered natural elemental cycling and retention rates in a variety of ways. This study examined atmospheric...

  14. Plant-soil distribution of potentially toxic elements in response to elevated atmospheric CO2.

    Science.gov (United States)

    Duval, Benjamin D; Dijkstra, Paul; Natali, Susan M; Megonigal, J Patrick; Ketterer, Michael E; Drake, Bert G; Lerdau, Manuel T; Gordon, Gwyneth; Anbar, Ariel D; Hungate, Bruce A

    2011-04-01

    The distribution of contaminant elements within ecosystems is an environmental concern because of these elements' potential toxicity to animals and plants and their ability to hinder microbial ecosystem services. As with nutrients, contaminants are cycled within and through ecosystems. Elevated atmospheric CO2 generally increases plant productivity and alters nutrient element cycling, but whether CO2 causes similar effects on the cycling of contaminant elements is unknown. Here we show that 11 years of experimental CO2 enrichment in a sandy soil with low organic matter content causes plants to accumulate contaminants in plant biomass, with declines in the extractable contaminant element pools in surface soils. These results indicate that CO2 alters the distribution of contaminant elements in ecosystems, with plant element accumulation and declining soil availability both likely explained by the CO2 stimulation of plant biomass. Our results highlight the interdependence of element cycles and the importance of taking a broad view of the periodic table when the effects of global environmental change on ecosystem biogeochemistry are considered.

  15. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    International Nuclear Information System (INIS)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun; Chan, King Ming

    2010-01-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn 2+ -induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  16. Characterization and localization of metal-responsive-element-binding transcription factors from tilapia

    Energy Technology Data Exchange (ETDEWEB)

    Cheung, Andrew Pok-Lap; Au, Candy Yee-Man; Chan, William Wai-Lun [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong); Chan, King Ming, E-mail: kingchan@cuhk.edu.hk [Department of Biochemistry, Chinese University of Hong Kong, Sha Tin, N.T., Hong Kong (Hong Kong)

    2010-08-01

    Two isoforms of MTF-1, MTF-1L (long form) and MTF-1S (short form), were cloned in tilapia (Ti) and characterized in a tilapia liver cell line, Hepa-T1. The cloned tiMTF-1L has the characteristics of all of the tiMTF-1S identified so far with the zinc finger domain having six fingers, the acidic-rich, proline-rich, and serine/threonine-rich domains; however, the short form encodes for the zinc finger domain with five zinc fingers only and no other domains. The transient transfection of tiMTF-1L into human HepG2 cells showed both constitutive and zinc-induced metal-responsive-element (MRE)-driven reporter gene expression. However, the transfection of tiMTF-1S (which lacks all three transactivation domains) into a human cell line showed reduced transcriptional activities compared with an endogenous control in both basal- and Zn{sup 2+}-induced conditions. The tiMTF-1 isoforms were tagged with GFP and transfected into Hepa-T1 cells (tilapia hepatocytes). The nuclear translocation of tiMTF-1L was observed when the cells were exposed to a sufficient concentration of metals for 6 h. However, tiMTF-1S, was localized in the nucleus with or without metal treatment. Electrophoretic mobility shift assay (EMSA) confirmed that both of the isoforms were able to bind to the MRE specifically in vitro. Tissue distribution studies showed that tiMTF-1L was more abundant than tiMTF-1S in all of the tissues tested.

  17. Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

    Science.gov (United States)

    Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

    2014-12-01

    HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

  18. Hepatic overexpression of cAMP-responsive element modulator α induces a regulatory T-cell response in a murine model of chronic liver disease

    NARCIS (Netherlands)

    Kuttkat, Nadine; Mohs, Antje; Ohl, Kim; Hooiveld, Guido; Longerich, Thomas; Tenbrock, Klaus; Cubero, Francisco Javier; Trautwein, Christian

    2016-01-01


    Objective Th17 cells are a subset of CD4+ T-helper cells characterised by interleukin 17 (IL-17) production, a cytokine that plays a crucial role in inflammation-associated diseases. The cyclic AMP-responsive element modulator-α (CREMα) is a central mediator of T-cell pathogenesis, which

  19. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  20. Romania non-proliferation policy

    International Nuclear Information System (INIS)

    Biro, Lucian; Grama, Viviana

    2001-01-01

    is a component of the National Development Strategy for Romania, presented to the European Union, as a main step in the accession process. Cernavoda NPP Unit 1 is in commercial operation from 1996 and assures 10% of the overall national electricity production. Cernavoda Unit 2 is now about 40% complete, and the Government of Romania has declared its completion as a national priority. The national participation in this project planned to be completed by the year 2005 comprises important contribution of the nuclear infrastructure developed in Romania for the CANDU power plants. Physical Protection of Nuclear Material is also regarded as a fundamental element of the non-proliferation regime. Physical Protection comprises those measures that Romania apply to prevent or deter illegal actions taken against nuclear facilities and nuclear materials, particularly when such materials, are transported across the country. Romania received IAEA assistance to enhance its efforts to prevent unclear material and other radioactive sources from being use illegally and to detect and respond to trafficking cases, should they occur. This assistance included an IPASS Mission and training for staff involved in physical protection for nuclear material and nuclear installations. In 1993 Romania ratified the Convention on Physical Protection of Nuclear Material and has following requirements for nuclear material transport: the material must be classified according to its characteristics, the material may be transported only in approved containers, containers must be marked with safety labels or placards to indicate their contents, for certain radioactive material the shipper must have in place an emergency response assistance plan. CNCAN coordinates at national level the activities regarding preventing and combating illicit trafficking with nuclear materials. From 1993 when the IAEA database was installed, Romania reported 22 incidents involving nuclear material and radioactive sources. In

  1. Responsibilities of supplier states and consumer states in accommodating supply arrangements to changing circumstances and to identify and evaluate alternative mechanisms for improving supply guarantees consistent with non-proliferation

    International Nuclear Information System (INIS)

    1978-01-01

    The papers by the USA and Australia deal with the responsibility of supplier states and consumer states in accommodating supply arrangements to changing circumstances and with the development of alternative supply guarantees consistent with non-proliferation treaties. A number of theses are evolved for the realisation of these goals; most of them refer to an improvement of bilateral contacts and agreements

  2. Efficient transfection of Xenobiotic Responsive Element-biosensor plasmid using diether lipid and phosphatidylcholine liposomes in differentiated HepaRG cells.

    Science.gov (United States)

    Demazeau, Maxime; Quesnot, Nicolas; Ripoche, Nicolas; Rauch, Claudine; Jeftić, Jelena; Morel, Fabrice; Gauffre, Fabienne; Benvegnu, Thierry; Loyer, Pascal

    2017-05-30

    In this study, we evaluated cationic liposomes prepared from diether-NH 2 and egg phosphatidylcholine (EPC) for in vitro gene delivery. The impact of the lipid composition, i.e. the EPC and Diether-NH 2 molar ratio, on in vitro transfection efficiency and cytotoxicity was investigated using the human HEK293T and hepatoma HepaRG cells known to be permissive and poorly permissive cells for liposome-mediated gene transfer, respectively. Here, we report that EPC/Diether-NH 2 -based liposomes enabled a very efficient transfection with low cytotoxicity compared to commercial transfection reagents in both HEK293T and proliferating progenitor HepaRG cells. Taking advantage of these non-toxic EPC/Diether-NH 2 -based liposomes, we developed a method to efficiently transfect differentiated hepatocyte-like HepaRG cells and a biosensor plasmid containing a Xenobiotic Responsive Element and a minimal promoter driving the transcription of the luciferase reporter gene. We demonstrated that the luciferase activity was induced by a canonical inducer of cytochrome P450 genes, the benzo[a]pyrene, and two environmental contaminants, the fluoranthene, a polycyclic aromatic hydrocarbon, and the endosulfan, an organochlorine insecticide, known to induce toxicity and genotoxicity in differentiated HepaRG cells. In conclusion, we established a new efficient lipofection-mediated gene transfer in hepatocyte-like HepaRG cells opening new perspectives in drug evaluation relying on xenobiotic inducible biosensor plasmids. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. O-linked N-acetylglucosamine transferase enhances secretory clusterin expression via liver X receptors and sterol response element binding protein regulation in cervical cancer.

    Science.gov (United States)

    Kim, Min Jun; Choi, Mee Young; Lee, Dong Hoon; Roh, Gu Seob; Kim, Hyun Joon; Kang, Sang Soo; Cho, Gyeong Jae; Kim, Yoon Sook; Choi, Wan Sung

    2018-01-12

    O-linked N-acetylglucosamine transferase (OGT) expression is increased in various cancer types, indicating the potential importance of O-GlcNAcylation in tumorigenesis. Secretory clusterin (sCLU) is involved in cancer cell proliferation and drug resistance, and recently, liver X receptors (LXRs) and sterol response element binding protein-1 (SREBP-1) were reported to regulate sCLU transcription. Here, we found that sCLU is significantly increased in cervical cancer cell lines, which have higher expression levels of O-GlcNAc and OGT than keratinocytes. OGT knockdown decreased expression of LXRs, SREBP-1 and sCLU through hypo-O-GlcNAcylation of LXRs. Additionally, treatment with Thiamet G, O-GlcNAcase OGA inhibitor, increased expression of O-GlcNAcylation and sCLU, and high glucose increased levels of LXRs, SREBP-1 and sCLU in HeLa cells. Moreover, OGT knockdown induced G 0 /G 1 phase cell cycle arrest and late apoptosis in cisplatin-treated HeLa cells, and decreased viability compared to OGT intact HeLa cells. Taken together, these findings suggest that OGT, O-GlcNAcylated LXRs, and SREBP-1 increase sCLU expression in cervical cancer cells, which contributes to drug resistance.

  4. Biomechanical Analysis of Human Abdominal Impact Responses and Injuries through Finite Element Simulations of a Full Human Body Model.

    Science.gov (United States)

    Ruan, Jesse S; El-Jawahri, Raed; Barbat, Saeed; Prasad, Priya

    2005-11-01

    Human abdominal response and injury in blunt impacts was investigated through finite element simulations of cadaver tests using a full human body model of an average-sized adult male. The model was validated at various impact speeds by comparing model responses with available experimental cadaver test data in pendulum side impacts and frontal rigid bar impacts from various sources. Results of various abdominal impact simulations are presented in this paper. Model-predicted abdominal dynamic responses such as force-time and force-deflection characteristics, and injury severities, measured by organ pressures, for the simulated impact conditions are presented. Quantitative results such as impact forces, abdominal deflections, internal organ stresses have shown that the abdomen responded differently to left and right side impacts, especially in low speed impact. Results also indicated that the model exhibited speed sensitive response characteristics and the compressibility of the abdomen significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated finite element human body model can be useful for abdominal injury assessment. Internal organ injuries, which are difficult to detect in experimental studies with human cadavers due to the difficulty of instrumentation, may be more easily identified with a validated finite element model through stress-strain analysis.

  5. An approach to unfold the response of a multi-element system using an artificial neural network

    International Nuclear Information System (INIS)

    Cordes, E.; Fehrenbacher, G.; Schuetz, R.; Sprunck, M.; Hahn, K.; Hofmann, R.; Wahl, W.

    1998-01-01

    An unfolding procedure is proposed which aims at obtaining spectral information of a neutron radiation field by the analysis of the response of a multi-element system consisting of converter type semiconductors. For the unfolding procedure an artificial neural network (feed forward network), trained by the back-propagation method, was used. The response functions of the single elements to neutron radiation were calculated by application of a computational model for an energy range from 10 -2 eV to 10 MeV. The training of the artificial neural network was based on the computation of responses of a six-element system for a set of 300 neutron spectra and the application of the back-propagation method. The validation was performed by the unfolding of 100 computed responses. Two unfolding examples were pointed out for the determination of the neutron spectra. The spectra resulting from the unfolding procedure agree well with the original spectra used for the response computation

  6. Nocodazole treatment interrupted Brucella abortus invasion in RAW 264.7 cells, and successfully attenuated splenic proliferation with enhanced inflammatory response in mice.

    Science.gov (United States)

    Reyes, Alisha Wehdnesday Bernardo; Hop, Huynh Tan; Arayan, Lauren Togonon; Huy, Tran Xuan Ngoc; Min, Wongi; Lee, Hu Jang; Chang, Hong Hee; Kim, Suk

    2017-02-01

    Brucellosis is one of the most important and widespread zoonosis worldwide responsible for serious economic losses and considerable public health burden. In this study, we investigated the modulatory effect of a microtubule-inhibitor, nocodazole, on B. abortus infection in murine macrophages and in a mouse model. Nocodazole activated macrophages and directly inhibited the growth of Brucella in a dose-dependent manner. Nocodazole increased adhesion but reduced invasion and intracellular growth of Brucella in macrophages although it did not affect co-localization of Brucella with LAMP-1. In addition, nocodazole negatively affected actin polymerization, and weakly activated ERK and p38α but significantly activated JNK in non-infected cells. After subsequent infection, nocodazole weakly inhibited activation of ERK and p38α. For the in vivo tests, nocodazole -treated mice displayed elevated levels of IFN-γ, MCP-1 and IL-10 while Brucella-infected nocodazole -treated mice showed high levels of TNF, IFN-γ, MCP-1, IL-10 and IL-6 as compared to controls. Furthermore, nocodazole treatment reduced inflammation and Brucella proliferation in the spleens of mice. These findings highlight the potential use of nocodazole for the control of brucellosis although further investigations are encouraged to validate its therapeutic use in animal hosts. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Vacuum ultraviolet photolysis of diclofenac and the effects of its treated aqueous solutions on the proliferation and migratory responses of Tetrahymena pyriformis

    International Nuclear Information System (INIS)

    Arany, Eszter; Láng, Júlia; Somogyvári, Dávid; Láng, Orsolya; Alapi, Tünde; Ilisz, István

    2014-01-01

    The effects of dissolved O 2 , phosphate buffer and the initial concentration of diclofenac on the vacuum ultraviolet photolysis of this contaminant molecule were studied. Besides kinetic measurements, the irradiated, multicomponent samples were characterized via the proliferation and migratory responses (in sublethal concentrations) of the bioindicator eukaryotic ciliate Tetrahymena pyriformis. The results suggest that hydroxyl radicals, hydrogen atoms and hydroperoxyl radicals may all contribute to the degradation of diclofenac. The aromatic by-products of diclofenac were presumed to include a hydroxylated derivative, 1-(8-chlorocarbazolyl)acetic acid and 1-(8-hydroxycarbazolyl)acetic acid. The biological activity of photoexposed samples reflected the chemical transformation of diclofenac and was also dependent on the level of dissolved O 2 . The increase in toxicity of samples taken after different irradiation times did not exceed a factor of two. Our results suggest that the combination of vacuum ultraviolet photolysis with toxicity and chemotactic measurements can be a valuable method for the investigation of the elimination of micropollutants. - Highlights: • The radical-scavenging effect of phosphates seems to be negligible. • Only higher concentrations of HO 2 · contribute to the degradation of diclofenac. • Toxicity of VUV-treated samples decreases with increasing rate of mineralization. • Dissolved O 2 enhances the mineralization of diclofenac by affecting the radical set. • Treated samples retain the chemorepellent character of the parent compound

  8. Vacuum ultraviolet photolysis of diclofenac and the effects of its treated aqueous solutions on the proliferation and migratory responses of Tetrahymena pyriformis

    Energy Technology Data Exchange (ETDEWEB)

    Arany, Eszter [Research Group of Environmental Chemistry, Institute of Chemistry, University of Szeged, H-6720 Szeged, Rerrich Béla tér 1 (Hungary); Láng, Júlia [Department of Genetics, Cell- and Immunobiology, Semmelweis University, H-1089 Budapest, Nagyvárad tér 4 (Hungary); Somogyvári, Dávid [Research Group of Environmental Chemistry, Institute of Chemistry, University of Szeged, H-6720 Szeged, Rerrich Béla tér 1 (Hungary); Láng, Orsolya [Department of Genetics, Cell- and Immunobiology, Semmelweis University, H-1089 Budapest, Nagyvárad tér 4 (Hungary); Alapi, Tünde [Research Group of Environmental Chemistry, Institute of Chemistry, University of Szeged, H-6720 Szeged, Rerrich Béla tér 1 (Hungary); Department of Inorganic and Analytical Chemistry, University of Szeged, H-6720 Szeged, Dóm tér 7 (Hungary); Ilisz, István [Department of Inorganic and Analytical Chemistry, University of Szeged, H-6720 Szeged, Dóm tér 7 (Hungary); and others

    2014-01-01

    The effects of dissolved O{sub 2}, phosphate buffer and the initial concentration of diclofenac on the vacuum ultraviolet photolysis of this contaminant molecule were studied. Besides kinetic measurements, the irradiated, multicomponent samples were characterized via the proliferation and migratory responses (in sublethal concentrations) of the bioindicator eukaryotic ciliate Tetrahymena pyriformis. The results suggest that hydroxyl radicals, hydrogen atoms and hydroperoxyl radicals may all contribute to the degradation of diclofenac. The aromatic by-products of diclofenac were presumed to include a hydroxylated derivative, 1-(8-chlorocarbazolyl)acetic acid and 1-(8-hydroxycarbazolyl)acetic acid. The biological activity of photoexposed samples reflected the chemical transformation of diclofenac and was also dependent on the level of dissolved O{sub 2}. The increase in toxicity of samples taken after different irradiation times did not exceed a factor of two. Our results suggest that the combination of vacuum ultraviolet photolysis with toxicity and chemotactic measurements can be a valuable method for the investigation of the elimination of micropollutants. - Highlights: • The radical-scavenging effect of phosphates seems to be negligible. • Only higher concentrations of HO{sub 2}{sup ·} contribute to the degradation of diclofenac. • Toxicity of VUV-treated samples decreases with increasing rate of mineralization. • Dissolved O{sub 2} enhances the mineralization of diclofenac by affecting the radical set. • Treated samples retain the chemorepellent character of the parent compound.

  9. Third-Generation Ah Receptor–Responsive Luciferase Reporter Plasmids: Amplification of Dioxin-Responsive Elements Dramatically Increases CALUX Bioassay Sensitivity and Responsiveness

    Science.gov (United States)

    He, Guochun; Tsutsumi, Tomoaki; Zhao, Bin; Baston, David S.; Zhao, Jing; Heath-Pagliuso, Sharon; Denison, Michael S.

    2011-01-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD, dioxin) and related dioxin-like chemicals are widespread and persistent environmental contaminants that produce diverse toxic and biological effects through their ability to bind to and activate the Ah receptor (AhR) and AhR-dependent gene expression. The chemically activated luciferase expression (CALUX) system is an AhR-responsive recombinant luciferase reporter gene–based cell bioassay that has been used in combination with chemical extraction and cleanup methods for the relatively rapid and inexpensive detection and relative quantitation of dioxin and dioxin-like chemicals in a wide variety of sample matrices. Although the CALUX bioassay has been validated and used extensively for screening purposes, it has some limitations when screening samples with very low levels of dioxin-like chemicals or when there is only a small amount of sample matrix for analysis. Here, we describe the development of third-generation (G3) CALUX plasmids with increased numbers of dioxin-responsive elements, and stable transfection of these new plasmids into mouse hepatoma (Hepa1c1c7) cells has produced novel amplified G3 CALUX cell bioassays that respond to TCDD with a dramatically increased magnitude of luciferase induction and significantly lower minimal detection limit than existing CALUX-type cell lines. The new G3 CALUX cell lines provide a highly responsive and sensitive bioassay system for the detection and relative quantitation of very low levels of dioxin-like chemicals in sample extracts. PMID:21775728

  10. Finite element modelling to assess the effect of surface mounted piezoelectric patch size on vibration response of a hybrid beam

    Science.gov (United States)

    Rahman, N.; Alam, M. N.

    2018-02-01

    Vibration response analysis of a hybrid beam with surface mounted patch piezoelectric layer is presented in this work. A one dimensional finite element (1D-FE) model based on efficient layerwise (zigzag) theory is used for the analysis. The beam element has eight mechanical and a variable number of electrical degrees of freedom. The beams are also modelled in 2D-FE (ABAQUS) using a plane stress piezoelectric quadrilateral element for piezo layers and a plane stress quadrilateral element for the elastic layers of hybrid beams. Results are presented to assess the effect of size of piezoelectric patch layer on the free and forced vibration responses of thin and moderately thick beams under clamped-free and clamped-clamped configurations. The beams are subjected to unit step loading and harmonic loading to obtain the forced vibration responses. The vibration control using in phase actuation potential on piezoelectric patches is also studied. The 1D-FE results are compared with the 2D-FE results.

  11. Characterization of an estrogen-responsive element implicated in regulation of the rainbow trout estrogen receptor gene.

    Science.gov (United States)

    Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y

    1995-08-01

    We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.

  12. Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

    Science.gov (United States)

    Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

    1992-09-05

    We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or

  13. A novel recombinantly produced banana lectin isoform is a valuable tool for glycoproteomics and a potent modulator of the proliferation response in CD3(+), CD4(+), and CD8(+) populations of human PBMCs

    DEFF Research Database (Denmark)

    Gavrovic-Jankulovic, M; Poulsen, Knud; Brckalo, T

    2008-01-01

    Lectins as carbohydrate-binding proteins have been employed in various biological assays for the detection and characterization of glycan structures on glycoproteins, including clinical biomarkers in disease states. A mannose-specific banana lectin (BanLec) is unique in its specificity for internal......, the immunomodulatory potential of rBanLec and nBanLec were comparable as assessed by an inhibition assay and a human T cell proliferation assay where they induced a strong proliferation response in CD3(+), CD4(+), and CD8(+) populations of human PBMCs. This recombinant BanLec is a useful reagent for glycoproteomics...

  14. SANTOS - a two-dimensional finite element program for the quasistatic, large deformation, inelastic response of solids

    Energy Technology Data Exchange (ETDEWEB)

    Stone, C.M.

    1997-07-01

    SANTOS is a finite element program designed to compute the quasistatic, large deformation, inelastic response of two-dimensional planar or axisymmetric solids. The code is derived from the transient dynamic code PRONTO 2D. The solution strategy used to compute the equilibrium states is based on a self-adaptive dynamic relaxation solution scheme, which is based on explicit central difference pseudo-time integration and artificial mass proportional damping. The element used in SANTOS is a uniform strain 4-node quadrilateral element with an hourglass control scheme to control the spurious deformation modes. Finite strain constitutive models for many common engineering materials are included. A robust master-slave contact algorithm for modeling sliding contact is implemented. An interface for coupling to an external code is also provided. 43 refs., 22 figs.

  15. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  16. First-principles study on the effect of alloying elements on the elastic deformation response in β-titanium alloys

    International Nuclear Information System (INIS)

    Gouda, Mohammed K.; Gepreel, Mohamed A. H.; Nakamura, Koichi

    2015-01-01

    Theoretical deformation response of hypothetical β-titanium alloys was investigated using first-principles calculation technique under periodic boundary conditions. Simulation was carried out on hypothetical 54-atom supercell of Ti–X (X = Cr, Mn, Fe, Zr, Nb, Mo, Al, and Sn) binary alloys. The results showed that the strength of Ti increases by alloying, except for Cr. The most effective alloying elements are Nb, Zr, and Mo in the current simulation. The mechanism of bond breaking was revealed by studying the local structure around the alloying element atom with respect to volume change. Moreover, the effect of alloying elements on bulk modulus and admissible strain was investigated. It was found that Zr, Nb, and Mo have a significant effect to enhance the admissible strain of Ti without change in bulk modulus

  17. Oxymatrine attenuates hepatic steatosis in non-alcoholic fatty liver disease rats fed with high fructose diet through inhibition of sterol regulatory element binding transcription factor 1 (Srebf1) and activation of peroxisome proliferator activated receptor alpha (Pparα).

    Science.gov (United States)

    Shi, Li-juan; Shi, Lei; Song, Guang-yao; Zhang, He-fang; Hu, Zhi-juan; Wang, Chao; Zhang, Dong-hui

    2013-08-15

    The aim of this study was to examine the therapeutic effect of oxymatrine, a monomer isolated from the medicinal plant Sophora flavescens Ait, on the hepatic lipid metabolism in non-alcoholic fatty liver (NAFLD) rats and to explore the potential mechanism. Rats were fed with high fructose diet for 8 weeks to establish the NAFLD model, then were given oxymatrine treatment (40, 80, and 160 mg/kg, respectively) for another 8 weeks. Body weight gain, liver index, serum and liver lipids, and histopathological evaluation were measured. Enzymatic activity and gene expression of the key enzymes involved in the lipogenesis and fatty acid oxidation were assayed. The results showed that oxymatrine treatment reduced body weight gain, liver weight, liver index, dyslipidemia, and liver triglyceride level in a dose dependant manner. Importantly, the histopathological examination of liver confirmed that oxymatrine could decrease the liver lipid accumulation. The treatment also decreased the fatty acid synthase (FAS) enzymatic activity and increased the carnitine palmitoyltransferase 1A (CPT1A) enzymatic activity. Besides, oxymatrine treatment decreased the mRNA expression of sterol regulatory element binding transcription factor 1(Srebf1), fatty acid synthase (Fasn), and acetyl CoA carboxylase (Acc), and increased the mRNA expression of peroxisome proliferator activated receptor alpha (Pparα), carnitine palmitoyltransferase 1A (Cpt1a), and acyl CoA oxidase (Acox1) in high fructose diet induced NAFLD rats. These results suggested that the therapeutic effect of oxymatrine on the hepatic steatosis in high fructose diet induced fatty liver rats is partly due to down-regulating Srebf1 and up-regulating Pparα mediated metabolic pathways simultaneously. © 2013 Elsevier B.V. All rights reserved.

  18. Implicit three-dimensional finite-element formulation for the nonlinear structural response of reactor components

    International Nuclear Information System (INIS)

    Kulak, R.F.; Belytschko, T.B.

    1975-09-01

    The formulation of a finite-element procedure for the implicit transient and static analysis of plate/shell type structures in three-dimensional space is described. The triangular plate/shell element can sustain both membrane and bending stresses. Both geometric and material nonlinearities can be treated, and an elastic-plastic material law has been incorporated. The formulation permits the element to undergo arbitrarily large rotations and translations; but, in its present form it is restricted to small strains. The discretized equations of motion are obtained by a stiffness method. An implicit integration algorithm based on trapezoidal integration formulas is used to integrate the discretized equations of motion in time. To ensure numerical stability, an iterative solution procedure with equilibrium checks is used

  19. cAMP response element binding protein (CREB activates transcription via two distinct genetic elements of the human glucose-6-phosphatase gene

    Directory of Open Access Journals (Sweden)

    Stefano Luisa

    2005-01-01

    Full Text Available Abstract Background The enzyme glucose-6-phosphatase catalyzes the dephosphorylation of glucose-6-phosphatase to glucose, the final step in the gluconeogenic and glycogenolytic pathways. Expression of the glucose-6-phosphatase gene is induced by glucocorticoids and elevated levels of intracellular cAMP. The effect of cAMP in regulating glucose-6-phosphatase gene transcription was corroborated by the identification of two genetic motifs CRE1 and CRE2 in the human and murine glucose-6-phosphatase gene promoter that resemble cAMP response elements (CRE. Results The cAMP response element is a point of convergence for many extracellular and intracellular signals, including cAMP, calcium, and neurotrophins. The major CRE binding protein CREB, a member of the basic region leucine zipper (bZIP family of transcription factors, requires phosphorylation to become a biologically active transcriptional activator. Since unphosphorylated CREB is transcriptionally silent simple overexpression studies cannot be performed to test the biological role of CRE-like sequences of the glucose-6-phosphatase gene. The use of a constitutively active CREB2/CREB fusion protein allowed us to uncouple the investigation of target genes of CREB from the variety of signaling pathways that lead to an activation of CREB. Here, we show that this constitutively active CREB2/CREB fusion protein strikingly enhanced reporter gene transcription mediated by either CRE1 or CRE2 derived from the glucose-6-phosphatase gene. Likewise, reporter gene transcription was enhanced following expression of the catalytic subunit of cAMP-dependent protein kinase (PKA in the nucleus of transfected cells. In contrast, activating transcription factor 2 (ATF2, known to compete with CREB for binding to the canonical CRE sequence 5'-TGACGTCA-3', did not transactivate reporter genes containing CRE1, CRE2, or both CREs derived from the glucose-6-phosphatase gene. Conclusions Using a constitutively active CREB2

  20. Metals and trace elements in feathers: A geochemical approach to avoid misinterpretation of analytical responses.

    Science.gov (United States)

    Borghesi, Fabrizio; Migani, Francesca; Andreotti, Alessandro; Baccetti, Nicola; Bianchi, Nicola; Birke, Manfred; Dinelli, Enrico

    2016-02-15

    Assessing trace metal pollution using feathers has long attracted the attention of ecotoxicologists as a cost-effective and non-invasive biomonitoring method. In order to interpret the concentrations in feathers considering the external contamination due to lithic residue particles, we adopted a novel geochemical approach. We analysed 58 element concentrations in feathers of wild Eurasian Greater Flamingo Phoenicopterus roseus fledglings, from 4 colonies in Western Europe (Spain, France, Sardinia, and North-eastern Italy) and one group of adults from zoo. In addition, 53 elements were assessed in soil collected close to the nesting islets. This enabled to compare a wide selection of metals among the colonies, highlighting environmental anomalies and tackling possible causes of misinterpretation of feather results. Most trace elements in feathers (Al, Ce, Co, Cs, Fe, Ga, Li, Mn, Nb, Pb, Rb, Ti, V, Zr, and REEs) were of external origin. Some elements could be constitutive (Cu, Zn) or significantly bioaccumulated (Hg, Se) in flamingos. For As, Cr, and to a lesser extent Pb, it seems that bioaccumulation potentially could be revealed by highly exposed birds, provided feathers are well cleaned. This comprehensive study provides a new dataset and confirms that Hg has been accumulated in feathers in all sites to some extent, with particular concern for the Sardinian colony, which should be studied further including Cr. The Spanish colony appears critical for As pollution and should be urgently investigated in depth. Feathers collected from North-eastern Italy were the hardest to clean, but our methods allowed biological interpretation of Cr and Pb. Our study highlights the importance of external contamination when analysing trace elements in feathers and advances methodological recommendations in order to reduce the presence of residual particles carrying elements of external origin. Geochemical data, when available, can represent a valuable tool for a correct

  1. Element uptake and physiological responses of Lactuca sativa upon co-exposures to tourmaline and dissolved humic acids.

    Science.gov (United States)

    Jia, Weili; Wang, Cuiping; Ma, Chuanxin; Wang, Jicheng; Sun, Hongwen

    2018-03-27

    Element migration and physiological response in Lactuca sativa upon co-exposure to tourmaline (T) and dissolved humic acids (DHAs) were investigated. Different fractions of DHA 1 and DHA 4 and three different doses of T were introduced into Hoagland's solution. The results indicated that T enhanced the contents of elements such as N and C, Si and Al in the roots and shoots. The correlation between TF values of Si and Al (R 2  = 0.7387) was higher than that of Si and Mn (R 2  = 0.4961) without the presence of DHAs. However, both DHA 1 and DHA 4 increased the correlation between Si and Mn, but decreased the one between Si and Al. CAT activities in T treatments were positively correlated to the contents of N and Al in the shoots, whose R 2 was 0.9994 and 0.9897, respectively. In the co-exposure of DHAs and tourmaline, DHA 4 exhibited more impacts on element uptake, CAT activities, as well as ABA contents in comparison with the presence of DHA 1 , regardless of the T exposure doses. These results suggested that DHAs have effects on mineral element behaviors and physiological response in Lactuca sativa upon exposure to tourmaline for the first time, which had great use in guiding soil remediation.

