Polymorphism of the prolactin gene and its association with egg ...
African Journals Online (AJOL)
p2492989
In this study, polymorphism of the prolactin gene was screened in six Chinese native ... Prolactin (PRL) is a single-chain polypeptide hormone that belongs to the growth hormone gene ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining.
Effects of bovine prolactin gene polymorphism within exon 4 on milk ...
African Journals Online (AJOL)
In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...
Effects of bovine prolactin gene polymorphism within exon 4 on milk ...
African Journals Online (AJOL)
STORAGESEVER
2009-10-05
Oct 5, 2009 ... In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for ... studied. Based on important role of prolactin gene in milk related traits and their genetic trends in dairy cattle, the aims of this study were, to screen ..... isolation and selection towards high fat and protein per-.
Polymorphism of the prolactin gene (PRL) and its relationship with ...
African Journals Online (AJOL)
The modern dairy cattle breeding strategy in the Mexican tropic is to identify genes or allelic variants that can be incorporated into selection programs such as the prolactin gene (PRL) which is associated with milk production and quality. The aim of this study is to screen an American Swiss population in Chiapas, Mexico, ...
Polymorphism of the prolactin gene (PRL) and its relationship with ...
African Journals Online (AJOL)
enoh
2012-04-10
Apr 10, 2012 ... prolactin gene (PRL), associated with milk production and quality (Brymet et al., 2005; ... synthesis and secretion of proteins, lactose, lipids, and other important ..... genotype AB in Black Pied cattle affected milk, fat and protein ...
DEFF Research Database (Denmark)
Jacob, K K; Sap, J; Stanley, F M
1998-01-01
A physiologically relevant response to insulin, stimulation of prolactin promoter activity in GH4 pituitary cells, was used as an assay to study the specificity of protein-tyrosine phosphatase function. Receptor-like protein-tyrosine phosphatase alpha (RPTPalpha) blocks the effect of insulin...... is specific by two criteria. A number of potential RPTPalpha targets were ruled out by finding (a) that they are not affected or (b) that they are not on the pathway to insulin-increased prolactin-CAT activity. The negative effect of RPTPalpha on insulin activation of the prolactin promoter is not due...... to reduced phosphorylation or kinase activity of the insulin receptor or to reduced phosphorylation of insulin receptor substrate-1 or Shc. Inhibitor studies suggest that insulin-increased prolactin gene expression is mediated by a Ras-like GTPase but is not mitogen-activated protein kinase dependent...
Interactions between prolactin and kisspeptin to control reproduction.
Donato, Jose; Frazão, Renata
2016-01-01
Prolactin is best known for its effects of stimulating mammary gland development and lactogenesis. However, prolactin is a pleiotropic hormone that is able to affect several physiological functions, including fertility. Prolactin receptors (PRLRs) are widely expressed in several tissues, including several brain regions and reproductive tract organs. Upon activation, PRLRs may exert prolactin's functions through several signaling pathways, although the recruitment of the signal transducer and activator of transcription 5 causes most of the known effects of prolactin. Pathological hyperprolactinemia is mainly due to the presence of a prolactinoma or pharmacological effects induced by drugs that interact with the dopamine system. Notably, hyperprolactinemia is a frequent cause of reproductive dysfunction and may lead to infertility in males and females. Recently, several studies have indicated that prolactin may modulate the reproductive axis by acting on specific populations of hypothalamic neurons that express the Kiss1 gene. The Kiss1 gene encodes neuropeptides known as kisspeptins, which are powerful activators of gonadotropin-releasing hormone neurons. In the present review, we will summarize the current knowledge about prolactin's actions on reproduction. Among other aspects, we will discuss whether the interaction between prolactin and the Kiss1-expressing neurons can affect reproduction and how kisspeptins may become a novel therapeutic approach to treat prolactin-induced infertility.
Directory of Open Access Journals (Sweden)
M. Indriati
2016-04-01
Full Text Available Genetic marker linked to loci reproductive traits could be used to increase an effectiveness of improvement in animal breeding. Association between DNA polymorphism and a trait could be considered as candidate genetic marker for marker assisted selection (MAS programs. Prolactin (PRL is one of polypeptide hormones secreted by anterior pituitary gland in vertebrates. PRL plays an important role in onset of poultry incubation and brooding behavior. The aim of this study was to investigate the diversity of prolactin gene and to characterize the type of mutation in partial intron 3, intron 4 and exon 4 of duck prolactin gene. Blood extraction was collected from 168 ducks consisted of 19 Peking, 36 Mojosari, and 113 Peking White Mojosari (Peking Mojosari putih ducks. Polymerase chain reaction of fragment prolactin gene exon 4 and partial intron 3 and 4 have been successfully amplified with length of base pair were 496 bp. A total of 30 µL PCR product from each sample were sequenced for forward sequence using BIOTRACE 3730 by First Base Company, Malaysia. Alignment analysis found six SNP consisted of g.3941T>G, g.3975C>A, g.4110T>C, INDEL 3724A, INDEL 34031, and INDEL 3939A. Analysis of SNP frequency result indicated mutation of INDEL 3724A, g.3941T>G, g.3975C>A, INDEL 4031A and g.4110T>A in duck sample were polymorphic and INDEL 3939A were monomorphic.
Kumar, V; Wong, D T; Pasion, S G; Biswas, D K
1987-12-08
The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.
Suppression of prolactin gene expression in GH cells correlates with site-specific DNA methylation.
Zhang, Z X; Kumar, V; Rivera, R T; Pasion, S G; Chisholm, J; Biswas, D K
1989-10-01
Prolactin- (PRL) producing and nonproducing subclones of the GH line of (rat) pituitary tumor cells have been compared to elucidate the regulatory mechanisms of PRL gene expression. Particular emphasis was placed on delineating the molecular basis of the suppressed state of the PRL gene in the prolactin-nonproducing (PRL-) GH subclone (GH(1)2C1). We examined six methylatable cytosine residues (5, -CCGG- and 1, -GCGC-) within the 30-kb region of the PRL gene in these subclones. This analysis revealed that -CCGG-sequences of the transcribed region, and specifically, one in the fourth exon of the PRL gene, were heavily methylated in the PRL-, GH(1)2C1 cells. Furthermore, the inhibition of PRL gene expression in GH(1)2C1 was reversed by short-term treatment of the cells with a sublethal concentration of azacytidine (AzaC), an inhibitor of DNA methylation. The reversion of PRL gene expression by AzaC was correlated with the concurrent demethylation of the same -CCGG- sequences in the transcribed region of PRL gene. An inverse correlation between PRL gene expression and the level of methylation of the internal -C- residues in the specific -CCGG-sequence of the transcribed region of the PRL gene was demonstrated. The DNase I sensitivity of these regions of the PRL gene in PRL+, PRL-, and AzaC-treated cells was also consistent with an inverse relationship between methylation state, a higher order of structural modification, and gene expression.(ABSTRACT TRUNCATED AT 250 WORDS)
Furigo, Isadora C; Kim, Ki Woo; Nagaishi, Vanessa S; Ramos-Lobo, Angela M; de Alencar, Amanda; Pedroso, João A B; Metzger, Martin; Donato, Jose
2014-05-30
Estrogens and prolactin share important target tissues, including the gonads, brain, liver, kidneys and some types of cancer cells. Herein, we sought anatomical and functional evidence of possible crosstalk between prolactin and estrogens in the mouse brain. First, we determined the distribution of prolactin-responsive neurons that express the estrogen receptor α (ERα). A large number of prolactin-induced pSTAT5-immunoreactive neurons expressing ERα mRNA were observed in several brain areas, including the anteroventral periventricular nucleus, medial preoptic nucleus, arcuate nucleus of the hypothalamus, ventrolateral subdivision of the ventromedial nucleus of the hypothalamus (VMH), medial nucleus of the amygdala and nucleus of the solitary tract. However, although the medial preoptic area, periventricular nucleus of the hypothalamus, paraventricular nucleus of the hypothalamus, retrochiasmatic area, dorsomedial subdivision of the VMH, lateral hypothalamic area, dorsomedial nucleus of the hypothalamus and ventral premammillary nucleus contained significant numbers of prolactin-responsive neurons, these areas showed very few pSTAT5-immunoreactive cells expressing ERα mRNA. Second, we evaluated prolactin sensitivity in ovariectomized mice and observed that sex hormones are required for a normal responsiveness to prolactin as ovariectomized mice showed a lower number of prolactin-induced pSTAT5 immunoreactive neurons in all analyzed brain nuclei compared to gonad-intact females. In addition, we performed hypothalamic gene expression analyses to determine possible post-ovariectomy changes in components of prolactin signaling. We observed no significant changes in the mRNA expression of prolactin receptor, STAT5a or STAT5b. In summary, sex hormones exert a permissive role in maintaining the brain's prolactin sensitivity, most likely through post-transcriptional mechanisms. Copyright © 2014 Elsevier B.V. All rights reserved.
Effects of deletion of the prolactin receptor on ovarian gene expression
Directory of Open Access Journals (Sweden)
Kelly Paul A
2003-02-01
Full Text Available Abstract Prolactin (PRL exerts pleiotropic physiological effects in various cells and tissues, and is mainly considered as a regulator of reproduction and cell growth. Null mutation of the PRL receptor (R gene leads to female sterility due to a complete failure of embryo implantation. Pre-implantatory egg development, implantation and decidualization in the mouse appear to be dependent on ovarian rather than uterine PRLR expression, since progesterone replacement permits the rescue of normal implantation and early pregnancy. To better understand PRL receptor deficiency, we analyzed in detail ovarian and corpora lutea development of PRLR-/- females. The present study demonstrates that the ovulation rate is not different between PRLR+/+ and PRLR-/- mice. The corpus luteum is formed but an elevated level of apoptosis and extensive inhibition of angiogenesis occur during the luteal transition in the absence of prolactin signaling. These modifications lead to the decrease of LH receptor expression and consequently to a loss of the enzymatic cascades necessary to produce adequate levels of progesterone which are required for the maintenance of pregnancy.
Directory of Open Access Journals (Sweden)
Edward L. Treadwell
2015-01-01
Full Text Available Systemic lupus erythematosus (SLE has shown an association with high levels of prolactin, low levels of dehydroepiandrosterone (DHEA, and induction of inflammatory cytokines in the serum of patients with the disease. This preliminary study examined the relevance of a −1149G/T functional single-nucleotide polymorphism (SNP (rs1341239 in the promoter of the extrapituitary prolactin gene in a cohort of African American and European American women with lupus. Examination of this SNP revealed that the −1149TT genotype was correlated with higher levels of prolactin in serum and prolactin gene expression (p=0.0001 in peripheral blood mononuclear cells (PBMCs. Lower levels of DHEA in serum were demonstrated in lupus patients (p=0.001; those with the −1149TT genotype had the lowest levels of DHEA. Furthermore, a small subset of women who were on DHEA therapy and had a TT genotype showed a significant decrease in prolactin gene expression and lower disease activity scores (SLEDAI. Lupus patients, particularly African Americans, had significantly higher levels of IL-6 (p=0.0001 and TNF-α (p=0.042. This study suggests that the −1149TT genotype may be a risk factor for lupus and may predict who could possibly benefit from DHEA therapy; therefore, these results should be validated in a larger cohort with all ethnic groups.
International Nuclear Information System (INIS)
Friesen, H.; Guyda, H.; Hwang, P.
1976-01-01
A radioimmunoassay for primate prolactin is described. Synthesis, secretion and immunological properties of prolactin in comparison to the human growth hormone and separation of the two are studied using 3 H-L-leucine. Prolactin was labelled with 131 I by the chloramine-T method of Hunter and Greenwood. Purification was performed by a sepharose column, coupled with antibodies to ovine prolactine from which the prolactin is subsequently eluted. The assay procedure and the cross-reactivity of different materials in the assay are described. Prolactin concentrations in healthy people, patients and pregnant women (amniotic fluid) are examined
Directory of Open Access Journals (Sweden)
AGATA ZIÓŁKOWSKA
2011-01-01
Full Text Available Prolactin receptor gene was found in pig chromosome 16, and it is one of the genes with a significant effect on reproduction traits in sows. The objective of the research was to determine polymorphism of the prolactin receptor gene in pigs of two maternal breeds: Polish Landrace and Polish Large White, as well as analyse relations between particular allelomorphic variants, and reproduction traits of examined sows. Two PRLR gene alleles, A and B, were isolated, they were obtained after AluI restriction gene digestion of the PCR product with the length of 163 bp; furthermore, three genotypes were identified: PRLRAA – 85, 59, 19 bp; PRLRAB – 104, 85, 59, 19 bp; PRLRBB – 104, 59 bp. We assessed 122 sows, in terms of their age at the first farrowing, as well as the sizes of the two subsequent litters. No statistically significant differences were found in the examined reproduction traits in sows with different allelomorphic relations, both within each breed and between breeds. Obtained results indicate that it is necessary to conduct further research on a larger animal group.