  2. Capacity for cooperative binding of thyroid hormone (T3) receptor dimers defines wild type T3 response elements.

    Science.gov (United States)

    Brent, G A; Williams, G R; Harney, J W; Forman, B M; Samuels, H H; Moore, D D; Larsen, P R

    1992-04-01

    Thyroid hormone response elements (T3REs) have been identified in a variety of promoters including those directing expression of rat GH (rGH), alpha-myosin heavy chain (rMHC), and malic enzyme (rME). A detailed biochemical and genetic analysis of the rGH element has shown that it consists of three hexamers related to the consensus [(A/G)GGT(C/A)A]. We have extended this analysis to the rMHC and rME elements. Binding of highly purified thyroid hormone receptor (T3R) to T3REs was determined using the gel shift assay, and thyroid hormone (T3) induction was measured in transient tranfections. We show that the wild type version of each of the three elements binds T3R dimers cooperatively. Mutational analysis of the rMHC and rME elements identified domains important for binding T3R dimers and allowed a direct determination of the relationship between T3R binding and function. In each element two hexamers are required for dimer binding, and mutations that interfere with dimer formation significantly reduce T3 induction. Similar to the rGH element, the rMHC T3RE contains three hexameric domains arranged as a direct repeat followed by an inverted copy, although the third domain is weaker than in rGH. All three are required for full function and T3R binding. The rME T3RE is a two-hexamer direct repeat T3RE, which also binds T3R monomer and dimer. Across a series of mutant elements, there was a strong correlation between dimer binding in vitro and function in vivo for rMHC (r = 0.99, P less than 0.01) and rME (r = 0.67, P less than 0.05) T3REs. Our results demonstrate a similar pattern of T3R dimer binding to a diverse array of hexameric sequences and arrangements in three wild type T3REs. Addition of nuclear protein enhanced T3R binding but did not alter the specificity of binding to wild type or mutant elements. Binding of purified T3R to T3REs was highly correlated with function, both with and without the addition of nuclear protein. T3R dimer formation is the common

  3. New advances in the forced response computation of periodic structures using the wave finite element (WFE) method

    OpenAIRE

    Mencik , Jean-Mathieu

    2014-01-01

    International audience; The wave finite element (WFE) method is investigated to describe the harmonic forced response of onedimensional periodic structures like those composed of complex substructures and encountered in engineering applications. The dynamic behavior of these periodic structures is analyzed over wide frequency bands where complex spatial dynamics, inside the substructures, are likely to occur.Within theWFE framework, the dynamic behavior of periodic structures is described in ...

  4. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Czech Academy of Sciences Publication Activity Database

    Štísová, Viktorie; Goffinont, S.; Maurizot, M. S.; Davídková, Marie

    2010-01-01

    Roč. 79, č. 8 (2010), s. 880-889 ISSN 0969-806X R&D Projects: GA MŠk 1P05OC085; GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : DNA-protein complex * estrogen response element * estrogen receptor * ionizing radiation Subject RIV: BO - Biophysics Impact factor: 1.132, year: 2010

  5. Dielectric response of arbitrary-shaped clusters studied by the finite element method

    Czech Academy of Sciences Publication Activity Database

    Rychetský, Ivan; Klíč, Antonín

    2012-01-01

    Roč. 427, č. 1 (2012), s. 143-147 ISSN 0015-0193 R&D Projects: GA ČR GA202/09/0430 Institutional research plan: CEZ:AV0Z10100520 Keywords : effective permittivity * two-component composite * integral representation * finite element analysis Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.415, year: 2012

  6. Program for responsible and safe disposal of spent fuel elements and radioactive wastes (National disposal program)

    International Nuclear Information System (INIS)

    2015-01-01

    The contribution covers the following topics: fundamentals of the disposal policy; amount of radioactive wastes and prognosis; disposal of radioactive wastes - spent fuel elements and wastes from waste processing, radioactive wastes with low heat production; legal framework of the nuclear waste disposal in Germany; public participation, cost and financing.

  7. Dis3- and exosome subunit-responsive 3′ mRNA instability elements

    International Nuclear Information System (INIS)

    Kiss, Daniel L.; Hou, Dezhi; Gross, Robert H.; Andrulis, Erik D.

    2012-01-01

    Highlights: ► Successful use of a novel RNA-specific bioinformatic tool, RNA SCOPE. ► Identified novel 3′ UTR cis-acting element that destabilizes a reporter mRNA. ► Show exosome subunits are required for cis-acting element-mediated mRNA instability. ► Define precise sequence requirements of novel cis-acting element. ► Show that microarray-defined exosome subunit-regulated mRNAs have novel element. -- Abstract: Eukaryotic RNA turnover is regulated in part by the exosome, a nuclear and cytoplasmic complex of ribonucleases (RNases) and RNA-binding proteins. The major RNase of the complex is thought to be Dis3, a multi-functional 3′–5′ exoribonuclease and endoribonuclease. Although it is known that Dis3 and core exosome subunits are recruited to transcriptionally active genes and to messenger RNA (mRNA) substrates, this recruitment is thought to occur indirectly. We sought to discover cis-acting elements that recruit Dis3 or other exosome subunits. Using a bioinformatic tool called RNA SCOPE to screen the 3′ untranslated regions of up-regulated transcripts from our published Dis3 depletion-derived transcriptomic data set, we identified several motifs as candidate instability elements. Secondary screening using a luciferase reporter system revealed that one cassette—harboring four elements—destabilized the reporter transcript. RNAi-based depletion of Dis3, Rrp6, Rrp4, Rrp40, or Rrp46 diminished the efficacy of cassette-mediated destabilization. Truncation analysis of the cassette showed that two exosome subunit-sensitive elements (ESSEs) destabilized the reporter. Point-directed mutagenesis of ESSE abrogated the destabilization effect. An examination of the transcriptomic data from exosome subunit depletion-based microarrays revealed that mRNAs with ESSEs are found in every up-regulated mRNA data set but are underrepresented or missing from the down-regulated data sets. Taken together, our findings imply a potentially novel mechanism of m

  8. Ultraviolet B (UVB) induction of the c-fos promoter is mediated by phospho-cAMP response element binding protein (CREB) binding to CRE and c-fos activator protein 1 site (FAP1) cis elements.

    Science.gov (United States)

    Gonzales, Melissa; Bowden, G Tim

    2002-06-26

    The ultraviolet B (UVB) portion (280-320 nm) of the ultraviolet spectrum has been shown to contribute to the development of non-melanoma skin cancer in humans. Research in the human keratinocyte cell line, HaCaT, revealed that UVB irradiation caused the upregulation of the transcription factor activator protein-1 (AP-1). The AP-1 complex formed in UVB-irradiated HaCaT cells is specifically composed of c-fos and Jun D. c-Fos expression was induced in a manner that correlated with the UVB-induced activation of AP-1. To investigate how c-fos expression is regulated by UVB irradiation, the role of each of four cis elements within the c-fos promoter was evaluated. Clustered point mutations at the sis inducible element (SIE), serum response element (SRE), c-fos AP-1 site (FAP1), or cyclic AMP response elements (CRE) significantly inhibited UVB induction of the c-fos promoter. This indicated that all four cis elements are required for maximum promoter activity. The CRE and FAP1 elements were the two most active cis elements that mediate the UVB transactivation of c-fos. Homodimers of phosphorylated cAMP response element binding protein (CREB) were induced by UVB irradiation to bind to each of these elements. Therefore, CREB may function as an important regulatory protein in the UVB-induced expression of c-fos.

  9. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    Directory of Open Access Journals (Sweden)

    Riaño-Pachón Diego

    2007-08-01

    Full Text Available Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs, ABRE and CE3, in thale cress (Arabidopsis thaliana and rice (Oryza sativa. Results Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Conclusion Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of

  11. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice.

    Science.gov (United States)

    Gómez-Porras, Judith L; Riaño-Pachón, Diego Mauricio; Dreyer, Ingo; Mayer, Jorge E; Mueller-Roeber, Bernd

    2007-08-01

    In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with the help of new molecular tools. The increasing availability of genomic sequences and gene expression data enables us to dissect ABA regulatory mechanisms at the individual gene expression level. In this paper we used an in-silico-based approach directed towards genome-wide prediction and identification of specific features of ABA-responsive elements. In particular we analysed the genome-wide occurrence and positional arrangements of two well-described ABA-responsive cis-regulatory elements (CREs), ABRE and CE3, in thale cress (Arabidopsis thaliana) and rice (Oryza sativa). Our results show that Arabidopsis and rice use the ABA-responsive elements ABRE and CE3 distinctively. Earlier reports for various monocots have identified CE3 as a coupling element (CE) associated with ABRE. Surprisingly, we found that while ABRE is equally abundant in both species, CE3 is practically absent in Arabidopsis. ABRE-ABRE pairs are common in both genomes, suggesting that these can form functional ABA-responsive complexes (ABRCs) in Arabidopsis and rice. Furthermore, we detected distinct combinations, orientation patterns and DNA strand preferences of ABRE and CE3 motifs in rice gene promoters. Our computational analyses revealed distinct recruitment patterns of ABA-responsive CREs in upstream sequences of Arabidopsis and rice. The apparent absence of CE3s in Arabidopsis suggests that another CE pairs with ABRE to establish a functional ABRC capable of interacting with transcription factors. Further studies will be

  12. Interactions between the cytomegalovirus promoter and the estrogen response element: implications for design of estrogen-responsive reporter plasmids.

    Science.gov (United States)

    Derecka, K; Wang, C K; Flint, A P F

    2006-07-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)ERE) was not estrogen responsive. Inhibition of ERE function was not due to an effect in trans or due to lack of estrogen receptor. It was not due to an interaction between the cmv promoter and the SeAP gene. cmv promoter function was dependent on NF-kappaB, and mutagenesis in the NF-kappaB sites reduced basal reporter expression without imparting responsiveness to estrogen. A mutation in the TATA box also failed to impart estrogen responsiveness. Modeling of DNA accessibility indicated the ERE was inserted at a site accessible to transcription factors. We conclude that the cmv promoter inhibits ERE function in cis when the two sequences are located in the same construct, and that this effect does not involve an interaction between cmv and reporter gene, NF-kappaB sites or the TATA box, or DNA inaccessibility.

  13. Increased cellular immune responses and CD4+ T-cell proliferation correlate with reduced plasma viral load in SIV challenged recombinant simian varicella virus - simian immunodeficiency virus (rSVV-SIV vaccinated rhesus macaques

    Directory of Open Access Journals (Sweden)

    Pahar Bapi

    2012-08-01

    Full Text Available Abstract Background An effective AIDS vaccine remains one of the highest priorities in HIV-research. Our recent study showed that vaccination of rhesus macaques with recombinant simian varicella virus (rSVV vector – simian immunodeficiency virus (SIV envelope and gag genes, induced neutralizing antibodies and cellular immune responses to SIV and also significantly reduced plasma viral loads following intravenous pathogenic challenge with SIVMAC251/CX1. Findings The purpose of this study was to define cellular immunological correlates of protection in rSVV-SIV vaccinated and SIV challenged animals. Immunofluorescent staining and multifunctional assessment of SIV-specific T-cell responses were evaluated in both Experimental and Control vaccinated animal groups. Significant increases in the proliferating CD4+ T-cell population and polyfunctional T-cell responses were observed in all Experimental-vaccinated animals compared with the Control-vaccinated animals. Conclusions Increased CD4+ T-cell proliferation was significantly and inversely correlated with plasma viral load. Increased SIV-specific polyfunctional cytokine responses and increased proliferation of CD4+ T-cell may be crucial to control plasma viral loads in vaccinated and SIVMAC251/CX1 challenged macaques.

  14. Modeling and assessment of the response of super-light elements to fire

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Campeanu, B.M.; Giraudo, M.

    2013-01-01

    Due to the significant weight of the elements, which raise the construction and transportation costs and the CO2 production, concrete buildings may not meet the requirements for sustainable constructions. Furthermore, concrete is quite vulnerable to fire, as it undergoes a permanent degradation...... of its mechanical properties at temperatures commonly reached by structural elements during a fire in a building. As a consequence, several multi-story concrete buildings have collapsed or suffered major structural damages because of fire, and caused injuries and casualties among the occupants. Even...... in those cases, where a safe evacuation of the building is ensured, the high costs associated with the downtime and reparation of the building can be very high and not acceptable in the view of a safe and sustainable design of structures. In this respect, the newly patented building technology...

  15. Study of the Internal Mechanical response of an asphalt mixture by 3-D Discrete Element Modeling

    DEFF Research Database (Denmark)

    Feng, Huan; Pettinari, Matteo; Hofko, Bernhard

    2015-01-01

    and the reliability of which have been validated. The dynamic modulus of asphalt mixtures were predicted by conducting Discrete Element simulation under dynamic strain control loading. In order to reduce the calculation time, a method based on frequency–temperature superposition principle has been implemented......In this paper the viscoelastic behavior of asphalt mixture was investigated by employing a three-dimensional Discrete Element Method (DEM). The cylinder model was filled with cubic array of spheres with a specified radius, and was considered as a whole mixture with uniform contact properties....... The ball density effect on the internal stress distribution of the asphalt mixture model has been studied when using this method. Furthermore, the internal stresses under dynamic loading have been studied. The agreement between the predicted and the laboratory test results of the complex modulus shows...

  16. Interactions Between the Cytomegalovirus Promoter and the Estrogen Response Element: Implications for Design of Estrogen-Responsive Reporter Plasmids

    OpenAIRE

    Derecka, K.; Wang, C.K.; Flint, A.P.F.

    2006-01-01

    We aimed to produce an estrogen-responsive reporter plasmid that would permit monitoring of estrogen receptor function in the uterus in vivo. The plasmid pBL-tk-CAT(+)ERE was induced by estrogen in bovine endometrial stromal cells. When the CAT gene was replaced by the secreted alkaline phosphatase SeAP, the resulting construct pBL-tk-SeAP(+)ERE remained estrogen responsive. However when the tk promoter was replaced by the cytomegalovirus (cmv) promoter, the resulting plasmid (pBL-cmv-SeAP(+)...

  17. Transport of rare earth element-tagged soil particles in response to thunderstorm runoff.

    Science.gov (United States)

    Matisoff, G; Ketterer, M E; Wilson, C G; Layman, R; Whiting, P J

    2001-08-15

    The downslope transport of rare earth element-tagged soil particles remobilized during a spring thunderstorm was studied on both a natural prairie and an agricultural field in southwestern Iowa (U.S.A.). A technique was developed for tagging natural soils with the rare earth elements Eu, Tb, and Ho to approximately 1,000 ppm via coprecipitation with MnO2. Tagged material was replaced in target locations; surficial soil samples were collected following precipitation and runoff; and rare earth element concentrations were determined by inductively coupled plasma mass spectrometry. Diffusion and exponential models were applied to the concentration-distance data to determine particle transport distances. The results indicate that the concentration-distance data are well described by the diffusion model, butthe exponential model does not simulate the rapid drop-off in concentrations near the tagged source. Using the diffusion model, calculated particle transport distances at all hillside locations and at both the cultivated and natural prairie sites were short, ranging from 3 to 73 cm during this single runoff event. This study successfully demonstrates a new tool for studying soil erosion.

  18. Non Proliferation of Nuclear

    International Nuclear Information System (INIS)

    Bambang S Irawan

    2004-01-01

    Non-Proliferation Treaty of Nuclear Weapons is the international community's efforts to maintain the security of the world, in order to prevent the spread of nuclear technology and the use of nuclear weapons, promoting cooperation for the use of nuclear peaceful purposes, build mutual trust (Confidence Building Measures) as well as to achieve the ultimate goal of disarmament overall (General and Complete Disarmament). Addressing the post-WTC tragedy, 11 September 2001, the Indonesian government should set up a National Measures (National Action Plan), among others formed the National Security Council and NBC Counter Proliferation Unit, or the National Authority for Nuclear Treaty, preparing national legislation, to prevent the abuse nuclear materials for terrorist acts, prevent Illicit Trafficking of Nuclear materials, developed a National Preparedness and Emergency Response Management in the event of a nuclear accident or attack by the use of nuclear terrorism. Importance of a National Action Plan meant the existence of a national commitment in the context of compliance with treaties and conventions which have been ratified relating to safety, security, safeguards towards a general and complete disarmament, to safeguard national security and maintain peace (safeguards) international

  19. Geological occurrence response to trace elemental migration in coal liquefaction based on SPSS: take no. 11 coalbed in Antaibao mine for example

    Science.gov (United States)

    Xia, Xiaohong; Qin, Yong; Yang, Weifeng

    2013-03-01

    Coal liquefaction is an adoptable method to transfer the solid fossil energy into liquid oil in large scale, but the dirty material in which will migrate to different step of liquefaction. The migration rule of some trace elements is response to the react activity of macerals in coal and the geological occurrence of the element nature of itself. In this paper, from the SPSS data correlation analysis and hierarchical clustering dendrogram about the trace elements with macerals respond to coal liquefaction yield, it shows the trace elements in No.11 Antaibao coal seam originated from some of lithophile and sulphophle elements. Correlation coefficient between liquefaction yield of three organic macerals and migration of the elements in liquefaction residue indicated that the lithophile are easy to transfer to residue, while sulphophle are apt to in the liquid products. The activated macerals are response to sulphophle trace elements. The conclusion is useful to the coal blending and environmental effects on coal direct liquefaction.

  20. MYC cis-Elements in PsMPT Promoter Is Involved in Chilling Response of Paeonia suffruticosa.

    Directory of Open Access Journals (Sweden)

    Yuxi Zhang

    Full Text Available The MPT transports Pi to synthesize ATP. PsMPT, a chilling-induced gene, was previously reported to promote energy metabolism during bud dormancy release in tree peony. In this study, the regulatory elements of PsMPT promoter involved in chilling response were further analyzed. The PsMPT transcript was detected in different tree peony tissues and was highly expressed in the flower organs, including petal, stigma and stamen. An 1174 bp of the PsMPT promoter was isolated by TAIL-PCR, and the PsMPT promoter::GUS transgenic Arabidopsis was generated and analyzed. GUS staining and qPCR showed that the promoter was active in mainly the flower stigma and stamen. Moreover, it was found that the promoter activity was enhanced by chilling, NaCl, GA, ACC and NAA, but inhibited by ABA, mannitol and PEG. In transgenic plants harboring 421 bp of the PsMPT promoter, the GUS gene expression and the activity were significantly increased by chilling treatment. When the fragment from -421 to -408 containing a MYC cis-element was deleted, the chilling response could not be observed. Further mutation analysis confirmed that the MYC element was one of the key motifs responding to chilling in the PsMPT promoter. The present study provides useful information for further investigation of the regulatory mechanism of PsMPT during the endo-dormancy release.

  1. Adaptive response of arbuscular mycorrhizal symbiosis to accumulation of elements and translocation in Phragmites australis affected by cadmium stress.

    Science.gov (United States)

    Huang, Xiaochen; Ho, Shih-Hsin; Zhu, Shishu; Ma, Fang; Wu, Jieting; Yang, Jixian; Wang, Li

    2017-07-15

    Arbuscular mycorrhizal (AM) fungi have been reported to play a central role in improving plant tolerance to cadmium (Cd)-contaminated sites. This is achieved by enhancing both the growth of host plants and the nutritive elements in plants. This study assessed potential regulatory effects of AM symbiosis with regard to nutrient uptake and transport, and revealed different response strategies to various Cd concentrations. Phragmites australis was inoculated with Rhizophagus irregularis in the greenhouse cultivation system, where it was treated with 0-20 mg L -1 of Cd for 21days to investigate growth parameters, as well as Cd and nutritive element distribution in response to AM fungus inoculation. Mycorrhizal plants showed a higher tolerance, particularly under high Cd-level stress in the substrate. Moreover, our results determined the roots as dominant Cd reservoirs in plants. The AM fungus improved Cd accumulation and saturated concentration in the roots, thus inhibiting Cd uptake to shoots. The observed distributions of nutritive elements and the interactions among these indicated the highest microelement contribution to roots, Ca contributed maximally in leaves, and K and P contributed similarly under Cd stress. In addition, AM fungus inoculation effectively impacted Mn and P uptake and accumulation while coping with Cd toxicity. This study also demonstrated translocation factor from metal concentration (TF) could be a good parameter to evaluate different transportation strategies induced by various Cd stresses in contrast to the bioconcentration factor (BCF) and translocation factor from metal accumulation (TF'). Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    Science.gov (United States)

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  3. The threat of proliferation

    International Nuclear Information System (INIS)

    Palme, Olof.

    1986-01-01

    The paper on the threat of proliferation, is a keynote speech delivered to the Colloquium on Nuclear War, Nuclear Proliferation and their Consequences, Geneva, 1985. Topics discussed in the address include: nuclear weapons, nuclear war, terrorists, Non-Proliferation Treaty, nuclear disarmament, and leadership in world affairs. (UK)

  4. A peroxisome proliferator-activated receptor ligand MCC-555 imparts anti-proliferative response in pancreatic cancer cells by PPARgamma-independent up-regulation of KLF4

    Energy Technology Data Exchange (ETDEWEB)

    Min, Kyung-Won [Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996 (United States); Zhang, Xiaobo [Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996 (United States); College of Animal Science and Technology, Northwest A and F University, Yangling, Shaanxi, 712100 (China); Imchen, Temjenmongla [Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996 (United States); Baek, Seung Joon, E-mail: sbaek2@utk.edu [Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville, TN 37996 (United States)

    2012-09-01

    MCC-555 is a novel PPARα/γ dual ligand of the thiazolidinedione class and was recently developed as an anti-diabetic drug with unique properties. MCC-555 also has anti-proliferative activity through growth inhibition and apoptosis induction in several cancer cell types. Our group has shown that MCC-555 targets several proteins in colorectal tumorigenesis including nonsteroidal anti-inflammatory drug (NSAID)-activated gene (NAG-1) which plays an important role in chemoprevention responsible for chemopreventive compounds. NAG-1 is a member of the TGF-β superfamily and is involved in tumor progression and development; however, NAG-1's roles in pancreatic cancer have not been studied. In this report, we found that MCC-555 alters not only NAG-1 expression, but also p21 and cyclin D1 expression. NAG-1 and p21 expression was not blocked by PPARγ-specific antagonist GW9662, suggesting that MCC-555-induced NAG-1 and p21 expression is independent of PPARγ activation. However, decreasing cyclin D1 by MCC-555 seems to be affected by PPARγ activation. Further, we found that the GC box located in the NAG-1 promoter play an important role in NAG-1 transactivation by MCC-555. Subsequently, we screened several transcription factors that may bind to the GC box region in the NAG-1 promoter and found that KLF4 potentially binds to this region. Expression of KLF4 precedes NAG-1 and p21 expression in the presence of MCC-555, whereas blocking KLF4 expression using specific KLF4 siRNA showed that both NAG-1 and p21 expression by MCC-555 was blocked. In conclusion, MCC-555's actions on anti-proliferation involve both PPARγ-dependent and -independent pathways, thereby enhancing anti-tumorigenesis in pancreatic cancer cells. -- Highlights: ► PPARα/γ ligand MCC-555 exhibits anti-proliferative activity in pancreatic cancer cells. ► MCC-555 affects KLF4 expression following by NAG-1 and p21 expression in a PPARγ independent manner. ► MCC-555 also affects cyclin D1 down

  5. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    International Nuclear Information System (INIS)

    Pavlikova, Nela; Kortner, Trond M.; Arukwe, Augustine

    2010-01-01

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 μg/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-α (ERα), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPARα, PPARβ and PPARγ mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ERα mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ERα mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly and also in combination. GST mRNA was

  6. A peroxisome proliferator-activated receptor ligand MCC-555 imparts anti-proliferative response in pancreatic cancer cells by PPARgamma-independent up-regulation of KLF4

    International Nuclear Information System (INIS)

    Min, Kyung-Won; Zhang, Xiaobo; Imchen, Temjenmongla; Baek, Seung Joon

    2012-01-01

    MCC-555 is a novel PPARα/γ dual ligand of the thiazolidinedione class and was recently developed as an anti-diabetic drug with unique properties. MCC-555 also has anti-proliferative activity through growth inhibition and apoptosis induction in several cancer cell types. Our group has shown that MCC-555 targets several proteins in colorectal tumorigenesis including nonsteroidal anti-inflammatory drug (NSAID)-activated gene (NAG-1) which plays an important role in chemoprevention responsible for chemopreventive compounds. NAG-1 is a member of the TGF-β superfamily and is involved in tumor progression and development; however, NAG-1's roles in pancreatic cancer have not been studied. In this report, we found that MCC-555 alters not only NAG-1 expression, but also p21 and cyclin D1 expression. NAG-1 and p21 expression was not blocked by PPARγ-specific antagonist GW9662, suggesting that MCC-555-induced NAG-1 and p21 expression is independent of PPARγ activation. However, decreasing cyclin D1 by MCC-555 seems to be affected by PPARγ activation. Further, we found that the GC box located in the NAG-1 promoter play an important role in NAG-1 transactivation by MCC-555. Subsequently, we screened several transcription factors that may bind to the GC box region in the NAG-1 promoter and found that KLF4 potentially binds to this region. Expression of KLF4 precedes NAG-1 and p21 expression in the presence of MCC-555, whereas blocking KLF4 expression using specific KLF4 siRNA showed that both NAG-1 and p21 expression by MCC-555 was blocked. In conclusion, MCC-555's actions on anti-proliferation involve both PPARγ-dependent and -independent pathways, thereby enhancing anti-tumorigenesis in pancreatic cancer cells. -- Highlights: ► PPARα/γ ligand MCC-555 exhibits anti-proliferative activity in pancreatic cancer cells. ► MCC-555 affects KLF4 expression following by NAG-1 and p21 expression in a PPARγ independent manner. ► MCC-555 also affects cyclin D1 down

  7. Activation of the carbohydrate response element binding protein (ChREBP) in response to anoxia in the turtle Trachemys scripta elegans.

    Science.gov (United States)

    Krivoruchko, Anastasia; Storey, Kenneth B

    2014-10-01

    ChREBP (carbohydrate response element binding protein) is a glucose-responsive transcription factor that is known to be an important regulator of glycolytic and lipogenic genes in response to glucose. We hypothesized that activation of ChREBP could be relevant to anoxia survival by the anoxia-tolerant turtle, Trachemys scripta elegans. Expression of ChREBP in response to 5 and 20h of anoxia was examined using RT-PCR and Western immunoblotting. In addition, subcellular localization and DNA-binding activity of ChREBP protein were assessed and transcript levels of liver pyruvate kinase (LPK), a downstream gene under ChREBP control were quantified using RT-PCR. ChREBP was anoxia-responsive in kidney and liver, with transcript levels increasing by 1.2-1.8 fold in response to anoxia and protein levels increasing by 1.8-1.9 fold. Enhanced nuclear presence under anoxia was also observed in both tissues by 2.2-2.8 fold. A 4.2 fold increase in DNA binding activity of ChREBP was also observed in liver in response to 5h of anoxia. In addition, transcript levels of LPK increased by 2.1 fold in response to 5h of anoxia in the liver. The results suggest that activation of ChREBP in response to anoxia might be a crucial factor for anoxia survival in turtle liver by contributing to elevated glycolytic flux in the initial phases of oxygen limitation. This study provides the first demonstration of activation of ChREBP in response to anoxia in a natural model of anoxia tolerance, further improving our understanding of the molecular nature of anoxia tolerance. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Seismic response of three-dimensional topographies using a time-domain boundary element method

    Science.gov (United States)

    Janod, François; Coutant, Olivier

    2000-08-01

    We present a time-domain implementation for a boundary element method (BEM) to compute the diffraction of seismic waves by 3-D topographies overlying a homogeneous half-space. This implementation is chosen to overcome the memory limitations arising when solving the boundary conditions with a frequency-domain approach. This formulation is flexible because it allows one to make an adaptive use of the Green's function time translation properties: the boundary conditions solving scheme can be chosen as a trade-off between memory and cpu requirements. We explore here an explicit method of solution that requires little memory but a high cpu cost in order to run on a workstation computer. We obtain good results with four points per minimum wavelength discretization for various topographies and plane wave excitations. This implementation can be used for two different aims: the time-domain approach allows an easier implementation of the BEM in hybrid methods (e.g. coupling with finite differences), and it also allows one to run simple BEM models with reasonable computer requirements. In order to keep reasonable computation times, we do not introduce any interface and we only consider homogeneous models. Results are shown for different configurations: an explosion near a flat free surface, a plane wave vertically incident on a Gaussian hill and on a hemispherical cavity, and an explosion point below the surface of a Gaussian hill. Comparison is made with other numerical methods, such as finite difference methods (FDMs) and spectral elements.

  9. Nuclear receptor corepressor-dependent repression of peroxisome-proliferator-activated receptor delta-mediated transactivation

    DEFF Research Database (Denmark)

    Krogsdam, Anne-M; Nielsen, Curt A F; Neve, Søren

    2002-01-01

    delta-RXR alpha heterodimer bound to an acyl-CoA oxidase (ACO)-type peroxisome-proliferator response element recruited a glutathione S-transferase-NCoR fusion protein in a ligand-independent manner. Contrasting with most other nuclear receptors, PPAR delta was found to interact equally well......The nuclear receptor corepressor (NCoR) was isolated as a peroxisome-proliferator-activated receptor (PPAR) delta interacting protein using the yeast two-hybrid system. NCoR interacted strongly with the ligand-binding domain of PPAR delta, whereas interactions with the ligand-binding domains...

  10. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  11. Quality assessment of structure and language elements of written responses given by seven Scandinavian drug information centres

    DEFF Research Database (Denmark)

    Reppe, Linda Amundstuen; Spigset, Olav; Kampmann, Jens Peter

    2017-01-01

    PURPOSE: The aim of this study was to identify structure and language elements affecting the quality of responses from Scandinavian drug information centres (DICs). METHODS: Six different fictitious drug-related queries were sent to each of seven Scandinavian DICs. The centres were blinded for wh...... on drug-related queries with respect to language and text structure. Giving specific advice and precise conclusions and avoiding too compressed language and non-standard abbreviations may aid to reach this goal....... of responses was generally judged as satisfactory to good. Presenting specific advice and conclusions were considered to improve the quality of the responses. However, small nuances in language formulations could affect the individual judgments of the experts, e.g. on whether or not advice was given. Some...... and explaining pharmacological terms to ensure that enquirers understand the response as intended. In addition, more use of active voice and less compressed text structure would be desirable. CONCLUSIONS: This evaluation of responses to DIC queries may give some indications on how to improve written responses...

  12. Enrichment of conserved synaptic activity-responsive element in neuronal genes predicts a coordinated response of MEF2, CREB and SRF.

    Directory of Open Access Journals (Sweden)

    Fernanda M Rodríguez-Tornos

    Full Text Available A unique synaptic activity-responsive element (SARE sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein. Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease.

  13. Differential regulation of the human progesterone receptor gene through an estrogen response element half site and Sp1 sites.

    Science.gov (United States)

    Petz, Larry N; Ziegler, Yvonne S; Schultz, Jennifer R; Kim, Hwajin; Kemper, J Kim; Nardulli, Ann M

    2004-02-01

    The progesterone receptor (PR) gene is regulated by estrogen in normal reproductive tissues and in MCF-7 human breast cancer cells. Although it is generally thought that estrogen responsiveness is mediated by interaction of the ligand-occupied estrogen receptor (ER) with estrogen response elements (EREs) in target genes, the human progesterone receptor (PR) gene lacks a palindromic ERE. Promoter A of the PR gene does, however, contain an ERE half site upstream of two adjacent Sp1 sites from +571 to +595, the +571 ERE/Sp1 site. We have examined the individual contributions of the ERE half site and the two Sp1 sites in regulating estrogen responsiveness. Transient transfection assays demonstrated that both Sp1 sites were critical for estrogen-mediated activation of the PR gene. Interestingly, rather than decreasing transcription, mutations in the ERE half site increased transcription substantially suggesting that this site plays a role in limiting transcription. Chromatin immunoprecipitation assays demonstrated that Sp1 was associated with the +571 ERE/Sp1 site in the endogenous PR gene in the absence and in the presence of estrogen, but that ERalpha was only associated with this region of the PR gene after MCF-7 cells had been treated with estrogen. Our studies provide evidence that effective regulation of transcription through the +571 ERE/Sp1 site requires the binding of ERalpha and Sp1 to their respective cis elements and the appropriate interaction of ERalpha and Sp1 with other coregulatory proteins and transcription factors.

  14. RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.

    Science.gov (United States)

    Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook

    2017-08-01

    Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].

  15. Development of electrochemical reporter assay using HeLa cells transfected with vector plasmids encoding various responsive elements

    Energy Technology Data Exchange (ETDEWEB)

    Shiku, Hitoshi, E-mail: shiku@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Takeda, Michiaki; Murata, Tatsuya [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan); Akiba, Uichi; Hamada, Fumio [Graduate School of Engineering and Resource Science, Akita University, 1-1 Tegata gakuen-machi, Akita 010-8502 (Japan); Matsue, Tomokazu, E-mail: matsue@bioinfo.che.tohoku.ac.jp [Graduate School of Environmental Studies, Tohoku University, 6-6-11-604 Aramaki-Aoba, Sendai 980-8579 (Japan)

    2009-04-27

    Electrochemical assay using HeLa cell lines transfected with various plasmid vectors encoding SEAP (secreted alkaline phosphatase) as the reporter has been performed by using SECM (scanning electrochemical microscopy). The plasmid vector contains different responsive elements that include GRE (glucocorticoid response elements), CRE (cAMP responsive elements), or {kappa}B (binding site for NF{kappa}B (nuclear factor kappa B)) upstream of the SEAP sequence. The transfected HeLa cells were patterned on a culture dish in a 4 x 4 array of circles of diameter 300 {mu}m by using the PDMS (poly(dimethylsiloxane)) stencil technique. The cellular array was first exposed to 100 ng mL{sup -1} dexamethasone, 10 ng mL{sup -1} forskolin, or 100 ng mL{sup -1} TNF-{alpha} (tumor necrosis factor {alpha}) after which it was further cultured in an RPMI culture medium for 6 h. After incubation, the cellular array was soaked in a measuring solution containing 4.7 mM PAPP (p-aminophenylphosphate) at pH 9.5, following which electrochemical measurements were performed immediately within 40 min. The SECM method allows parallel evaluation of different cell lines transfected with pGRE-SEAP, pCRE-SEAP, and pNF{kappa}B-SEAP patterned on the same solid support for detection of the oxidation current of PAP (p-aminophenol) flux produced from only 300 HeLa cells in each stencil pattern. The results of the SECM method were highly sensitive as compared to those obtained from the conventional CL (chemiluminescence) protocol with at least 5 x 10{sup 4} cells per well.

  16. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    Science.gov (United States)

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

  17. Regulation of CYP3A4 by pregnane X receptor: The role of nuclear receptors competing for response element binding

    Energy Technology Data Exchange (ETDEWEB)

    Istrate, Monica A., E-mail: monicai@scripps.edu [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Nussler, Andreas K., E-mail: nuessler@uchir.me.tum.de [Department of Traumatology, Technical University Munich, Ismaningerstr. 22, 81675 Munich (Germany); Eichelbaum, Michel, E-mail: michel.eichelbaum@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany); Burk, Oliver, E-mail: oliver.burk@ikp-stuttgart.de [Dr. Margarete Fischer-Bosch-Institute of Clinical Pharmacology, Stuttgart, Germany, and University of Tuebingen, Auerbachstr. 112, D-70376 Stuttgart (Germany)

    2010-03-19

    Induction of the major drug metabolizing enzyme CYP3A4 by xenobiotics contributes to the pronounced interindividual variability of its expression and often results in clinically relevant drug-drug interactions. It is mainly mediated by PXR, which regulates CYP3A4 expression by binding to several specific elements in the 5' upstream regulatory region of the gene. Induction itself shows a marked interindividual variability, whose underlying determinants are only partly understood. In this study, we investigated the role of nuclear receptor binding to PXR response elements in CYP3A4, as a potential non-genetic mechanism contributing to interindividual variability of induction. By in vitro DNA binding experiments, we showed that several nuclear receptors bind efficiently to the proximal promoter ER6 and distal xenobiotic-responsive enhancer module DR3 motifs. TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII further demonstrated dose-dependent repression of PXR-mediated CYP3A4 enhancer/promoter reporter activity in transient transfection in the presence and absence of the PXR inducer rifampin, while VDR showed this effect only in the absence of treatment. By combining functional in vitro characterization with hepatic expression analysis, we predict that TR{alpha}1, TR{beta}1, COUP-TFI, and COUP-TFII show a strong potential for the repression of PXR-mediated activation of CYP3A4 in vivo. In summary, our results demonstrate that nuclear receptor binding to PXR response elements interferes with PXR-mediated expression and induction of CYP3A4 and thereby contributes to the interindividual variability of induction.

  18. Fissile material proliferation risk

    International Nuclear Information System (INIS)

    Dreicer, J.S.; Rutherford, D.A.

    1996-01-01

    The proliferation risk of a facility depends on the material attractiveness, level of safeguards, and physical protection applied to the material in conjunction with an assessment of the impact of the socioeconomic circumstances and threat environment. Proliferation risk is a complementary extension of proliferation resistance. The authors believe a better determination of nuclear proliferation can be achieved by establishing the proliferation risk for facilities that contain nuclear material. Developing a method that incorporates the socioeconomic circumstances and threat environment inherent to each country enables a global proliferation assessment. To effectively reduce the nuclear danger, a broadly based set of criteria is needed that provides the capability to relatively assess a wide range of nuclear related sites and facilities in different countries and still ensure a global decrease in proliferation risk for fissile material (plutonium and highly enriched uranium)

  19. Non-linear finite element analysis for prediction of seismic response of buildings considering soil-structure interaction

    Directory of Open Access Journals (Sweden)

    E. Çelebi

    2012-11-01

    Full Text Available The objective of this paper focuses primarily on the numerical approach based on two-dimensional (2-D finite element method for analysis of the seismic response of infinite soil-structure interaction (SSI system. This study is performed by a series of different scenarios that involved comprehensive parametric analyses including the effects of realistic material properties of the underlying soil on the structural response quantities. Viscous artificial boundaries, simulating the process of wave transmission along the truncated interface of the semi-infinite space, are adopted in the non-linear finite element formulation in the time domain along with Newmark's integration. The slenderness ratio of the superstructure and the local soil conditions as well as the characteristics of input excitations are important parameters for the numerical simulation in this research. The mechanical behavior of the underlying soil medium considered in this prediction model is simulated by an undrained elasto-plastic Mohr-Coulomb model under plane-strain conditions. To emphasize the important findings of this type of problems to civil engineers, systematic calculations with different controlling parameters are accomplished to evaluate directly the structural response of the vibrating soil-structure system. When the underlying soil becomes stiffer, the frequency content of the seismic motion has a major role in altering the seismic response. The sudden increase of the dynamic response is more pronounced for resonance case, when the frequency content of the seismic ground motion is close to that of the SSI system. The SSI effects under different seismic inputs are different for all considered soil conditions and structural types.

  20. Nuclear factor erythroid 2-related factor 2 antioxidant response element pathways protect bovine mammary epithelial cells against H2O2-induced oxidative damage in vitro.

    Science.gov (United States)

    Ma, Y F; Wu, Z H; Gao, M; Loor, J J

    2018-03-21

    The experiment was conducted to determine the role of nuclear factor (erythroid-derived 2)-like factor 2 (NFE2L2, formerly Nrf2) antioxidant response element (ARE) pathway in protecting bovine mammary epithelial cells (BMEC) against H 2 O 2 -induced oxidative stress injury. An NFE2L2 small interfering RNA (siRNA) interference or a pCMV6-XL5-NFE2L2 plasmid fragment was transfected to independently downregulate or upregulate expression of NFE2L2. Isolated BMEC in triplicate were exposed to H 2 O 2 (600 μM) for 6 h to induce oxidative stress before transient transfection with scrambled siRNA, NFE2L2-siRNA, pCMV6-XL5, and pCMV6-XL5-NFE2L2. Cell proliferation, apoptosis and necrosis rates, antioxidant enzyme activities, reactive oxygen species (ROS) and malondialdehyde (MDA) production, protein and mRNA expression of NFE2L2 and downstream target genes, and fluorescence activity of ARE were measured. The results revealed that compared with the control, BMEC transfected with NFE2L2-siRNA3 had proliferation rates that were 9 or 65% lower without or with H 2 O 2 , respectively. These cells also had apoptosis and necrosis rates that were 27 and 3.5 times greater with H 2 O 2 compared with the control group, respectively. In contrast, transfected pCMV6-XL5-NFE2L2 had proliferation rates that were 64.3% greater or 17% lower without or with H 2 O 2 compared with the control group, respectively. Apoptosis rates were 1.8 times lower with H 2 O 2 compared with the control. In addition, compared with the control, production of ROS and MDA and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), catalase (CAT), and glutathione-S-transferase (GST) increased markedly in cells transfected with pCMV6-XL5-NFE2L2 and without H 2 O 2 . However, compared with the control, production of ROS and MDA and activity of CAT and GSH-Px increased markedly, whereas activities of SOD and GST decreased in cells transfected with pCMV6-XL5-NFE2L2 and incubated with H 2 O 2

  1. Identification of hookworm DAF-16/FOXO response elements and direct gene targets.

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2010-08-01

    Full Text Available The infective stage of the parasitic nematode hookworm is developmentally arrested in the environment and needs to infect a specific host to complete its life cycle. The canine hookworm (Ancylostoma caninum is an excellent model for investigating human hookworm infections. The transcription factor of A. caninum, Ac-DAF-16, which has a characteristic fork head or "winged helix" DNA binding domain (DBD, has been implicated in the resumption of hookworm development in the host. However, the precise roles of Ac-DAF-16 in hookworm parasitism and its downstream targets are unknown. In the present study, we combined molecular techniques and bioinformatics to identify a group of Ac-DAF-16 binding sites and target genes.The DNA binding domain of Ac-DAF-16 was used to select genomic fragments by in vitro genomic selection. Twenty four bound genomic fragments were analyzed for the presence of the DAF-16 family binding element (DBE and possible alternative Ac-DAF-16 bind motifs. The 22 genes linked to these genomic fragments were identified using bioinformatics tools and defined as candidate direct gene targets of Ac-DAF-16. Their developmental stage-specific expression patterns were examined. Also, a new putative DAF-16 binding element was identified.Our results show that Ac-DAF-16 is involved in diverse biological processes throughout hookworm development. Further investigation of these target genes will provide insights into the molecular basis by which Ac-DAF-16 regulates its downstream gene network in hookworm infection.

  2. Skeletal response to maxillary protraction with and without maxillary expansion: a finite element study.

    Science.gov (United States)

    Gautam, Pawan; Valiathan, Ashima; Adhikari, Raviraj

    2009-06-01

    The purpose of this finite element study was to evaluate biomechanically 2 treatment modalities-maxillary protraction alone and in combination with maxillary expansion-by comparing the displacement of various craniofacial structures. Two 3-dimensional analytical models were developed from sequential computed tomography scan images taken at 2.5-mm intervals of a dry young skull. AutoCAD software (2004 version, Autodesk, San Rafael, Calif) and ANSYS software (version 10, Belcan Engineering Group, Cincinnati, Ohio) were used. The model consisted of 108,799 solid 10 node 92 elements, 193,633 nodes, and 580,899 degrees of freedom. In the first model, maxillary protraction forces were simulated by applying 1 kg of anterior force 30 degrees downward to the palatal plane. In the second model, a 4-mm midpalatal suture opening and maxillary protraction were simulated. Forward displacement of the nasomaxillary complex with upward and forward rotation was observed with maxillary protraction alone. No rotational tendency was noted when protraction was carried out with 4 mm of transverse expansion. A tendency for anterior maxillary constriction after maxillary protraction was evident. The amounts of displacement in the frontal, vertical, and lateral directions with midpalatal suture opening were greater compared with no opening of the midpalatal suture. The forward and downward displacements of the nasomaxillary complex with maxillary protraction and maxillary expansion more closely approximated the natural growth direction of the maxilla. Displacements of craniofacial structures were more favorable for the treatment of skeletal Class III maxillary retrognathia when maxillary protraction was used with maxillary expansion. Hence, biomechanically, maxillary protraction combined with maxillary expansion appears to be a superior treatment modality for the treatment of maxillary retrognathia than maxillary protraction alone.

  3. Assisting the development of innovative responsive façade elements using building performance simulation

    NARCIS (Netherlands)

    de Klijn-Chevalerias, M.L.; Loonen, R.C.G.M.; Zarzycka, A.; de Witte, D.; Sarakinioti, M.V.; Hensen, JLM; Turrin, Michela; Peters, Brady; O'Brien, William; Stouffs, Rudi; Dogan, Timur

    2017-01-01

    Thermal mass is usually positively associated with energy efficiency and thermal comfort in buildings. However, the slow response of heavyweight constructions is not beneficial at all times, as these dynamic effects may actually also increase heating and cooling energy demand during intermittent

  4. The effect of tibia element on the tibia response due to impact loading

    CSIR Research Space (South Africa)

    Pandelani, T

    2014-10-01

    Full Text Available , specifically for anti-vehicular mine blast scenarios. The aim of this study was to assess under impact loading to ensure that it represents the natural lower leg response. Axial impact loads were applied to the MIL-Lx at impact velocities of 2.7 to 10.2 m...

  5. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    Science.gov (United States)

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  6. CD80 and CD86 Costimulatory Molecules Differentially Regulate OT-II CD4+ T Lymphocyte Proliferation and Cytokine Response in Cocultures with Antigen-Presenting Cells Derived from Pregnant and Pseudopregnant Mice

    Directory of Open Access Journals (Sweden)

    Tomasz Maj

    2014-01-01

    Full Text Available Immune phenomena during the preimplantation period of pregnancy are poorly understood. The aim of our study was to assess the capacity for antigen presentation of splenic antigen-presenting cells (APCs derived from pregnant and pseudopregnant mice in in vitro conditions. Therefore, sorted CD11c+ dendritic cells and macrophages F4/80+ and CD11b+ presenting ovalbumin (OVA were cocultured with CD4+ T cells derived from OT-II mice’s (C57BL6/J-Tg(TcraTcrb1100Mjb/J spleen. After 132 hours of cell culture, proliferation of lymphocytes (ELISA-BrdU, activation of these cells (flow cytometry, cytokine profile (ELISA, and influence of costimulatory molecules blocking on these parameters were measured. We did not detect any differences in regulation of Th1/Th2 cytokine balance. CD86 seems to be the main costimulatory molecule involved in the proliferation response but CD80 is the main costimulatory molecule influencing cytokine secretion in pregnant mice. In conclusion, this study showed that CD80 and CD86 costimulatory molecules regulate OT-II CD4+ T lymphocyte proliferation and cytokine response in cocultures with antigen-presenting cells derived from pregnant and pseudopregnant mice. The implications of these changes still remain unclear.

  7. Reactor elements properties response during a postulated loss-of-coolant accident (LOCA)

    International Nuclear Information System (INIS)

    Ahmed, E.E.; Rahman, F.A.

    1985-01-01

    Four computer algorithms have been introduced to solve for the reactor different materials response subjected to LOCA conditions, they were developed with the intent of producing a simple, accurate and efficient prediction schemes. A general overview of the solution procedures design and working of each of four algorithms are presented, followed by short description of the nature of solution and calculated results. These algorithms are: 1. ZIRCP to give the cladding material properties response under normal and transient conditions. 2. FCGAPP to give the fuel- cladding gas-gap conductivity. 3. NFUEIP to solve the temperature dependent of nuclear fuel properties during normal and transient conditions. 4. TSDATP has been developed to solve for the thermodynamic and transport properties of water and steam over a large range of temperature and pressure. 14 fig

  8. Distinctly different dynamics and kinetics of two steroid receptors at the same response elements in living cells.

    Directory of Open Access Journals (Sweden)

    Hatice Z Nenseth

    Full Text Available Closely related transcription factors (TFs can bind to the same response elements (REs with similar affinities and activate transcription. However, it is unknown whether transcription is similarly orchestrated by different TFs bound at the same RE. Here we have compared the recovery half time (t1/2, binding site occupancy and the resulting temporal changes in transcription upon binding of two closely related steroid receptors, the androgen and glucocorticoid receptors (AR and GR, to their common hormone REs (HREs. We show that there are significant differences at all of these levels between AR and GR at the MMTV HRE when activated by their ligands. These data show that two TFs bound at the same RE can have significantly different modes of action that can affect their responses to environmental cues.

  9. Growth and Tissue Elemental Composition Response of Butterhead Lettuce (Lactuca sativa, cv. Flandria to Hydroponic and Aquaponic Conditions

    Directory of Open Access Journals (Sweden)

    Tyler S. Anderson

    2017-07-01

    Full Text Available The primary objective of this research was to compare lettuce performance under conventional hydroponics at pH 5.8 (referred to as H5, hydroponics at pH 7.0 (referred to as H7, and recirculated aquaponic water at pH 7.0 (referred to as A7. Aquaponic nutrients were supplied by continuously recirculating water between a fish rearing system (recirculating aquaculture system or RAS and the lettuce growing system (with the sole addition being chelated iron. This paper builds upon our previous research where we found that H7 produced 26% less shoot fresh weight (FW growth than H5 and an 18% reduction in dry weight (DW. In this research, we also evaluated the inorganic hydroponics nutrient solution at pH 7.0 (H7 to provide continuity between experiments and to isolate the pH effect. The A7 plant biomass responses were not different from H5 in all biomass response categories. H7 was different from H5 in shoot FW, DW, and DW/FW, as well as root FW and DW. H7 was different from the A7 in shoot FW, DW/FW, and root DW. There were no tissue elemental differences between H5 and H7 except Cu. The Ca and Na contents differed between H5 and A7, while the microelements Mn, Mo, and Zn differed. Generally, the elemental tissue differences between treatments were proportional to the differences for the same elements in the nutrient solutions. Aquaponic systems are often viewed to be more complicated and more risky because two complex systems are being joined (hydroponics plus RAS. However, the aquaponics system proved to be surprisingly simple to manage in daily operations. Our data suggested that the aquaponics system (A7, which was operated at a higher pH 7.0, was able to offset any negative biomass and elemental effects that occurred in the inorganic hydroponic pH 7.0 treatment (H7 from its increased pH and less optimized nutrient solution elemental concentrations.

  10. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  11. Micoses superficiais e os elementos da resposta imune Superficial mycosis and the immune response elements

    Directory of Open Access Journals (Sweden)

    Paulo Ricardo Criado

    2011-08-01

    Full Text Available As micoses superficiais são prevalentes em todo o mundo, geralmente ocasionadas por dermatófitos e restritas à camada córnea. A resposta imunológica do hospedeiro às infecções dos fungos dermatófitos depende basicamente das defesas do hospedeiro a metabólitos do fungo, da virulência da cepa ou da espécie infectante e da localização anatômica da infecção. Serão revistos alguns dos fatores da defesa imunológica do hospedeiro que influenciam na eficácia da resposta imune. Em especial, a participação dos receptores de padrão de reconhecimento (PRRs, tais como os receptores toll-like ou os da família lectina (DC-SIGN e dectin-2, que participam da resposta imune inata, conferindo-lhe especificidade e definindo o padrão da resposta imune como um todo. O predomínio celular ou humoral da resposta imune definirá o quadro clínico e o prognóstico da infecção, levando à cura ou cronicidadeSuperficial mycoses are prevalent worldwide. They are often caused by dermatophytes and restricted to the stratum corneum. The host's immune response against infections caused by dermatophytes basically depends on the host's defense against metabolites of the fungi, virulence of the infecting strain or species and anatomical site of the infection. We will review some of the factors of the host's immune defense that influence the efficacy of the immune response. We will particularly review the role of pattern recognition receptors (PRRs, such as toll-like receptors or lectin receptors (DCSIGN and Dectin 2, which participate in the innate immune response, bringing specificity to the immune response and setting its pattern. The predominance of a cellular or humoral immune response determines the clinical manifestations and the prognosis of the infection, leading to healing or chronicity

  12. An Image-Based Finite Element Approach for Simulating Viscoelastic Response of Asphalt Mixture

    Directory of Open Access Journals (Sweden)

    Wenke Huang

    2016-01-01

    Full Text Available This paper presents an image-based micromechanical modeling approach to predict the viscoelastic behavior of asphalt mixture. An improved image analysis technique based on the OTSU thresholding operation was employed to reduce the beam hardening effect in X-ray CT images. We developed a voxel-based 3D digital reconstruction model of asphalt mixture with the CT images after being processed. In this 3D model, the aggregate phase and air void were considered as elastic materials while the asphalt mastic phase was considered as linear viscoelastic material. The viscoelastic constitutive model of asphalt mastic was implemented in a finite element code using the ABAQUS user material subroutine (UMAT. An experimental procedure for determining the parameters of the viscoelastic constitutive model at a given temperature was proposed. To examine the capability of the model and the accuracy of the parameter, comparisons between the numerical predictions and the observed laboratory results of bending and compression tests were conducted. Finally, the verified digital sample of asphalt mixture was used to predict the asphalt mixture viscoelastic behavior under dynamic loading and creep-recovery loading. Simulation results showed that the presented image-based digital sample may be appropriate for predicting the mechanical behavior of asphalt mixture when all the mechanical properties for different phases became available.

  13. Ethylene Inhibits Cell Proliferation of the Arabidopsis Root Meristem1[OPEN

    Science.gov (United States)

    Street, Ian H.; Aman, Sitwat; Zubo, Yan; Ramzan, Aleena; Wang, Xiaomin; Shakeel, Samina N.; Kieber, Joseph J.; Schaller, G. Eric

    2015-01-01

    The root system of plants plays a critical role in plant growth and survival, with root growth being dependent on both cell proliferation and cell elongation. Multiple phytohormones interact to control root growth, including ethylene, which is primarily known for its role in controlling root cell elongation. We find that ethylene also negatively regulates cell proliferation at the root meristem of Arabidopsis (Arabidopsis thaliana). Genetic analysis indicates that the inhibition of cell proliferation involves two pathways operating downstream of the ethylene receptors. The major pathway is the canonical ethylene signal transduction pathway that incorporates CONSTITUTIVE TRIPLE RESPONSE1, ETHYLENE INSENSITIVE2, and the ETHYLENE INSENSITIVE3 family of transcription factors. The secondary pathway is a phosphorelay based on genetic analysis of receptor histidine kinase activity and mutants involving the type B response regulators. Analysis of ethylene-dependent gene expression and genetic analysis supports SHORT HYPOCOTYL2, a repressor of auxin signaling, as one mediator of the ethylene response and furthermore, indicates that SHORT HYPOCOTYL2 is a point of convergence for both ethylene and cytokinin in negatively regulating cell proliferation. Additional analysis indicates that ethylene signaling contributes but is not required for cytokinin to inhibit activity of the root meristem. These results identify key elements, along with points of cross talk with cytokinin and auxin, by which ethylene negatively regulates cell proliferation at the root apical meristem. PMID:26149574

  14. Peroxisome proliferator-activated receptors, estrogenic responses and biotransformation system in the liver of salmon exposed to tributyltin and second messenger activator

    Energy Technology Data Exchange (ETDEWEB)

    Pavlikova, Nela [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); RECETOX Research Centre for Environmental Chemistry and Ecotoxicology, Masaryk University, Kamenice 3, CZ62500 Brno (Czech Republic); Kortner, Trond M. [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway); Arukwe, Augustine, E-mail: arukwe@bio.ntnu.no [Department of Biology, Norwegian University of Science and Technology (NTNU), Hogskoleringen 5, 7491 Trondheim (Norway)

    2010-08-15

    The mechanisms by which organotin compounds produce modulations of the endocrine systems and other biological responses are not fully understood. In this study, juvenile salmon were force-fed diet containing TBT (0: solvent control, 0.1, 1 and 10 mg/kg fish) for 72 h. Subsequently, fish exposed to solvent control and 10 mg TBT were exposed to waterborne concentration (200 {mu}g/l) of the adenylate cyclase (AC) stimulator, forskolin for 2 and 4 h. The overall aim of the study was to explore whether TBT endocrine disruptive effects involve second messenger activation. Liver was sampled from individual fish (n = 8) at the end of the exposures. The transcription patterns of peroxisome proliferator-activated receptor (PPAR) isotype and acyl-coenzyme A oxidase 1 (ACOX1), aromatase isoform, estrogen receptor-{alpha} (ER{alpha}), pregnane X receptor (PXR), CYP3A and glutathione S-transferase (GST) genes were measured by quantitative polymerase chain reaction (qPCR). Our data showed a consistent increase in PPAR{alpha}, PPAR{beta} and PPAR{gamma} mRNA and protein expression after TBT exposure that were inversely correlated with ACOX1 mRNA levels. Forskolin produced PPAR isotype-specific mRNA and protein effects that were modulated by TBT. ACOX1 expression was decreased (at 2 h) and increased (at 4 h) by forskolin and the presence of TBT potentiated these effects. TBT apparently increased mRNA and protein levels of cyp19a, compared to the solvent control, whereas cyp19b mRNA levels were unaffected by TBT treatment. Combined TBT and forskolin exposure produced respective decrease and increase of mRNA levels of cyp19a and cyp19b, compared with control. TBT decreased ER{alpha} mRNA at low dose (1 mg/kg) and forskolin exposure alone produced a consistent decrease of ER{alpha} mRNA levels that were not affected by the presence of TBT. Interestingly, PXR and CYP3A mRNA levels were differentially affected, either decreased or increased, after exposure to TBT and forskolin, singly

  15. Historical landscape elements in preserving steppic species - vegetation responses on micro-topography and human disturbances

    Science.gov (United States)

    Deák, Balázs; Valkó, Orsolya; Török, Péter; Tóthmérész, Béla

    2017-04-01

    Land use changes of past centuries resulted in a considerable loss and isolation of grassland habitats worldwide which also led to a serious loss in ecosystem functions. In intensively used agricultural landscapes remnants of natural flora persisted only in small habitat islands embedded in a hostile matrix, which are inadequate for arable farming or construction. In the steppe zone of Eurasia burial mounds, so-called kurgans, have a great potential to preserve the natural flora and habitats and act as local biodiversity hotspots. Their special micro-topography and historical origin makes kurgans characteristic landscape elements of the steppe region. These features also result in a specific soil development and micro-climate, which makes kurgans especially adequate habitats for several steppe specialist plant species. Furthermore, they are proper objects for studying the effects of present and past human disturbances on the vegetation of semi-natural habitats. Exploration of the main factors driving biodiversity in isolated habitat fragments is crucial for understanding the ecological processes shaping their vegetation and for designing effective strategies for their protection. We surveyed the vegetation of 44 isolated kurgans in East-Hungary and studied the effects of habitat area, slope, recent disturbance, past destruction and the level of woody encroachment on the species richness and cover of grassland specialist and weedy species. We used model selection techniques and linear models for testing relevant factors affecting specialist species in grassland fragments. We found that the biodiversity conservation potential of kurgans is supported by their steep slopes, which provide adequate habitat conditions and micro-climate for steppic specialist plant species. By harbouring several grassland specialist species, kurgans have a great potential for preserving the natural species pool of even considerably altered agricultural landscapes, and can mitigate the

  16. The effect of precrash velocity reduction on occupant response using a human body finite element model.

    Science.gov (United States)

    Guleyupoglu, B; Schap, J; Kusano, K D; Gayzik, F S

    2017-07-04

    The objective of this study is to use a validated finite element model of the human body and a certified model of an anthropomorphic test dummy (ATD) to evaluate the effect of simulated precrash braking on driver kinematics, restraint loads, body loads, and computed injury criteria in 4 commonly injured body regions. The Global Human Body Models Consortium (GHBMC) 50th percentile male occupant (M50-O) and the Humanetics Hybrid III 50th percentile models were gravity settled in the driver position of a generic interior equipped with an advanced 3-point belt and driver airbag. Fifteen simulations per model (30 total) were conducted, including 4 scenarios at 3 severity levels: median, severe, and the U.S. New Car Assessment Program (U.S.-NCAP) and 3 extra per model with high-intensity braking. The 4 scenarios were no precollision system (no PCS), forward collision warning (FCW), FCW with prebraking assist (FCW+PBA), and FCW and PBA with autonomous precrash braking (FCW + PBA + PB). The baseline ΔV was 17, 34, and 56.4 kph for median, severe, and U.S.-NCAP scenarios, respectively, and were based on crash reconstructions from NASS/CDS. Pulses were then developed based on the assumed precrash systems equipped. Restraint properties and the generic pulse used were based on literature. In median crash severity cases, little to no risk (braking cases (1.0-1.4 g), head injury criterion (HIC), brain injury criterion (BrIC), and chest deflection injury measures increased with increased braking intensity. All other measures for these cases tended to decrease. The ATD also predicted and trended similar to the human body models predictions for both the median, severe, and NCAP cases. Forward excursion for both models decreased across median, severe, and NCAP cases and diverged from each other in cases above 1.0 g of braking intensity. The addition of precrash systems simulated through reduced precrash speeds caused reductions in some injury criteria, whereas others (chest

  17. Strengthening the nuclear non-proliferation regime

    International Nuclear Information System (INIS)

    Carlson, J.

    2003-01-01

    Although the nuclear non-proliferation regime has enjoyed considerable success, today the regime has never been under greater threat. Three states have challenged the objectives of the NPT, and there is a technology challenge - the spread of centrifuge enrichment technology and know-how. A major issue confronting the international community is, how to deal with a determined proliferator? Despite this gloomy scenario, however, the non-proliferation regime has considerable strengths - many of which can be developed further. The regime comprises complex interacting and mutually reinforcing elements. At its centre is the NPT - with IAEA safeguards as the Treaty's verification mechanism. Important complementary elements include: restraint in the supply and the acquisition of sensitive technologies; multilateral regimes such as the CTBT and proposed FMCT; various regional and bilateral regimes; the range of security and arms control arrangements outside the nuclear area (including other WMD regimes); and the development of proliferation-resistant technologies. Especially important are political incentives and sanctions in support of non-proliferation objectives. This paper outlines some of the key issues facing the non-proliferation regime

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  19. Genomic Regulation of the Response of an Agroecosystem to Elements of Global Change

    Energy Technology Data Exchange (ETDEWEB)

    DeLucia, Evan, H.

    2011-06-03

    This document outlines some of the major accomplishments from this project: (1) New tools for analyzing and visualizing microarray data from soybean gene expression experiments; (2) Physiological, biochemical, and gene array evidence that acclimation of carbon metabolism to elevated CO{sub 2} is governed in significant part by changes in gene expression associated with respiratory metabolism; (3) Increased carbon assimilation in soybeans grown at elevated CO{sub 2} altered pools of carbohydrates and transcripts that control growth and expansion of young leaves; (4) Growth at elevated CO{sub 2} increases the abundance of transcripts controlling cell wall polysaccharide synthesis but not transcripts controlling lignin synthesis; (5) The total antioxidant capacity of soybeans varies among cultivars and in response to atmospheric change; (6) Accelerated leaf senescence at elevated O{sub 3} coincides with reduced abundance of transcripts controlling protein synthesis; (7) Growth under elevated CO{sub 2} increases the susceptibility of soybean to insect herbivores by increasing insect lifespan and fecundity through altered leaf chemistry and by defeating molecular induction of plant defenses; (8) Exposure to elevated CO{sub 2} and O{sub 3} alters flavonoid metabolism in soybean; (9) Exposure to elevated CO{sub 2} or O{sub 3} conferred resistance to soybean mosaic virus by cross inducing defense- and stress-related signaling pathways; and (10) Exposure to elevated CO{sub 2} accelerates decomposition by changing chemical and biotic properties of the soil.

  20. Evidence for some signal transduction elements involved in UV-light-dependent responses in parsley protoplasts

    International Nuclear Information System (INIS)

    Frohnmeyer, H.; Bowler, C.; Schäfer, E.