Directory of Open Access Journals (Sweden)
Patel Osman V
2009-03-01
Full Text Available Abstract Background Bovine trophoblast binucleate cells (BNC express a plethora of molecules including bovine placental lactogen (bPL, gene name is bCSH1 and bovine prolactin-related protein-1 (bPRP1. BCSH1 and bPRP1 are members of the growth hormone (GH/prolactin (PRL gene family, which are expressed simultaneously in BNC and are central to placentation and the progression of pregnancy in cattle. However, there is a paucity of information on the transcriptional regulatory mechanisms of both the bCSH1 and bPRP1 genes. Recent studies, however, have demonstrated that the expression of a number of genes is controlled by the methylation status of their promoter region. In the present study, we examined the cell-type-specific epigenetic alterations of the 5'-flanking region of the bCSH1 and bPRP1 genes to gain an insight into their regulatory mechanisms. Results Analysis of 5-aza-2'-deoxycytidine treatment demonstrated that bCSH1 expression is moderately induced in fibroblast cultures but enhanced in BT-1 cells. Sodium bisulfite based sequencing revealed that bCSH1 is hypomethylated in the cotyledonary tissue but not in the fetal skin, and this pattern was not altered with the progression of pregnancy. On the other hand, the methylation status of bPRP1 was similar between the cotyledon and fetal skin. The bPRP1 gene was exclusively hypermethylated in a bovine trophoblast cell-derived BT-1 cell-line. While the activity of bCSH1 was similar in both BT-1 and bovine fibroblast cells, that of bPRP1 was specific to BT-1. Treatment with a demethylating agent and luciferase assays provided in vitro evidence of the positive regulation of bCSH1 but not bPRP1. Conclusion This is the first report to identify the differential regulatory mechanisms of the bCSH1 and bPRP1 genes and indicates that bCSH1 might potentially be the only transcript that is subject to DNA methyltransferase regulation. The data indicates the possibility of novel kinetics of induction of
Are sexual side effects of prolactin-raising antipsychotics reducible to serum prolactin?
Knegtering, Henderikus; van den Bosch, Rob; Castelein, Stynke; Bruggeman, Richard; Sytema, Sjoerd; van Os, Jim
Objective: To assess the degree to which sexual side effects (SSE) are associated with prolactin-raising antipsychotics, and to what degree such SSE are reducible to serum prolactin levels. Method: A large sample (n = 264) of patients treated for 6 weeks with protactin-raising and prolactin-sparing
Chen, Chun-Yen; Yeh, Yi-Wei; Kuo, Shin-Chang; Ho, Pei-Shen; Liang, Chih-Sung; Yen, Che-Hung; Lu, Ru-Band; Huang, San-Yuan
2016-03-01
Catechol-O-methyltransferase (COMT) enzyme is involved in the pathogenesis of psychotic symptoms and may be associated with a therapeutic response to antipsychotic drugs. The aim of this study was to examine the relationship between COMT variants, plasma prolactin level, and the therapeutic effectiveness of amisulpride treatment in patients with schizophrenia. A 12-week naturalistic study of amisulpride treatment was carried out in 185 Han Chinese patients with schizophrenia. The patients were screened for 14 single-nucleotide polymorphisms of the COMT gene. The Positive and Negative Syndrome Scale (PANSS) was used to assess the improvement of psychopathological symptoms from the baseline to the end point in each subject. For better presentation of time-course changes in response status, a mixed model for repeated-measures (MMRM) analysis of symptom improvement during the 12-week treatment period was conducted. The change in plasma prolactin level after amisulpride treatment was also examined (n=51). No significant differences in the genotype frequencies of the COMT variants investigated were observed between responders and non-responders. Moreover, an MMRM analysis of psychopathological symptom improvement during the 12-week treatment course showed that it depended significantly on COMT variants (rs4680, rs4633, and rs6267), particularly regarding changes in negative symptoms. The increase in plasma prolactin levels observed was influenced by the COMT rs4680 variant and was positively correlated with a reduction in PANSS negative scores. Our results suggest that variation of the COMT gene is associated with treatment response regarding negative symptoms and prolactin changes after amisulpride treatment in patients with schizophrenia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Prolactin family of the guinea pig, Cavia porcellus.
Alam, S M Khorshed; Konno, Toshihiro; Rumi, M A Karim; Dong, Yafeng; Weiner, Carl P; Soares, Michael J
2010-08-01
Prolactin (PRL) is a multifunctional hormone with prominent roles in regulating growth and reproduction. The guinea pig (Cavia porcellus) has been extensively used in endocrine and reproduction research. Thus far, the PRL cDNA and protein have not been isolated from the guinea pig. In the present study, we used information derived from the public guinea pig genome database as a tool for identifying guinea pig PRL and PRL-related proteins. Guinea pig PRL exhibits prominent nucleotide and amino acid sequence differences when compared with PRLs of other eutherian mammals. In contrast, guinea pig GH is highly conserved. Expression of PRL and GH in the guinea pig is prominent in the anterior pituitary, similar to known expression patterns of PRL and GH for other species. Two additional guinea pig cDNAs were identified and termed PRL-related proteins (PRLRP1, PRLRP2). They exhibited a more distant relationship to PRL and their expression was restricted to the placenta. Recombinant guinea pig PRL protein was generated and shown to be biologically active in the PRL-responsive Nb2 lymphoma cell bioassay. In contrast, recombinant guinea pig PRLRP1 protein did not exhibit PRL-like bioactivity. In summary, we have developed a new set of research tools for investigating the biology of the PRL family in an important animal model, the guinea pig.
The Beckman DxI 800 prolactin assay demonstrates superior specificity for monomeric prolactin.
LENUS (Irish Health Repository)
Byrne, Brendan
2010-02-01
Commercially available prolactin immunoassays detect macroprolactin to variable degrees. Best practice requires laboratories to assess the cross-reactivity of their prolactin assay with macroprolactin, and where appropriate, introduce a screen for the presence of macroprolactin. Our policy has been to reanalyse hyperprolactinaemic samples following polyethylene glycol (PEG) precipitation and to report the resultant value as the monomeric prolactin content of the sample. The goal of this study was to determine the need to continue PEG precipitation when prolactin measurements with the Wallac AutoDELFIA were replaced by the Beckman DxI 800.
... page: //medlineplus.gov/ency/article/003718.htm Prolactin blood test To use the sharing features on this page, ... test measures the amount of prolactin in the blood. How the Test is Performed A blood sample is needed . How ...
Functions of two distinct prolactin-releasing peptides evolved from a common ancestral gene
Directory of Open Access Journals (Sweden)
Tetsuya eTachibana
2014-11-01
Full Text Available Prolactin-releasing peptide (PrRP is one of the RF-amide peptides and was originally identified in the bovine hypothalamus as a stimulator of prolactin (PRL release. Independently, another RF-amide peptide was found in Japanese crucian carp and named Carassius RFa (C-RFa, which shows high homology to PrRP and stimulates PRL secretion in teleost fish. Therefore, C-RFa has been recognized as fish PrRP. However, recent work has revealed that PrRP and C-RFa in non-mammalian vertebrates are encoded by separate genes originated through duplication of an ancestral gene. Indeed, both PrRP and C-RFa are suggested to exist in teleost, amphibian, reptile, and avian species. Therefore, we propose that non-mammalian PrRP (C-RFa be renamed PrRP2. Despite a common evolutionary origin, PrRP2 appears to be a physiological regulator of PRL, whereas this is not a consistent role for PrRP itself. Further work revealed that the biological functions of PrRP and PrRP2 are not limited solely to PRL release, because they are also neuromodulators of several hypothalamus-pituitary axes and are involved in some brain circuits related to the regulation of food intake, stress, and cardiovascular functions. However, these actions appear to be different among vertebrates. For example, central injection of PrRP inhibits feeding behavior in rodents and teleosts while it stimulates it in chicks. Therefore, both PrRP and PrRP2 have acquired diverse actions through evolution. In this review, we integrate the burgeoning information of structures, expression profiles, and multiple biological actions of PrRP in higher vertebrates, as well as those of PrRP2 in non-mammals.
International Nuclear Information System (INIS)
Murphy, L.; Myal, Y.; Tsuyuki, D.; Shiu, R.
1986-01-01
Recently in this laboratory it was shown that in the human breast cancer cell line T47D, human prolactin of human growth hormone in the presence of hydrocortisone induced the synthesis and secretion of PIP's, a family of proteins which differed only in their degree of glycosylation. This finding represented the first demonstration of an inductin of specific proteins by prolactin in human target cells and has provided us with a unique model in which to study the molecular mechanism of multihormonal actions as well as the possible significance of prolactin in human breast cancer. In order to facilitate their studies the authors cloned PIP cDNA. The strategy chosen and the methods used are described in this article
Obtention of antibodies anti prolactin from human prolactin of national production
International Nuclear Information System (INIS)
Caso, R.; Mosquera, M.; Perez, E.; Amanz, C.
1996-01-01
In this work was studied the use of the the Prolactin hormone as immuno gen, which is obtained in Cuba by the pharmaceutical institute Mario Munoz, to produce the antibody antiprolactin. Was made the validation of obtained antibody (tritatium, specificity and affinity) The produced antibody had necessary quality to be use as a component of the Kits-RIA Prolactin
Serum prolactin level in patients taking olanzapine
Directory of Open Access Journals (Sweden)
Diganta Das
2015-01-01
Full Text Available Introduction: Olanzapine is a commonly used antipsychotic. Prolactin elevation is a common adverse effect of anstipsychotics, and serum prolactin elevation is seen in about 30% patients treated with olanzapine. There are confounding results about dose dependency of olanzapine and prolactin elevation, and also the duration of treatment. Method: Fifty six patients, 36 male and 20 female, who were taking olanzapine for any condition for more than a month at a constant dose were enrolled in the study. Patients’ age, weight, body mass index (BMI, serum prolactin levels, and some biochemical values were recorded. Patients were taken from the review outpatient department (OPD after due consent. Results: Five each in male and female groups showed elevation of serum prolactin (estimated to be high if >20 ng/dl for males, and >25 ng/dl for females. In females, the elevation was found at lesser dose of olanzapine (13 mg/day, in males 18 mg/day and early in the treatment (2.4 months vs. 9.7 months in males. Males tended to show raised prolactin with higher doses of olanzapine (mean 18 mg/day. Females (26.31% also showed higher prevalence of prolactin elevation compared to males (13.51%. No other parameter was found to modify the prolactin levels. Conclusion: Olanzapine causes elevation of serum prolactin, though lesser degree than some other antipsychotics. Females are more prone to have raised serum prolactin with olanzapine compared to males. However, the elevation seems to be transient. Higher doses of olanzapine tend to cause elevation of serum prolactin. Serum prolactin estimation in patients taking olanzapine may be undertaken to maintain quality life, particularly in females.
Clinical indications of prolactin radioimmunoassay
International Nuclear Information System (INIS)
Lengyel, A.M.J.; Vieira, J.G.H.; Zanella, M.R.; Zampieri, M.; Chacra, A.R.
1980-01-01
Is a review is presented of the main clinical uses of prolactin measurements, including the galactorrhea-amenorrhea syndrome, an experiment employing the prolactin radioimmunoassay is related. (Author) [pt
Ogura-Ochi, Kanako; Fujisawa, Satoshi; Iwata, Nahoko; Komatsubara, Motoshi; Nishiyama, Yuki; Tsukamoto-Yamauchi, Naoko; Inagaki, Kenichi; Wada, Jun; Otsuka, Fumio
2017-08-01
The effects of melatonin on prolactin production and its regulatory mechanism remain uncertain. We investigated the regulatory role of melatonin in prolactin production using rat pituitary lactotrope GH3 cells by focusing on the bone morphogenetic protein (BMP) system. Melatonin receptor activation, induced by melatonin and its receptor agonist ramelteon, significantly suppressed basal and forskolin-induced prolactin secretion and prolactin mRNA expression in GH3 cells. The melatonin MT2 receptor was predominantly expressed in GH3 cells, and the inhibitory effects of melatonin on prolactin production were reversed by treatment with the receptor antagonist luzindole, suggesting functional involvement of MT2 action in the suppression of prolactin release. Melatonin receptor activation also suppressed BMP-4-induced prolactin expression by inhibiting phosphorylation of Smad and transcription of the BMP-target gene Id-1, while BMP-4 treatment upregulated MT2 expression. Melatonin receptor activation suppressed basal, BMP-4-induced and forskolin-induced cAMP synthesis; however, BtcAMP-induced prolactin mRNA expression was not affected by melatonin or ramelteon, suggesting that MT2 activation leads to inhibition of prolactin production through the suppression of Smad signaling and cAMP synthesis. Experiments using intracellular signal inhibitors revealed that the ERK pathway is, at least in part, involved in prolactin induction by GH3 cells. Thus, a new regulatory role of melatonin involving BMP-4 in prolactin secretion was uncovered in lactotrope GH3 cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Pérez, R L; Machiavelli, G A; Romano, M I; Burdman, J A
1986-03-01
Relationships among the release of prolactin, the effect of oestrogens and the proliferation of prolactin-secreting cells were studied under several experimental conditions. Administration of sulpiride or oestradiol released prolactin and stimulated cell proliferation in the anterior pituitary gland of adult male rats. Clomiphene completely abolished the rise in cell proliferation, but did not interfere with the sulpiride-induced release of prolactin. Treatment with oestradiol plus sulpiride significantly increased serum prolactin concentrations and the mitotic index compared with the sum of the stimulation produced by both drugs separately. Bromocriptine abolished the stimulatory effect of oestradiol on the serum prolactin concentration and on cell proliferation. In oestradiol- and/or sulpiride-treated rats, 80% of the cells in mitoses were lactotrophs. The remaining 20% did not stain with antisera against any of the pituitary hormones. The number of prolactin-secreting cells in the anterior pituitary gland significantly increased after the administration of oestradiol or sulpiride. The results demonstrate that treatment with sulpiride and/or oestradiol increases the proliferation and the number of lactotrophs in the anterior pituitary gland of the rat.