    1997-01-01

    The signalling pathways used by UV-light are largely unknown. Using protoplasts from a heterotrophic parsley (Petroselinum crispum L.) cell culture that exclusively respond to UV-B light between 300 and 350 nm with a fast induction of genes encoding flavonoid biosynthetic enzymes, information was obtained about the UV-light signal transduction pathway for chalcone synthase (CHS) and phenylalanine ammonia-lyase (PAL) gene expression. Pharmacological effectors which influence intracellular calcium levels, calmodulin and the activity of serine/threonine kinases also changed the UV-light-dependent expression of these genes. This evaluation indicated the participation of these components on the UV-B-mediated signal transduction cascade to CHS. In contrast, neither membrane-permeable cyclic GMP nor the tyrosine kinase inhibitor genistein affected CHS or PAL expression. Similar results were obtained in protoplasts, which have been transiently transformed with CHS-promoter/GUS (β-glucuronidase) reporter fusion constructs. The involvement of calcium and calmodulin was further indicated in a cell-free light-responsive in vitro transcription system from evacuolated parsley protoplasts. In conclusion, there is evidence now that components of the UV-light-dependent pathway leading to the CHS-promoter are different from the previously characterized cGMP-dependent pathway to CHS utilized by phytochrome in soybean (Glycine max) and tomato seedlings (Lycopersicon esculentum). (author)

  1. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  2. The Dynamic Response of an Euler-Bernoulli Beam on an Elastic Foundation by Finite Element Analysis using the Exact Stiffness Matrix

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Moon Kyum

    2012-01-01

    In this study, finite element analysis of beam on elastic foundation, which received great attention of researchers due to its wide applications in engineering, is performed for estimating dynamic responses of shallow foundation using exact stiffness matrix. First, element stiffness matrix based on the closed solution of beam on elastic foundation is derived. Then, we performed static finite element analysis included exact stiffness matrix numerically, comparing results from the analysis with some exact analysis solutions well known for verification. Finally, dynamic finite element analysis is performed for a shallow foundation structure under rectangular pulse loading using trapezoidal method. The dynamic analysis results exist in the reasonable range comparing solution of single degree of freedom problem under a similar condition. The results show that finite element analysis using exact stiffness matrix is evaluated as a good tool of estimating the dynamic response of structures on elastic foundation.

  3. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Park, Serk In, E-mail: serkin@korea.edu [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); The BK21 Plus Program for Biomedical Sciences, Korea University College of Medicine, Seoul (Korea, Republic of); Department of Medicine and Center for Bone Biology, Vanderbilt University School of Medicine, Nashville, TN (United States); Park, Sung-Jun [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Laboratory of Obesity and Aging Research, National Heart, Lung and Blood Institute, National Institutes of Health, Bethesda, MD (United States); Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of); Park, Yun Gyu, E-mail: parkyg@korea.ac.kr [Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul (Korea, Republic of)

    2016-01-15

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  4. Inhibition of cyclic AMP response element-directed transcription by decoy oligonucleotides enhances tumor-specific radiosensitivity

    International Nuclear Information System (INIS)

    Park, Serk In; Park, Sung-Jun; Lee, Junghan; Kim, Hye Eun; Park, Su Jin; Sohn, Jeong-Won; Park, Yun Gyu

    2016-01-01

    The radiation stress induces cytotoxic responses of cell death as well as cytoprotective responses of cell survival. Understanding exact cellular mechanism and signal transduction pathways is important in improving cancer radiotherapy. Increasing evidence suggests that cyclic AMP response element binding protein (CREB)/activating transcription factor (ATF) family proteins act as a survival factor and a signaling molecule in response to stress. We postulated that CREB inhibition via CRE decoy oligonucleotide increases tumor cell sensitization to γ-irradiation-induced cytotoxic stress. In the present study, we demonstrate that CREB phosphorylation and CREB DNA-protein complex formation increased in time- and radiation dose-dependent manners, while there was no significant change in total protein level of CREB. In addition, CREB was phosphorylated in response to γ-irradiation through p38 MAPK pathway. Further investigation revealed that CREB blockade by decoy oligonucleotides functionally inhibited transactivation of CREB, and significantly increased radiosensitivity of multiple human cancer cell lines including TP53- and/or RB-mutated cells with minimal effects on normal cells. We also demonstrate that tumor cells ectopically expressing dominant negative mutant CREB (KCREB) and the cells treated with p38 MAPK inhibitors were more sensitive to γ-irradiation than wild type parental cells or control-treated cells. Taken together, we conclude that CREB protects tumor cells from γ-irradiation, and combination of CREB inhibition plus ionizing radiation will be a promising radiotherapeutic approach. - Highlights: • γ-Irradiation induced CREB phosphorylation and CRE-directed transcription in tumor. • γ-Irradiation-induced transcriptional activation of CREB was via p38 MAPK pathway. • CRE blockade increased radiosensitivity of tumor cells but not of normal cells. • CRE decoy oligonucleotides or p38 MAPK inhibitors can be used as radiosensitizers.

  5. The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

    Science.gov (United States)

    Fleckenstein, E C; Dirks, W G; Drexler, H G

    2000-02-01

    The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

  6. Growth responses of selected freshwater algae to trace elements and scrubber ash slurry generated by coal-fired power plants

    Energy Technology Data Exchange (ETDEWEB)

    Vocke, R.W.

    1979-01-01

    The development and implementation of standard toxicity tests is a necessity if consistent and reliable data are to be obtained for water quality criteria. The adapted EPA AAPBT is an ideal static algal toxicity test system. The algal test medium has a chemical composition similar to natural unpolluted waters of low ionic strength. It is appropriate to use MATC water quality criteria when assessing the potential impact of pollutants generated by coal-fired power stations because these energy-generated pollutants typically enter aquatic systems in small quantities over long periods. The MATC water quality criteria are estimates of trace element and SASE levels, based on the most sensitive alga investigated, that will not cause significant changes in naturally-functioning algal populations. These levels are 0.016f mg L/sup -1/ As(V), 0.001 mg L/sup -1/ Cd(II), 0.004 mg L/sup -1/ Hg(II), 0.006 mg L/sup -1/ Se(VI), and 0.344% SASE. To provide viable working water quality criteria, an extrapolation from the laboratory to the natural environment must be made. Therefore, those oxidation states of the trace elements were selected which are the dominant states occurring in natural, unpolluted, slightly alkaline freshwaters. It must be pointed out that these MATC values are based on algal responses to single toxicants and no allowance is made for synergistic, additive, or antagonistic relationships which could occur in natural aquatic systems. Additionally, natural chelation may influence toxicity. The highly toxic nature of potential pollutants from coal-fired generating plants emphasizes the need for minimizing stack effluent pollutants and retaining scrubber ash slurry for proper disposal in an effort to maintain trace elements in concentration ranges compatible with naturally-functioning ecosystems.

  7. Director's series on proliferation

    International Nuclear Information System (INIS)

    Bailey, K.C.; Price, M.E.

    1995-01-01

    This is an occasional publication of essays on the topics of nuclear, chemical, biological, and missile proliferation. The views represented are those of the author's. Essay topics include: Nuclear Proliferation: Myth and Reality; Problems of Enforcing Compliance with Arms Control Agreements; The Unreliability of the Russian Officer Corps: Reluctant Domestic Warriors; and Russia's Nuclear Legacy

  8. Global and Local Mechanical Responses for Necking of Rectangular Bars Using Updated and Total Lagrangian Finite Element Formulations

    Directory of Open Access Journals (Sweden)

    Claudio A. Careglio

    2016-01-01

    Full Text Available In simulations of forged and stamping processes using the finite element method, load displacement paths and three-dimensional stress and strains states should be well and reliably represented. The simple tension test is a suitable and economical tool to calibrate constitutive equations with finite strains and plasticity for those simulations. A complex three-dimensional stress and strain states are developed when this test is done on rectangular bars and the necking phenomenon appears. In this work, global and local numerical results of the mechanical response of rectangular bars subjected to simple tension test obtained from two different finite element formulations are compared and discussed. To this end, Updated and Total Lagrangian formulations are used in order to get the three-dimensional stress and strain states. Geometric changes together with strain and stress distributions at the cross section where necking occurs are assessed. In particular, a detailed analysis of the effective plastic strain, stress components in axial and transverse directions and pressure, and deviatoric stress components is presented. Specific numerical results are also validated with experimental measurements comparing, in turn, the performance of the two numerical approaches used in this study.

  9. Microstructure Optimization of Dual-Phase Steels Using a Representative Volume Element and a Response Surface Method: Parametric Study

    Science.gov (United States)

    Belgasam, Tarek M.; Zbib, Hussein M.

    2017-12-01

    Dual-phase (DP) steels have received widespread attention for their low density and high strength. This low density is of value to the automotive industry for the weight reduction it offers and the attendant fuel savings and emission reductions. Recent studies on developing DP steels showed that the combination of strength/ductility could be significantly improved when changing the volume fraction and grain size of phases in the microstructure depending on microstructure properties. Consequently, DP steel manufacturers are interested in predicting microstructure properties and in optimizing microstructure design. In this work, a microstructure-based approach using representative volume elements (RVEs) was developed. The approach examined the flow behavior of DP steels using virtual tension tests with an RVE to identify specific mechanical properties. Microstructures with varied martensite and ferrite grain sizes, martensite volume fractions, carbon content, and morphologies were studied in 3D RVE approaches. The effect of these microstructure parameters on a combination of strength/ductility of DP steels was examined numerically using the finite element method by implementing a dislocation density-based elastic-plastic constitutive model, and a Response surface methodology to determine the optimum conditions for a required combination of strength/ductility. The results from the numerical simulations are compared with experimental results found in the literature. The developed methodology proves to be a powerful tool for studying the effect and interaction of key microstructural parameters on strength and ductility and thus can be used to identify optimum microstructural conditions.

  10. Contributions of vitamin D response elements and HLA promoters to multiple sclerosis risk.

    Science.gov (United States)

    Nolan, David; Castley, Alison; Tschochner, Monika; James, Ian; Qiu, Wei; Sayer, David; Christiansen, Frank T; Witt, Campbell; Mastaglia, Frank; Carroll, William; Kermode, Allan

    2012-08-07

    The identification of a vitamin D-responsive (VDRE) motif within the HLA-DRB1*15:01 promoter region provides an attractive explanation for the combined effects of HLA-DR inheritance and vitamin D exposure on multiple sclerosis (MS) risk. We therefore sought to incorporate HLA-DRB1 promoter variation, including the VDRE motif, in an assessment of HLA-DRB1-associated MS risk. We utilized 32 homozygous HLA cell lines (covering 17 DRB1 alleles) and 53 heterozygote MS samples (20 DRB1 alleles) for HLA-DRB1 promoter sequencing. The influence of HLA-DRB1 variation on MS risk was then assessed among 466 MS cases and 498 controls. The majority of HLA*DRB1 alleles (including HLA-DRB1*15:01) express the functional VDRE motif, apart from HLA-DRB1*04, *07, and *09 alleles that comprise the HLA-DR53 serologic group. Allele-specific variation within functional X-box and Y-box motifs was also associated with serologically defined HLA-DR haplotypes. Incorporating these results in an analysis of MS risk, we identified a strong protective effect of HLA-DRB1*04, *07, and *09 (DR53) alleles (p = 10(-12)) and elevated risk associated with DRB1*15 and *16 (DR51) and *08 (DR8) alleles (p < 10(-18)). HLA-DRB1 groups corresponding to serologic HLA-DR profiles as well as promoter polymorphism haplotypes effectively stratified MS risk over an 11-fold range, suggesting functional relationships between risk-modifying HLA-DRB1 alleles. An independent contribution of VDRE motif variation to increase MS risk was not discernible, although vitamin D-dependent regulation of HLA-DR expression may still play an important role given that HLA-DRB1*04/*07/*09 (DR53) alleles that express the "nonresponsive" VDRE motif were associated with significantly reduced risk of MS.

  11. Development of a Finite Element Model of the Human Shoulder to Investigate the Mechanical Responses and Injuries in Side Impact

    Science.gov (United States)

    Iwamoto, Masami; Miki, Kazuo; Yang, King H.

    Previous studies in both fields of automotive safety and orthopedic surgery have hypothesized that immobilization of the shoulder caused by the shoulder injury could be related to multiple rib fractures, which are frequently life threatening. Therefore, for more effective occupant protection, it is important to understand the relationship between shoulder injury and multiple rib fractures in side impact. The purpose of this study is to develop a finite element model of the human shoulder in order to understand this relationship. The shoulder model included three bones (the humerus, scapula and clavicle) and major ligaments and muscles around the shoulder. The model also included approaches to represent bone fractures and joint dislocations. The relationships between shoulder injury and immobilization of the shoulder are discussed using model responses for lateral shoulder impact. It is also discussed how the injury can be related to multiple rib fractures.

  12. Activation of estrogen response elements is mediated both via estrogen and muscle contractions in rat skeletal muscle myotubes

    DEFF Research Database (Denmark)

    Wiik, A.; Hellsten, Ylva; Berthelson, P.

    2009-01-01

    is ER independent. The muscle contraction-induced transactivation of ERE and increase in ERbeta mRNA were instead found to be MAP kinase (MAPK) dependent. This study demonstrates for the first time that muscle contractions have a similar functional effect as estrogen in skeletal muscle myotubes, causing......The aim of the present study was to investigate the activation of estrogen response elements (EREs) by estrogen and muscle contractions in rat myotubes in culture and to assess whether the activation is dependent on the estrogen receptors (ERs). In addition, the effect of estrogen and contraction...... on the mRNA levels of ERalpha and ERbeta was studied to determine the functional consequence of the transactivation. Myoblasts were isolated from rat skeletal muscle and transfected with a vector consisting of sequences of EREs coupled to the gene for luciferase. The transfected myoblasts were...

  13. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    International Nuclear Information System (INIS)

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A.

    2005-01-01

    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity

  14. Four New Acylated Iridoid Glycosides from the Aerial Part of Veronicastrum sibiricum and Their Antioxidant Response Element-Inducing Activity.

    Science.gov (United States)

    Kim, Myeong Il; Kim, Chul Young

    2018-01-01

    Four new (1 - 4) and one known (5) acylated iridoid glycosides were isolated from the aerial parts of Veronicastrum sibiricum (L.) Pennell. The chemical structures of the isolated compounds were determined to be 3″,4″-dicinnamoyl-6-O-rhamnopyranosyl-10-O-bergaptol-5,7-bisdeoxycynanchoside (1), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylpaulownioside (2), 2″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (3), 3″,4″-dicinnamoyl-6-O-rhamnopyranosylaucubin (4), and 3″,4″-dicinnamoyl-6-O-rhamnopyranosylcatalpol (5) using spectroscopic techniques. Among these compounds, compound 5 increased antioxidant response element (ARE) luciferase activity. © 2018 Wiley-VHCA AG, Zurich, Switzerland.

  15. On the residual stress modeling of shot-peened AISI 4340 steel: finite element and response surface methods

    Science.gov (United States)

    Asgari, Ali; Dehestani, Pouya; Poruraminaie, Iman

    2018-02-01

    Shot peening is a well-known process in applying the residual stress on the surface of industrial parts. The induced residual stress improves fatigue life. In this study, the effects of shot peening parameters such as shot diameter, shot speed, friction coefficient, and the number of impacts on the applied residual stress will be evaluated. To assess these parameters effect, firstly the shot peening process has been simulated by finite element method. Then, effects of the process parameters on the residual stress have been evaluated by response surface method as a statistical approach. Finally, a strong model is presented to predict the maximum residual stress induced by shot peening process in AISI 4340 steel. Also, the optimum parameters for the maximum residual stress are achieved. The results indicate that effect of shot diameter on the induced residual stress is increased by increasing the shot speed. Also, enhancing the friction coefficient magnitude always cannot lead to increase in the residual stress.

  16. Proliferation Networks and Financing

    International Nuclear Information System (INIS)

    Gruselle, Bruno

    2007-01-01

    The objective of this study is to propose practical solutions aimed at completing and strengthening the existing arrangement for the control of nuclear proliferation through a control of financial as well as material or immaterial flows. In a first part, the author proposes a systemic analysis of networks of suppliers and demanders. He notably evokes the Khan's network and the Iraqi acquisition network during the 1993-2001 period. He also proposes a modelling of proliferation networks (supplier networks and acquisition networks) and of their interactions. In a second part, the author examines possible means and policies aimed at neutralising proliferation networks: organisation, adaptation and improvement of intelligence tools in front of proliferation networks, and means, limitations and perspectives of network neutralisation. He also briefly addresses the possibility of military action to contain proliferation flows

  17. Isolation of an X-ray-responsive element in the promoter region of tissue-type plasminogen activator: Potential uses of X-ray-responsive elements for gene therapy

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, I.W.; Sahijdak, W.M.

    1994-01-01

    Tissue-type plasminogen activator (t-PA) was induced over 50-fold after X irradiation in radioresistant human melanoma cells. Activities of t-PA were induced 14-fold in ataxia telangiectasia, 9-fold in Bloom's syndrome and 6-fold in Fanconi's anemia cells, compared to normal human fibroblasts. X-ray-inducible synthesis of the protease, t-PA, may play a role(s) in damage-inducible repair processes in mammalian cells, similar to the SOS repair systems in lower eukaryotes and prokaryotes. DNA band shift and DNase I footprinting assays were used to determine binding if transcription factors to a previously unknown X-ray-responsive element (XRE) in the t-PA promoter. The major goals of our research with XREs are to understand (a) which transcription factor(s) regulates to-PA induction after X-rays, and (b) the role(s) of t-PA in DNA repair, apoptosis or other responses to X rays. The purpose of this paper is to discuss the potential use of an XRE, such as the one in the t-PA promoter, for gene radiotherapy. Several gene therapy strategies are proposed. 22 refs., 3 figs

  18. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  19. Alcohol dysregulates corticotropin-releasing-hormone (CRH promoter activity by interfering with the negative glucocorticoid response element (nGRE.

    Directory of Open Access Journals (Sweden)

    Magdalena M Przybycien-Szymanska

    Full Text Available EtOH exposure in male rats increases corticotropin-releasing hormone (CRH mRNA in the paraventricular nucleus of the hypothalamus (PVN, a brain region responsible for coordinating stress and anxiety responses. In this study we identified the molecular mechanisms involved in mediating these effects by examining the direct effects of EtOH on CRH promoter activity in a neuronal cell line derived from the PVN (IVB. In addition, we investigated the potential interactions of EtOH and glucocorticoids on the CRH promoter by concomitantly treating cells with EtOH and the glucocorticoid receptor (GR antagonist RU486, and by sequentially deleting GR binding sites within glucocorticoid response element (GRE on the CRH promoter. Cells were transiently transfected with a firefly luciferase reporter construct containing 2.5 kb of the rat wild type (WT or mutated CRH promoter. Our results showed that EtOH treatment induced a biphasic response in CRH promoter activity. EtOH exposure for 0.5 h significantly decreased promoter activity compared to vehicle treated controls, whereas promoter activity was significantly increased after 2.0 h of EtOH exposure. Treatment with RU486, or deletion of the GR binding sites 1 and 2 within the GRE, abolished the EtOH-induced increase in the promoter activity, however did not affect EtOH-induced decrease in CRH promoter activity at an earlier time point. Overall, our data suggest that alcohol exposure directly regulates CRH promoter activity by interfering with the normal feedback mechanisms of glucocorticoids mediated by GR signaling at the GRE site of the CRH promoter.

  20. Expression of MUC17 is regulated by HIF1α-mediated hypoxic responses and requires a methylation-free hypoxia responsible element in pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Sho Kitamoto

    Full Text Available MUC17 is a type 1 membrane-bound glycoprotein that is mainly expressed in the digestive tract. Recent studies have demonstrated that the aberrant overexpression of MUC17 is correlated with the malignant potential of pancreatic ductal adenocarcinomas (PDACs; however, the exact regulatory mechanism of MUC17 expression has yet to be identified. Here, we provide the first report of the MUC17 regulatory mechanism under hypoxia, an essential feature of the tumor microenvironment and a driving force of cancer progression. Our data revealed that MUC17 was significantly induced by hypoxic stimulation through a hypoxia-inducible factor 1α (HIF1α-dependent pathway in some pancreatic cancer cells (e.g., AsPC1, whereas other pancreatic cancer cells (e.g., BxPC3 exhibited little response to hypoxia. Interestingly, these low-responsive cells have highly methylated CpG motifs within the hypoxia responsive element (HRE, 5'-RCGTG-3', a binding site for HIF1α. Thus, we investigated the demethylation effects of CpG at HRE on the hypoxic induction of MUC17. Treatment of low-responsive cells with 5-aza-2'-deoxycytidine followed by additional hypoxic incubation resulted in the restoration of hypoxic MUC17 induction. Furthermore, DNA methylation of HRE in pancreatic tissues from patients with PDACs showed higher hypomethylation status as compared to those from non-cancerous tissues, and hypomethylation was also correlated with MUC17 mRNA expression. Taken together, these findings suggested that the HIF1α-mediated hypoxic signal pathway contributes to MUC17 expression, and DNA methylation of HRE could be a determinant of the hypoxic inducibility of MUC17 in pancreatic cancer cells.

  1. Hydroponics: A Versatile System to Study Nutrient Allocation and Plant Responses to Nutrient Availability and Exposure to Toxic Elements.

    Science.gov (United States)

    Nguyen, Nga T; McInturf, Samuel A; Mendoza-Cózatl, David G

    2016-07-13

    Hydroponic systems have been utilized as one of the standard methods for plant biology research and are also used in commercial production for several crops, including lettuce and tomato. Within the plant research community, numerous hydroponic systems have been designed to study plant responses to biotic and abiotic stresses. Here we present a hydroponic protocol that can be easily implemented in laboratories interested in pursuing studies on plant mineral nutrition. This protocol describes the hydroponic system set up in detail and the preparation of plant material for successful experiments. Most of the materials described in this protocol can be found outside scientific supply companies, making the set up for hydroponic experiments less expensive and convenient. The use of a hydroponic growth system is most advantageous in situations where the nutrient media need to be well controlled and when intact roots need to be harvested for downstream applications. We also demonstrate how nutrient concentrations can be modified to induce plant responses to both essential nutrients and toxic non-essential elements.

  2. Finite Element Modeling and Analysis of Nonlinear Impact and Frictional Motion Responses Including Fluid—Structure Coupling Effects

    Directory of Open Access Journals (Sweden)

    Yong Zhao

    1997-01-01

    Full Text Available A nonlinear three dimensional (3D single rack model and a nonlinear 3D whole pool multi-rack model are developed for the spent fuel storage racks of a nuclear power plant (NPP to determine impacts and frictional motion responses when subjected to 3D excitations from the supporting building floor. The submerged free standing rack system and surrounding water are coupled due to hydrodynamic fluid-structure interaction (FSI using potential theory. The models developed have features that allow consideration of geometric and material nonlinearities including (1 the impacts of fuel assemblies to rack cells, a rack to adjacent racks or pool walls, and rack support legs to the pool floor; (2 the hydrodynamic coupling of fuel assemblies with their storing racks, and of a rack with adjacent racks, pool walls, and the pool floor; and (3 the dynamic motion behavior of rocking, twisting, and frictional sliding of rack modules. Using these models 3D nonlinear time history dynamic analyses are performed per the U.S. Nuclear Regulatory Commission (USNRC criteria. Since few such modeling, analyses, and results using both the 3D single and whole pool multiple rack models are available in the literature, this paper emphasizes description of modeling and analysis techniques using the SOLVIA general purpose nonlinear finite element code. Typical response results with different Coulomb friction coefficients are presented and discussed.

  3. Enhanced phosphorylation of cyclic AMP response element binding protein in Brain of mice following repetitive hypoxic exposure

    International Nuclear Information System (INIS)

    Gao Yanan; Gao Ge; Long Caixia; Han Song; Zu Pengyu; Fang Li; Li Junfa

    2006-01-01

    Cerebral ischemic/hypoxic preconditioning (I/HPC) is a phenomenon of endogenous protection that renders Brain tolerant to sustained ischemia/hypoxia. This profound protection induced by I/HPC makes it an attractive target for developing potential clinical therapeutic approaches. However, the molecular mechanism of I/HPC is unclear. Cyclic AMP (cAMP) response element binding protein (CREB), a selective nuclear transcriptional factor, plays a key role in the neuronal functions. Phosphorylation of CREB on Ser-133 may facilitate its transcriptional activity in response to various stresses. In the current study, we observed the changes in CREB phosphorylation (Ser-133) and protein expression in Brain of auto-hypoxia-induced HPC mice by using Western blot analysis. We found that the levels of phosphorylated CREB (Ser-133), but not protein expression of CREB, increased significantly (p < 0.05) in the hippocampus and the frontal cortex of mice after repetitive hypoxic exposure (H2-H4, n = 6 for each group), when compared to that of the normoxic (H0, n = 6) or hypoxic exposure once group (H1, n = 6). In addition, a significant enhancement (p < 0.05) of CREB phosphorylation (Ser-133) could also be found in the nuclear extracts from the whole hippocampus of hypoxic preconditioned mice (H2-H4, n = 6 for each group). These results suggest that the phosphorylation of CREB might be involved in the development of cerebral hypoxic preconditioning

  4. Early growth response 4 is involved in cell proliferation of small cell lung cancer through transcriptional activation of its downstream genes.

    Directory of Open Access Journals (Sweden)

    Taisuke Matsuo

    Full Text Available Small cell lung cancer (SCLC is aggressive, with rapid growth and frequent bone metastasis; however, its detailed molecular mechanism remains poorly understood. Here, we report the critical role of early growth factor 4 (EGR4, a DNA-binding, zinc-finger transcription factor, in cell proliferation of SCLC. EGR4 overexpression in HEK293T cells conferred significant upregulation of specific splice variants of the parathyroid hormone-related protein (PTHrP gene, resulting in enhancement of the secretion of PTHrP protein, a known mediator of osteolytic bone metastasis. More importantly, depletion of EGR4 expression by siRNA significantly suppressed growth of the SCLC cell lines, SBC-5, SBC-3 and NCI-H1048. On the other hand, introduction of EGR4 into NIH3T3 cells significantly enhanced cell growth. We identified four EGR4 target genes, SAMD5, RAB15, SYNPO and DLX5, which were the most significantly downregulated genes upon depletion of EGR4 expression in all of the SCLC cells examined, and demonstrated the direct recruitment of EGR4 to their promoters by ChIP and luciferase reporter analysis. Notably, knockdown of the expression of these genes by siRNA remarkably suppressed the growth of all the SCLC cells. Taken together, our findings suggest that EGR4 likely regulates the bone metastasis and proliferation of SCLC cells via transcriptional regulation of several target genes, and may therefore be a promising target for the development of anticancer drugs for SCLC patients.

  5. Non-proliferation

    International Nuclear Information System (INIS)

    Manley, I.T.

    1981-01-01

    Proliferation is a problem that can only be solved when the political problems which lead countries to contemplate, the possession of nuclear weapons are solved; in the meantime it can only be managed. Non-proliferation policy has to deal both with the political and the technical aspects of proliferation. It must seek to buy time by addressing the reasons why nations feel the political need to construct nuclear weapons, as well as delaying the moment when such nations feel capable of doing so. The subject is examined and proposals made. (author)

  6. Getting serious about proliferation

    International Nuclear Information System (INIS)

    Leventhal, P.

    1984-01-01

    The US needs to give a higher priority to nuclear non-proliferation, but Reagan's policies assume that proliferation is inevitable and that it is more important to be a reliable supplier than to cause trade frictions by trading only with those nations which sign the non-proliferation treaty (NPT). This undercuts US leadership and the intent of the agreement. Several bills now before Congress could help to restore US leadership by tightening export restrictions and the use of plutonium from the US

  7. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  8. Nuclear proliferation and terrorism

    International Nuclear Information System (INIS)

    Anon.

    1977-01-01

    This section of the book, Part III, has two chapters (9 and 10). Chapter 9, Nuclear Power and Proliferation of Nuclear Weapons, is disucssed under these subjects: nuclear nonproliferation: origins and status; requirements for nuclear weapons manufacture; current nuclear programs and proliferation capabilities; encouraging decisions to forego weapons; arms control; safeguards; attitudes and expectations. Chapter 10, Nuclear Terrorism, discusses these areas: theft of nuclear materials; attacks on nuclear reactors; responding to nuclear terrorism; security and civil liberties

  9. Initial attachment, subsequent cell proliferation/viability and gene expression of epithelial cells related to attachment and wound healing in response to different titanium surfaces.

    Science.gov (United States)

    An, Na; Rausch-fan, Xiaohui; Wieland, Marco; Matejka, Michael; Andrukhov, Oleh; Schedle, Andreas

    2012-12-01

    A tight seal between the epithelium and the dental implant surface is required to prevent bacterial inflammation and soft tissue recession and therefore to demonstrate a long-term success. Surface hydrophilicity was recently shown to promote osseointegration. The aim of this study was to investigate the influence of surface hydrophilicity in combination with surface topography of Ti implant surfaces on the behavior and activation/differentiation of epithelial cells using a set of in vitro experiments mimicking the implant-soft tissue contact. Hydrophobic acid-etched (A) and coarse-grit-blasted, acid-etched (SLA) surfaces and hydrophilic acid-etched (modA) and modSLA surfaces were produced. The behavior of an oral squamous cell carcinoma cell line (HSC-2) grown on all surfaces was compared through determination of cell attachment and proliferation/viability (CCK-8 and MTT assay), time-lapse microscopy of fluorescence labeled cells and determination of gene expression by real time polymerase chain reaction. Within the surfaces with similar wettability cell spreading and cell movements observed by time-lapse microscopy after one day of incubation were most pronounced on smoother (A and modA) surfaces compared to rougher (SLA and modSLA) surfaces. Within the surfaces with similar roughness the hydrophilic surfaces (modA and modSLA) showed more cell spreading and cell activity compared to the hydrophobic surfaces (A and SLA). The relative gene expressions of cytokeratin14, integrin α6, integrin β4, vinculin, transforming growth factor (TGF)-β, TGF-β1, and TGF-β3 were decreased in HSC-2 on all four types of Ti surfaces compared to control surfaces (tissue culture polystyrene; pmodA). These results suggest that surface hydrophilicity might positively influence the epithelial seal around dental implants. All tested titanium surfaces downregulate cell attachment, cell proliferation, expression of adhesion promoters, and cytokines involved in wound healing in HSC-2

  10. Brain response to primary blast wave using validated finite element models of human head and advanced combat helmet

    Directory of Open Access Journals (Sweden)

    Liying eZhang

    2013-08-01

    Full Text Available Blast-induced traumatic brain injury has emerged as a signature injury in combat casualty care. Present combat helmets are designed primarily to protect against ballistic and blunt impacts, but the current issue with helmets is protection concerning blasts. In order to delineate the blast wave attenuating capability of the Advanced Combat Helmet (ACH, a finite element (FE study was undertaken to evaluate the head response against blast loadings with and without helmet using a partially validated FE model of the human head and ACH. Four levels of overpressures (0.27-0.66 MPa from the Bowen’s lung iso-damage threshold curves were used to simulate blast insults. Effectiveness of the helmet with respect to head orientation was also investigated. The resulting biomechanical responses of the brain to blast threats were compared for human head with and without the helmet. For all Bowen’s cases, the peak intracranial pressures (ICP in the head ranged from 0.68-1.8 MPa in the coup cortical region. ACH was found to mitigate ICP in the head by 10-35%. Helmeted head resulted in 30% lower average peak brain strains and product of strain and strain rate. Among three blast loading directions with ACH, highest reduction in peak ICP (44% was due to backward blasts whereas the lowest reduction in peak ICP and brain strains was due to forward blast (27%. The biomechanical responses of a human head to primary blast insult exhibited directional sensitivity owing to the different geometry contours and coverage of the helmet construction and asymmetric anatomy of the head. Thus, direction-specific tolerances are needed in helmet design in order to offer omni-directional protection for the human head. The blasts of varying peak overpressures and durations that are believed to produce the same level of lung injury produce different levels of mechanical responses in the brain, and hence "iso-damage" curves for brain injury are likely different than the Bowen curves

  11. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  12. Insulin induces a transcriptional activation of epiregulin, HB-EGF and amphiregulin, by a PI3K-dependent mechanism: Identification of a specific insulin-responsive promoter element

    International Nuclear Information System (INIS)

    Ornskov, Dorthe; Nexo, Ebba; Sorensen, Boe S.

    2007-01-01

    Previously we have shown that insulin-stimulation of RT4 bladder cancer cells leads to increased proliferation, which require HER1 activation, and is accompanied by increased mRNA expression of the EGF-ligands heparin-binding EGF-like growth factor (HB-EGF), amphiregulin (AR), and epiregulin (EPI) [D. Ornskov, E. Nexo, B.S. Sorensen, Insulin-induced proliferation of bladder cancer cells is mediated through activation of the epidermal growth factor system, FEBS J. 273 (2006) 5479-5489]. In the present paper, we have investigated the molecular mechanism leading to this insulin-induced expression. We monitored the decay of mRNA after inhibiting transcription with Actinomycin D and demonstrated that the insulin-mediated increase was not caused by enhanced mRNA stability. In untreated cells, HB-EGF mRNA was the least stable, whereas AR and EPI mRNA decayed with slower kinetics. However, promoter analysis of HB-EGF and EPI demonstrated that insulin stimulated transcription. Studies on the EPI promoter identified the insulin-responsive element to be located in the region -564 to -365 bp. This region contains potential binding sites for the transcription factors SP1, AP1, and NF-κB. Interestingly, all three transcription factors can be activated by PI3K. We demonstrate that the insulin-induced expression of HB-EGF, AR, and EPI mRNA is completely prevented by the specific PI3K inhibitor Wortmannin, suggesting an involvement of the PI3K

  13. Effects of gamma irradiation on the DNA-protein complex between the estrogen response element and the estrogen receptor

    Energy Technology Data Exchange (ETDEWEB)

    Stisova, Viktorie [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic); Goffinont, Stephane; Spotheim-Maurizot, Melanie [Centre de Biophysique Moleculaire CNRS, rue Charles Sadron, 45071 Orleans Cedex 2 (France); Davidkova, Marie, E-mail: davidkova@ujf.cas.c [Department of Radiation Dosimetry, Nuclear Physics Institute AS CR, Na Truhlarce 39/64, 18086 Praha 8 (Czech Republic)

    2010-08-15

    Signaling by estrogens, risk factors in breast cancer, is mediated through their binding to the estrogen receptor protein (ER), followed by the formation of a complex between ER and a DNA sequence, called estrogen response element (ERE). Anti-estrogens act as competitive inhibitors by blocking the signal transduction. We have studied in vitro the radiosensitivity of the complex between ERalpha, a subtype of this receptor, and a DNA fragment bearing ERE, as well as the influence of an estrogen (estradiol) or an anti-estrogen (tamoxifen) on this radiosensitivity. We observe that the complex is destabilized upon irradiation with gamma rays in aerated aqueous solution. The analysis of the decrease of binding abilities of the two partners shows that destabilization is mainly due to the damage to the protein. The destabilization is reduced when irradiating in presence of tamoxifen and is increased in presence of estradiol. These effects are due to opposite influences of the ligands on the loss of binding ability of ER. The mechanism that can account for our results is: binding of estradiol or tamoxifen induces distinct structural changes of the ER ligand-binding domain that can trigger (by allostery) distinct structural changes of the ER DNA-binding domains and thus, can differently affect ER-ERE interaction.

  14. A two-dimensional, finite-element methods for calculating TF coil response to out-of-plane Lorentz forces

    International Nuclear Information System (INIS)

    Witt, R.J.

    1989-01-01

    Toroidal field (TF) coils in fusion systems are routinely operated at very high magnetic fields. While obtaining the response of the coil to in-plane loads is relatively straightforward, the same is not true for the out-of-plane loads. Previous treatments of the out-of-plane problem have involved large, three-dimensional finite element idealizations. A new treatment of the out-of-plane problem is presented here; the model is two-dimensional in nature, and consumes far less CPU-time than three-dimensional methods. The approach assumes there exists a region of torsional deformation in the inboard leg and a bending region in the outboard leg. It also assumes the outboard part of the coil is attached to a torque frame/cylinder, which experiences primarily torsional deformation. Three-dimensional transition regions exist between the inboard and outboard legs and between the outboard leg and the torque frame. By considering several idealized problems of cylindrical shells subjected to moment distributions, it is shown that the size of these three-dimensional regions is quite small, and that the interaction between the torsional and bending regions can be treated in an equivalent two-dimensional fashion. Equivalent stiffnesses are derived to model penetration into and twist along the cylinders. These stiffnesses are then used in a special substructuring analysis to couple the three regions together. Results from the new method are compared to results from a 3D continuum model. (orig.)

  15. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  16. Cannabinoid exposure during zebra finch sensorimotor vocal learning persistently alters expression of endocannabinoid signaling elements and acute agonist responsiveness

    Directory of Open Access Journals (Sweden)

    Lichtman Aron H

    2011-01-01

    Full Text Available Abstract Background Previously we have found that cannabinoid treatment of zebra finches during sensorimotor stages of vocal development alters song patterns produced in adulthood. Such persistently altered behavior must be attributable to changes in physiological substrates responsible for song. We are currently working to identify the nature of such physiological changes, and to understand how they contribute to altered vocal learning. One possibility is that developmental agonist exposure results in altered expression of elements of endocannabinoid signaling systems. To test this hypothesis we have studied effects of the potent cannabinoid receptor agonist WIN55212-2 (WIN on endocannabinoid levels and densities of CB1 immunostaining in zebra finch brain. Results We found that late postnatal WIN treatment caused a long-term global disregulation of both levels of the endocannabinoid, 2-arachidonyl glycerol (2-AG and densities of CB1 immunostaining across brain regions, while repeated cannabinoid treatment in adults produced few long-term changes in the endogenous cannabinoid system. Conclusions Our findings indicate that the zebra finch endocannabinoid system is particularly sensitive to exogenous agonist exposure during the critical period of song learning and provide insight into susceptible brain areas.

  17. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  18. Hypoxia-induced oxidative base modifications in the VEGF hypoxia-response element are associated with transcriptionally active nucleosomes.

    Science.gov (United States)

    Ruchko, Mykhaylo V; Gorodnya, Olena M; Pastukh, Viktor M; Swiger, Brad M; Middleton, Natavia S; Wilson, Glenn L; Gillespie, Mark N

    2009-02-01

    Reactive oxygen species (ROS) generated in hypoxic pulmonary artery endothelial cells cause transient oxidative base modifications in the hypoxia-response element (HRE) of the VEGF gene that bear a conspicuous relationship to induction of VEGF mRNA expression (K.A. Ziel et al., FASEB J. 19, 387-394, 2005). If such base modifications are indeed linked to transcriptional regulation, then they should be detected in HRE sequences associated with transcriptionally active nucleosomes. Southern blot analysis of the VEGF HRE associated with nucleosome fractions prepared by micrococcal nuclease digestion indicated that hypoxia redistributed some HRE sequences from multinucleosomes to transcriptionally active mono- and dinucleosome fractions. A simple PCR method revealed that VEGF HRE sequences harboring oxidative base modifications were found exclusively in mononucleosomes. Inhibition of hypoxia-induced ROS generation with myxathiozol prevented formation of oxidative base modifications but not the redistribution of HRE sequences into mono- and dinucleosome fractions. The histone deacetylase inhibitor trichostatin A caused retention of HRE sequences in compacted nucleosome fractions and prevented formation of oxidative base modifications. These findings suggest that the hypoxia-induced oxidant stress directed at the VEGF HRE requires the sequence to be repositioned into mononucleosomes and support the prospect that oxidative modifications in this sequence are an important step in transcriptional activation.

  19. APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.

    Science.gov (United States)

    Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe

    2014-07-29

    Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Groundwater response under an electronuclear plant to a river flood wave analyzed by a nonlinear finite element model

    International Nuclear Information System (INIS)

    Gambolati, G.; Toffolo, F.; Uliana, F.

    1984-01-01

    A nonlinear finite element model based on the Dupuit-Boussinesq equation of flow in an unconfined aquifer has been developed and applied to simulate the water table fluctuation under the electronuclear plant of the test site of Trino Vercellese (northwestern Italy) in response to the flood event that occurred in the Po River from March 30 to April 4, 1981. The nonlinearity has been overcome by the aid of an efficient iterative linearization technique wherein the model equations are solved by symbolic factorization, numerical factorization, and backward-forward substitution after an optimal preliminary reordering. The model was run for uniform values of aquifer permeability and specific yield within the typical range evidenced for the Trino sands by the early data in our possession. The results show that the maximum water level elevation below the reactor is almost 3 m lower than the corresponding river flood peak even in the most unfavorable conditions, i.e., with the hydraulic conductivity in the upper range, and is rather insensitive to the specific yield values within the plausible interval. The model allowed for an easy evaluation of the effectiveness of the impermeable protection walls and of a possible secondary aquifer recharge from a minor channel. The modeling approach for the analysis of the water table behavior appears to be a very promising tool to help in the structural design of future electronuclear plants

  1. Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

    Science.gov (United States)

    Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

    2013-04-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

  2. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    Science.gov (United States)

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  3. In vitro studies of ante-mortem proliferation kinetics

    International Nuclear Information System (INIS)

    McBride, W.H.; Withers, H.R.

    1986-01-01

    Using K562 human erythroblastoid cells, it was concluded that dose fractionation has no discrepant effect on the ante-mortem proliferation kinetics of doomed cells as opposed to clonogenic cell survival and that effects on ante-mortem proliferation kinetics cannot be solely responsible for the differences in fractionation response between early and late responding tissues. (UK)

  4. The Use of Sparse Direct Solver in Vector Finite Element Modeling for Calculating Two Dimensional (2-D) Magnetotelluric Responses in Transverse Electric (TE) Mode

    Science.gov (United States)

    Yihaa Roodhiyah, Lisa’; Tjong, Tiffany; Nurhasan; Sutarno, D.

    2018-04-01

    The late research, linear matrices of vector finite element in two dimensional(2-D) magnetotelluric (MT) responses modeling was solved by non-sparse direct solver in TE mode. Nevertheless, there is some weakness which have to be improved especially accuracy in the low frequency (10-3 Hz-10-5 Hz) which is not achieved yet and high cost computation in dense mesh. In this work, the solver which is used is sparse direct solver instead of non-sparse direct solverto overcome the weaknesses of solving linear matrices of vector finite element metod using non-sparse direct solver. Sparse direct solver will be advantageous in solving linear matrices of vector finite element method because of the matrix properties which is symmetrical and sparse. The validation of sparse direct solver in solving linear matrices of vector finite element has been done for a homogen half-space model and vertical contact model by analytical solution. Thevalidation result of sparse direct solver in solving linear matrices of vector finite element shows that sparse direct solver is more stable than non-sparse direct solver in computing linear problem of vector finite element method especially in low frequency. In the end, the accuracy of 2D MT responses modelling in low frequency (10-3 Hz-10-5 Hz) has been reached out under the efficient allocation memory of array and less computational time consuming.

  5. Dynamics of nuclear proliferation

    International Nuclear Information System (INIS)

    Meyer, S.M.

    1984-01-01

    This book looks beyond policy disputes to make a systematic examination of the assumptions and contending hypotheses that constitute contemporary thinking on nuclear proliferation. Rather than determine who is right or wrong, the intent is to develop a better picture by using the various schools of thought as analytic windows. A better understanding of how the process operates should offer better guidance for predicting future nuclear proliferation and, ultimately, for controlling it. Separate chapters deal with the contending views, the technological and motivational bases of nuclear proliferation, the presence of a technological imperative, testing the motivational hypothesis, the dynamics of the process, and forecasting. Four appendices present historical decisions, the technical model, cost-estimating procedures, and procedures for estimating nuclear propensities. 288 references, 17 figures, 26 tables

  6. Proliferation resistance modeling

    International Nuclear Information System (INIS)

    Bari, R.; Peterson, P.; Roglans, J.; Mladineo, S.; Nuclear Engineering Division; BNL; Univ. of California at Berkely; PNNL

    2004-01-01

    The National Nuclear Security Administration is developing methods for nonproliferation assessments. A working group on Nonproliferation Assessment Methodology (NPAM) assembled a toolbox of methods for various applications in the nonproliferation arena. One application of this methodology is to the evaluation of the proliferation resistance of Generation IV nuclear energy systems. This paper first summarizes the key results of the NPAM program and then provides results obtained thus far in the ongoing application, which is co-sponsored by the DOE Office of Nuclear Energy Science and Technology. In NPAM, a top-level measure of proliferation resistance for a fuel cycle system is developed from a hierarchy of metrics. The problem is decomposed into: metrics to be computed, barriers to proliferation, and a finite set of threats. The analyst models the process undertaken by the proliferant to overcome barriers to proliferation and evaluates the outcomes. In addition to proliferation resistance (PR) evaluation, the application also addresses physical protection (PP) evaluation against sabotage and theft. The Generation IV goal for future nuclear energy systems is to assure that they are very unattractive and the least desirable route for diversion or theft of weapons-usable materials, and provide increased physical protection against terrorism. An Expert Group, addressing this application, has identified six high-level measures for the PR goals (six measures have also been identified for the PP goals). Combined together, the complete set of measures provides information for program policy makers and system designers to compare specific system design features and integral system characteristics and to make choices among alternative options. The Group has developed a framework for a phased evaluation approach to analyzing PR and PP of system characteristics and to quantifying metrics and measures. This approach allows evaluations to become more detailed and representative

  7. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity.

    NARCIS (Netherlands)

    Boerboom, A.M.A.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  9. Newly constructed stable reporter cell lines for mechanistic studies on electrophile-responsive element-mediated gene expression reveal a role for flavonoid planarity

    NARCIS (Netherlands)

    Boerboom, A.M.J.F.; Vermeulen, M.; Woude, H. van der; Bremer, B.I.; Lee-Hilz, Y.Y.; Kampman, E.; Bladeren, P.J. van; Rietjens, I.M.C.M.; Aarts, J.M.M.J.G.

    2006-01-01

    The electrophile-responsive element (EpRE) is a transcriptional enhancer involved in cancer-chemoprotective gene expression modulation by certain food components. Two stably transfected luciferase reporter cell lines were developed, EpRE(hNQO1)-LUX and EpRE(mGST-Ya)-LUX, based on EpRE sequences from

  10. Enhanced efficacy of radiation-induced gene therapy in mice bearing lung adenocarcinoma xenografts using hypoxia responsive elements

    International Nuclear Information System (INIS)

    Wang Wei-dong; Chen Zheng-tang; Li De-zhi; Duan Yu-zhong; Cao Zheng-huai; Li Rong

    2005-01-01

    The aim of the present study was to investigate whether the hypoxia responsive element (HRE) could be used to enhance suicide gene (HSV-tk) expression and tumoricidal activity in radiation-controlled gene therapy of human lung adenocarcinoma xenografts. A chimeric promoter, HRE-Egr, was generated by directly linking a 0.3-kb fragment of HRE to a 0.6-kb human Egr-1 promoter. Retroviral vectors containing luciferase or the HSV-tk gene driven by Egr-1 or HRE-Egr were constructed. A human adenocarcinoma cell line (A549) was stably transfected with the above vectors using the lipofectamine method. The sensitivity of transfected cells to prodrug ganciclovir (GCV) and cell survival rates were analyzed after exposure to a dose of 2 Gy radiation and hypoxia (1%). In vivo, tumor xenografts in BALB/c mice were transfected with the constructed retroviruses and irradiated to a total dose of 6 Gy, followed by GCV treatment (20 mg/kg for 14 days). When the HSV-tk gene controlled by the HRE-Egr promoter was introduced into A549 cells by a retroviral vector, the exposure to 1% O 2 and 2 Gy radiation induced significant enhancement of GCV cytotoxicity to the cells. Moreover, in nude mice bearing solid tumor xenografts, only the tumors infected with the hybrid promoter-containing virus gradually disappeared after GCV administration and radiation. These results indicate that HRE can enhance transgene expression and tumoricidal activity in HSV-tk gene therapy controlled by ionizing radiation in hypoxic human lung adenocarcinoma. (author)

  11. Polybutylcyanoacrylate nanoparticles for delivering hormone response element-conjugated neurotrophin-3 to the brain of intracerebral hemorrhagic rats.

    Science.gov (United States)

    Chung, Chiu-Yen; Yang, Jen-Tsung; Kuo, Yung-Chih

    2013-12-01

    Hypertensive intracerebral hemorrhage (ICH) is a rapidly evolutional pathology, inducing necrotic cell death followed by apoptosis, and alters gene expression levels in surrounding tissue of an injured brain. For ICH therapy by controlled gene release, the development of intravenously administrable delivery vectors to promote the penetration across the blood-brain barrier (BBB) is a critical challenge. To enhance transfer efficiency of genetic materials under hypoxic conditions, polybutylcyanoacrylate (PBCA) nanoparticles (NPs) were used to mediate the intracellular transport of plasmid neurotrophin-3 (NT-3) containing hormone response element (HRE) with a cytomegalovirus (cmv) promoter and to differentiate induced pluripotent stem cells (iPSCs). The differentiation ability of iPSCs to neurons was justified by various immunological stains for protein fluorescence. The effect of PBCA NP/cmvNT-3-HRE complexes on treating ICH rats was studied by immunostaining, western blotting and Nissl staining. We found that the treatments with PBCA NP/cmvNT-3-HRE complexes increased the capability of differentiating iPSCs to express NT-3, TrkC and MAP-2. Moreover, PBCA NPs could protect cmvNT-3-HRE against degradation with EcoRI/PstI and DNase I in vitro and raise the delivery across the BBB in vivo. The administration of PBCA NP/cmvNT-3-HRE complexes increased the expression of NT-3, inhibited the expression of apoptosis-inducing factor, cleaved caspase-3 and DNA fragmentation, and reduced the cell death rate after ICH in vivo. PBCA NPs are demonstrated as an appropriate delivery system for carrying cmvNT-3-HRE to the brain for ICH therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

    Science.gov (United States)

    Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

    2013-08-01

    Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

  13. STAT3 Regulates Proliferation and Survival of CD8+ T Cells: Enhances Effector Responses to HSV-1 Infection, and Inhibits IL-10+ Regulatory CD8+ T Cells in Autoimmune Uveitis

    Directory of Open Access Journals (Sweden)

    Cheng-Rong Yu

    2013-01-01

    Full Text Available STAT3 regulates CD4+ T cell survival and differentiation. However, its effects on CD8+ T cells are not well understood. Here, we show that in comparison to WT CD8+ T cells, STAT3-deficient CD8+ T cells exhibit a preactivated memory-like phenotype, produce more IL-2, proliferate faster, and are more sensitive to activation-induced cell death (AICD. The enhanced proliferation and sensitivity to AICD correlated with downregulation of class-O forkhead transcription factors (FoxO1, FoxO3A, , , Bcl-2, OX-40, and upregulation of FasL, Bax, and Bad. We examined whether STAT3-deficient CD8+ T cells can mount effective response during herpes simplex virus (HSV-1 infection and experimental autoimmune uveitis (EAU. Compared to WT mice, HSV-1-infected STAT3-deficient mice (STAT3KO produced less IFN- and virus-specific KLRG-1+ CD8+ T cells. STAT3KO mice are also resistant to EAU and produced less IL-17-producing Tc17 cells. Resistance of STAT3KO to EAU correlated with marked expansion of IL-10-producing regulatory CD8+ T cells (CD8-Treg implicated in recovery from autoimmune encephalomyelitis. Thus, increases of IL-6-induced STAT3 activation observed during inflammation may inhibit expansion of CD8-Tregs, thereby impeding recovery from uveitis. These results suggest that STAT3 is a potential therapeutic target for upregulating CD8+ T cell-mediated responses to viruses and suggest the successful therapeutic targeting of STAT3 as treatment for uveitis, derived, in part, from promoting CD8-Treg expansion.

  14. Controlling nuclear proliferation

    International Nuclear Information System (INIS)

    Sweet, W.

    1981-01-01

    Nuclear non-proliferation policy depends on the 1968 Non-Proliferation Treaty, in which countries promise not to acquire nuclear weapons in exchange for open access to peaceful nuclear technology, and a system of international safeguards that are imposed on exported nuclear equipment and facilities operated by parties to the treaty. Critics have feared all along that non-nuclear countries might circumvent or exploit the system to obtain nuclear weapons and that the Atoms for Peace plan would spread the very technology it sought to control. The nuclear weapons states would like everyone else to believe that atomic bombs are undesirable, but they continue to rely on the bombs for their own defense. Israel's raid on Iraq's nuclear reactor focused world attention on the proliferation problem and helped to broaden and sterengthen its prospects. It also highlighted the weakness that there are no effective sanctions against violators. Until the international community can ageee on enforcement measures powerful enough to prevent nuclear proliferation, individual countries may be tempted to follow Israel's example, 19 references

  15. A 20 bp cis-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene.

    Science.gov (United States)

    Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B

    1995-01-01

    Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.

  16. Identification of an ICP27-responsive element in the coding region of a herpes simplex virus type 1 late gene.

    Science.gov (United States)

    Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A

    2010-03-01

    During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.

  17. Proliferation and mitogenic response to PDGF-BB of fibroblasts isolated from chronic venous leg ulcers is ulcer-age dependent

    DEFF Research Database (Denmark)

    Agren, M S; Steenfos, H H; Dabelsteen, S

    1999-01-01

    Several pathophysiologic mechanisms have been proposed to explain slow-healing leg ulcers, but little is known about the growth behavior of cells in these wounds. Platelet-derived growth factor-BB applied topically to chronic wounds has shown beneficial effects, although the effects have been less...... pronounced than would have been expected based on studies on acute wounds. The objective of this study was to compare fibroblasts in culture obtained from chronic wounds (non-healing chronic venous leg ulcers), acute wounds and normal dermis regarding growth, mitogenic response to platelet-derived growth...... chronic wounds have approached or even reached the end of their lifespan (phase III). This might provide one explanation for the non-healing state and therapy resistance to topical platelet-derived growth factor-BB of some venous leg ulcers....

  18. Does programmed CTL proliferation optimize virus control?

    DEFF Research Database (Denmark)

    Wodarz, Dominik; Thomsen, Allan Randrup

    2005-01-01

    CD8 T-cell or cytotoxic T-lymphocyte responses develop through an antigen-independent proliferation and differentiation program. This is in contrast to the previous thinking, which was that continuous antigenic stimulation was required. This Opinion discusses why nature has chosen the proliferati...

  19. Platelet lysate activates quiescent cell proliferation and reprogramming in human articular cartilage: Involvement of hypoxia inducible factor 1.

    Science.gov (United States)

    Nguyen, Van Thi; Cancedda, Ranieri; Descalzi, Fiorella

    2018-03-01

    The idea of rescuing the body self-repair capability lost during evolution is progressively gaining ground in regenerative medicine. In particular, growth factors and bioactive molecules derived from activated platelets emerged as promising therapeutic agents acting as trigger for repair of tissue lesions and restoration of tissue functions. Aim of this study was to assess the potential of a platelet lysate (PL) for human articular cartilage repair considering its activity on progenitor cells and differentiated chondrocytes. PL induced the re-entry in the cell cycle of confluent, growth-arrested dedifferentiated/progenitor cartilage cells. In a cartilage permissive culture environment, differentiated cells also resumed proliferation after exposure to PL. These findings correlated with an up-regulation of the proliferation/survival pathways ERKs and Akt and with an induction of cyclin D1. In short- and long-term cultures of articular cartilage explants, we observed a release of proliferating chondroprogenitors able to differentiate and form an "in vitro" tissue with properties of healthy articular cartilage. Moreover, in cultured cartilage cells, PL induced a hypoxia-inducible factor (HIF-1) alpha increase, its nuclear relocation and the binding to HIF-1 responsive elements. These events were possibly related to the cell proliferation because the HIF-1 inhibitor acriflavine inhibited HIF-1 binding to HIF-1 responsive elements and cell proliferation. Our study demonstrates that PL induces quiescent cartilage cell activation and proliferation leading to new cartilage formation, identifies PL activated pathways playing a role in these processes, and provides a rationale to the application of PL for therapeutic treatment of damaged articular cartilage. Copyright © 2017 John Wiley & Sons, Ltd.

  20. Proliferation in cycle

    Energy Technology Data Exchange (ETDEWEB)

    Piao Yunsong [College of Physical Sciences, Graduate School of Chinese Academy of Sciences, Beijing 100049 (China)], E-mail: yspiao@gucas.ac.cn

    2009-06-15

    In the contracting phase with w{approx_equal}0, the scale invariant spectrum of curvature perturbation is given by the increasing mode of metric perturbation. In this Letter, it is found that if the contracting phase with w{approx_equal}0 is included in each cycle of a cycle universe, since the metric perturbation is amplified on super horizon scale cycle by cycle, after each cycle the universe will be inevitably separated into many parts independent of one another, each of which corresponds to a new universe and evolves up to next cycle, and then is separated again. In this sense, a cyclic multiverse scenario is actually presented, in which the universe proliferates cycle by cycle. We estimate the number of new universes proliferated in each cycle, and discuss the implications of this result.

  1. Proliferation in cycle

    International Nuclear Information System (INIS)

    Piao Yunsong

    2009-01-01

    In the contracting phase with w≅0, the scale invariant spectrum of curvature perturbation is given by the increasing mode of metric perturbation. In this Letter, it is found that if the contracting phase with w≅0 is included in each cycle of a cycle universe, since the metric perturbation is amplified on super horizon scale cycle by cycle, after each cycle the universe will be inevitably separated into many parts independent of one another, each of which corresponds to a new universe and evolves up to next cycle, and then is separated again. In this sense, a cyclic multiverse scenario is actually presented, in which the universe proliferates cycle by cycle. We estimate the number of new universes proliferated in each cycle, and discuss the implications of this result.

  2. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    Science.gov (United States)

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-09-13

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

  3. Global proliferation concerns

    International Nuclear Information System (INIS)

    Simpkins, R.

    1978-01-01

    The Non-Proliferation Treaty and the IAGA Safeguards System are discussed. President Carter's program to defer commercial reprocessing and recycle, to restructure the breeder program, to develop alternative fuel cycles, to increase US uranium enrichment capability, to provide fuel assurance for consumer nations, to continue the embargo of sensitive technology and equipment and to develop the International Nuclear Fuel Cycle Evaluation Program is outlined

  4. Molecular mechanisms of the 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced inverted U-shaped dose responsiveness in anchorage independent growth and cell proliferation of human breast epithelial cells with stem cell characteristics

    International Nuclear Information System (INIS)

    Ahn, Nam-Shik; Hu, Hongbo; Park, Jin-Sung; Park, Joon-Suk; Kim, Jong-Sik; An, Sungwhan; Kong, Gu; Aruoma, Okezie I.; Lee, Yong-Soon; Kang, Kyung-Sun

    2005-01-01

    Although 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) has a variety of carcinogenic and noncarcinogenic effects in experimental animals, its role in human carcinogenicity remain controversial. A simian virus 40-immortalized cell line from normal human breast epithelial cells with stem cells and luminal characteristics (M13SV1) was used to study whether TCDD can induce AIG positive colony formation and cause increased cell numbers in a inverted U-shaped dose-response manner. TCDD activated Akt, ERK2, and increased the expression of CYP1A1, PAI-2, IL-lb mRNA, and ERK2 protein levels. TCDD was able to increased phosphorylation and expression of ERK2 in same dose-response manner as AIG positive colony formation. Thus, TCDD induced tumorigenicity in M13SV1, possibly through the phosphorylation of ERK2 and/or Akt. Further, cDNA microarray with 7448 sequence-verified clones was used to profile various gene expression patterns after treatment of TCDD. Three clear patterns could be delineated: genes that were dose-dependently up-regulated, genes expressed in either U-shape and/or inverted U-shape. The fact that these genes are intrinsically related to breast epithelial cell proliferation and survival clearly suggests that they may be involved in the TCDD-induced breast tumorigenesis

  5. Quantitative proteomic analysis of HIV-1 infected CD4+ T cells reveals an early host response in important biological pathways: Protein synthesis, cell proliferation, and T-cell activation

    Energy Technology Data Exchange (ETDEWEB)

    Navare, Arti T.; Sova, Pavel; Purdy, David E.; Weiss, Jeffrey M. [Department of Microbiology, University of Washington, Seattle, WA (United States); Wolf-Yadlin, Alejandro [Department of Genome Sciences, University of Washington, Seattle, WA (United States); Korth, Marcus J.; Chang, Stewart T.; Proll, Sean C. [Department of Microbiology, University of Washington, Seattle, WA (United States); Jahan, Tahmina A. [Proteomics Resource, UW Medicine at South Lake Union, Seattle, WA (United States); Krasnoselsky, Alexei L.; Palermo, Robert E. [Department of Microbiology, University of Washington, Seattle, WA (United States); Katze, Michael G., E-mail: honey@uw.edu [Department of Microbiology, University of Washington, Seattle, WA (United States); Washington National Primate Research Center, University of Washington, Seattle, WA (United States)

    2012-07-20

    Human immunodeficiency virus (HIV-1) depends upon host-encoded proteins to facilitate its replication while at the same time inhibiting critical components of innate and/or intrinsic immune response pathways. To characterize the host cell response on protein levels in CD4+ lymphoblastoid SUP-T1 cells after infection with HIV-1 strain LAI, we used mass spectrometry (MS)-based global quantitation with iTRAQ (isobaric tag for relative and absolute quantification). We found 266, 60 and 22 proteins differentially expressed (DE) (P-value{<=}0.05) at 4, 8, and 20 hours post-infection (hpi), respectively, compared to time-matched mock-infected samples. The majority of changes in protein abundance occurred at an early stage of infection well before the de novo production of viral proteins. Functional analyses of these DE proteins showed enrichment in several biological pathways including protein synthesis, cell proliferation, and T-cell activation. Importantly, these early changes before the time of robust viral production have not been described before.

  6. Gas Centrifuges and Nuclear Proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Albright, David

    2004-09-15

    Gas centrifuges have been an ideal enrichment method for a wide variety of countries. Many countries have built gas centrifuges to make enriched uranium for peaceful nuclear purposes. Other countries have secretly sought centrifuges to make highly enriched uranium for nuclear weapons. In more recent times, several countries have secretly sought or built gas centrifuges in regions of tension. The main countries that have been of interest in the last two decades have been Pakistan, Iraq, Iran, and North Korea. Currently, most attention is focused on Iran, Pakistan, and North Korea. These states did not have the indigenous abilities to make gas centrifuges, focusing instead on illicit and questionable foreign procurement. The presentation covered the following main sections: Spread of centrifuges through illicit procurement; Role of export controls in stopping proliferation; Increasing the transparency of gas centrifuge programs in non-nuclear weapon states; and, Verified dismantlement of gas centrifuge programs. Gas centrifuges are important providers of low enriched uranium for civil nuclear power reactors. They also pose special nuclear proliferation risks. We all have special responsibilities to prevent the spread of gas centrifuges into regions of tension and to mitigate the consequences of their spread into the Middle East, South Asia, and North Asia.

  7. Nuclear toxicology file: cell response to the steady or radioactive chemical elements exposure; Dossier toxicologie nucleaire: reponse cellulaire a l'exposition aux elements chimiques stables ou radioactifs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, B.S.; Saintigny, Y. [Centre National de la Recherche Scientifique (CNRS), Sciences du Vivant, UMR 217, 92 - Fontenay aux Roses (France); CEA Fontenay aux Roses, IRCM, UMR 217, 92 (France); Adam, Ch. [Institut de Radioprotection et de Surete Nucleaire (IRSN:DEI/SECRE), Lab. de Radioecologie et d' Ecotoxicologie, 13 - Saint-Paul-lez-Durance (France)

    2008-09-15

    The cellular response to an exposure in a toxic element is made at different levels. The first level is the agent detoxication by its elimination or its neutralization. The second level is the repair of the damages caused by this agent (for example the DNA repair). The third level is the control of the cellular death programmed to eliminate the irreparably damaged cells.Finally, the hurt cell can inform the nearby cells by producing molecular effectors inducing an abscopal or bystander effect. (N.C.)