Breves, Jason P.; McCormick, Stephen D.; Karlstrom, Rolf O.
2014-01-01
The peptide hormone prolactin is a functionally versatile hormone produced by the vertebrate pituitary. Comparative studies over the last six decades have revealed that a conserved function for prolactin across vertebrates is the regulation of ion and water transport in a variety of tissues including those responsible for whole-organism ion homeostasis. In teleost fishes, prolactin was identified as the “freshwater-adapting hormone”, promoting ion-conserving and water-secreting processes by acting on the gill, kidney, gut and urinary bladder. In mammals, prolactin is known to regulate renal, intestinal, mammary and amniotic epithelia, with dysfunction linked to hypogonadism, infertility, and metabolic disorders. Until recently, our understanding of the cellular mechanisms of prolactin action in fishes has been hampered by a paucity of molecular tools to define and study ionocytes, specialized cells that control active ion transport across branchial and epidermal epithelia. Here we review work in teleost models indicating that prolactin regulates ion balance through action on ion transporters, tight-junction proteins, and water channels in ionocytes, and discuss recent advances in our understanding of ionocyte function in the genetically and embryonically accessible zebrafish (Danio rerio). Given the high degree of evolutionary conservation in endocrine and osmoregulatory systems, these studies in teleost models are contributing novel mechanistic insight into how prolactin participates in the development, function, and dysfunction of osmoregulatory systems across the vertebrate lineage.
Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.
2013-01-01
OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:
Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.
Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods
Maintenance of prolactin receptors in human breast cancer
International Nuclear Information System (INIS)
Ben-David, M.; Dror, Y.; Biran, S.
1981-01-01
Breast tissue specimens of 110 women with various stages of breast cancer were tested in vitro to determine their specific binding sites for human prolactin. In contrast to the case of steroid receptors, binding sites for prolactin were found in the vast majority of breast cancer tissue. Distribution profiles giving amount of prolactin receptor and their affinity coefficients were found to be similar in the tissues of women whose ages, hormonal status, or stage of breast cancer varied. These findings show that in contrast to steroid receptors, human breast cancer tissue maintains binding sites for prolactin. The findings also indicate that there may be a higher dependency of breast cancer on prolactin than on steroids. Clinical trials must be carried out to determine the role of ''positive'' prolactin receptors in prognosis and prediction of response to future hormone therapy. (author)
Prostate response to prolactin in sexually active male rats
Directory of Open Access Journals (Sweden)
Garcia Luis I
2006-05-01
Full Text Available Abstract Background The prostate is a key gland in the sexual physiology of male mammals. Its sensitivity to steroid hormones is widely known, but its response to prolactin is still poorly known. Previous studies have shown a correlation between sexual behaviour, prolactin release and prostate physiology. Thus, here we used the sexual behaviour of male rats as a model for studying this correlation. Hence, we developed experimental paradigms to determine the influence of prolactin on sexual behaviour and prostate organization of male rats. Methods In addition to sexual behaviour recordings, we developed the ELISA procedure to quantify the serum level of prolactin, and the hematoxilin-eosin technique for analysis of the histological organization of the prostate. Also, different experimental manipulations were carried out; they included pituitary grafts, and haloperidol and ovine prolactin treatments. Data were analyzed with a One way ANOVA followed by post hoc Dunnet test if required. Results Data showed that male prolactin has a basal level with two peaks at the light-dark-light transitions. Consecutive ejaculations increased serum prolactin after the first ejaculation, which reached the highest level after the second, and started to decrease after the third ejaculation. These normal levels of prolactin did not induce any change at the prostate tissue. However, treatments for constant elevations of serum prolactin decreased sexual potency and increased the weight of the gland, the alveoli area and the epithelial cell height. Treatments for transient elevation of serum prolactin did not affect the sexual behaviour of males, but triggered these significant effects mainly at the ventral prostate. Conclusion The prostate is a sexual gland that responds to prolactin. Mating-induced prolactin release is required during sexual encounters to activate the epithelial cells in the gland. Here we saw a precise mechanism controlling the release of prolactin
Prolactin secretion: the impact of dynamic studies
International Nuclear Information System (INIS)
L'Hermite, M.; Degueldre, M.; Caufriez, A.; Delvoye, P.; Robyn, C.
1975-01-01
Human prolactin blood levels were determined by radioimmunoassay in basal condition and in response to various inhibiting and/or stimulating agents (levodopa, water overload, insulinic hypoglycaemia, synthetic TRH, sulpiride) in cases of disturbed hypothalamo-pituitary axis (failure to lactate, prolactin-secreting pituitary adenomas, acromegaly, other pituitary tumours, clinical panhypopituitarism). A blunted prolactin response to suckling was evidenced in 2 post-partum women who were unable to breast feed. Hyperprolactinaemia, whether related to the existence of a prolactin-producing adenoma or not was associated with the disappearance of the normal circadian pattern of prolactin secretion and with a blunted relative response to TRH; the latter phenomenon occurred also in acromegaly regardless of the basal prolactinaemia, and during the last trimester of pregnancy. Water overload was unsuccessful to suppress prolactin during the last trimester of pregnancy while the acute administration of levodopa was quite effective in about half of the patients with pituitary tumour. Therefore none of the dynamic tests presently studied allowed to attribute a hyperprolactinaemia to a pituitary tumour rather than to a functional disturbance. On the contrary, stimulation tests can help to locate the level of a defect in cases of hypopituitarism [fr
Effects of light deprivation on prolactin regulation in the Golden Syrian hamster
International Nuclear Information System (INIS)
Massa, J.S.
1986-01-01
Pineal-mediated depressions in prolactin cell activity after light deprivation were studied in the male and female Golden Syrian hamster. Prolactin cell activity was determined by measuring radioimmunoassayable prolactin, newly synthesized prolactin, newly synthesized prolactin and prolactin mRNA levels in the pituitary. Serum prolactin was also measured by radioimmunoassay. Use of the recombinant DNA plasmid, pPRL-1, which contains the rat prolactin complimentary DNA sequence, was validated in this dissertation for measuring prolactin mRNA in the hamster. Male Hamsters blinded for 11, 21, or 42 days showed significant and progressively greater declines in prolactin mRNA levels which were completely prevented by pinealectomy. Female hamsters blinded for 28 days, however, showed no such decreases in prolactin cell activity if they continued to display estrous cyclicity. After 12 weeks of blinding, females were acyclic and had dramatically depressed levels of prolactin cell activity. However, pinealectomy did not completely prevent this decline due to blinding unless the females continue to display estrous cyclicity. In ovariectomized females, blinding caused a decline in prolactin cell activity. In a separate study, significant changes in prolactin cell activity during the estrous cycle were seen in untreated normally cycling female hamsters. These changes in prolactin mRNA, prolactin synthesis, and radioimmunoassayable prolactin in the pituitary were measured in the morning, when, consistent with other reports, no differences in serum prolactin were observed
Gene cluster statistics with gene families.
Raghupathy, Narayanan; Durand, Dannie
2009-05-01
Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data
Prolactin receptors in Rip-cre cells, but not in AgRP neurones, are involved in energy homeostasis.
Ladyman, S R; MacLeod, M A; Khant Aung, Z; Knowles, P; Phillipps, H R; Brown, R S E; Grattan, D R
2017-10-01
Among its many functions, prolactin has been implicated in energy homeostasis, particularly during pregnancy and lactation. The arcuate nucleus is a key site in the regulation of energy balance. The present study aimed to examine whether arcuate nucleus neuronal populations involved in energy homeostasis are prolactin responsive and whether they can mediate the effects of prolactin on energy homeostasis. To determine whether Agrp neurones or Rip-Cre neurones are prolactin responsive, transgenic mice expressing the reporter td-tomato in Agrp neurones (td-tomato/Agrp-Cre) or Rip-Cre neurones (td-tomato/Rip-Cre) were treated with prolactin and perfused 45 minutes later. Brains were processed for double-labelled immunohistochemistry for pSTAT5, a marker of prolactin-induced intracellular signalling, and td-tomato. In addition, Agrp-Cre mice and Rip-Cre mice were crossed with mice in which the prolactin receptor gene (Prlr) was flanked with LoxP sites (Prlr lox/lox mice). The Prlr lox/lox construct was designed such that Cre-mediated recombination resulted in deletion of the Prlr and expression of green fluorescent protein (GFP) in its place. In td-tomato/Rip-Cre mice, prolactin-induced pSTAT5 was co-localised with td-tomato, indicating that there is a subpopulation of Rip-Cre neurones in the arcuate nucleus that respond to prolactin. Furthermore, mice with a specific deletion of Prlr in Rip-Cre neurones had lower body weights, increased oxygen consumption, increased running wheel activity and numerous cells in the arcuate nucleus had positive GFP staining indicating deletion of Prlr from Rip-Cre neurones. By contrast, no co-localisation of td-tomato and pSTAT5 was observed in td-tomato/Agrp-Cre mice after prolactin treatment. Moreover, Prlr lox/lox /Agrp-Cre mice had no positive GFP staining in the arcuate nucleus and did not differ in body weight compared to littermate controls. Overall, these results indicate that Rip-Cre neurones in the arcuate nucleus are
The Caenorhabditis chemoreceptor gene families
Directory of Open Access Journals (Sweden)
Robertson Hugh M
2008-10-01
Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
The Caenorhabditis chemoreceptor gene families.
Thomas, James H; Robertson, Hugh M
2008-10-06
Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.
Genome-Wide Comparative Gene Family Classification
Frech, Christian; Chen, Nansheng
2010-01-01
Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221
Sex differences in the hypothalamic control of prolactin secretion
International Nuclear Information System (INIS)
Grattan, D.R.; Liu, L.; Bunn, S.J.
2001-01-01
Full text: Sex differences in the brain may arise from the organisational effects of exposure to sex steroids during development, or from the exposure to a differential hormonal milieu in the adult. There is a marked sex difference in the neuroendocrine mechanism that regulates prolactin secretion. Levels of prolactin in the blood are higher in females than in males. Similarly, basal activity of tuberoinfundibular dopamine (TIDA) neurons, which are involved in the tonic suppression of prolactin secretion, are two fold higher in females than in males. Prolactin is known to stimulate the activity of TIDA neurons, thereby regulating its own secretion by short-loop feedback. Hence, it is thought that elevated TIDA neuronal activity in females is induced by increased prolactin in the blood. We have recently demonstrated that prolactin stimulation of TIDA neurons requires the transcription factor, STAT5b. We have now investigated prolactin secretion in male and female STAT5b-deficient mice, to test the hypothesis that sex differences in TIDA neuronal activity are dependent on stimulation by prolactin acting through STAT5b. Prolactin levels in blood were measured by radioimmunoassay, and TIDA activity was assessed by measuring concentrations of the dopamine metabolite DOPAC in the median eminence by HPLC, and by measuring tyrosine hydroxylase mRNA in the arcuate nucleus by real-time RT-PCR. The data demonstrate marked gender differences in the activity of TIDA neurons. While TIDA activity in STAT5b-deficient mice was reduced compared to wild type, the sex difference persisted. Since STAT5b is required for the actions of prolactin on these neurons, we can conclude that the sexual dimorphism in brain function is independent of gender differences in blood levels of prolactin. It seems likely that differential exposure to gonadal steroid hormones, either during development or in adulthood, might underlie the sex difference in TIDA neuronal activity. Copyright (2001
Night shift work and prolactin as a breast cancer risk factor
Directory of Open Access Journals (Sweden)
Agnieszka Bukowska
2013-04-01
Full Text Available Prolactin - a hormone secreted in a circadian rhythm acts as a regulator of growth and development of the mammary glands. It has been observed that working at night increases breast cancer risk in women. Night shift work, probably carcinogenic to humans (Group 2A IARC, can disrupt a circadian rhythm, and thus potentially alter the rhythm of prolactin secretion. The aim of our work was to review epidemiological evidence on the association between prolactin and the risk of breast cancer and the influence of work at night on prolactin secretion. Search was done in the Medline database by keywords (shift work, work at night, risk of breast cancer and prolactin. The increased proliferation of breast cells activated by prolactin can promote the development of cancer. The results of the largest epidemiological prospective studies suggest the association between prolactin levels and the risk of breast cancer in women. So far, only seven studies have investigated the association between work at night and prolactin secretion. In three studies lower concentrations of prolactin have been observed in night shift workers. No relationship between the night shift work duration and prolactin level in women have been reported. Night shift work can modify the profile of prolactin secretion in night workers, probably decreasing the secretion of this hormone at night. It is therefore unlikely that prolactin plays an important role in the development of breast cancer in women working at night. This conclusion is based on the results of a few epidemiological studies. Med Pr 2013;64(2:245–257
Prolactin suppresses malonyl-CoA concentration in human adipose tissue
DEFF Research Database (Denmark)
Nilsson, L. A.; Roepstorff, Carsten; Kiens, Bente
2009-01-01
Prolactin is best known for its involvement in lactation, where it regulates mechanisms that supply nutrients for milk production. In individuals with pathological hyperprolactinemia, glucose and fat homeostasis have been reported to be negatively influenced. It is not previously known, however......, whether prolactin regulates lipogenesis in human adipose tissue. The aim of this study was to investigate the effect of prolactin on lipogenesis in human adipose tissue in vitro. Prolactin decreased the concentration of malonyl-CoA, the product of the first committed step in lipogenesis, to 77......+/-6% compared to control 100+/-5% (p=0.022) in cultured human adipose tissue. In addition, prolactin was found to decrease glucose transporter 4 ( GLUT4) mRNA expression, which may cause decreased glucose uptake. In conclusion, we propose that prolactin decreases lipogenesis in human adipose tissue...