  8. Apoptosis, proliferation and p53, cyclin D1, and retinoblastoma gene expression in relation to radiation response in transitional cell carcinoma of the bladder

    International Nuclear Information System (INIS)

    Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry

    2001-01-01

    .6%) had a significantly better local control rate (p=0.035). Ki67 index (p=0.35), retinoblastoma gene expression (p=0.30) and cyclin D1 overexpression (p=0.61) were not found to have an additional predictive value regarding local tumor control. None of the tested biologic parameters were found to be associated with overall survival. Time to distant metastases was significantly shorter for tumors with high Ki67 index (p=0.01) and tumors with an apoptotic index less than median (p=0.009). Conclusions: The results of our study provide evidence for a prognostic value of p53 expression and apoptotic index with respect to the radiation response in bladder cancer in addition to more conventional prognosticators. The value of these parameters as a predictive assay for radiation response warrants confirmation in larger and prospective studies

  9. High-resolution quantification of root dynamics in split-nutrient rhizoslides reveals rapid and strong proliferation of maize roots in response to local high nitrogen.

    Science.gov (United States)

    in 't Zandt, Dina; Le Marié, Chantal; Kirchgessner, Norbert; Visser, Eric J W; Hund, Andreas

    2015-09-01

    The plant's root system is highly plastic, and can respond to environmental stimuli such as high nitrogen (N) in patches. A root may respond to an N patch by selective placement of new lateral roots, and therewith increases root N uptake. This may be a desirable trait in breeding programmes, since it decreases NO3(-) leaching and N2O emission. Roots of maize (Zea mays L.) were grown without N in split-nutrient rhizoslides. One side of the slides was exposed to high N after 15 d of root development, and root elongation was measured for another 15 d, described in a time course model and parameterized. The elongation rates of crown axile roots on the N-treated side of the plant followed a logistic increase to a maximum of 5.3cm d(-1); 95% of the maximum were reached within 4 d. At the same time, on the untreated side, axile root elongation dropped linearly to 1.2cm d(-1) within 6.4 d and stayed constant thereafter. Twice as many lateral roots were formed on the crown axis on the N side compared to the untreated side. Most strikingly, the elongation rates of laterals of the N side increased linearly with most of the roots reaching an asymptote ~8 d after start of the N treatment. By contrast, laterals on the side without N did not show any detectable elongation beyond the first day after their emergence. We conclude that split-nutrient rhizoslides have great potential to improve our knowledge about nitrogen responsiveness and selection for contrasting genotypes. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  10. Nuclear proliferation in developing countries: A comparative study for selected countries

    International Nuclear Information System (INIS)

    Chun Woong.

    1991-01-01

    This study explores major conditions conducive to nuclear proliferation to project possible proliferation trends in the future and, hopefully, to suggest some effective strategies to address the problem of nuclear proliferation. It attempts to provide a qualitative analysis of the causes and trends of nuclear proliferation by presenting generalizations of the causes of proliferation. While a variety of factors can be considered as causes of proliferation, three primary factors appear to influence the prospects for proliferation: (1) the technical capabilities and constraints; (2) motivation: incentives and disincentives; and (3) particular domestic and international situations. It is generally hypothesized that in order for a country to go nuclear, two basic conditions - some minimum level of indigenous national capability and strong motivations - must be simultaneously satisfied. It is concluded that while technology is, of course, one element necessary for the nuclear-proliferation process, the fundamental conditions of nuclear proliferation appear to be motivational factors

  11. United States non-proliferation policy

    International Nuclear Information System (INIS)

    Scheinman, L.

    1978-01-01

    U.S. non-proliferation policy is aimed at slowing the spread of nuclear weapons capabilities, managing the destabilizing effects of nuclear technology for energy purposes, and fostering international standards and institutions to deal responsibly with global nuclear development. These goals assume that nuclear technology has not already precluded social control and recognize the social benefits offered by peaceful uses of atomic energy. Non-proliferation policies recognize that the motivation for possessing nuclear weapons is a more-difficult problem than technical ability and will concentrate on reducing those incentives through international agreements and safeguards and by maintaining the separation of commercial nuclear fuel cycles and military uses

  12. Proliferation after the Iraq war

    International Nuclear Information System (INIS)

    Daguzan, J.F.

    2004-09-01

    This article uses the Iraq war major event to analyze the approach used by the US to fight against proliferation. It questions the decision and analysis process which has led to the US-British intervention and analyzes the consequences of the war on the proliferation of other countries and on the expected perspectives. Finally, the future of proliferation itself is questioned: do we have to fear more threat or is the virtuous circle of non-proliferation well started? (J.S.)

  13. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Yan-Zhuo Yang

    Full Text Available The plant hormone abscisic acid (ABA plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  14. A distal ABA responsive element in AtNCED3 promoter is required for positive feedback regulation of ABA biosynthesis in Arabidopsis.

    Science.gov (United States)

    Yang, Yan-Zhuo; Tan, Bao-Cai

    2014-01-01

    The plant hormone abscisic acid (ABA) plays a crucial role in plant development and responses to abiotic stresses. Recent studies indicate that a positive feedback regulation by ABA exists in ABA biosynthesis in plants under dehydration stress. To understand the molecular basis of this regulation, we analyzed the cis-elements of the AtNCED3 promoter in Arabidopsis. AtNCED3 encodes the first committed and highly regulated dioxygenase in the ABA biosynthetic pathway. Through delineated and mutagenesis analyses in stable-transformed Arabidopsis, we revealed that a distal ABA responsive element (ABRE: GGCACGTG, -2372 to -2364 bp) is required for ABA-induced AtNCED3 expression. By analyzing the AtNCED3 expression in ABRE binding protein ABF3 over-expression transgenic plants and knock-out mutants, we provide evidence that the ABA feedback regulation of AtNCED3 expression is not mediated by ABF3.

  15. Oxidative DNA damage and mammary cell proliferation by alcohol-derived salsolinol.

    Science.gov (United States)

    Murata, Mariko; Midorikawa, Kaoru; Kawanishi, Shosuke

    2013-10-21

    Drinking alcohol is a risk factor for breast cancer. Salsolinol (SAL) is endogenously formed by a condensation reaction of dopamine with acetaldehyde, a major ethanol metabolite, and SAL is detected in blood and urine after alcohol intake. We investigated the possibility that SAL can participate in tumor initiation and promotion by causing DNA damage and cell proliferation, leading to alcohol-associated mammary carcinogenesis. SAL caused oxidative DNA damage including 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), in the presence of transition metal ions, such as Cu(II) and Fe(III)EDTA. Inhibitory effects of scavengers on SAL-induced DNA damage and the electron spin resonance study indicated the involvement of H₂O₂, which is generated via the SAL radical. Experiments on scavengers and site specificity of DNA damage suggested ·OH generation via a Fenton reaction and copper-peroxide complexes in the presence of Fe(III)EDTA and Cu(II), respectively. SAL significantly increased 8-oxodG formation in normal mammary epithelial MCF-10A cells. In addition, SAL induced cell proliferation in estrogen receptor (ER)-negative MCF-10A cells, and the proliferation was inhibited by an antioxidant N-acetylcysteine and an epidermal growth factor receptor (EGFR) inhibitor AG1478, suggesting that reactive oxygen species may participate in the proliferation of MCF-10A cells via EGFR activation. Furthermore, SAL induced proliferation in estrogen-sensitive breast cancer MCF-7 cells, and a surface plasmon resonance sensor revealed that SAL significantly increased the binding activity of ERα to the estrogen response element but not ERβ. In conclusion, SAL-induced DNA damage and cell proliferation may play a role in tumor initiation and promotion of multistage mammary carcinogenesis in relation to drinking alcohol.

  16. Nuclear arbitration: Interpreting non-proliferation agreements

    International Nuclear Information System (INIS)

    Tzeng, Peter

    2015-01-01

    At the core of the nuclear non-proliferation regime lie international agreements. These agreements include, inter alia, the Nuclear Non-proliferation Treaty, nuclear co-operation agreements and nuclear export control agreements.1 States, however, do not always comply with their obligations under these agreements. In response, commentators have proposed various enforcement mechanisms to promote compliance. The inconvenient truth, however, is that states are generally unwilling to consent to enforcement mechanisms concerning issues as critical to national security as nuclear non-proliferation.3 This article suggests an alternative solution to the non-compliance problem: interpretation mechanisms. Although an interpretation mechanism does not have the teeth of an enforcement mechanism, it can induce compliance by providing an authoritative interpretation of a legal obligation. Interpretation mechanisms would help solve the non-compliance problem because, as this article shows, in many cases of alleged non-compliance with a non-proliferation agreement, the fundamental problem has been the lack of an authoritative interpretation of the agreement, not the lack of an enforcement mechanism. Specifically, this article proposes arbitration as the proper interpretation mechanism for non-proliferation agreements. It advocates the establishment of a 'Nuclear Arbitration Centre' as an independent branch of the International Atomic Energy Agency (IAEA), and recommends the gradual introduction of arbitration clauses into the texts of non-proliferation agreements. Section I begins with a discussion of international agreements in general and the importance of interpretation and enforcement mechanisms. Section II then discusses nuclear non-proliferation agreements and their lack of interpretation and enforcement mechanisms. Section III examines seven case studies of alleged non-compliance with non-proliferation agreements in order to show that the main problem in many cases

  17. The role of the glucose-sensing transcription factor carbohydrate-responsive element-binding protein pathway in termite queen fertility

    Czech Academy of Sciences Publication Activity Database

    Sillam-Dusses, D.; Hanus, Robert; Poulsen, M.; Roy, V.; Favier, M.; Vasseur-Cognet, M.

    2016-01-01

    Roč. 6, č. 5 (2016), č. článku 160080. ISSN 2046-2441 R&D Projects: GA ČR(CZ) GA14-12774S Institutional support: RVO:61388963 Keywords : reproduction * phenotypic plasticity * carbohydrate-responsive element-binding protein * transcription factor * social insects * lipogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016 http://rsob.royalsocietypublishing.org/content/6/5/160080

  18. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

    OpenAIRE

    Itzhaki, H; Maxson, J M; Woodson, W R

    1994-01-01

    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define ...

  19. Limiting Future Proliferation and Security Risks

    International Nuclear Information System (INIS)

    Bari, R.

    2011-01-01

    A major new technical tool for evaluation of proliferation and security risks has emerged over the past decade as part the activities of the Generation IV International Forum. The tool has been developed by a consensus group from participating countries and organizations and is termed the Proliferation Resistance and Physical Protection (PR and PP) Evaluation Methodology. The methodology defines a set of challenges, analyzes system response to these challenges, and assesses outcomes. The challenges are the threats posed by potential actors (proliferant states or sub-national adversaries). It is of paramount importance in an evaluation to establish the objectives, capabilities, resources, and strategies of the adversary as well as the design and protection contexts. Technical and institutional characteristics are both used to evaluate the response of the system and to determine its resistance against proliferation threats and robustness against sabotage and terrorism threats. The outcomes of the system response are expressed in terms of a set of measures, which thereby define the PR and PP characteristics of the system. This paper summarizes results of applications of the methodology to nuclear energy systems including reprocessing facilities and large and small modular reactors. The use of the methodology in the design phase a facility will be discussed as it applies to future safeguards concepts.

  20. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  1. Signatures of rare-earth elements in banded corals of Kalpeni atoll-Lakshadweep archipelago in response to monsoonal variations

    Digital Repository Service at National Institute of Oceanography (India)

    Naqvi, S.A.S.; Nath, B.N.; Balaram, V.

    Concentrations of rare-earth elements (REE) have been determined in seasonal bands of Porites species collected from the Lakshadweep lagoon. Total REE (REE) are very low (less than 3 ppm) in these corals. Seasonal variations in REE appear to have...

  2. Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

    Science.gov (United States)

    Wang, F; Samudio, I; Safe, S

    2001-01-01

    The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

  3. An IFNG SNP with an estrogen-like response element selectively enhances promoter expression in peripheral but not lamina propria T cells.

    Science.gov (United States)

    Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R

    2006-07-01

    This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.

  4. Can we predict nuclear proliferation

    International Nuclear Information System (INIS)

    Tertrais, Bruno

    2011-01-01

    The author aims at improving nuclear proliferation prediction capacities, i.e. the capacities to identify countries susceptible to acquire nuclear weapons, to interpret sensitive activities, and to assess nuclear program modalities. He first proposes a retrospective assessment of counter-proliferation actions since 1945. Then, based on academic studies, he analyzes what causes and motivates proliferation, with notably the possibility of existence of a chain phenomenon (mechanisms driving from one program to another). He makes recommendations for a global approach to proliferation prediction, and proposes proliferation indices and indicators

  5. Sphingosine kinase 1 is regulated by peroxisome proliferator-activated receptor α in response to free fatty acids and is essential for skeletal muscle interleukin-6 production and signaling in diet-induced obesity.

    Science.gov (United States)

    Ross, Jessica S; Hu, Wei; Rosen, Bess; Snider, Ashley J; Obeid, Lina M; Cowart, L Ashley

    2013-08-02

    We previously demonstrated that sphingosine kinase 1 (Sphk1) expression and activity are up-regulated by exogenous palmitate (PAL) in a skeletal muscle model system and in diet-induced obesity in mice; however, potential functions and in vivo relevance of this have not been addressed. Here, we aimed to determine the mechanism by which PAL regulates SphK1 in muscle, and to determine potential roles for its product, sphingosine-1-phosphate (S1P), in muscle biology in the context of obesity. Cloning and analysis of the mouse Sphk1 promoter revealed a peroxisome proliferator-activated receptor (PPAR) α cis-element that mediated activation of a reporter under control of the Sphk1 promoter; direct interaction of PPARα was demonstrated by chromatin immunoprecipitation. PAL treatment induced the proinflammatory cytokine interleukin (IL)-6 in a manner dependent on SphK1, and this was attenuated by inhibition of the sphingosine-1-phosphate receptor 3 (S1PR3). Diet-induced obesity in mice demonstrated that IL-6 expression in muscle, but not adipose tissue, increased in obesity, but this was attenuated in Sphk1(-/-) mice. Moreover, plasma IL-6 levels were significantly decreased in obese Sphk1(-/-) mice relative to obese wild type mice, and muscle, but not adipose tissue IL-6 signaling was activated. These data indicate that PPARα regulates Sphk1 expression in the context of fatty acid oversupply and links PAL to muscle IL-6 production. Moreover, this function of SphK1 in diet-induced obesity suggests a potential role for SphK1 in obesity-associated pathological outcomes.

  6. Identification of Smad Response Elements in the Promoter of Goldfish FSHβ Gene and Evidence for Their Mediation of Activin and GnRH Stimulation of FSHβ Expression

    Directory of Open Access Journals (Sweden)

    Man-Tat eLau

    2012-03-01

    Full Text Available As an essential hormone regulating gonads in vertebrates, the biosynthesis and secretion of follicle-stimulating hormone (FSH is controlled by a variety of endocrine and paracrine factors in both mammalian and non-mammalian vertebrates. Activin was initially discovered in the ovary for its specific stimulation of FSH secretion by the pituitary cells. Our earlier studies in fish have shown that activin stimulates FSHβ but suppresses LHβ expression in both the goldfish and zebrafish. Further experiments showed that the regulation of FSHβ in fish occurred at the promoter level involving Smads, in particular Smad3. To further understand the mechanisms by which activin/Smad regulates FSHβ transcription, the present study was undertaken to analyze the promoter of goldfish FSHβ gene (fshb with the aim to identify potential cis-regulatory elements responsible for activin/Smad stimulation. Both serial deletion and site-directed mutagenesis were used, and the promoter activity was tested in the LβT2 cells, a murine gonadotroph cell line. The reporter constructs of goldfish FSHβ promoter-SEAP (secreted alkaline phosphatase were co-transfected with an expression plasmid for Smads (2 or 3 followed by measurement of SEAP activity in the medium. Two putative Smad responsive elements (SRE were identified in the promoter at distal and proximal regions, respectively. The distal site contained a consensus Smad binding element (SBE; AGAC, -1675/-1672 whereas the proximal site (GACCTTGA, -212/-205 was identical to an SF-1 binding site reported in humans, which was preceded by a sequence (AACACTGA highly conserved between fish and mammals. The proximal site also seemed to be involved in mediating stimulation of FSHβ expression by gonadotropin-releasing hormone (GnRH and its potential interaction with activin. In conclusion, we have identified two potential cis-regulatory elements in the promoter of goldfish FSHβ that are responsible for activin

  7. HIGH PERCENTAGE OF RARE EARTH ELEMENT CONNECTION WITH THE ACCUMULATION SEDIMENT AS RESPONSE LONGSHORE CURRENTS IN THE BELITUNG WATERS

    Directory of Open Access Journals (Sweden)

    Delyuzar Ilahude

    2017-07-01

    Full Text Available The study area is geographically located in the West coast of Belitung island at coordinates 105o48'00" - 106o06' 00" E and 06o46'00" - 06o50' 00" S. The beach and coastal area is influenced by wave energy from the West and North directions The purpose of this study is to analyze the relationship between the zone of sediment accumulation of empirical approaches on oceanography parameter containing rare earth elements. The approach used is to predict the shore wave energy using wave prediction curve deep waters to obtain the energy flux of the wave at each point of reference. Sediments containing rare earth elements tend to lead to the south as a result of the movement of longshore currents. Regional coastal area of the western part of the island of Belitung, especially in the southern part of the estuary of the river Tanjung Pandan is estimated to be a zone of sediment accumulation. The movement of sediment caused by wave energy from the north led to sedimentation evolved significantly in the south which is thought to contain rare earths minerals derived from land. This sedimentation process takes place on a seasonal basis, which allegedly took place in the west. The movement of sediment to the south of the mouth of the Cerucuk River it is predicted that rare earth elements were supplied from these rivers tend to settle in the southern part of the estuary Cerucuk throughout the year.

  8. Extended spectrum β-lactamases, carbapenemases and mobile genetic elements responsible for antibiotics resistance in Gram-negative bacteria.

    Science.gov (United States)

    El Salabi, Allaaeddin; Walsh, Timothey R; Chouchani, Chedly

    2013-05-01

    Infectious diseases due to Gram-negative bacteria are a leading cause of morbidity and mortality worldwide. Antimicrobial agents represent one major therapeutic tools implicated to treat these infections. The misuse of antimicrobial agents has resulted in the emergence of resistant strains of Gram-negatives in particular Enterobacteriaceae and non-fermenters; they have an effect not only on a human but on the public health when bacteria use the resistance mechanisms to spread in the hospital environment and to the community outside the hospitals by means of mobile genetic elements. Gram-negative bacteria have become increasingly resistant to antimicrobial agents. They have developed several mechanisms by which they can withstand to antimicrobials, these mechanisms include the production of Extended-spectrum β-lactamases (ESBLs) and carbapenemases, furthermore, Gram-negative bacteria are now capable of spreading such resistance between members of the family Enterobacteriaceae and non-fermenters using mobile genetic elements as vehicles for such resistance mechanisms rendering antibiotics useless. Therefore, addressing the issue of mechanisms of antimicrobial resistance is considered one of most urgent priorities. This review will help to illustrate different resistance mechanisms; ESBLs, carbapenemases encoded by genes carried by mobile genetic elements, which are used by Gram-negative bacteria to escape antimicrobial effect.

  9. Use of a questionnaire design as an element of nuclear energy generating enterprises social responsibility public audit

    International Nuclear Information System (INIS)

    Gushchina, M.O.; Pryalyin, M.A.; Torganova, O.B.

    2006-01-01

    In the article we describe some issues concerning corporate social responsibility to a society from the point of view its influence on image of an enterprise. We present results of a social investigation regarding to evaluation of social responsibility of the 'South-Ukraine Nuclear Power Plant'

  10. Non-proliferation

    International Nuclear Information System (INIS)

    Deiseroth, D.; Gustafsson, S.

    1993-01-01

    The issue of Nuclear Non Proliferation has been moved to a leading place on the contemporary international security agenda. What about the situation of nuclear weapons and nuclear technology in Russia, Kazakhstan, Ukraine and Belorussia? Why did the IAEA-inspectors totally failed to discover any sign of Iraq's clandestine nuclear-weapon programme before the Gulf War? Do the NATO and their nuclear power states violate Art. VI of the Non-Proliferation-Treaty (NPT), because they are - despite the end of the cold war - not willing to renounce of the ''option of the first use of nuclear weapons''? Does the NPT establish a form of nuclear apartheid? What will be the situation if the NPT-Extension-Conference in 1995 will be unable to obtain a majority of the parties for any one extension proposal? Do we need a new international nuclear control agency with severe powers, a sort of nuclear Interpol? The Colloquium ''Saving NPT and abolishing Nuclear Weapons'', held in Stockholm in September 1992, organized by the Swedish and the German Sections of IALANA, tried to analyse some of the raised issues. (orig.) [de

  11. Initiatives for proliferation prevention

    International Nuclear Information System (INIS)

    1997-04-01

    Preventing the proliferation of weapons of mass destruction is a central part of US national security policy. A principal instrument of the Department of Energy's (DOE's) program for securing weapons of mass destruction technology and expertise and removing incentives for scientists, engineers and technicians in the newly independent states (NIS) of the former Soviet Union to go to rogue countries or assist terrorist groups is the Initiatives for Proliferation Prevention (IPP). IPP was initiated pursuant to the 1994 Foreign Operations Appropriations Act. IPP is a nonproliferation program with a commercialization strategy. IPP seeks to enhance US national security and to achieve nonproliferation objectives by engaging scientists, engineers and technicians from former NIS weapons institutes; redirecting their activities in cooperatively-developed, commercially viable non-weapons related projects. These projects lead to commercial and economic benefits for both the NIS and the US IPP projects are funded in Russian, Ukraine, Kazakhstan and Belarus. This booklet offers an overview of the IPP program as well as a sampling of some of the projects which are currently underway

  12. Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

    Science.gov (United States)

    Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

    2000-06-01

    17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

  13. Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

    Science.gov (United States)

    Kizis, Dimosthenis; Pagès, Montserrat

    2002-06-01

    The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

  14. The challenges of nuclear proliferation

    International Nuclear Information System (INIS)

    Le Guelte, Georges

    2015-01-01

    The author of this article first outlines that the Non Proliferation Treaty (NPT) is a tool of domination used by nuclear powers: they can keep and even develop their own nuclear arsenal, while other countries who sign this treaty commit themselves not to try to acquire nuclear weapons. The USA and USSR kept on persuading various countries to sign this treaty, but eventually let some countries develop their military nuclear programme (Israel, Pakistan, or India). He evokes technical difficulties in the application of the Treaty, notably for the control of centrifugation activities. He outlines that the USA have now a dominant position with respect to this Treaty and its application, but that the Treaty remains a major safety element for the world. He evokes more recent and negative evolutions: the withdrawal of North Korea from the Treaty, the destruction of an Iraqi nuclear reactor by Israel (i.e. the destruction of a nuclear installation belonging to a country who signed the NPT by a country who did not sign it). He proposes an overview of the Iranian issue (history of the Iranian nuclear programme, of the nuclear crisis, of the still going on negotiations), and describes what could be the worst possible scenario

  15. ASSESSING THE PROLIFERATION RESISTANCE OF INNOVATIVE NUCLEAR FUEL CYCLES

    International Nuclear Information System (INIS)

    BARI, R.; ROGLANS, J.; DENNING, R.; MLADINEO, S.

    2003-01-01

    The National Nuclear Security Administration is developing methods for nonproliferation assessments to support the development and implementation of U.S. nonproliferation policy. This paper summarizes the key results of that effort. Proliferation resistance is the degree of difficulty that a nuclear material, facility, process, or activity poses to the acquisition of one or more nuclear weapons. A top-level measure of proliferation resistance for a fuel cycle system is developed here from a hierarchy of metrics. At the lowest level, intrinsic and extrinsic barriers to proliferation are defined. These barriers are recommended as a means to characterize the proliferation characteristics of a fuel cycle. Because of the complexity of nonproliferation assessments, the problem is decomposed into: metrics to be computed, barriers to proliferation, and a finite set of threats. The spectrum of potential threats of nuclear proliferation is complex and ranges from small terrorist cells to industrialized countries with advanced nuclear fuel cycles. Two general categories of methods have historically been used for nonproliferation assessments: attribute analysis and scenario analysis. In the former, attributes of the systems being evaluated (often fuel cycle systems) are identified that affect their proliferation potential. For a particular system under consideration, the attributes are weighted subjectively. In scenario analysis, hypothesized scenarios of pathways to proliferation are examined. The analyst models the process undertaken by the proliferant to overcome barriers to proliferation and estimates the likelihood of success in achieving a proliferation objective. An attribute analysis approach should be used at the conceptual design level in the selection of fuel cycles that will receive significant investment for development. In the development of a detailed facility design, a scenario approach should be undertaken to reduce the potential for design vulnerabilities

  16. Radiographic element

    International Nuclear Information System (INIS)

    Abbott, T.I.; Jones, C.G.

    1984-01-01

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  17. Uncertainties in Nuclear Proliferation Modeling

    International Nuclear Information System (INIS)

    Kim, Chul Min; Yim, Man-Sung; Park, Hyeon Seok

    2015-01-01

    There have been various efforts in the research community to understand the determinants of nuclear proliferation and develop quantitative tools to predict nuclear proliferation events. Such systematic approaches have shown the possibility to provide warning for the international community to prevent nuclear proliferation activities. However, there are still large debates for the robustness of the actual effect of determinants and projection results. Some studies have shown that several factors can cause uncertainties in previous quantitative nuclear proliferation modeling works. This paper analyzes the uncertainties in the past approaches and suggests future works in the view of proliferation history, analysis methods, and variable selection. The research community still lacks the knowledge for the source of uncertainty in current models. Fundamental problems in modeling will remain even other advanced modeling method is developed. Before starting to develop fancy model based on the time dependent proliferation determinants' hypothesis, using graph theory, etc., it is important to analyze the uncertainty of current model to solve the fundamental problems of nuclear proliferation modeling. The uncertainty from different proliferation history coding is small. Serious problems are from limited analysis methods and correlation among the variables. Problems in regression analysis and survival analysis cause huge uncertainties when using the same dataset, which decreases the robustness of the result. Inaccurate variables for nuclear proliferation also increase the uncertainty. To overcome these problems, further quantitative research should focus on analyzing the knowledge suggested on the qualitative nuclear proliferation studies

  18. Prediction and analysis of human thoracic impact responses and injuries in cadaver impacts using a full human body finite element model.

    Science.gov (United States)

    Ruan, Jesse; El-Jawahri, Raed; Chai, Li; Barbat, Saeed; Prasad, Priya

    2003-10-01

    Human thoracic dynamic responses and injuries associated with frontal impact, side impact, and belt loading were investigated and predicted using a complete human body finite element model for an average adult male. The human body model was developed to study the impact biomechanics of a vehicular occupant. Its geometry was based on the Visible Human Project (National Library of Medicine) and the topographies from human body anatomical texts. The data was then scaled to an average adult male according to available biomechanical data from the literature. The model includes details of the head, neck, ribcage, abdomen, thoracic and lumbar spine, internal organs of the chest and abdomen, pelvis, and the upper and lower extremities. The present study is focused on the dynamic response and injuries of the thorax. The model was validated at various impact speeds by comparing predicted responses with available experimental cadaver data in frontal and side pendulum impacts, as well as belt loading. Model responses were compared with similar individual cadaver tests instead of using cadaver corridors because the large differences between the upper and lower bounds of the corridors may confound the model validation. The validated model was then used to study thorax dynamic responses and injuries in various simulated impact conditions. Parameters that could induce injuries such as force, deflection, and stress were computed from model simulations and were compared with previously proposed thoracic injury criteria to assess injury potential for the thorax. It has been shown that the model exhibited speed sensitive impact characteristics, and the compressibility of the internal organs significantly influenced the overall impact response in the simulated impact conditions. This study demonstrates that the development of a validated FE human body model could be useful for injury assessment in various cadaveric impacts reported in the literature. Internal organ injuries, which are

  19. The Seismic Response of High-Speed Railway Bridges Subjected to Near-Fault Forward Directivity Ground Motions Using a Vehicle-Track-Bridge Element

    Directory of Open Access Journals (Sweden)

    Chen Ling-kun

    2014-01-01

    Full Text Available Based on the Next Generation Attenuation (NGA project ground motion library, the finite element model of the high-speed railway vehicle-bridge system is established. The model was specifically developed for such system that is subjected to near-fault ground motions. In addition, it accounted for the influence of the rail irregularities. The vehicle-track-bridge (VTB element is presented to simulate the interaction between train and bridge, in which a train can be modeled as a series of sprung masses concentrated at the axle positions. For the short period railway bridge, the results from the case study demonstrate that directivity pulse effect tends to increase the seismic responses of the bridge compared with far-fault ground motions or nonpulse-like motions and the directivity pulse effect and high values of the vertical acceleration component can notably influence the hysteretic behaviour of piers.

  20. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    Science.gov (United States)

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-10-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element.

  1. The nuclear proliferation

    International Nuclear Information System (INIS)

    Gere, F.

    1995-04-01

    In this book is detailed the beginning of nuclear military power, with the first bomb of Hiroshima, the different ways of getting uranium 235 and plutonium 239, and how the first countries (Usa, Ussr, China, United kingdom, France) got nuclear weapons. Then the most important part is reviewed with the details of non-proliferation treaty and the creation of IAEA to promote civilian nuclear power in the world and to control the use of plutonium and uranium in nuclear power plants. The cases of countries who reached the atom mastery, such Israel, South Africa, Pakistan, Iraq, North Korea, Argentina, Brazil, Iran, Algeria, Taiwan and the reasons which they wanted nuclear weapon for or why they gave up, are exposed

  2. Standard elements; Elements standards

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, B [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1958-07-01

    Following his own experience the author recalls the various advantages, especially in the laboratory, of having pre-fabricated vacuum-line components at his disposal. (author) [French] A la suite de sa propre experience, l'auteur veut rappeler les divers avantages que presente, tout particulierement en laboratoire, le fait d'avoir a sa disposition des elements pre-fabriques de canalisations a vide. (auteur)

  3. Iptakalim inhibits PDGF-BB-induced human airway smooth muscle cells proliferation and migration

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Wenrui; Kong, Hui; Zeng, Xiaoning; Wang, Jingjing; Wang, Zailiang; Yan, Xiaopei; Wang, Yanli; Xie, Weiping, E-mail: wpxie@njmu.edu.cn; Wang, Hong, E-mail: hongwang@njmu.edu.cn

    2015-08-15

    Chronic airway diseases are characterized by airway remodeling which is attributed partly to the proliferation and migration of airway smooth muscle cells (ASMCs). ATP-sensitive potassium (K{sub ATP}) channels have been identified in ASMCs. Mount evidence has suggested that K{sub ATP} channel openers can reduce airway hyperresponsiveness and alleviate airway remodeling. Opening K{sup +} channels triggers K{sup +} efflux, which leading to membrane hyperpolarization, preventing Ca{sup 2+}entry through closing voltage-operated Ca{sup 2+} channels. Intracellular Ca{sup 2+} is the most important regulator of muscle contraction, cell proliferation and migration. K{sup +} efflux decreases Ca{sup 2+} influx, which consequently influences ASMCs proliferation and migration. As a K{sub ATP} channel opener, iptakalim (Ipt) has been reported to restrain the proliferation of pulmonary arterial smooth muscle cells (PASMCs) involved in vascular remodeling, while little is known about its impact on ASMCs. The present study was designed to investigate the effects of Ipt on human ASMCs and the mechanisms underlying. Results obtained from cell counting kit-8 (CCK-8), flow cytometry and 5-ethynyl-2′-deoxyuridine (EdU) incorporation showed that Ipt significantly inhibited platelet-derived growth factor (PDGF)-BB-induced ASMCs proliferation. ASMCs migration induced by PDGF-BB was also suppressed by Ipt in transwell migration and scratch assay. Besides, the phosphorylation of Ca{sup 2+}/calmodulin-dependent kinase II (CaMKII), extracellular regulated protein kinases 1/2 (ERK1/2), protein kinase B (Akt), and cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) were as well alleviated by Ipt administration. Furthermore, we found that the inhibition of Ipt on the PDGF-BB-induced proliferation and migration in human ASMCs was blocked by glibenclamide (Gli), a selective K{sub ATP} channel antagonist. These findings provide a strong evidence to support that Ipt

  4. Thyroid Hormone Receptor β (TRβ) and Liver X Receptor (LXR) Regulate Carbohydrate-response Element-binding Protein (ChREBP) Expression in a Tissue-selective Manner*

    Science.gov (United States)

    Gauthier, Karine; Billon, Cyrielle; Bissler, Marie; Beylot, Michel; Lobaccaro, Jean-Marc; Vanacker, Jean-Marc; Samarut, Jacques

    2010-01-01

    Thyroid hormone (TR) and liver X (LXR) receptors are transcription factors involved in lipogenesis. Both receptors recognize the same consensus DNA-response element in vitro. It was previously shown that their signaling pathways interact in the control of cholesterol elimination in the liver. In the present study, carbohydrate-response element-binding protein (ChREBP), a major transcription factor controlling the activation of glucose-induced lipogenesis in liver, is characterized as a direct target of thyroid hormones (TH) in liver and white adipose tissue (WAT), the two main lipogenic tissues in mice. Using genetic and molecular approaches, ChREBP is shown to be specifically regulated by TRβ but not by TRα in vivo, even in WAT where both TR isoforms are expressed. However, this isotype specificity is not found in vitro. This TRβ specific regulation correlates with the loss of TH-induced lipogenesis in TRβ−/− mice. Fasting/refeeding experiments show that TRβ is not required for the activation of ChREBP expression particularly marked in WAT following refeeding. However, TH can stimulate ChREBP expression in WAT even under fasting conditions, suggesting completely independent pathways. Because ChREBP has been described as an LXR target, the interaction of LXR and TRβ in ChREBP regulation was assayed both in vitro and in vivo. Each receptor recognizes a different response element on the ChREBP promoter, located only 8 bp apart. There is a cross-talk between LXR and TRβ signaling on the ChREBP promoter in liver but not in WAT where LXR does not regulate ChREBP expression. The molecular basis for this cross-talk has been determined in in vitro systems. PMID:20615868

  5. Abscisic acid-activated SNRK2 protein kinases function in the gene-regulation pathway of ABA signal transduction by phosphorylating ABA response element-binding factors.

    Science.gov (United States)

    Kobayashi, Yuhko; Murata, Michiharu; Minami, Hideyuki; Yamamoto, Shuhei; Kagaya, Yasuaki; Hobo, Tokunori; Yamamoto, Akiko; Hattori, Tsukaho

    2005-12-01

    The plant hormone abscisic acid (ABA) induces gene expression via the ABA-response element (ABRE) present in the promoters of ABA-regulated genes. A group of bZIP proteins have been identified as ABRE-binding factors (ABFs) that activate transcription through this cis element. A rice ABF, TRAB1, has been shown to be activated via ABA-dependent phosphorylation. While a large number of signalling factors have been identified that are involved in stomatal regulation by ABA, relatively less is known about the ABA-signalling pathway that leads to gene expression. We have shown recently that three members of the rice SnRK2 protein kinase family, SAPK8, SAPK9 and SAPK10, are activated by ABA signal as well as by hyperosmotic stress. Here we show that transient overexpression in cultured cell protoplasts of these ABA-activated SnRK2 protein kinases leads to the activation of an ABRE-regulated promoter, suggesting that these kinases are involved in the gene-regulation pathway of ABA signalling. We further show several lines of evidence that these ABA-activated SnRK2 protein kinases directly phosphorylate TRAB1 in response to ABA. Kinetic analysis of SAPK10 activation and TRAB1 phosphorylation indicated that the latter immediately followed the former. TRAB1 was found to be phosphorylated not only in response to ABA, but also in response to hyperosmotic stress, which was interpreted as the consequence of phosphorylation of TRAB1 by hyperosmotically activated SAPKs. Physical interaction between TRAB1 and SAPK10 in vivo was demonstrated by a co-immunoprecipitation experiment. Finally, TRAB1 was phosphorylated in vitro by the ABA-activated SnRK2 protein kinases at Ser102, which is phosphorylated in vivo in response to ABA and is critical for the activation function.

  6. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    Energy Technology Data Exchange (ETDEWEB)

    Chan, T; Griffith, P; Nakka, B W; Khair, K R

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs.

  7. Finite-element modelling of geomechanical and hydraulic responses to the room 209 heading extension excavation response experiment 2: post-excavation analysis of experimental results

    International Nuclear Information System (INIS)

    Chan, T.; Griffith, P.; Nakka, B.W.; Khair, K.R.

    1993-07-01

    An in situ excavation response test was conducted at the 240 Level of the Underground Research Laboratory (URL) in conjunction with the excavation of a tunnel (Room 209) through a narrow, near-vertical, water-bearing fracture oriented almost perpendicular to the tunnel axis. This report presents a post-excavation analysis of the predicted mechanical response of the granitic rock mass to the tunnel excavation and the near-field hydraulic response of the fracture zone, compares the numerical modelling predictions with the actual measured response, provides information on the rock mass and fracture from back-analysis of the responses, and makes recommendations for future experiments. Results indicate that displacements and stress changes were reasonably well predicted. Pressure drops at hydrology boreholes and inflow to the tunnel were overpredicted, and fracture permeability changes were underpredicted. The permeability change is considered too large to be solely stress-induced. The back-calculated deformation modulus indicated nonlinear softening of the rock within 3.5 m of the tunnel wall. This is likely due to both excavation damage and the confining stress dependence of the modulus. For future excavation experiments it is recommended that mechanical excavation should replace the drill-and-blast technique; excavation damage should be incorporated into mechanical models; an improved hydraulic fracture model should be developed; and a coupled geomechanical-hydraulic analysis of fracture flow should be developed. (author). 16 refs., 15 tabs., 156 figs

  8. Phosphorylated cAMP response element-binding protein as a molecular marker of memory processing in rat hippocampus: effect of novelty

    OpenAIRE

    Viola, Haydée Ana María; Furman, Melina; Izquierdo, Luciana Adriana; Alonso, Mariana; Barros, Daniela Martí; Souza, Márcia Maria de; Izquierdo, Ivan Antônio; Medina, Jorge Horacio

    2000-01-01

    From mollusks to mammals the activation of cAMP response element-binding protein (CREB) appears to be an important step in the formation of long-term memory (LTM). Here we show that a 5 min exposure to a novel environment (open field) 1 hr after acquisition of a one-trial inhibitory avoidance training hinders both the formation of LTM for the avoidance task and the increase in the phosphorylation state of hippocampal Ser 133 CREB [phosphorylated CREB (pCREB)] associated with the avoidance tra...

  9. Proliferation risks from nuclear power infrastructure

    Science.gov (United States)

    Squassoni, Sharon

    2017-11-01

    Certain elements of nuclear energy infrastructure are inherently dual-use, which makes the promotion of nuclear energy fraught with uncertainty. Are current restraints on the materials, equipment, and technology that can be used either to produce fuel for nuclear electricity generation or material for nuclear explosive devices adequate? Technology controls, supply side restrictions, and fuel market assurances have been used to dissuade countries from developing sensitive technologies but the lack of legal restrictions is a continued barrier to permanent reduction of nuclear proliferation risks.

  10. Deletion of hepatic carbohydrate response element binding protein (ChREBP impairs glucose homeostasis and hepatic insulin sensitivity in mice

    Directory of Open Access Journals (Sweden)

    Tara Jois

    2017-11-01

    Conclusions: Overall, hepatic ChREBP is protective in regards to hepatic insulin sensitivity and whole body glucose homeostasis. Hepatic ChREBP action can influence other peripheral tissues and is likely essential in coordinating the body's response to different feeding states.

  11. Monascus-fermented red mold dioscorea protects mice against alcohol-induced liver injury, whereas its metabolites ankaflavin and monascin regulate ethanol-induced peroxisome proliferator-activated receptor-γ and sterol regulatory element-binding transcription factor-1 expression in HepG2 cells.

    Science.gov (United States)

    Cheng, Chih-Fu; Pan, Tzu-Ming

    2018-03-01

    Alcoholic hepatitis is a necroinflammatory process that is associated with fibrosis and leads to cirrhosis in 40% of cases. The hepatoprotective effects of red mold dioscorea (RMD) from Monascus purpureus NTU 568 were evaluated in vivo using a mouse model of chronic alcohol-induced liver disease (ALD). ALD mice were orally administered vehicle (ALD group) or vehicle plus 307.5, 615.0 or 1537.5 mg kg -1 (1 ×, 2 × and 5 ×) RMD for 5 weeks. RMD lowered serum leptin, hepatic total cholesterol, free fatty acid and hepatic triglyceride levels and increased serum adiponectin, hepatic alcohol dehydrogenase and antioxidant enzyme levels. Furthermore, ankaflavin (AK) and monascin (MS), metabolites of RMD fermented with M. purpureus 568, induced peroxisome proliferator-activated receptor-γ expression and the concomitant suppression of ethanol-induced elevation of sterol regulatory element-binding transcription factor-1 and TG in HepG2 cells. These results indicate the hepatoprotective effect of Monascus-fermented RMD. Moreover, AK and MS were identified as the active constituents of RMD for the first time and were shown to protect against ethanol-induced liver damage. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  12. The International Atomic Energy Agency shows keen interest. Innovative warning system for nuclear proliferation

    International Nuclear Information System (INIS)

    Smet, S.; Van der Meer, K.

    2011-01-01

    In order to prevent nuclear proliferation, nuclear fuels and other strategic materials have to be responsibly managed. Non-proliferation aims to counteract the uncontrolled proliferation of nuclear materials worldwide. SCK-CEN is developing an innovative nuclear warning system based on political and economic indicators. Such a system should allow the early detection of the development of a nuclear weapons programme.

  13. An ABA-responsive element in the AtSUC1 promoter is involved in the regulation of AtSUC1 expression.

    Science.gov (United States)

    Hoth, Stefan; Niedermeier, Matthias; Feuerstein, Andrea; Hornig, Julia; Sauer, Norbert

    2010-09-01

    Abscisic acid (ABA) and sugars regulate many aspects of plant growth and development, and we are only just beginning to understand the complex interactions between ABA and sugar signaling networks. Here, we show that ABA-dependent transcription factors bind to the promoter of the Arabidopsis thaliana AtSUC1 (At1g71880) sucrose transporter gene in vitro. We present the characterization of a cis-regulatory element by truncation of the AtSUC1 promoter and by electrophoretic mobility shift assays that is identical to a previously characterized ABA-responsive element (ABRE). In yeast 1-hybrid analyses we identified ABI5 (AtbZIP39; At2g36270) and AREB3 (AtbZIP66; At3g56850) as potential interactors. Analyses of plants expressing the beta-glucuronidase reporter gene under the control of ABI5 or AREB3 promoter sequences demonstrated that both transcription factor genes are co-expressed with AtSUC1 in pollen and seedlings, the primary sites of AtSUC1 action. Mutational analyses of the identified cis-regulatory element verified its importance for AtSUC1 expression in young seedlings. In abi5-4 seedlings, we observed an increase of sucrose-dependent anthocyanin accumulation and AtSUC1 mRNA levels. This suggests that ABI5 prevents an overshoot of sucrose-induced AtSUC1 expression and confirmed a novel cross-link between sugar and ABA signaling.

  14. Response of a multi-element dosimeter to calibrated beta sources with E/sub max/ from 0.23 to 3.5 MeV

    International Nuclear Information System (INIS)

    Endres, G.W.R.; Scherpelz, R.I.; Roberson, P.L.

    1982-06-01

    The responses of several different dosimeter absorber systems were studied to determine their usefulness in beta radiation fields. Exposures to several different beta emitters were conducted at the PNL Calibrations Laboratory. The sources used are: 147 Pm, 85 Kr, U(nat), 90 Sr- 90 Y, and 106 Ru- 106 Rh. The maximum energy of these beta emitters varies from 0.23 to 3.5 MeV. The beta sources are calibrated for absorbed dose to tissue at a depth of 0.007 cm. Measurements of response for 4, 5, and 7 element versions of the dosimeter were made. All data reported were obtained from sets of three TLDs exposed under each absorber and for each of the radiation sources

  15. Genome-wide analysis of ABA-responsive elements ABRE and CE3 reveals divergent patterns in Arabidopsis and rice

    OpenAIRE

    Riaño-Pachón Diego; Gómez-Porras Judith L; Dreyer Ingo; Mayer Jorge E; Mueller-Roeber Bernd

    2007-01-01

    Abstract Background In plants, complex regulatory mechanisms are at the core of physiological and developmental processes. The phytohormone abscisic acid (ABA) is involved in the regulation of various such processes, including stomatal closure, seed and bud dormancy, and physiological responses to cold, drought and salinity stress. The underlying tissue or plant-wide control circuits often include combinatorial gene regulatory mechanisms and networks that we are only beginning to unravel with...

  16. Emerging nuclear energy systems and nuclear weapon proliferation

    International Nuclear Information System (INIS)

    Gsponer, A.; Sahin, S.; Jasani, B.

    1983-01-01

    Generally when considering problems of proliferation of nuclear weapons, discussions are focused on horizontal proliferation. However, the emerging nuclear energy systems currently have an impact mainly on vertical proliferation. The paper indicates that technologies connected with emerging nuclear energy systems, such as fusion reactors and accelerators, enhance the knowledge of thermonuclear weapon physics and will enable production of military useful nuclear materials (including some rare elements). At present such technologies are enhancing the arsenal of the nuclear weapon states. But one should not forget the future implications for horizontal proliferation of nuclear weapons as some of the techniques will in the near future be within the technological and economic capabilities of non-nuclear weapon states. Some of these systems are not under any international control. (orig.) [de

  17. The new US nuclear non-proliferation and export policy

    International Nuclear Information System (INIS)

    Welck, S. von.

    1981-01-01

    The future American nuclear non-proliferation and export policy will be determined chiefly by three elements: (1) Adherence to the former objective of nuclear non-proliferation. (2) A large and varied assortment of old and new tools for implementing this goal. (3) Much more differentiation in applying these tools in the light of the reliability, with respect to non-proliferation policy, of the respective partner. Consequently, it would make little sense for the new Administration to force upon allied industrialized countries, whose nuclear technologies are at the same level as that of the United States, restrictive rules on reprocessing and breeder technology. The new measures designed to curb proliferation are especially meant to destroy motivations that could cause states to own nuclear explosives. This also applies to the removal of economic motivations. (orig.) [de

  18. Growth and Tissue Elemental Composition Response of Spinach (Spinacia oleracea to Hydroponic and Aquaponic Water Quality Conditions

    Directory of Open Access Journals (Sweden)

    Daniel A. Vandam

    2017-05-01

    Full Text Available Spinach (Spinacia oleracea cv. Carmel was grown in a conventional glass greenhouse under three different nutrient solution treatments. Lighting and temperature conditions were identical. Six growing systems were used to provide a duplicate trough system for each of these three treatments. Six trials were harvested from each system over a two month time period. Two treatments received hydroponic nutrient inputs, with one treatment at pH 7.0 (referred to as H7 and the other at pH 5.8 (H5, and the third treatment was aquaponic (A7, receiving all of its nutrients from a single fish tank with koi (Cyprinus carpio except for chelated iron. System pH was regulated by adding K2CO3 to aquaponic systems and KOH to hydroponic systems. Comparisons made between treatments were total yield, leaf surface area, tissue elemental content, and dry weight to fresh weight ratio. Dry weight biomass yield values were not different in pairwise comparisons between treatments (A7 vs. H5: p = 0.59 fresh weight, p = 0.42 dry weight. Similarly, surface area results were not different between treatments. The important comparison was that A7 achieved the same growth as H5, the conventional pH with a complete inorganic nutrient solution, despite unbalanced and less than “ideal” nutrient concentrations in the A7 condition.

  19. Transuranium element toxicity: dose-response relationships at low exposure levels. Summary and speculative interpretation relative to exposure limits

    International Nuclear Information System (INIS)

    Thompson, R.C.

    1975-01-01

    A summary is given of information on transuranium element toxicity and the correlation of this information with current established exposure limits. It is difficult to calculate a biologically relevant radiation dose from deposited plutonium; it is exposure that must be controlled in order to prevent biological effect, and if the relationship between exposure and effect is known, then radiation dose is of no concern. There are extensive data on the effects of plutonium in bone. Results of studies at the University of Utah indicate that plutonium in beagles may be as much as ten times more toxic than radium. It has been suggested that this toxicity ratio may be even higher in man than in the beagle dog because of differences in surface-to-volume ratios and differences in the rate of burial of surface-deposited plutonium. The present capabilities for extrapolating dose-effect relationships seem to be limited to the setting of upper limits, based on assumptions of linearity and considerations related to natural background

  20. Finite Element Analysis as a response to frequently asked questions of machine tool mechanical design-engineers

    Directory of Open Access Journals (Sweden)

    Kehl Gerhard

    2017-01-01

    Full Text Available The finite element analysis (FEA nowadays is indispensable in the product development of machining centres and production machinery for metal cutting processes. It enables extensive static, dynamic and thermal simulation of digital prototypes of machine tools before production start-up. But until now less reflection has been made about what are the most pressing questions to be answered in this application field, with the intention to align the modelling and simulation methods with substantial requirements. Based on 3D CAD geometry data for a modern machining centre (Deckel-Maho-Gildemeister DMG 635 V eco merely the basic steps of a static analysis are reconstructed by FEA. Particularly the two most frequently asked questions by the design departments of machine tool manufacturers are discussed and highlighted. For this authentic simulation results are used, at which their selection is a consequence of long lasting experience in the industrial application of FEA in the design process chain. Noticing that such machine tools are mechatronic systems applying a considerable number of actuators, sensors and controllers in addition to mechanical structures, the answers to those core questions are required for design enhancement, to save costs and to improve the productivity and the quality of machined workpieces.

  1. Cyclic Symmetry Finite Element Forced Response Analysis of a Distortion-Tolerant Fan with Boundary Layer Ingestion

    Science.gov (United States)

    Min, J. B.; Reddy, T. S. R.; Bakhle, M. A.; Coroneos, R. M.; Stefko, G. L.; Provenza, A. J.; Duffy, K. P.

    2018-01-01

    Accurate prediction of the blade vibration stress is required to determine overall durability of fan blade design under Boundary Layer Ingestion (BLI) distorted flow environments. Traditional single blade modeling technique is incapable of representing accurate modeling for the entire rotor blade system subject to complex dynamic loading behaviors and vibrations in distorted flow conditions. A particular objective of our work was to develop a high-fidelity full-rotor aeromechanics analysis capability for a system subjected to a distorted inlet flow by applying cyclic symmetry finite element modeling methodology. This reduction modeling method allows computationally very efficient analysis using a small periodic section of the full rotor blade system. Experimental testing by the use of the 8-foot by 6-foot Supersonic Wind Tunnel Test facility at NASA Glenn Research Center was also carried out for the system designated as the Boundary Layer Ingesting Inlet/Distortion-Tolerant Fan (BLI2DTF) technology development. The results obtained from the present numerical modeling technique were evaluated with those of the wind tunnel experimental test, toward establishing a computationally efficient aeromechanics analysis modeling tool facilitating for analyses of the full rotor blade systems subjected to a distorted inlet flow conditions. Fairly good correlations were achieved hence our computational modeling techniques were fully demonstrated. The analysis result showed that the safety margin requirement set in the BLI2DTF fan blade design provided a sufficient margin with respect to the operating speed range.

  2. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    Science.gov (United States)

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  3. The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

    Science.gov (United States)

    Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

    1993-01-01

    The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

  4. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    Science.gov (United States)

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  5. Nuclear proliferation: linkages and solutions

    International Nuclear Information System (INIS)

    Quester, G.H.

    1979-01-01

    Nuclear proliferation must be periodically re-examined as a moral as well as a practical foreign policy dilemma. The question is asked whether proliferation precludes a safe and peaceful world, or if a halt to proliferation is adequate without other arms control. The moral dilemma in foreign policy arises over the need to make practical choices which often serve one goal while sacrificing another. The ramifications of nuclear proliferation are examined and the conclusions reached that it is not an acceptable option. It is also decided that, because general disarmament steps will be more difficult to achieve, the world may have to accept a small number of nuclear arsenals as the price of state sovereignties. A high priority for making the effort to prevent proliferation is advised. 8 references

  6. Effect of chloroquine on human lymphocyte proliferation

    DEFF Research Database (Denmark)

    Bygbjerg, Ib Christian; Flachs, H

    1986-01-01

    The effect of chloroquine on human blood mononuclear cells was studied. High concentrations of chloroquine in vitro profoundly suppressed the proliferation of mitogen- and antigen-stimulated cells, as indicated by decreased 14C-thymidine incorporation. Lower concentrations of chloroquine increase...... to large particulate antigens; the response to small antigens was not affected. The mode of action of chloroquine and the possible consequences of the findings for dosage of chloroquine when used for malaria prophylaxis is discussed.......The effect of chloroquine on human blood mononuclear cells was studied. High concentrations of chloroquine in vitro profoundly suppressed the proliferation of mitogen- and antigen-stimulated cells, as indicated by decreased 14C-thymidine incorporation. Lower concentrations of chloroquine increased...... the response to pokeweed mitogen. The response to concanavalin A and to various antigens was suppressed, especially the response to large particulate antigens. Oral intake of 300 mg of chloroquine base/week did not affect the lymphocyte proliferative responses. 600 mg of base/week decreased the response...

  7. An exploratory study on the elements that might affect medical students’ and residents’ responsibility during clinical training

    Science.gov (United States)

    Asemani, Omid; Iman, Mohammad Taghi; Moattari, Marzieh; Tabei, Seyed Ziaadin; Sharif, Farkhondeh; Khayyer, Mohammad

    2014-01-01

    We are now more or less confronting a “challenge of responsibility” among both undergraduate and postgraduate medical students and some recent alumni from medical schools in Iran. This ethical problem calls for urgent etiologic and pathologic investigations into the problem itself and the issues involved. This study aimed to develop a thematic conceptual framework to study factors that might affect medical trainees’ (MTs) observance of responsibility during clinical training. A qualitative descriptive methodology involving fifteen in-depth semi-structured interviews was used to collect the data. Interviews were conducted with both undergraduate and postgraduate MTs as well as clinical experts and experienced nurses. Interviews were audio-recorded and then transcribed. The data was analyzed using thematic content analysis. The framework derived from the data included two main themes, namely “contextual conditions” and “intervening conditions”. Within each theme, participants recurrently described “individual” and “non-individual or system” based factors that played a role in medical trainees’ observance of responsibility. Overall, contextual conditions provide MTs with a “primary or basic responsibility” which is then transformed into a “secondary or observed responsibility” under the influence of intervening conditions. In conclusion three measures were demonstrated to be very important in enhancing Iranian MTs’ observance of responsibility: a) to make and implement stricter and more exact admission policies for medical colleges, b) to improve and revise the education system in its different dimensions such as management, structure, etc. based on regular and systematic evaluations, and c) to establish, apply and sustain higher standards throughout the educational environment. PMID:25512829

  8. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  9. Identification of the G13 (cAMP-response-element-binding protein-related protein) gene product related to activating transcription factor 6 as a transcriptional activator of the mammalian unfolded protein response.

    Science.gov (United States)

    Haze, K; Okada, T; Yoshida, H; Yanagi, H; Yura, T; Negishi, M; Mori, K

    2001-04-01

    Eukaryotic cells control the levels of molecular chaperones and folding enzymes in the endoplasmic reticulum (ER) by a transcriptional induction process termed the unfolded protein response (UPR). The mammalian UPR is mediated by the cis-acting ER stress response element consisting of 19 nt (CCAATN(9)CCACG), the CCACG part of which is considered to provide specificity. We recently identified the basic leucine zipper (bZIP) protein ATF6 as a mammalian UPR-specific transcription factor; ATF6 is activated by ER stress-induced proteolysis and binds directly to CCACG. Here we report that eukaryotic cells express another bZIP protein closely related to ATF6 in both structure and function. This protein encoded by the G13 (cAMP response element binding protein-related protein) gene is constitutively synthesized as a type II transmembrane glycoprotein anchored in the ER membrane and processed into a soluble form upon ER stress as occurs with ATF6. The proteolytic processing of ATF6 and the G13 gene product is accompanied by their relocation from the ER to the nucleus; their basic regions seem to function as a nuclear localization signal. Overexpression of the soluble form of the G13 product constitutively activates the UPR, whereas overexpression of a mutant lacking the activation domain exhibits a strong dominant-negative effect. Furthermore, the soluble forms of ATF6 and the G13 gene product are unable to bind to several point mutants of the cis-acting ER stress response element in vitro that hardly respond to ER stress in vivo. We thus concluded that the two related bZIP proteins are crucial transcriptional regulators of the mammalian UPR, and propose calling the ATF6 gene product ATF6alpha and the G13 gene product ATF6beta.

  10. Galvanic element. Galvanisches Element

    Energy Technology Data Exchange (ETDEWEB)

    Sprengel, D.; Haelbig, H.

    1980-01-03

    The invention concerns a gas-tight sealed accumulator with positive and negative electrode plates and an auxillary electrode electroconductively bound to the latter for suppressing oxygen pressure. The auxillary electrode is an intermediate film electrode. The film catalysing oxygen reduction is hydrophilic in character and the other film is hydrophobic. A double coated foil has proved to be advantageous, the hydrophilic film being formed from polymer-bound activated carbon and the hydrophrobic film from porous polytetrafluoroethylene. A metallic network of silver or nickel is rolled into the outer side of the activated carbon film. This auxillary electrode can be used to advantage in all galvanic elements. Even primary cells fall within the scope of application for auxillary electrodes because many of these contain a highly oxidized electrodic material which tends to give off oxygen.

  11. Polyvinylpyrrolidone-coated gold nanoparticles inhibit endothelial cell viability, proliferation, and ERK1/2 phosphorylation and reduce the magnitude of endothelial-independent dilator responses in isolated aortic vessels

    Directory of Open Access Journals (Sweden)

    Mohamed T

    2017-12-01

    viability/proliferation. These inhibitory effects were lost after 48 hours’ exposure (except for the PVP-modified AuNPs. Furthermore, all AuNPs decreased acetylcholine (ACh-induced phosphorylation of ERK1/2, a key signaling protein of cell function. mPEG-modified AuNPs had lower cytostatic effects than PVP-modified AuNPs. Citrate-stabilized AuNPs did not alter endothelial-dependent vasodilation induced by ACh, but attenuated endothelial-independent responses induced by sodium nitroprusside. PVP-modified AuNPs attenuated ACh-induced dilation, whereas mPEG-modified AuNPs did not, though this was dose-related.Conclusion: We demonstrated that mPEG-modified AuNPs at a therapeutic dosage showed lower cytostatic effects and were less detrimental to vasodilator function than PVP-modified AuNPs, indicating greater potential as agents for diagnostic imaging and therapy. Keywords: nanoparticles, gold, vascular, vasodilation, artery, cell culture

  12. Thorium cycles and proliferation

    International Nuclear Information System (INIS)

    Lovins, A.B.

    1979-01-01

    This paper analyzes several prevalent misconceptions about nuclear fuel cycles that breed fissile uranium-233 from thorium. Its main conclusions are: U-233, despite the gamma radioactivity of associated isotopes, is a rather attractive material for making fission bombs, and is a credible material for subnational as well as national groups to use for this purpose; (2) pure thorium cycles, which in effect merely substitute U-233 for Pu, would take many decades and much U to establish, and offer no significant safeguards advantage over Pu, cycles; (3) denatured Th-U cycles, which dilute the U-233 with inert U-238 to a level not directly usable in bombs, are not an effective safeguard even against subnational bomb-making; (4) several other features of mixed Th-U cycles are rather unattractive from a safeguards point of view; (5) thus, Th cycles of any kind are not a technical fix for proliferation (national or subnational) and, though probably more safeguardable than Pu cycles, are less so than once-through U cycles that entail no reprocessing; (6) while thorium cycles have some potential technical advantages, including flexibility, they cannot provide major savings in nuclear fuel resources compared to simpler ways of saving neutrons and U; and (7) while advocates of nuclear power may find Th cycles worth exploring, such cycles do not differ fundamentally from U cycles in any of the respects--including safeguards and fuel resources--that are relevant to the broader nuclear debate, and should not be euphorically embraced as if they did

  13. Liver X receptor regulates hepatic nuclear O-GlcNAc signaling and carbohydrate responsive element-binding protein activity

    DEFF Research Database (Denmark)

    Bindesbøll, Christian; Fan, Qiong; Nørgaard, Rikke C

    2015-01-01

    in response to feeding, which is believed to be mediated by insulin. We have previously shown that LXRs are targets for glucose-hexosamine-derived O-linked β-N-acetylglucosamine (O-GlcNAc) modification enhancing their ability to regulate SREBP-1c promoter activity in vitro. To elucidate insulin...... of glycolytic and lipogenic enzymes, including glucokinase (GK), SREBP-1c, ChREBPα, and the newly identified shorter isoform ChREBPβ. Furthermore, glucose-dependent increases in LXR/retinoid X receptor-regulated luciferase activity driven by the ChREBPα promoter was mediated, at least in part, by O-GlcNAc...... transferase (OGT) signaling in Huh7 cells. Moreover, we show that LXR and OGT interact and colocalize in the nucleus and that loss of LXRs profoundly reduced nuclear O-GlcNAc signaling and ChREBPα promoter binding activity in vivo. In summary, our study provides evidence that LXRs act as nutrient and glucose...

  14. Hypotonicity-induced reduction of aquaporin-2 transcription in mpkCCD cells is independent of the tonicity responsive element, vasopressin, and cAMP.

    Science.gov (United States)

    Kortenoeven, Marleen L A; van den Brand, Michiel; Wetzels, Jack F M; Deen, Peter M T

    2011-04-15

    The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.

  15. v-src Induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element

    Energy Technology Data Exchange (ETDEWEB)

    Xie, W.; Fletcher, B.S.; Andersen, R.D.; Herschman, H.R. [Univ. of California, Los Angeles, CA (United States)

    1994-10-01

    The authors recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factor and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5{prime} of the TIS10/PGS2 transcription start site that mediates pp60{sup v-src} induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the AFT/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60{sup v-src} induction. E-box mutation has no effect on the fold induction in response to pp60{sup v-src}. In contrast, ATF/CRE mutation attenuates the pp{sup v-src} response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. The data suggest that Ras mediates pp60{sup v-src} activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. 64 refs., 8 figs.

  16. Theoretical Approaches to Nuclear Proliferation

    Directory of Open Access Journals (Sweden)

    Konstantin S. Tarasov

    2015-01-01

    Full Text Available This article analyses discussions between representatives of three schools in the theory of international relations - realism, liberalism and constructivism - on the driving factors of nuclear proliferation. The paper examines major theoretical approaches, outlined in the studies of Russian and foreign scientists, to the causes of nuclear weapons development, while unveiling their advantages and limitations. Much of the article has been devoted to alternative approaches, particularly, the role of mathematical modeling in assessing proliferation risks. The analysis also reveals a variety of different approaches to nuclear weapons acquisition, as well as the absence of a comprehensive proliferation theory. Based on the research results the study uncovers major factors both favoring and impeding nuclear proliferation. The author shows that the lack of consensus between realists, liberals and constructivists on the nature of proliferation led a number of scientists to an attempt to explain nuclear rationale by drawing from the insights of more than one school in the theory of IR. Detailed study of the proliferation puzzle contributes to a greater understating of contemporary international realities, helps to identify mechanisms that are most likely to deter states from obtaining nuclear weapons and is of the outmost importance in predicting short- and long-term security environment. Furthermore, analysis of the existing scientific literature on nuclear proliferation helps to determine future research agenda of the subject at hand.