Synthesis of human prolactin in Chinese hamster ovary (CHO) cells
International Nuclear Information System (INIS)
Soares, Carlos Roberto Jorge
2000-01-01
Three different eukaryotic expression vectors, based on the same selectable gene marker (dhfr), have been used for dhf- CHO cells transfection to rapidly isolate stable cell lines capable of secreting high levels of recombinant human prolactin (rec-hPRL). Two vectors, one codifying a human prolactin (p658-hPRL) and the other a tag-prolactin (p658-tagPRL), contain the complete hepatitis B virus-X (HBV-X) gene coding for a viral transactivator and a sequence derived from the granulocyte-macrophage colony-stimulating factor (GM-CSF) that mediates selective dhfr mRNA degradation. These vectors have the advantage of rapidly obtaining stable cell lines without methotrexate amplification. The highest secretion obtained by these vectors was of approximately 10 μg hPRU10 6 cells/day. The other vector (pEDdc-hPRL) is based on a dicistronic expression system, containing an internal ribosome entry site isolated from the encephalomyocarditis (EMC) virus. This vector before amplification provided secretion levels at least 10 fold lower than that obtained with the other two vectors. However, after three steps of methotrexate amplification, it provided some clones able to secrete up to 30 μg hPRU10 6 cells/day. This is the first report describing the production and purification of rec-hPRL from CHO cells, obtaining secretion levels with both vectors higher than those reported so far for this hormone in other eukaryotic systems. CHO-derived rec-hPRL contained approximately 10 % of the glycosylated form, a value that is consistent with results reported for hPRL purified from the pituitary or from transformed murine C-127 cells. CHO-derived rec-hPRL was purified with good yield, obtaining also a good resolution between non-glycosylated and glycosylated prolactin. The latter, when its potency was determined via an in vitro bioassay, presented a 47 % lower bioactivity. A qualitative and quantitative analysis of these forms was also possible thanks to the setting up of a reversed
DEFF Research Database (Denmark)
Overgaard, Martin; Pedersen, Susanne Møller
2017-01-01
regimes across commonly used automated immunoassay platforms. METHODS: Parametric total and monomeric gender-specific reference intervals were determined for six immunoassay methods using female (n=96) and male sera (n=127) from healthy donors. The reference intervals were validated using 27...... and macroprolactinemic; n=27) showed higher discordant classification [mean=2.8; 95% confidence interval (CI) 1.2-4.4] for the monomer reference interval method compared to the post-polyethylene glycol (PEG) recovery cutoff method (mean=1.8; 95% CI 0.8-2.8). The two monomer/macroprolactin discrimination methods did...... not differ significantly (p=0.089). Among macroprolactinemic sera evaluated by both discrimination methods, the Cobas and Architect/Kryptor prolactin assays showed the lowest and the highest number of misclassifications, respectively. CONCLUSIONS: Current automated immunoassays for prolactin testing require...
Prolactin and Psychopathology in Schizophrenia: A Literature Review and Reappraisal
Directory of Open Access Journals (Sweden)
Ravi Philip Rajkumar
2014-01-01
Full Text Available Secretion of the anterior pituitary hormone prolactin can be significantly increased by antipsychotic drugs, leading to a range of adverse effects in patients with schizophrenia. However, there is evidence from a variety of studies that prolactin may also be related to symptom profile and treatment response in these patients, and recent work has identified variations in prolactin secretion even in drug-free patients. In this paper, a selective review of all relevant studies pertaining to prolactin and schizophrenia, including challenge and provocation studies, is presented. The implications of this work are discussed critically. A tentative model, which synthesizes these findings and argues for a significant role for prolactin in the development of schizophrenia, is outlined.
Seasonal prolactin secretion and its role in seasonal reproduction: a review.
Curlewis, J D
1992-01-01
The majority of seasonally breeding mammals show a seasonal pattern of prolactin secretion with peak concentrations in spring or summer and a nadir in autumn or winter. Photoperiod influences prolactin secretion via its effects on the secretion of the pineal hormone melatonin. Preliminary evidence suggests that the effects of melatonin on both prolactin and gonadotrophin secretion are via a common target area, possibly within the anterior hypothalamus, and that differences in response to photoperiod may be due to differences in the processing and/or interpretation of the melatonin signal. In contrast to seasonal gonadotrophin secretion, the seasonal changes in prolactin are not due to changes in the sensitivity of a feedback loop and so must be due to direct effects on the hypothalamic pathways that control prolactin secretion. Little else can be said with confidence about the neuroendocrine mechanisms that lead to the seasonal changes in prolactin secretion. Dopamine and noradrenaline turnover in the arcuate nucleus and median eminence decrease under short daylength. If catecholamine turnover in these structures is positively correlated with catecholamine concentrations in the long or short hypophysial portal vessels, it is unlikely that the decrease in prolactin concentration in winter is due to the effects of increased concentrations of dopamine or noradrenaline in the portal vessels. There is, however, evidence for increased pituitary sensitivity to dopamine under short daylength, so increased dopamine concentrations may not be required for suppression of prolactin secretion at this time. In addition to the diminished secretion of prolactin under short daylength, rate of prolactin synthesis and pituitary content of prolactin also decline although the mechanisms that regulate these changes are poorly understood. Although all seasonal breeders show a seasonal change in prolactin secretion, there are continuously breeding species in which prolactin secretion is
Evaluation of the human prolactin of National Production for use in radioimmunoassay (RIA)
International Nuclear Information System (INIS)
Caso, R.; Arranz, C.
1996-01-01
In this work was studied the possibility of using the Prolactin hormone as raw material to produce Kits-RIA of Prolactin. Was used the prolactin, which is obtained in Cuba by the Pharmaceutical Institute Mario Munoz. Was made the labbeling of Prolactin with I-125, was used the hormone as standard and were done the probes of quality control. The Prolactin Hormone had the necesary quality to produce Kits-RIA-Prolactin
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Development and characterization of a homologous radioimmunoassay for equine prolactin
International Nuclear Information System (INIS)
Roser, J.F.; Chang, Y.S.; Papkoff, H.; Li, C.H.
1984-01-01
A specific and sensitive homologous radioimmunoassay has been developed for equine prolactin, suitable for measuring prolactin concentrations in serum of horses. The sensitivity of the assay ranged from 0.4 to 0.6 ng/ml and the intra- and inter-assay coefficients of variation averaged 6.9 and 15.4%, respectively, for five doses of hormone. Cross-reactivity with other mammalian and nonmammalian prolactins and growth hormones was less than 20 and 0.3%, respectively. Cross-reactivity with equine growth hormone was less than 0.07%. Equine serum and pituitary extracts showed parallel dilution-response curves with equine prolactin. The percentage recovery of exogenous equine prolactin in serum was 89%. Preliminary analysis of several physiological samples (stallions, pregnant, and nonpregnant mares) yielded values from 0.6 to 12.0 ng/ml
A combined computational and structural model of the full-length human prolactin receptor
DEFF Research Database (Denmark)
Bugge, Katrine Østergaard; Papaleo, Elena; Haxholm, Gitte Wolfsberg
2016-01-01
The prolactin receptor is an archetype member of the class I cytokine receptor family, comprising receptors with fundamental functions in biology as well as key drug targets. Structurally, each of these receptors represent an intriguing diversity, providing an exceptionally challenging target for...... 40 different receptor chains, and reveals that the extracellular domain is merely the tip of a molecular iceberg....
Transfer of milk prolactin ro the plasma of neonatal rats by intestinal absorption
Energy Technology Data Exchange (ETDEWEB)
Whitworth, N S; Grosvenor, C E [Tennessee Univ., Memphis (USA). Dept. of Physiology and Biophysics
1978-11-01
Prolactin passes from the systemic circulation of lactating rats into the milk where it can be consumed by the young rats during suckling. /sup 131/- labelled rat prolactin was detected in the plasma of 9- to 14-day-old rats after being nursed by mothers previously injected with /sup 131/I-labelled rat prolactin and after the pups had received /sup 131/I-labelled rat prolactin by gastric intubation. It was estimated that 16% of the /sup 131/I-labelled rat prolactin given by gastric intubation subsequently appeared in the plasma of the neonate. Gastric administration of 10.5 or 21.0 ..mu..g B-1 rat prolactin significantly raised the level of prolactin in the plasma of 13-day-old pups, but a similar increase was not observed when 27-day-old rats were given 46.2 ..mu..g B-1 prolactin by gastric intubation. The concentration of prolactin in the plasma of 13-to 14-day-old rats rose to 55 ng/ml 30 min after the onset of nursing by mothers whose mammary glands were full of milk, whereas the concentration in the plasma of mothers with empty mammary glands remained at basal values. It is concluded that the intestine of the newborn is permeable to prolactin and that milk may constitute an exogeneous source of prolactin for the suckled offspring.
A pigeon crop sac radioreceptor assay for prolactin
International Nuclear Information System (INIS)
Forsyth, I.A.; Buntin, J.D.; Nicoll, C.S.
1978-01-01
Ovine prolactin, labelled with 125 I by either lactoperoxidase or a mild chloramine T method, was bound to receptors from the pigeon crop sac mucosa cells of prolactin-injected pigeons. Binding was demonstrated in a crude homogenate of mucosal cells removed from the crop by scraping and in a subcellular fraction in which 5'- nucleotidase activity was enhanced two- to three-fold. The binding was specific, dependent on time, temperature and the concentration of receptors and had a dissociation constant of 7 x 10 -10 mol/l. The binding capacity of the crop tissue was 71 fmol/mg membrane protein. Nine purified preparations of prolactin from four species were assayed by local pigeon crop sac bioassay and by radioreceptor assay. The two methods were highly correlated (r = 0.934). The regression equation was radioreceptor assay = 1.22 bioassay - 0.18 indicating a 1:1 correspondence between the two methods for prolactin purified from sheep, rat, horse and pig anterior pituitary glands. (author)
Pubertal dependent effects of cadmium on episodic prolactin secretion in male rats
Energy Technology Data Exchange (ETDEWEB)
Lafuente, A.; Alvarez-Demanuel, E.; Marquez, N. [Fac. de Cienicas, Orense (Spain). Lab. de Toxicologia; Esquifino, A.I. [Dept. Bioquimica, Facultad de Medicina, Universidad Complutense, 28040-Madrid (Spain)
1999-02-01
This work was undertaken to assess if exposure to cadmium related to puberty may affect the episodic pattern of prolactin. Male rats were submitted to cadmium exposure, from day 30 to 60 or from day 60 to 90 of life respectively, at a dose of 50 ppm in the drinking water. Control age-matched rats received cadmium-free water. Prepubertal cadmium administration decreased mean serum prolactin levels and the absolute amplitude of the prolactin pulses. Subchronic exposure to cadmium of adult rats decreased mean serum prolactin levels, the absolute amplitude of the prolactin pulses and their duration, and the mean half-life of the hormone. These results suggest that subchronic cadmium exposure changes the secretory pattern of prolactin in adult male rats in a puberty-dependent way. (orig.) With 1 fig., 1 tab., 37 refs.
Primary Hypothyroidism with Exceptionally High Prolactin-A Really Big Deal.