  17. Scaffold architecture and fibrin gels promote meniscal cell proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Pawelec, K. M., E-mail: pawelec.km@gmail.com, E-mail: jw626@cam.ac.uk; Best, S. M.; Cameron, R. E. [Cambridge Centre for Medical Materials, Materials Science and Metallurgy Department, University of Cambridge, Cambridge CB3 0FS (United Kingdom); Wardale, R. J., E-mail: pawelec.km@gmail.com, E-mail: jw626@cam.ac.uk [Division of Trauma and Orthopaedic Surgery, Department of Surgery, University of Cambridge, Cambridge CB2 2QQ (United Kingdom)

    2015-01-01

    Stability of the knee relies on the meniscus, a complex connective tissue with poor healing ability. Current meniscal tissue engineering is inadequate, as the signals for increasing meniscal cell proliferation have not been established. In this study, collagen scaffold structure, isotropic or aligned, and fibrin gel addition were tested. Metabolic activity was promoted by fibrin addition. Cellular proliferation, however, was significantly increased by both aligned architectures and fibrin addition. None of the constructs impaired collagen type I production or triggered adverse inflammatory responses. It was demonstrated that both fibrin gel addition and optimized scaffold architecture effectively promote meniscal cell proliferation.

  18. Nerves Regulate Cardiomyocyte Proliferation and Heart Regeneration.

    Science.gov (United States)

    Mahmoud, Ahmed I; O'Meara, Caitlin C; Gemberling, Matthew; Zhao, Long; Bryant, Donald M; Zheng, Ruimao; Gannon, Joseph B; Cai, Lei; Choi, Wen-Yee; Egnaczyk, Gregory F; Burns, Caroline E; Burns, C Geoffrey; MacRae, Calum A; Poss, Kenneth D; Lee, Richard T

    2015-08-24

    Some organisms, such as adult zebrafish and newborn mice, have the capacity to regenerate heart tissue following injury. Unraveling the mechanisms of heart regeneration is fundamental to understanding why regeneration fails in adult humans. Numerous studies have revealed that nerves are crucial for organ regeneration, thus we aimed to determine whether nerves guide heart regeneration. Here, we show using transgenic zebrafish that inhibition of cardiac innervation leads to reduction of myocyte proliferation following injury. Specifically, pharmacological inhibition of cholinergic nerve function reduces cardiomyocyte proliferation in the injured hearts of both zebrafish and neonatal mice. Direct mechanical denervation impairs heart regeneration in neonatal mice, which was rescued by the administration of neuregulin 1 (NRG1) and nerve growth factor (NGF) recombinant proteins. Transcriptional analysis of mechanically denervated hearts revealed a blunted inflammatory and immune response following injury. These findings demonstrate that nerve function is required for both zebrafish and mouse heart regeneration. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Hepatic expression of heme oxygenase-1 and antioxidant response element-mediated genes following administration of ethinyl estradiol to rats

    International Nuclear Information System (INIS)

    Morio, Lisa A.; Leone, Angelique; Sawant, Sharmilee P.; Nie, Alex Y.; Brandon Parker, J.; Taggart, Peter; Barron, Alfred M.; McMillian, Michael K.; Lord, Peter

    2006-01-01

    Heme oxygenase-1 (HO-1) is one of several enzymes induced by hepatotoxicants, and is thought to have an important protective role against cellular stress during liver inflammation and injury. The objective of the present study was to evaluate the role of HO-1 in estradiol-induced liver injury. A single dose of ethinyl estradiol (500 mg/kg, po) resulted in mild liver injury. Repeated administration of ethinyl estradiol (500 mg/kg/day for 4 days, po) resulted in no detectable liver injury or dysfunction. Using RT-PCR analysis, we demonstrate that HO-1 gene expression in whole liver tissue is elevated (> 20-fold) after the single dose of ethinyl estradiol. The number and intensity of HO-1 immunoreactive macrophages were increased after the single dose of ethinyl estradiol. HO-1 expression was undetectable in hepatic parenchymal cells from rats receiving Methocel control or a single dose of ethinyl estradiol, however cytosolic HO-1 immunoreactivity in these cells after repeated dosing of ethinyl estradiol was pronounced. The increases in HO-1 mRNA and HO-1 immunoreactivity following administration of a single dose of ethinyl estradiol suggested that this enzyme might be responsible for the observed protection of the liver during repeated dosing. To investigate the effect of HO-1 expression on ethinyl estradiol-induced hepatotoxicity, rats were pretreated with hemin (50 μmol/kg, ip, a substrate and inducer of HO-1), with tin protoporphyrin IX (60 μmol/kg, ip, an HO-1 inhibitor), or with gadolinium chloride (10 mg/kg, iv, an inhibitor/toxin of Kupffer cells) 24 h before ethinyl estradiol treatment. Pretreatment with modulators of HO-1 expression and activity had generally minimal effects on ethinyl estradiol-induced liver injury. These data suggest that HO-1 plays a limited role in antioxidant defense against ethinyl estradiol-induced oxidative stress and hepatotoxicity, and suggests that other coordinately induced enzymes are responsible for protection observed with

  20. Nuclear non proliferation and disarmament

    International Nuclear Information System (INIS)

    2000-01-01

    In the framework of the publication of a document on the ''weapons mastership, disarmament and non proliferation: the french action'', by the ministry of Foreign Affairs and the ministry of Defense, the French Documentation organization presents a whole document. This document describes and details the following topics: the conference on the treaty of non proliferation of nuclear weapons, the France, Usa and Non Governmental Organizations position, the threats of the proliferation, the french actions towards the disarmament, the disarmament in the world, a chronology and some bibliographic resources. (A.L.B.)

  1. International proliferation on nuclear weapons

    International Nuclear Information System (INIS)

    Hill, J.

    1977-01-01

    The subject is dealt with under the following headings: introduction; routes to proliferation (preparation of U 235 , Pu 239 , U 233 ); nuclear power fuel cycles and proliferation; the fast reactor fuel cycle; security aspects of the existing fuel cycle; the IAEA and the nuclear non-proliferation treaty. It is concluded that 'the basis for sound international control exists, and taken together with the further technical steps which will be taken to make the existing fuel cycles more robust against the diversion of materials by terrorists and the abuse of civil nuclear power programmes by governments, we have good reason to proceed now with the orderly exploitation of ...nuclear energy...'. (U.K.)

  2. Neural responses to nostalgia-evoking music modeled by elements of dynamic musical structure and individual differences in affective traits.

    Science.gov (United States)

    Barrett, Frederick S; Janata, Petr

    2016-10-01

    Nostalgia is an emotion that is most commonly associated with personally and socially relevant memories. It is primarily positive in valence and is readily evoked by music. It is also an idiosyncratic experience that varies between individuals based on affective traits. We identified frontal, limbic, paralimbic, and midbrain brain regions in which the strength of the relationship between ratings of nostalgia evoked by music and blood-oxygen-level-dependent (BOLD) signal was predicted by affective personality measures (nostalgia proneness and the sadness scale of the Affective Neuroscience Personality Scales) that are known to modulate the strength of nostalgic experiences. We also identified brain areas including the inferior frontal gyrus, substantia nigra, cerebellum, and insula in which time-varying BOLD activity correlated more strongly with the time-varying tonal structure of nostalgia-evoking music than with music that evoked no or little nostalgia. These findings illustrate one way in which the reward and emotion regulation networks of the brain are recruited during the experiencing of complex emotional experiences triggered by music. These findings also highlight the importance of considering individual differences when examining the neural responses to strong and idiosyncratic emotional experiences. Finally, these findings provide a further demonstration of the use of time-varying stimulus-specific information in the investigation of music-evoked experiences. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Finite element analysis of high modal dynamic responses of a composite floor subjected to human motion under passive live load

    Directory of Open Access Journals (Sweden)

    Arash Behnia

    Full Text Available Light weight and long span composite floors are common place in modern construction. A critical consequence of this application is undesired vibration which may cause excessive discomfort to occupants. This work investigates the composite floor vibration behavior of an existing building based on a comprehensive study of high modal dynamic responses, the range of which has been absent in previous studies and major analytical templates, of different panels under the influence of loads induced by human motion. The resulting fundamental natural frequency and vibration modes are first validated with respect to experimental and numerical evidences from literature. Departing from close correlation established in comparison, this study explores in detail the effects of intensity of passive live load as additional stationary mass due to crowd jumping as well as considering human structure interaction. From observation, a new approach in the simulation of passive live load through the consideration of human structure interaction and human body characteristics is proposed. It is concluded that higher vibration modes are essential to determine the minimum required modes and mass participation ratio in the case of vertical vibration. The results indicate the need to consider 30 modes of vibration to obtain all possible important excitations and thereby making third harmonic of load frequency available to excite the critical modes. In addition, presence of different intensities of passive live load on the composite floor showed completely different behavior in each particular panel associated with load location of panel and passive live load intensity. Furthermore, implementing human body characteristics in simulation causes an obvious increase in modal damping and hence better practicality and economical presentation can be achieved in structural dynamic behavior.

  4. Metabolite Regulation of Nuclear Localization of Carbohydrate-response Element-binding Protein (ChREBP): ROLE OF AMP AS AN ALLOSTERIC INHIBITOR.

    Science.gov (United States)

    Sato, Shogo; Jung, Hunmin; Nakagawa, Tsutomu; Pawlosky, Robert; Takeshima, Tomomi; Lee, Wan-Ru; Sakiyama, Haruhiko; Laxman, Sunil; Wynn, R Max; Tu, Benjamin P; MacMillan, John B; De Brabander, Jef K; Veech, Richard L; Uyeda, Kosaku

    2016-05-13

    The carbohydrate-response element-binding protein (ChREBP) is a glucose-responsive transcription factor that plays an essential role in converting excess carbohydrate to fat storage in the liver. In response to glucose levels, ChREBP is regulated by nuclear/cytosol trafficking via interaction with 14-3-3 proteins, CRM-1 (exportin-1 or XPO-1), or importins. Nuclear localization of ChREBP was rapidly inhibited when incubated in branched-chain α-ketoacids, saturated and unsaturated fatty acids, or 5-aminoimidazole-4-carboxamide ribonucleotide. Here, we discovered that protein-free extracts of high fat-fed livers contained, in addition to ketone bodies, a new metabolite, identified as AMP, which specifically activates the interaction between ChREBP and 14-3-3. The crystal structure showed that AMP binds directly to the N terminus of ChREBP-α2 helix. Our results suggest that AMP inhibits the nuclear localization of ChREBP through an allosteric activation of ChREBP/14-3-3 interactions and not by activation of AMPK. AMP and ketone bodies together can therefore inhibit lipogenesis by restricting localization of ChREBP to the cytoplasm during periods of ketosis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. NF-κB is involved in the LPS-mediated proliferation and apoptosis of MAC-T epithelial cells as part of the subacute ruminal acidosis response in cows.

    Science.gov (United States)

    Fan, Wen-Jie; Li, He-Ping; Zhu, He-Shui; Sui, Shi-Ping; Chen, Pei-Ge; Deng, Yue; Sui, Tong-Ming; Wang, Yue-Ying

    2016-11-01

    To determine the effect of NF-κB on cell proliferation and apoptosis, we investigate the expression of inflammation and apoptosis-related factors in the bovine mammary epithelial cell line, MAC-T. MAC-T cells were cultured in vitro and MTT and LDH assays used to determine the effects of lipopolysaccharide (LPS) on proliferation and cytotoxicity respectively. RT-PCR and western blotting were used to evaluate the effect of LPS and NF-κB inhibition [pyrrolidine dithiocarbamate (PDTC) treatment] on the expression of inflammation and apoptosis-related factors. LPS significantly inhibited MAC-T cell proliferation in a dose- and time-dependent manner. Furthermore, LPS promoted apoptosis while the NF-кB inhibitor PDTC attenuated this effect. After LPS treatment, the NF-кB signaling pathway was activated, and the expression of inflammation and apoptosis-related factors increased. When PDTC blocked NF-кB signaling, the expression of inflammation and apoptosis-related factors were decreased in MAC-T cells. LPS activates the TLR4/NF-κB signaling pathway, inhibits proliferation and promotes apoptosis in MAC-T cells. NF-кB inhibition attenuates MAC-T cell apoptosis and TLR4/NF-κB signaling pathway. NF-кB inhibitor alleviating MAC-T cell apoptosis is presumably modulated by NF-кB.

  6. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tachibana, Keisuke, E-mail: nya@phs.osaka-u.ac.jp [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Takeuchi, Kentaro; Inada, Hirohiko [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamasaki, Daisuke [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ishimoto, Kenji [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko [Laboratory for System Biology and Medicine, Research Center for Advanced Science and Technology, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-8904 (Japan); Doi, Takefumi [Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871 (Japan); The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2009-11-20

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  7. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    International Nuclear Information System (INIS)

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; Ishimoto, Kenji; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi

    2009-01-01

    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial β-oxidation. The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor that plays an important role in the regulation of β-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPARα and found that PPARα induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPARα regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  8. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    Science.gov (United States)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  9. Non-proliferation and nuclear data

    International Nuclear Information System (INIS)

    Sowerby, M.G.

    1978-01-01

    A review is made of the problem of the proliferation of nuclear weapons with particular emphasis on proliferation and nuclear power. Some indications of the nuclear data requirements associated with methods of reducing proliferation risks are presented

  10. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  11. Expression of phosphorylated cAMP response element binding protein (p-CREB) in bladder afferent pathways in VIP-/- mice with cyclophosphamide (CYP)-induced cystitis

    DEFF Research Database (Denmark)

    Jensen, Dorthe G; Studeny, Simon; May, Victor

    2008-01-01

    The expression of phosphorylated cAMP response element binding protein (p-CREB) in dorsal root ganglia (DRG) with and without cyclophosphamide (CYP)-induced cystitis (150 mg/kg, i.p; 48 h) was determined in VIP(-/-) and wild-type (WT) mice. p-CREB immunoreactivity (IR) was determined in bladder...... (Fast blue) afferent cells. Nerve growth factor (NGF) bladder content was determined by enzyme-linked immunosorbent assays. Basal expression of p-CREB-IR in DRG of VIP(-/-) mice was (p DRG compared to WT mice. CYP treatment in WT mice increased (p ...-CREB-IR in L1, L2, L5-S1 DRG. CYP treatment in VIP(-/-) mice (p DRG compared to WT with CYP. In WT mice, bladder afferent cells (20-38%) in DRG expressed p-CREB-IR under basal conditions. With CYP, p-CREB-IR increased in bladder afferent cells (60...

  12. Intraretinal proliferation induced by retinal detachment

    International Nuclear Information System (INIS)

    Fisher, S.K.; Erickson, P.A.; Lewis, G.P.; Anderson, D.H.

    1991-01-01

    Cellular proliferation after retinal detachment was studied by 3 H-thymidine light microscopic autoradiography in cats that had experimental detachments of 0.5-180 days duration. The animals underwent labeling 2 hr before death with an intraocular injection of 200 microCi of 3 H-thymidine. The number of labeled nuclei were counted in 1-micron thick tissue sections in regions of detachment, in regions of the experimental eyes that remained attached, and in control eyes that had no detachments. In the normal eye, in one that had only the lens and vitreous removed, and in the eyes with 0.5- and 1-day detachments, the number of labeled nuclei ranged from 0/mm (0.5-day detachment) to 0.38/mm (lens and vitreous removed only). By 2 days postdetachment, the number of labeled nuclei increased to 2.09/mm. The highest levels of labeling occurred in two animals with detachments of 3 (7.86/mm) and 4 (7.09/mm) days. Thereafter, the numbers declined steadily until near-baseline counts were obtained at 14 days. The number of labeled nuclei was slightly elevated in the attached regions of two animals with 3-day detachments. Labeled cell types included: Mueller cells, astrocytes, pericytes, and endothelial cells of the retinal vasculature, and both resident (microglial cells) and invading macrophages. In an earlier study RPE cells were also shown to proliferate in response to detachment. Thus, these data show that proliferation is a rapid response to detachment, reaching a maximum within 4 days, and that virtually every nonneuronal cell type in the retina can participate in this response. The data suggest that events leading to such clinical manifestations as proliferative vitreoretinopathy and subretinal fibrosis may have their beginnings in this very early proliferative response

  13. Position paper on nuclear proliferation issues preventing nuclear proliferation. A duty for the nuclear community

    Energy Technology Data Exchange (ETDEWEB)

    Goldschmidt, Pierre; Bonin, Bernard [ENS High Scientific Council, Brussels (Belgium)

    2010-06-15

    The production of electricity from nuclear power plants is widely seen today as having an increasing role to play in meeting global energy requirements in a sustainable manner. Conscious of the inherently sensitive nature of nuclear technology and materials the ENS-HSC (European Nuclear Society - High Scientific Council) is well aware that a severe safety, security, environmental or proliferation mishap stemming from nuclear energy anywhere in the world would undermine the potential for nuclear energy to contribute to the global energy supply and the minimization of harmful carbon emissions. While the safety of nuclear power plants has continuously improved over the last three decades, the same degree of success cannot be claimed when it comes to the achievements of the international community in stemming the risk of nuclear weapons proliferation. This unfortunate situation is due to both technical and political reasons. The European nuclear industry is committed to the exclusively peaceful use of nuclear energy and to export nuclear facilities and related materials, equipment and technology solely in accordance with relevant national export laws and regulations, Nuclear Suppliers Group guidelines and pertinent United Nations Security Council Resolutions. The ENS-HSC considers that, as a manifestation of their strong commitment to nonproliferation, it is important for the nuclear industry to pay special attention to and promote proliferation-resistant designs and to take IAEA safeguards requirements into account at the design stage. Preventing nuclear proliferation is primarily the responsibility of states but, as major stakeholders, the nuclear industry and scientific community should actively support nuclear disarmament as foreseen in the Non-Proliferation Treaty and measures necessary to strengthen the non-proliferation regime, particularly the international control of the flux of nuclear material and technology. (orig.)

  14. Position paper on nuclear proliferation issues preventing nuclear proliferation. A duty for the nuclear community

    International Nuclear Information System (INIS)

    Goldschmidt, Pierre; Bonin, Bernard

    2010-01-01

    The production of electricity from nuclear power plants is widely seen today as having an increasing role to play in meeting global energy requirements in a sustainable manner. Conscious of the inherently sensitive nature of nuclear technology and materials the ENS-HSC (European Nuclear Society - High Scientific Council) is well aware that a severe safety, security, environmental or proliferation mishap stemming from nuclear energy anywhere in the world would undermine the potential for nuclear energy to contribute to the global energy supply and the minimization of harmful carbon emissions. While the safety of nuclear power plants has continuously improved over the last three decades, the same degree of success cannot be claimed when it comes to the achievements of the international community in stemming the risk of nuclear weapons proliferation. This unfortunate situation is due to both technical and political reasons. The European nuclear industry is committed to the exclusively peaceful use of nuclear energy and to export nuclear facilities and related materials, equipment and technology solely in accordance with relevant national export laws and regulations, Nuclear Suppliers Group guidelines and pertinent United Nations Security Council Resolutions. The ENS-HSC considers that, as a manifestation of their strong commitment to nonproliferation, it is important for the nuclear industry to pay special attention to and promote proliferation-resistant designs and to take IAEA safeguards requirements into account at the design stage. Preventing nuclear proliferation is primarily the responsibility of states but, as major stakeholders, the nuclear industry and scientific community should actively support nuclear disarmament as foreseen in the Non-Proliferation Treaty and measures necessary to strengthen the non-proliferation regime, particularly the international control of the flux of nuclear material and technology. (orig.)

  15. Dynamics of proliferating powers. For a new interdisciplinary approach

    International Nuclear Information System (INIS)

    Archambault, Jean-Claude; GRAND, Camille; Pasco, Xavier; SITT, Bernard

    2002-01-01

    The authors highlight that conventional approaches to the proliferation of arms of massive destruction are not sufficient to provide a generic evaluation grid whereas such a grid is clearly needed. In a first part, they discuss the contribution of various theories of proliferation of arms of massive destruction which generally address this phenomenon through three main points of view: legal and political means of struggle against proliferation, analysis of technical capacities, and motivations of proliferating States. The authors indicate and briefly present the various associated models. Then, they develop the basis of an analytical method aimed at a better understanding of the 'proliferating power', and at using various approaches, and notably that related to leader's psychology. They comment the content of studies already published on these issues, more precisely address the psycho-sociological dimension, outline the interest of diplomacy in this psychological approach, evoke the different typologies of personality, and propose elements of a new matrix of analysis of the proliferation phenomenon which takes national resources, history and strategic context, type of political regime, history and personality typology of the leader, and international dependencies, alliances, elites and mediators of the inner power, and public opinions into account

  16. Improving Hybrid III injury assessment in steering wheel rim to chest impacts using responses from finite element Hybrid III and human body model.

    Science.gov (United States)

    Holmqvist, Kristian; Davidsson, Johan; Mendoza-Vazquez, Manuel; Rundberget, Peter; Svensson, Mats Y; Thorn, Stefan; Törnvall, Fredrik

    2014-01-01

    The main aim of this study was to improve the quality of injury risk assessments in steering wheel rim to chest impacts when using the Hybrid III crash test dummy in frontal heavy goods vehicle (HGV) collision tests. Correction factors for chest injury criteria were calculated as the model chest injury parameter ratios between finite element (FE) Hybrid III, evaluated in relevant load cases, and the Total Human Model for Safety (THUMS). This is proposed to be used to compensate Hybrid III measurements in crash tests where steering wheel rim to chest impacts occur. The study was conducted in an FE environment using an FE-Hybrid III model and the THUMS. Two impactor shapes were used, a circular hub and a long, thin horizontal bar. Chest impacts at velocities ranging from 3.0 to 6.0 m/s were simulated at 3 impact height levels. A ratio between FE-Hybrid III and THUMS chest injury parameters, maximum chest compression C max, and maximum viscous criterion VC max, were calculated for the different chest impact conditions to form a set of correction factors. The definition of the correction factor is based on the assumption that the response from a circular hub impact to the middle of the chest is well characterized and that injury risk measures are independent of impact height. The current limits for these chest injury criteria were used as a basis to develop correction factors that compensate for the limitations in biofidelity of the Hybrid III in steering wheel rim to chest impacts. The hub and bar impactors produced considerably higher C max and VC max responses in the THUMS compared to the FE-Hybrid III. The correction factor for the responses of the FE-Hybrid III showed that the criteria responses for the bar impactor were consistently overestimated. Ratios based on Hybrid III and THUMS responses provided correction factors for the Hybrid III responses ranging from 0.84 to 0.93. These factors can be used to estimate C max and VC max values when the Hybrid III is

  17. ATTRIBUTION OF CONDUCT TO A STATE-THE SUBJECTIVE ELEMENT OF THE INTERNATIONAL RESPONSIBILITY OT THE STATE FOR INTERNATIONALLY WRONGFUL ACTS

    Directory of Open Access Journals (Sweden)

    FELICIA MAXIM

    2012-05-01

    Full Text Available In order to establish responsibility of states for internationally wrongful act, two elements are identified. First, the conduct in question must be attributable to the State under international law. Secondly, for responsibility to attach to the act of the State, the conduct must constitute a breach of an international legal obligation in force for that State at that time. For particular conduct to be characterized as an internationally wrongful act, it must first be attributable to the State. The State is a real organized entity, a legal person with full authority to act under international law. But to recognize this is not to deny the elementary fact that the State cannot act of itself. States can act only by and through their agents and representatives. In determining what constitutes an organ of a State for the purposes of responsibility, the internal law and practice of each State are of prime importance. The structure of the State and the functions of its organs are not, in general, governed by international law. It is a matter for each State to decide how its administration is to be structured and which functions are to be assumed by government. But while the State remains free to determine its internal structure and functions through its own law and practice, international law has a distinct role. Conduct is thereby attributed to the State as a subject of international law and not as a subject of internal law. The State as a subject of international law is held responsible for the conduct of all the organs, instrumentalities and officials which form part of its organization and act in that capacity, whether or not they have separate legal personality under its internal law.

  18. Melatonin regulates CRE-dependent gene transcription underlying osteoblast proliferation by activating Src and PKA in parallel.

    Science.gov (United States)

    Tao, Lin; Zhu, Yue

    2018-01-01

    Several studies have indicated a relationship between melatonin and idiopathic scoliosis, including our previous work which demonstrated that melatonin can inhibit osteoblast proliferation; however, the mechanism remains unclear. Here, we utilized a MTT assay to show that melatonin significantly reduces osteoblast proliferation in a concentration-and time-dependent manner. Through a combination of techniques, including real-time PCR, MTT assays, immunofluorescence, and luciferase assays, we confirmed that melatonin-induced changes in phosphorylated cAMP response element-binding protein (CREB) reduced transcriptional activity in a melatonin receptor-dependent manner. Surprisingly, treatment of osteoblasts with the mitogen-activated protein kinase/extracellular signal-regulated kinase kinase (MEK) inhibitor PD98059 up-regulated other cascades upstream of CREB. We next treated cells with PKA and Src inhibitors and observed that melatonin can also activate the protein kinase A (PKA) and Src pathways. To examine whether Src is upstream from the cAMP-PKA pathway, we measured cAMP levels in response to melatonin with and without a Src inhibitor (PP2) and found that PP2 had no additional effect. Therefore, the transcription-dependent mechanisms involved in CREB phosphorylation, along with melatonin, activated Src via a parallel signaling pathway that was separate from that of PKA. Finally, we transfected osteoblasts with lentiviral CREB short hairpin (sh) RNAs and found a decrease in the expression of proliferating cell nuclear antigen (PCNA) and osteoblast proliferation. These results suggest that CREB and PCNA are downstream targets of melatonin signaling, and that the down-regulation of CREB, which is regulated via PKA and Src pathways, contributes to the melatonin-induced inhibition of osteoblast proliferation.

  19. A Polymorphic Antioxidant Response Element Links NRF2/sMAF Binding to Enhanced MAPT Expression and Reduced Risk of Parkinsonian Disorders

    Directory of Open Access Journals (Sweden)

    Xuting Wang

    2016-04-01

    Full Text Available The NRF2/sMAF protein complex regulates the oxidative stress response by occupying cis-acting enhancers containing an antioxidant response element (ARE. Integrating genome-wide maps of NRF2/sMAF occupancy with disease-susceptibility loci, we discovered eight polymorphic AREs linked to 14 highly ranked disease-risk SNPs in individuals of European ancestry. Among these SNPs was rs242561, located within a regulatory region of the MAPT gene (encoding microtubule-associated protein Tau. It was consistently occupied by NRF2/sMAF in multiple experiments and its strong-binding allele associated with higher mRNA levels in cell lines and human brain tissue. Induction of MAPT transcription by NRF2 was confirmed using a human neuroblastoma cell line and a Nrf2-deficient mouse model. Most importantly, rs242561 displayed complete linkage disequilibrium with a highly protective allele identified in multiple GWASs of progressive supranuclear palsy, Parkinson’s disease, and corticobasal degeneration. These observations suggest a potential role for NRF2/sMAF in tauopathies and a possible role for NRF2 pathway activators in disease prevention.

  20. Advanced glycation end products promote ChREBP expression and cell proliferation in liver cancer cells by increasing reactive oxygen species.

    Science.gov (United States)

    Chen, Hanbei; Li, Yakui; Zhu, Yemin; Wu, Lifang; Meng, Jian; Lin, Ning; Yang, Dianqiang; Li, Minle; Ding, WenJin; Tong, Xuemei; Su, Qing

    2017-08-01

    The aim of the study was to elucidate the mechanism by which advanced glycation end products (AGEs) promote cell proliferation in liver cancer cells.We treated liver cancer HepG2 cells with 200 mg/L AGEs or bovine serum albumin (BSA) and assayed for cell viability, cell cycle, and apoptosis. We performed real-time PCR and Western blot analysis for RNA and protein levels of carbohydrate responsive element-binding protein (ChREBP) in AGEs- or BSA-treated HepG2 cells. We analyzed the level of reactive oxygen species (ROS) in HepG2 cells treated with AGEs or BSA.We found that increased S-phase cell percentage and decreased apoptosis contributed to AGEs-induced liver cancer cell proliferation. Real-time PCR and Western blot analysis showed that AGEs stimulated RNA and protein levels of ChREBP, a transcription factor promoting glycolysis and maintaining cell proliferation in liver cancer cells. Intriguingly, the level of ROS was higher in AGEs-treated liver cancer cells. Treating liver cancer cells with antioxidant N-acetyl cystein (NAC) partly blocked AGEs-induced ChREBP expression and cell proliferation.Our results suggest that the AGEs-ROS-ChREBP pathway plays a critical role in promoting ChREBP expression and liver cancer cell proliferation.

  1. Deletion of an Endoplasmic Reticulum Stress Response Element in a ZmPP2C-A Gene Facilitates Drought Tolerance of Maize Seedlings.

    Science.gov (United States)

    Xiang, Yanli; Sun, Xiaopeng; Gao, Shan; Qin, Feng; Dai, Mingqiu

    2017-03-06

    Drought is a major abiotic stress that causes the yearly yield loss of maize, a crop cultured worldwide. Breeding drought-tolerant maize cultivars is a priority requirement of world agriculture. Clade A PP2C phosphatases (PP2C-A), which are conserved in most plant species, play important roles in abscisic acid (ABA) signaling and plant drought response. However, natural variations of PP2C-A genes that are directly associated with drought tolerance remain to be elucidated. Here, we conducted a candidate gene association analysis of the ZmPP2C-A gene family in a maize panel consisting of 368 varieties collected worldwide, and identified a drought responsive gene ZmPP2C-A10 that is tightly associated with drought tolerance. We found that the degree of drought tolerance of maize cultivars negatively correlates with the expression levels of ZmPP2C-A10. ZmPP2C-A10, like its Arabidopsis orthologs, interacts with ZmPYL ABA receptors and ZmSnRK2 kinases, suggesting that ZmPP2C-A10 is involved in mediating ABA signaling in maize. Transgenic studies in maize and Arabidopsis confirmed that ZmPP2C-A10 functions as a negative regulator of drought tolerance. Further, a causal natural variation, deletion allele-338, which bears a deletion of ERSE (endoplasmic reticulum stress response element) in the 5'-UTR region of ZmPP2C-A10, was detected. This deletion causes the loss of endoplasmic reticulum (ER) stress-induced expression of ZmPP2C-A10, leading to increased plant drought tolerance. Our study provides direct evidence linking ER stress signaling with drought tolerance and genetic resources that can be used directly in breeding drought-tolerant maize cultivars. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Porcine calbindin-D9k gene: expression in endometrium, myometrium, and placenta in the absence of a functional estrogen response element in intron A.

    Science.gov (United States)

    Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C

    1995-01-01

    The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.

  3. Nuclear proliferation and safeguards. Summary

    International Nuclear Information System (INIS)

    1982-03-01

    This comprehensive analysis of the technological, economic, and political factors affecting the potential spread of nuclear weapons proved useful in the congressional debate which culminated in the Nuclear Non-Proliferation Act of 1978. The report was subsequently published commercially and has been a frequently cited reference in the literature on proliferation and nuclear power. Despite developments since 1977, the information in the OTA report is still useful to those wishing to obtain an indepth understanding of the issues. Included is an analysis of why a nation might want nuclear weapons development program and the various sources of nuclear material are discussed. The control of proliferation is considered as well as its relation to the nuclear industry

  4. Domestic Politics and Nuclear Proliferation

    International Nuclear Information System (INIS)

    Kim, Chul Min; Yim, Man Sung

    2016-01-01

    The external security threat is known as the most important factor of nuclear weapons progra