Khorassanizadeh, Rahim; Sundaresh, Vishnu; Levine, Steven N
2016-07-01
Primary hypothyroidism can cause both hyperprolactinemia and pituitary hyperplasia. The degree of hyperprolactinemia is generally modest, and rarely do prolactin concentrations exceed 100 ng/mL (4.34 nmol/L). This combination of hyperprolactinemia and pituitary gland enlargement might raise suspicion for a prolactinoma or a nonfunctioning adenoma limiting the ability of hypothalamic dopamine to inhibit prolactin production, the so-called "stalk effect." We describe a 30-year-old female with headaches, galactorrhea, and hyperprolactinemia with a presumptive diagnosis of a prolactinoma. She had hypothyroidism after treatment of Graves disease at age 17 years but was noncompliant with levothyroxine replacement. Thyroid-stimulating hormone (TSH) was 263 mIU/L, FT4 was 3.01 pmol/L, and prolactin was 323 ng/mL (14.06 nmol/L). Magnetic resonance imaging (MRI) demonstrated increased volume of the pituitary gland with homogeneous enhancement with gadolinium. Levothyroxine treatment for 2 weeks decreased her TSH to130 mIU/L, but her total prolactin remained elevated at 386 ng/mL (16.78 nmol/L). Further testing identified that 76% of the total prolactin was macroprolactin. Primary hypothyroidism can cause hyperprolactinemia, and prolonged disease may lead to pituitary hyperplasia. However, a marked elevation of prolactin should raise suspicion to investigate additional etiologies for hyperprolactinemia. Our case exemplifies a dual etiology for hyperprolactinemia and pituitary hyperplasia caused by both hypothyroidism and macroprolactin. This knowledge is invaluable for clinicians to avoid unnecessary management with dopamine agonists and/or surgery. This patient's prolactin was 323 ng/mL (14.06 nmol/L). Before our case, the highest prolactin in a hypothyroid patient reported in the literature was 253 ng/mL (11.0 nmol/L). Copyright © 2016 Elsevier Inc. All rights reserved.
EFFECT OF ADRENALECTOMY ON PROLACTIN SECRETION IN PRIMIPAROUS AND MULTIPAROUS LACTATING RATS
Directory of Open Access Journals (Sweden)
C. D. C. Sanches
2018-04-01
Full Text Available The adenohypophysis produces among other hormones prolactin, which plays an important role in reproduction, especially on the mammary glands and lactation of mammals. Prolactin is tonically controlled by tufo-infundibular dopamine, but several studies indicate that prolactin secretion is altered by the action of glucocorticoids and, therefore, is related to stress. However, the exact contribution of corticosteroids in the control of prolactin secretion is poorly understood. On the other hand, it is also known that reproductive experience can modify prolactin secretion by adenohypophysis. Thus, the present study aims to study the hormonal relationships of the hypothalamic-pituitary-adrenal axis, in particular, the glucocorticoid relationship on prolactin secretion as a function of the reproductive experience in females during lactation. The results show that reproductive experience may be a factor modifying the sensitivity of the neuroendocrine response of prolactin secretion to glucocorticoids. However, more studies are needed to understand the possible mechanisms involved, as well as possible modifications in this response as a function of the reproductive status of the females.
Variation in prolactin is related to variation in sexual behavior and contact affiliation.
Directory of Open Access Journals (Sweden)
Charles T Snowdon
Full Text Available Prolactin is associated with both maternal and paternal care and appears important in developing a bond between parent and infant. In contrast with oxytocin, another hormone important in infant care, there is scant information on the role of prolactin in maintaining adult heterosexual relationships. We present here the first results demonstrating a relationship between prolactin levels and sexual and contact affiliation behavior in a pair-bonded species. We studied cotton-top tamarins, a socially-monogamous, cooperatively-breeding primate. We measured chronic urinary prolactin levels over a four week period to include the entire female ovulatory cycle and correlated prolactin levels in males and females with simultaneous measures of contact affiliation and sexual behavior. Current mothers who were no longer nursing displayed lower amounts of sexual behavior and proximity than non-breeding females and also had marginally lower levels of prolactin. The prolactin levels of males and females were similar within pairs, and variation in prolactin levels for both sexes was explained both by the amount of sexual behavior and contact affiliation. The results parallel a previous study that compared oxytocin levels with sociosexual behavior in the same species, and supports the hypothesis that both prolactin and oxytocin are involved in pair-bonding as well as in infant care.
Activation of protein kinase C inhibits synthesis and release of decidual prolactin
International Nuclear Information System (INIS)
Harman, I.; Costello, A.; Ganong, B.; Bell, R.M.; Handwerger, S.
1986-01-01
Activation of calcium-activated, phospholipid-dependent protein kinase C by diacylglycerol and phorbol esters has been shown to mediate release of hormones in many systems. To determine whether protein kinase C activation is also involved in the regulation of prolactin release from human decidual, the authors have examined the effects of various acylglycerols and phorbol esters on the synthesis and release of prolactin from cultured human decidual cells. sn-1,2-Dioctanolyglycerol (diC 8 ), which is known to stimulate protein kinase C in other systems, inhibited prolactin release in a dose-dependent manner with maximal inhibition of 53.1% at 100 μM. Diolein (100 μM), which also stimulates protein kinase C activity in some systems, inhibited prolactin release by 21.3%. Phorbol 12-myristate 13-acetate (PMA), phorbol 12,13-didecanoate, and 4β-phorbol 12,13-dibutyrate, which activate protein kinase C in other systems, also inhibited the release of prolactin, which the protein kinase C inactivate 4α-phorbol-12,13-didecanoate was without effect. The inhibition of prolactin release was secondary to a decrease in prolactin synthesis. Although diC 8 and PMA inhibited the synthesis and release of prolactin, these agents had no effect on the synthesis or release of trichloroacetic acid-precipitable [ 35 S]methionine-labeled decidual proteins and did not cause the release of the cytosolic enzymes lactic dehydrogenase and alkaline phosphatase. DiC 8 and PMA stimulates the specific activity of protein kinase C in decidual tissue by 14.6 and 14.0-fold, respectively. The inhibition of the synthesis and release of prolactin by diC 8 and phorbol esters strongly implicates protein kinase C in the regulation of the production and release of prolactin from the decidua
Fang, Feng; Zheng, Jiamao; Galbaugh, Traci L; Fiorillo, Alyson A; Hjort, Elizabeth E; Zeng, Xianke; Clevenger, Charles V
2010-06-01
The effects of prolactin (PRL) during the pathogenesis of breast cancer are mediated in part though Stat5 activity enhanced by its interaction with its transcriptional inducer, the prolyl isomerase cyclophilin B (CypB). We have demonstrated that knockdown of CypB decreases cell growth, proliferation, and migration, and CypB expression is associated with malignant progression of breast cancer. In this study, we examined the effect of CypB knockdown on PRL signaling in breast cancer cells. CypB knockdown with two independent siRNAs was shown to impair PRL-induced reporter expression in breast cancer cell line. cDNA microarray analysis was performed on these cells to assess the effect of CypB reduction, and revealed a significant decrease in PRL-induced endogenous gene expression in two breast cancer cell lines. Parallel functional assays revealed corresponding alterations of both anchorage-independent cell growth and cell motility of breast cancer cells. Our results demonstrate that CypB expression levels significantly modulate PRL-induced function in breast cancer cells ultimately resulting in enhanced levels of PRL-responsive gene expression, cell growth, and migration. Given the increasingly appreciated role of PRL in the pathogenesis of breast cancer, the actions of CypB detailed here are of biological significance.
Regulation of blood vessels by prolactin and vasoinhibins.
Clapp, Carmen; Thebault, Stéphanie; Macotela, Yazmín; Moreno-Carranza, Bibiana; Triebel, Jakob; Martínez de la Escalera, Gonzalo
2015-01-01
Prolactin (PRL) stimulates the growth of new blood vessels (angiogenesis) either directly through actions on endothelial cells or indirectly by upregulating proangiogenic factors like vascular endothelial growth factor (VEGF). Moreover, PRL acquires antiangiogenic properties after undergoing proteolytic cleavage to vasoinhibins, a family of PRL fragments (including 16 kDa PRL) with potent antiangiogenic, vasoconstrictive, and antivasopermeability effects. In view of the opposing actions of PRL and vasoinhibins, the regulation of the proteases responsible for specific PRL cleavage represents an efficient mechanism for controlling blood vessel growth and function. This review briefly describes the vascular actions of PRL and vasoinhibins, and addresses how their interplay could help drive biological effects of PRL in the context of health and disease.
Directory of Open Access Journals (Sweden)
Maria V. Fernández
2018-04-01
Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.
Ontogenic studies of the neural control of adenohypophyseal hormones in the rat. II. Prolactin.
Becú-Villalobos, D; Lacau-Mengido, I M; Díaz-Torga, G S; Libertun, C
1992-02-01
1. Serum prolactin levels are low during the first 20 days of life and gradually increase toward puberty, in both male and female rats. 2. There is an age-related increase in the cell population engaged in prolactin secretion, as well as an increase in the synthesis of prolactin and of the amount of prolactin secreted from individual lactotropes. 3. The gradual increase in prolactin levels in the third week of life is not related to a decrease in dopaminergic inhibition but to an increase in the efficiency of prolactin releasing factors such as estrogen, serotonin, opiates, and posterior pituitary extracts. 4. Prolactin release induced by physiological factors, such as stress, cervical stimulation, or the expression of spontaneous diurnal and nocturnal surges, requires maturational events within the hypothalamic-pituitary axis which are evident at the end of the third week of life. 5. In the female rat the steadily increasing levels of prolactin are involved in the timing of puberty eclosion acting at the ovary and at the brain. 6. In the prepubertal male rat increasing titers of prolactin may be involved in testicular and accessory organ development and may facilitate the actions of luteinizing hormone, follicle stimulating hormone, and testosterone on male sexual organs.
Correlation between FSH, LH and prolactin serum levels. [Radioimmunoassay of hormones
Energy Technology Data Exchange (ETDEWEB)
Krause, W [Giessen Univ. (Germany, F.R.)
1978-01-01
In 188 males FSH, LH, and prolactin serum levels determined by radioimmunoassay from a single blood sample were found to be closely correlated. No correlation appeared to testosterone levels. The same correlation is observed, if serum levels of FSH, LH, and prolactin are measured after stimulation with LH-RH and TRH. In order to explain the close correlation, in five young men hormone levels were measured at 2-min-intervals over a period of 2 hours. Peaks of prolactin often correspond to those of FSH and LH, and a statistical correlation was found in two cases between FSH and prolactin. Results suggest a common releasing mechanism, which is superposed to the main mediating mechanism.
[Plasma prolactin concentration and the effect of metergoline in pseudopregnant Afghan hounds].
Okkens, A C; Dieleman, S J; Kooistra, H S; Bevers, M M
2000-02-01
The effects of metergoline, a 5-hydroxytryptamine (serotinin) antagonist, on the plasma concentrations of prolactin in overtly pseudopregnant Afghan hounds and on the clinical symptoms of overt pseudopregnancy were studied. Plasma concentrations of prolactin and progesterone were determined in six Afghan hounds with signs of overt pseudopregnancy for 2-3 weeks and in three Afghan hounds that were not pseudopregnant at the time of blood sampling. In the overtly pseudopregnant bitches the plasma concentrations of prolactin before treatment (35.5 +/- 8.5 micrograms l-1) were significantly higher than the plasma concentrations of prolactin of the three bitches that were not pseudopregnant (6.3 +/- 0.5 micrograms l-1); the latter values were similar to those of non-psueodopregnant beagle bitches during the total luteal phase. The six pseudopregnant Afghan hounds were treated for 10 days with the antiserotoninergic drug metergoline. At 2 h after the onset of treatment with metergoline, the mean plasma concentration of prolactin had decreased to 10.8 +/- 2.9 micrograms l-1. The plasma concentrations of prolactin continued to decline to 5.4 +/- 1.0 micrograms l-1 at 4 h and to 1.0 +/- 0.1 microgram l-1 during treatment days 3-10. Signs of pseudopregnancy, such as swelling of the mammary glands and digging, decreased during the treatment period. The treatment was associated with mild behavioural side effects such as whimpering and aggressiveness. These side effects are probably not related to suppression of prolactin but are due to a direct effect on serotoninergic pathways in the brain. It is concluded that high plasma concentrations of prolactin are associated with the development and maintenance of pseudopregnancy. The serotonin antagonist metergoline strongly suppresses plasma concentration of prolactine in pseudopregnant dogs and decreases the clinical signs of pseudopregnancy.
Prolactin promotes breast cancer cell migration through actin cytoskeleton remodeling
Directory of Open Access Journals (Sweden)
Priscilla Ludovico da Silva
2015-12-01
Full Text Available The role of prolactin on breast cancer development and progression is debated. Breast cancer progression largely depends on cell movement and on the ability to remodel the actin cytoskeleton. In this process, actin-binding proteins are requested to achieve fibrillar actin de-polymerization and relocation at the cell membrane. Kinases such as focal adhesion kinase (FAK are later required to form actin/vinculin-enriched structures called focal adhesion complexes, which mediate firm adhesion to the extracellular matrix. These controllers are regulated by c-Src, which forms multiprotein signaling complexes with membrane receptors and is regulated by a number of hormones, including prolactin. We here show that breast cancer cells exposed to prolactin display an elevated c-Src expression and phosphorylation. In parallel, increased moesin and FAK expression and phosphorylation are found. These molecular changes are associated to relocation to the plasma membrane of cytoskeletal actin fibers and to increased horizontal cell movement. In conclusion, prolactin regulates actin remodeling and enhances breast cancer cell movement. This finding broadens the understanding of prolactin actions on breast cancer cells, highlighting new pathways that may be relevant to on breast cancer progression.
Methylmercury inhibits prolactin release in a cell line of pituitary origin
Directory of Open Access Journals (Sweden)
L.A.L. Maués
2015-08-01
Full Text Available Heavy metals, such as methylmercury, are key environmental pollutants that easily reach human beings by bioaccumulation through the food chain. Several reports have demonstrated that endocrine organs, and especially the pituitary gland, are potential targets for mercury accumulation; however, the effects on the regulation of hormonal release are unclear. It has been suggested that serum prolactin could represent a biomarker of heavy metal exposure. The aim of this study was to evaluate the effect of methylmercury on prolactin release and the role of the nitrergic system using prolactin secretory cells (the mammosomatotroph cell line, GH3B6. Exposure to methylmercury (0-100 μM was cytotoxic in a time- and concentration-dependent manner, with an LC50 higher than described for cells of neuronal origin, suggesting GH3B6 cells have a relative resistance. Methylmercury (at exposures as low as 1 μM for 2 h also decreased prolactin release. Interestingly, inhibition of nitric oxide synthase by N-nitro-L-arginine completely prevented the decrease in prolactin release without acute neurotoxic effects of methylmercury. These data indicate that the decrease in prolactin production occurs via activation of the nitrergic system and is an early effect of methylmercury in cells of pituitary origin.
Enhanced prolactin levels in opium smokers.
Moshtaghi-Kashanian, Ghollam-Reza; Esmaeeli, Farzaneh; Dabiri, Shahriar
2005-12-01
In Iran, opium is smoked for pleasure or as a medication by some people. It is a complex mixture of 40 different alkaloids, including morphine and codeine along with many impurities. Although it is well established that opioids or tobacco affect many physiological functions in humans, to our knowledge there has been no specific study looking at these effects in opium smokers. To assess that, we investigated the circulating levels of prolactin, TSH, LH, FSH and testosterone in male opium smokers who also smoke cigarettes (n=23, aged 28.4+/- 4.1 years), and comparing this with the corresponding values for nicotine abusers (n=12, 15-25 cigarettes/day) or a healthy control group (n=20) of the same age. Our results showed that 86.96% of the opium-dependent and 41.67 % of the nicotine-dependent group displayed high prolactin values (popium and the plasma prolactin level of opium dependents (p=0.748, popium smokers and 50% of the cigarette smokers (popium smokers was also lower than that of the other two groups (popium and cigarette smoking may synergistically influence pituitary hormone production through the effects on neuropeptides produced either locally or systemic.
Lack of effect of naloxone on prolactin and seizures in electroconvulsive therapy.
Sperling, M R; Melmed, S; McAllister, T; Price, T R
1989-01-01
Both opiate agonist and antagonist injection have been reported to modulate prolactin secretion, alter brain excitability and produce seizures, and modify the postictal state. We studied the effects of administration of high-dose naloxone, an opiate antagonist, on postictal prolactin levels, seizure duration, and postictal behavior, using patients undergoing electroconvulsive therapy (ECT) as a seizure model. Seven patients had 8 mg naloxone injected prior to one ECT treatment and saline injected prior to another treatment, with the order of injection randomized. Before ECT and 15 min after ECT, prolactin levels were drawn, and no blunting of the expected postictal prolactin elevation by naloxone injection was observed. We found no evidence that endogenous opiates trigger prolactin secretion during seizures. Seizure duration was also similar in saline and naloxone groups, and naloxone did not reverse postictal depression, as has been reported in an animal model.
Prolactin and cortisol levels in women with endometriosis
Directory of Open Access Journals (Sweden)
A.P. Lima
2006-08-01
Full Text Available Endometriosis is a progressive estrogen-dependent disease affecting women during their reproductive years. The objective of the present study was to investigate whether endometriosis is associated with stress parameters. We determined cortisol and prolactin levels in serum, peritoneal and follicular fluid from infertile women with endometriosis and fertile women without the disease. The extent of the disease was staged according to the revised American Fertility Society classification (1997. Serum and peritoneal fluid were collected from 49 women aged 19 to 39 years undergoing laparoscopy. Eighteen women had stage I-II endometriosis and 10 had stage III-IV. Controls were 21 women undergoing laparoscopy for tubal sterilization. Follicular fluid was obtained from 39 women aged 25-39 years undergoing in vitro fertilization (21 infertile women with endometriosis and 18 infertile women without endometriosis. Serum prolactin levels were significantly higher in infertile women with stage III-IV endometriosis (28.9 ± 2.1 ng/mL than in healthy controls (13.2 ± 2.1 ng/mL. Serum cortisol levels were significantly higher in infertile women with stage III-IV endometriosis (20.1 ± 1.3 ng/mL than in controls (10.5 ± 1.4 ng/mL. Cortisol and prolactin levels in follicular fluid and peritoneal fluid did not differ significantly between groups. The high levels of cortisol and prolactin in the serum from women with endometriosis might contribute to the subfertility frequently associated with the disease. Moreover, since higher levels of cortisol and prolactin are often associated with stress, it is probable that stress might contribute to the development of endometriosis and its progression to advanced stages of the disease.
Brain prolactin is involved in stress-induced REM sleep rebound.
Machado, Ricardo Borges; Rocha, Murilo Ramos; Suchecki, Deborah
2017-03-01
REM sleep rebound is a common behavioural response to some stressors and represents an adaptive coping strategy. Animals submitted to multiple, intermittent, footshock stress (FS) sessions during 96h of REM sleep deprivation (REMSD) display increased REM sleep rebound (when compared to the only REMSD ones, without FS), which is correlated to high plasma prolactin levels. To investigate whether brain prolactin plays a role in stress-induced REM sleep rebound two experiments were carried out. In experiment 1, rats were either not sleep-deprived (NSD) or submitted to 96h of REMSD associated or not to FS and brains were evaluated for PRL immunoreactivity (PRL-ir) and determination of PRL concentrations in the lateral hypothalamus and dorsal raphe nucleus. In experiment 2, rats were implanted with cannulas in the dorsal raphe nucleus for prolactin infusion and were sleep-recorded. REMSD associated with FS increased PRL-ir and content in the lateral hypothalamus and all manipulations increased prolactin content in the dorsal raphe nucleus compared to the NSD group. Prolactin infusion in the dorsal raphe nucleus increased the time and length of REM sleep episodes 3h after the infusion until the end of the light phase of the day cycle. Based on these results we concluded that brain prolactin is a major mediator of stress-induced REMS. The effect of PRL infusion in the dorsal raphe nucleus is discussed in light of the existence of a bidirectional relationship between this hormone and serotonin as regulators of stress-induced REM sleep rebound. Copyright © 2016 Elsevier Inc. All rights reserved.
Effects of cortisol, growth hormone and prolactin on gill claudin expression in Atlantic salmon
DEFF Research Database (Denmark)
Tipsmark, Christian Kølbæk; Jørgensen, Charlotte; Brande-Lavridsen, Nanna
2009-01-01
We recently showed that a series of tight junction proteins of the claudin family are regulated in the gill of salmon during salinity acclimation. The aim of the present study was to investigate the role of cortisol, growth hormone (GH) and prolactin (PRL) on regulation of expression of these iso......We recently showed that a series of tight junction proteins of the claudin family are regulated in the gill of salmon during salinity acclimation. The aim of the present study was to investigate the role of cortisol, growth hormone (GH) and prolactin (PRL) on regulation of expression...... antagonists RU486 and spironolactone, respectively. The observed in vitro responses were blocked by RU486, suggesting the involvement of a glucocorticoid type receptor. Injections of FW salmon with cortisol increased the expression of claudin 10e, 27a, and 30 but did not affect claudin 28a and 28b...... significantly. While GH had no effect on its own, the combination of GH and cortisol reduced claudin 28b levels. Injection of SW salmon with PRL selectively increased the expression of claudin 28a but had no effect on the other examined isoforms. The data shows that FW- (27a and 30) and SW-induced (10e...
Effect of Changes in Prolactin RIA Reactants on the Validity of the Results
International Nuclear Information System (INIS)
Ahmed, A.M.; Megahed, Y.M.; El Mosallamy, M.A.F.; El-Khoshnia, R.A.M.
1998-01-01
Human prolactin plays an essential role in the secretion of milk and has the ability to suppress gonadal function. This study is considered as atrial to discuss some technical problems which made by operator in the RIA technique to select an optimized reliable and valid parameters for the measurement of prolactin concentration in human sera. Prolactin concentration was measured in normal control group and chronic renal failure group using the optimized technique. Finally the present optimized technique is very suitable selected one for measurement of prolactin
Chávez-Güitrón, L E; Morales-Montor, J; Muñoz-Guzmán, M A; Nava-Castro, K E; Ramírez-Álvarez, H; Moreno-Méndoza, N A; Hernández-Cervantes, R; Alba-Hurtado, F
2016-07-15
The in vitro effect of prolactin (PRL) on the growth and motility of Toxocara canis larvae was assessed. Additionally, the expression and location of prolactin receptors (PRL-Rs) were determined in the larvae. Larvae of T. canis were incubated with different concentrations of PRL for different periods of time. The stimulated larvae accelerated their enlargement and increased their motility. The mean percentage of PRL-R+ cells in non-stimulated larvae, measured by flow cytometry was 7.3±0.3%. Compared with non-stimulated larvae, the mean fluorescence intensity (pPCR. The sequence of this fragment showed 99% similarity with the gene fragment that codes for the PRL-R of the domestic dog. A high concentration of PRL-Rs was immune-located in the posterior region of the larval intestine; therefore, the intestinal cells in this region were most likely the targets for this hormone. Based on these results, PRL-Rs were identified in T. canis larvae, and the in vitro stimulation with PRL increased the number of these receptors, accelerated the growth and modified the activity of larvae. All of the above suggest that T. canis larvae are evolutionarily adapted to recognize the PRL of their definitive host and furthermore might explain the reactivation of tissue-arrested larvae during the gestation of bitches, which does not occur in gestating females of other species. Copyright © 2016 Elsevier B.V. All rights reserved.
Mammalian Prolactin – An Ancient But Still A Mysterious Hormone
Indian Academy of Sciences (India)
Table of contents. Mammalian Prolactin – An Ancient But Still A Mysterious Hormone · Prolactin inhibits LHRH action during lactational ammenorrhoea · Slide 3 · Slide 4 · REDUCTIONIST VIEW OF HORMONES · CONCERN · PURIFICATION PROTOCOLS · CHARACTERIZATION OF HORMONES · Slide 9 · Slide 10.
Effects of chronic alternating cadmium exposure on the episodic secretion of prolactin in male rats
Energy Technology Data Exchange (ETDEWEB)
Esquifino, A.I. [Madrid Univ. (Spain). Facultad de Medicina Complutense; Marquez, N.; Alvarez-Demanuel, E.; Lafuente, A. [Vigo Univ., Orense (Spain). Lab. de Toxicologia
1998-07-01
Cadmium increases or decreases prolactin secretion depending on the dose and duration of the exposure to the metal. However, whether there are cadmium effects on the episodic prolactin secretion is less well known. This study was undertaken to address whether chronic alternating exposure to two different doses of cadmium affects the episodic pattern of prolactin and to what extent the effects of cadmium are age-dependent. Male rats were treated s.c. with cadmium chloride (0.5 or 1.0 mg/kg) from day 30 to 60, or from day 60 to 90 of age, with alteration of the doses every 4 days, starting with the smaller dose. Controls received vehicle every 4 days. The last dose of cadmium was given 48 h prior to the pulsatility study. Prolactin secretion in the 4 experimental groups studied was episodic and changed significantly after cadmium exposure. Cadmium administration from day 30 to 60 of life significantly decreased the mean half-life of prolactin. On the other hand, when administered from day 60 to 90 cadmium significantly decreased the mean as well as serum prolactin levels and the absolute amplitude of the prolactin pulses, their duration, the relative amplitude or the mean half-life of the hormone. The frequency of prolactin peaks was not changed by cadmium administration. The results indicate that low intermittent doses of cadmium chronically administered change the episodic secretion pattern of prolactin in rats. The effects of cadmium on prolactin secretion were age dependent. (orig.)
Agnus castus extracts inhibit prolactin secretion of rat pituitary cells.
Sliutz, G; Speiser, P; Schultz, A M; Spona, J; Zeillinger, R
1993-05-01
In our studies on prolactin inhibition by plant extracts we focused on the effects of extracts of Vitex agnus castus and its preparations on rat pituitary cells under basal and stimulated conditions in primary cell culture. Both extracts from Vitex agnus castus as well as synthetic dopamine agonists (Lisuride) significantly inhibit basal as well as TRH-stimulated prolactin secretion of rat pituitary cells in vitro and as a consequence inhibition of prolactin secretion could be blocked by adding a dopamine receptor blocker. Therefore because of its dopaminergic effect Agnus castus could be considered as an efficient alternative phytotherapeutic drug in the treatment of slight hyperprolactinaemia.
RELATIONSHIP BETWEEN PROLACTIN HORMONE LEVEL, MOLTING AND DUCK EGG PRODUCTION
Directory of Open Access Journals (Sweden)
T. Susanti
2012-09-01
Full Text Available The aims of this study were to obtain information on the mechanism of molting and the prolactin hormone levels affecting egg production. The study utilized AP (crossbred of Alabio ♂ with Peking ♀ and PA (crossbred of Peking ♂ and Alabio ♀ ducks with a total of 180 birds. The observed variables were the duration of cessation of egg production before and after molting, the prolactin hormone level in the period of molting, the egg production period before and after molting. The data was analyzed using ANOVA, regression and correlation. The results showed that AP crossbred had fewer molting (23.33% compared to PA (50.00%. The mechanism of molting is always preceded by cessation of egg production, molting and relaying. The prolactin hormone concentrations of AP and PA in the period before and after molting were significantly higher than in the period of molting. At the egg production period before molting, the prolactin hormone concentration of AP ducks was higher than the PA ducks. So that the egg production of AP before molting (0-16 weeks was higher than the PA. The egg production of AP was higher than PA, 256.66±6.00 vs 232.22±6.64 eggs for 48 weeks. So it can be concluded that the prolactin hormone affects the molting and egg production.
Energy Technology Data Exchange (ETDEWEB)
Caso, R; Mosquera, M [Centro de Isotopos, La Habana (Cuba); Perez, E [Centro de Investigaciones de Mejoramiento Animal, La Habana (Cuba); Amanz, C [Instituto Nacional de Endocrinologia, La Habana (Cuba)
1996-07-01
In this work was studied the use of the the Prolactin hormone as immuno gen, which is obtained in Cuba by the pharmaceutical institute Mario Munoz, to produce the antibody antiprolactin. Was made the validation of obtained antibody (tritatium, specificity and affinity) The produced antibody had necessary quality to be use as a component of the Kits-RIA Prolactin.
Directory of Open Access Journals (Sweden)
Luz eTorner
2016-03-01
Full Text Available Prolactin is one of the most versatile hormones known. It is considered an adaptive hormone due to the key roles it plays in the modulation of the stress response and during pregnancy and lactation. Within the brain, prolactin acts as a neuropeptide to promote physiological responses related to reproduction, stress adaptation, neurogenesis, and neuroprotection. The action of prolactin on the nervous system contributes to the wide array of changes that occur in the female brain during pregnancy and result in the attenuation of the hypothalamic pituitary adrenal axis. Together, all these changes promote behavioral and physiological adaptations of the new mother to enable reproductive success. Brain adaptations driven by prolactin are also important for the regulation of maternal emotionality and wellbeing Prolactin also affects the male brain during the stress response but its effects have been less studied. Prolactin regulates neurogenesis both in the subventricular zone and in the hippocampus. Therefore, alterations in the prolactin system due to stress, or exposure to substances that reduce neurogenesis or other conditions, could contribute to maladaptive responses and pathological behavioral outcomes. Here we review the prolactin system and the role it plays in the modulation of stress response and emotion regulation. We discuss the effects of prolactin on neurogenesis and neuroprotection, the putative neuronal mechanisms underlying these effects, and their contribution to the onset of psychopathological states like depression.
International Nuclear Information System (INIS)
Rozsival, V.; Petr, R.; Kubicek, J.; Hajek, P.; Fingerova, H.; Talas, M.; Janouskova, M.
1981-01-01
In the years 1977 to 1979, prolactin levels were examined in the blood of 39 patients with breast cancer metastases in the skeleton. In 27 patients undergoing surgery, prolactin values were obtained prior to the operation and on the 7th day after stereotactic cryohypophysectomy; in 19 patients the values were obtained also at later intervals. Prolactin was examined using RIA. Prior to surgery, the prolactin levels ranged between 4.3 and above 100 μg/l, with an average of 24.69. Seven days after cryohypophysectomy, the average was 14.01 μg/l, i.e., a remarkable decrease was observed showing considerable significance in the pair test. Prolactin examination in patients with breast cancer metastases showed increased levels above the menopausal standard in almost 80% of the group of patients prior to hypophysectomy. After surgery, a prolactin level decrease was observed in 60% of patients, which confirmed that the intervention in the hypophysis was effective. (author)
SERUM PROLACTIN LEVEL IN ACNE PATIENTS VERSUS CONTROL GROUP: STUDY ON 14 TO 35 YEARS OLD WOMEN
Directory of Open Access Journals (Sweden)
G FAGHIHI
2002-03-01
Full Text Available Introduction. Androgens have a main role in acne pathogenesis. The interaction between prolactin and androgens generate the hypothesis of prolactin role in acne pathogenesis. Methods. In a case - control study, 71 women with modearte to severe acne were compaired with 71 healthy women about their serum prolactin levels. Results. Mean of serum prolactin level was 533 632 miu/lit in cases. Mean of serum prolactin level was 365 363 in control group (P > 0.05. There was a significant correlation between serum prolactin level and severity of acne. Discussion. Despite the non significant difference between serum prolactin level in acne patients and healthy women, thare was a significant relationship between serum prolactin level and severity of acne. It may be due to our small sample size. However, the more powerful studies is needed.
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Directory of Open Access Journals (Sweden)
Itziar Montalvo
Full Text Available Hyperprolactinaemia, a common side effect of some antipsychotic drugs, is also present in drug-naïve psychotic patients and subjects at risk for psychosis. Recent studies in non-psychiatric populations suggest that increased prolactin may have negative effects on cognition. The aim of our study was to explore whether high plasma prolactin levels are associated with poorer cognitive functioning in subjects with early psychoses. We studied 107 participants: 29 healthy subjects and 78 subjects with an early psychosis (55 psychotic disorders with <3 years of illness, 23 high-risk subjects. Cognitive assessment was performed with the MATRICS Cognitive Consensus Cognitive Battery, and prolactin levels were determined as well as total cortisol levels in plasma. Psychopathological status was assessed and the use of psychopharmacological treatments (antipsychotics, antidepressants, benzodiazepines recorded. Prolactin levels were negatively associated with cognitive performance in processing speed, in patients with a psychotic disorder and high-risk subjects. In the latter group, increased prolactin levels were also associated with impaired reasoning and problem solving and poorer general cognition. In a multiple linear regression analysis conducted in both high-risk and psychotic patients, controlling for potential confounders, prolactin and benzodiazepines were independently related to poorer cognitive performance in the speed of processing domain. A mediation analysis showed that both prolactin and benzodiazepine treatment act as mediators of the relationship between risperidone/paliperidone treatment and speed of processing. These results suggest that increased prolactin levels are associated with impaired processing speed in early psychosis. If these results are confirmed in future studies, strategies targeting reduction of prolactin levels may improve cognition in this population.
Development Of Radioimmunoassay For Prolactin HORMONE Using Solid Phase Magnetic Particles
International Nuclear Information System (INIS)
SHAFIK, H.M.; MEHANY, N.L.
2009-01-01
The preparation and development of primary reagents of prolactin (PRL) radioimmunoassay (RIA) technique using solid phase magnetic particles with low cost is considered to be the main objective of the present study. The production of polyclonal antibodies was undertaken by immunizing four female New-Zealand rabbits through primary injection and four booster doses subcutaneously. The preparation of 125 I-prolactin radiotracer was carried out using chloramine-T. The preparation of standard prolactin was undertaken by preparing stock standard solution of prolactin and diluted with assay buffer. Activation and coupling of low magnetizable particles with the purified anti-PRL was carried out. Optimization and validation of the assay were carried out. The results obtained provide a highly sensitive, specific and accurate RIA system of PRL. In conclusion, this assay could be used in diagnosis of galactorrhea, prolactinoma, visual impairment and diagnosis of infertility in males and females.
Montalvo, Itziar; Gutiérrez-Zotes, Alfonso; Creus, Marta; Monseny, Rosa; Ortega, Laura; Franch, Joan; Lawrie, Stephen M; Reynolds, Rebecca M; Vilella, Elisabet; Labad, Javier
2014-01-01
Hyperprolactinaemia, a common side effect of some antipsychotic drugs, is also present in drug-naïve psychotic patients and subjects at risk for psychosis. Recent studies in non-psychiatric populations suggest that increased prolactin may have negative effects on cognition. The aim of our study was to explore whether high plasma prolactin levels are associated with poorer cognitive functioning in subjects with early psychoses. We studied 107 participants: 29 healthy subjects and 78 subjects with an early psychosis (55 psychotic disorders with levels were determined as well as total cortisol levels in plasma. Psychopathological status was assessed and the use of psychopharmacological treatments (antipsychotics, antidepressants, benzodiazepines) recorded. Prolactin levels were negatively associated with cognitive performance in processing speed, in patients with a psychotic disorder and high-risk subjects. In the latter group, increased prolactin levels were also associated with impaired reasoning and problem solving and poorer general cognition. In a multiple linear regression analysis conducted in both high-risk and psychotic patients, controlling for potential confounders, prolactin and benzodiazepines were independently related to poorer cognitive performance in the speed of processing domain. A mediation analysis showed that both prolactin and benzodiazepine treatment act as mediators of the relationship between risperidone/paliperidone treatment and speed of processing. These results suggest that increased prolactin levels are associated with impaired processing speed in early psychosis. If these results are confirmed in future studies, strategies targeting reduction of prolactin levels may improve cognition in this population.
Development of radioimmunoassay for prolactin binding protein
Energy Technology Data Exchange (ETDEWEB)
Raikar, R.S.; Sheth, A.R. (Institute for Research in Reproduction, Bombay (India))
1982-01-01
Using a homogenous prolactin binding protein (PBP) preparations from rat seminal vesicle secretion, a sensitive and specific radioimmunoassay (RIA) for PBP has been developed. The assay was highly specific and showed no cross-reaction with other protein hormones from various species. The antiserum had an affinity constant (Ka) of 2.66 x 10/sup 10/ M/sup -1/. The assay sensitivity was in the range of 0.5-1.0 ng of pure PBP per assay tube and the intra- and inter-assay coefficients of variations were 6-8% and 12-14.5% respectively. The overall recovery of PBP to the rat seminal vesicle secretion was 96.8%. Using this RIA, PBP levels in various biological fluids and reproductive tissues were measured. Azoospermic human semen contained significantly higher levels of PBP than normospermic semen. The seminal vesicle of rat exhibited the highest concentration of PBP. Administration of antiserum to PBP to mature male rats resulted in a significant reduction in the weight of ventral prostrate and serum prolactin levels were significantly elevated in these animals suggesting that the antibody raised against the PBP was capable of blocking prolactin receptors.
Association of Thyroid Profile and Prolactin Level in Patient with Secondary Amenorrhea
Shrestha, Sujata; Neupane, Sunita; Gautam, Narayan; Dubey, Raju Kumar; Jha, Amit Chandra; Doshi, Nilesh Raj; Jayan, Archana
2016-01-01
Background Amenorrhea is the absence of menstrual periods. It has multiple social consequences as it may leads to infertility. This case control study was conducted for determining the association of thyroid hormones with hyperprolactinemia in patient with amenorrhea. Methods We investigated 50 women with diagnosed cases of secondary amenorrhoea, who attended UCMS hospital, for hormonal evaluations. Fifty two healthy women were taken as the controls. The thyroid dysfunction and serum prolactin level were reviewed in cases and in the controls. Results Mean serum prolactin level was found to be significantly higher in the cases as compared to the controls. Mean serum fT3 and fT4 level in the hyperprolactinemic cases (mean = 2.67, SD = 1.04 pg/ml) and (mean = 1.38, SD = 0.51 ng/dl respectively) were slightly lower as compared to normoprolactinemic cases (mean = 3.21, SD = 1.86 pg/ml) and (mean = 1.73, SD = 1.37 ng/dl) respectively. Mean TSH of normoprolactinemic and hyperprolactinemic cases were comparable (P = 0.049). There was positive correlation between prolactin, BMI and TSH whereas negative correlation of prolactin was seen with fT3, fT4 and age. In hyperprolactainemic cases, prolactin was found to be negatively correlated with TSH (r = −0.155, P = 0.491) whereas prolactin was positively correlated with TSH (r = 0.296, P = 0.126) in normoprolactainemic cases. Conclusions Thus, hyperprolactinemia with thyroid dysfunction may be contributory hormonal factor in patient with amenorrhoea and as such, estimation of prolactin, fT3, fT4 and TSH should be included for diagnostic evaluation of amenorrhea. PMID:27904425
Fundamental studies, reference values and relationship to menstrual cycle on Prolactin RIA BEAD II
International Nuclear Information System (INIS)
Kobayashi, Midori; Sakai, Rinko; Satoh, Shigekiyo; Maruyama, Kiyoji; Kanai, Masamitsu
1989-01-01
We have tried fundamental studies, reference values and relationship to menstrual cycle on Prolactin RIA BEAD II kit which has a method of IRMA using monocronal antibody. On clinical studies, we investigated change of serum prolactin level during the menstrual cycle and relationship to other hormones (LH, FSH, estradiol, progesterone). It was the result that prolactin level of follicular phase was lower than that of preavulatory phase and luteal phase. We conclude that change of prolactin level during the menstrual cycle is related with change of estradiol level. (author)
Fundamental studies, reference values and relationship to menstrual cycle on Prolactin RIA BEAD II
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, Midori; Sakai, Rinko; Satoh, Shigekiyo; Maruyama, Kiyoji; Kanai, Masamitsu (Shinshu Univ., Matsumoto, Nagano (Japan). Faculty of Medicine)
1989-06-01
We have tried fundamental studies, reference values and relationship to menstrual cycle on Prolactin RIA BEAD II kit which has a method of IRMA using monocronal antibody. On clinical studies, we investigated change of serum prolactin level during the menstrual cycle and relationship to other hormones (LH, FSH, estradiol, progesterone). It was the result that prolactin level of follicular phase was lower than that of preavulatory phase and luteal phase. We conclude that change of prolactin level during the menstrual cycle is related with change of estradiol level. (author).
International Nuclear Information System (INIS)
Moreno-Guzman, Maria; Gonzalez-Cortes, Araceli; Yanez-Sedeno, Paloma; Pingarron, Jose M.
2011-01-01
A novel electrochemical immunosensor was developed for the determination of the hormone prolactin. The design involved the use of screen-printed carbon electrodes and streptavidin-functionalized magnetic particles. Biotinylated anti-prolactin antibodies were immobilized onto the functionalized magnetic particles and a sandwich-type immunoassay involving prolactin and anti-prolactin antibody labelled with alkaline phosphatase was employed. The resulting bio-conjugate was trapped on the surface of the screen-printed electrode with a small magnet and prolactin quantification was accomplished by differential pulse voltammetry of 1-naphtol formed in the enzyme reaction using 1-naphtyl phosphate as alkaline phosphatase substrate. All variables involved in the preparation of the immunosensor and in the electrochemical detection step were optimized. The calibration plot for prolactin exhibited a linear range between 10 and 2000 ng mL -1 with a slope value of 7.0 nA mL ng -1 . The limit of detection was 3.74 ng mL -1 . Furthermore, the modified magnetic beads-antiprolactin conjugates showed an excellent stability. The immunosensor exhibited also a high selectivity with respect to other hormones. The analytical usefulness of the immnunosensor was demonstrated by analyzing human sera spiked with prolactin at three different concentration levels.
Energy Technology Data Exchange (ETDEWEB)
Moreno-Guzman, Maria; Gonzalez-Cortes, Araceli [Department of Analytical Chemistry, Faculty of Chemistry, University Computense of Madrid, 28040 Madrid (Spain); Yanez-Sedeno, Paloma, E-mail: yseo@quim.ucm.es [Department of Analytical Chemistry, Faculty of Chemistry, University Computense of Madrid, 28040 Madrid (Spain); Pingarron, Jose M. [Department of Analytical Chemistry, Faculty of Chemistry, University Computense of Madrid, 28040 Madrid (Spain)
2011-04-29
A novel electrochemical immunosensor was developed for the determination of the hormone prolactin. The design involved the use of screen-printed carbon electrodes and streptavidin-functionalized magnetic particles. Biotinylated anti-prolactin antibodies were immobilized onto the functionalized magnetic particles and a sandwich-type immunoassay involving prolactin and anti-prolactin antibody labelled with alkaline phosphatase was employed. The resulting bio-conjugate was trapped on the surface of the screen-printed electrode with a small magnet and prolactin quantification was accomplished by differential pulse voltammetry of 1-naphtol formed in the enzyme reaction using 1-naphtyl phosphate as alkaline phosphatase substrate. All variables involved in the preparation of the immunosensor and in the electrochemical detection step were optimized. The calibration plot for prolactin exhibited a linear range between 10 and 2000 ng mL{sup -1} with a slope value of 7.0 nA mL ng{sup -1}. The limit of detection was 3.74 ng mL{sup -1}. Furthermore, the modified magnetic beads-antiprolactin conjugates showed an excellent stability. The immunosensor exhibited also a high selectivity with respect to other hormones. The analytical usefulness of the immnunosensor was demonstrated by analyzing human sera spiked with prolactin at three different concentration levels.
Serum prolactin profiles of normal human conception cycles
Energy Technology Data Exchange (ETDEWEB)
Adejuwon, C A [Ibadan Univ. (Nigeria). Coll. of Medicine; Faundes, Anibal [Universidade Estadual de Campinas (Brazil). Faculdade de Medicina; Segal, S J [Rockefeller Foundation, New York (USA); Alvarez-Sanchez, Francisco [Hospital Moscoso Puello, Santo Domingo (Dominican Republic). Dept. of Obstet. and Gynaecol.
1984-06-01
Commencing on day 10 of the menstrual cycle through onset of subsequent menses, or confirmation of pregnancy, daily sera collected from 15 women planning pregnancy were analyzed by radioimmunoassays (RIA) for prolactin (hPRL), estradiol-17..beta.. and luteinizing hormone (hLH). Two of the observed subjects became pregnant in the single cycles studied. The profiles of these hormones during the early gestation following spontaneous ovulation were established. No distinct midcycle peaks of hPEL were observed in either subject. Enormous spikes were observed in daily prolactin values, with wide variations between subjects.
Okkens, A C; Dieleman, S J; Kooistra, H S; Bevers, M M
1997-01-01
The effect of metergoline, a 5-hydroxytryptamine (serotonin) antagonist, on the plasma concentrations of prolactin in overtly pseudopregnant Afghan hounds and on the clinical symptoms of overt pseudopregnancy were studied. Plasma concentrations of prolactin and progesterone were determined in six Afghan hounds with signs of overt pseudopregnancy for 2-3 weeks and in three Afghan hounds that were not pseudopregnant at the time of blood sampling. In the overtly pseudopregnant bitches the plasma concentrations of prolactin before treatment (35.5 +/- 8.5 micrograms l-1) were significantly higher than the plasma concentrations of prolactin of the three bitches that were not pseudopregnant (6.3 +/- 0.5 micrograms l-1); the latter values were similar to those of non-pseudopregnant beagle bitches during the total luteal phase. The six pseudopregnant Afghan hounds were treated for 10 days with the antiserotoninergic drug metergoline. At 2 h after the onset of treatment with metergoline, the mean plasma concentration of prolactin had decreased to 10.8 +/- 2.9 micrograms l-1. The plasma concentrations of prolactin continued to decline to 5.4 +/- 1.0 micrograms l-1 at 4 h and to 1.0 +/- 0.1 microgram l-1 during treatment days 3-10. Signs of pseudopregnancy, such as swelling of the mammary glands and digging, decreased during the treatment period. The treatment was associated with mild behavioural side effects such as whimpering and aggressiveness. These side effects are probably not related to suppression of prolactin but are due to a direct effect on serotoninergic pathways in the brain. It is concluded that high plasma concentrations of prolactin are associated with the development and maintenance of pseudopregnancy. The serotonin antagonist metergoline strongly suppresses plasma concentrations of prolactin in pseudopregnant dogs and decreases the clinical signs of pseudopregnancy.
DEFF Research Database (Denmark)
Svensson, L Anders; Bondensgaard, Kent; Nørskov-Lauritsen, Leif
2008-01-01
The crystal structure of the complex between an N-terminally truncated G129R human prolactin (PRL) variant and the extracellular domain of the human prolactin receptor (PRLR) was determined at 2.5A resolution by x-ray crystallography. This structure represents the first experimental structure...... studies, the structural data imply that the definition of PRL binding site 1 should be extended to include residues situated in the N-terminal part of loop 1 and in the C terminus. Comparison of the structure of the receptor-bound PRL variant with the structure reported for the unbound form of a similar...... scale rearrangements and structuring occur in the flexible N-terminal part of loop 1. Hydrogen exchange mass spectrometry data imply that the dynamics of the four-helix bundle in solution generally become stabilized upon receptor interaction at binding site 1....
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Energy Technology Data Exchange (ETDEWEB)
Bagli, N P; Rajendran, K G; Shah, P N [Cancer Research Inst., Bombay (India). Div. of Endocrinology
1980-05-01
To study the effect of gonadotropin inhibiting material (GIM) on the binding of prolactin to Leydig cell receptors isolated Leydig cells were incubated with sup(125)I-prolactin. Presence of GIM in the incubation mixture did not inhibit the binding of sup(125)I-prolactin to Leydig cells whereas unlabelled prolactin significantly reduced the binding. In another experiment, testicular cells were incubated with FITC-tagged GIM. Binding of GIM to Leydig cells was seen by the presence of fluorescence on these cells. This binding could be inhibited by untagged GIM but not by prolactin. The results suggest the presence of separate receptors for GIM and prolactin on the Leydig cells and indicate that termination of pregnancy by GIM is not due to any interference with prolactin binding to its receptors.
Becú-Villalobos, D; Lacau-Mengido, I M; Thyssen, S M; Díaz-Torga, G S; Libertun, C
1994-02-01
We have used the nonpeptide angiotensin II (ANG II) receptor antagonists losartan (receptor subtype AT1) and PD-123319 (AT2) to determine the participation of ANG II receptor subtypes in luteinizing hormone-releasing hormone (LHRH)-induced prolactin release in a perifusion study using intact pituitaries in vitro. LHRH (1.85 x 10(-7) M) released prolactin consistently, whereas losartan (10(-5) M) abolished prolactin response without modifying basal prolactin or luteinizing hormone (LH) and follicle-stimulating hormone (FSH) release. PD-123319 (10(-5) M) had no effect on basal or LHRH-induced prolactin, LH, or FSH release. We also determined that the effect of ANG II on prolactin release was mediated by the same receptor subtype. In adenohypophysial cells dispersed in vitro ANG II (10(-8) M) released prolactin. Losartan (10(-7) and 10(-6) M), but not PD-123319, inhibited this effect. We conclude that in intact hypophyses of 15-day-old female rats the effect of LHRH on prolactin release is readily demonstrated. LHRH-induced prolactin release appears to be mediated by ANG II acting in a paracrine manner on AT1 receptors located on lactotrophs.
Directory of Open Access Journals (Sweden)
Gao Li-Zhi
2009-12-01
Full Text Available Abstract Background A series of studies showed the presence of substantial amount of nerve fibers and their close relationship with the anterior pituitary gland cells. Our previous studies have suggested that aside from the classical theory of humoral regulation, the rat anterior pituitary has direct neural regulation on adrenocorticotropic hormone release. In rat anterior pituitary, typical synapses are found on every type of the hormone-secreting cells, many on lactotrophs. The present study was aimed at investigating the physiological significance of this synaptic relationship on prolactin release. Methods The anterior pituitary of rat was sliced and stimulated with electrical field in a self-designed perfusion chamber. The perfusate was continuously collected in aliquots and measured by radioimmunoassay for prolactin levels. After statistic analysis, differences of prolactin concentrations within and between groups were outlined. Results The results showed that stimulation at frequency of 2 Hz caused a quick enhancement of prolactin release, when stimulated at 10 Hz, prolactin release was found to be inhibited which came slower and lasted longer. The effect of nerve stimulation on prolactin release is diphasic and frequency dependent. Conclusions The present in vitro study offers the first physiological evidence that stimulation of nerve fibers can affect prolactin release in rat anterior pituitary. Low frequency stimulation enhances prolactin release and high frequency mainly inhibits it.
Prolactin effect on the insulin content of albino rats in different physiological states
International Nuclear Information System (INIS)
Megahed, Y.M.; Abdel-Wahab, M.F.; El-Mougi, S.M.; El-Sayed, F.B.; Kuwait Univ.)
1980-01-01
The metabolic action of prolactin on insulin levels in plasma and pancreas has been studied. Prolactin was injected in a single dose or single daily doses on 4 successive days into albino rats in six different physiological states. Insulin was determined by radioimmunoassay using 125 I insulin. From the results it is concluded that prolactin injected i.p. influences the output of insulin and stimulates the pancreas to secrete insulin into the plasma. (author)
Effect of exogenous prolactin on ultrastructure of pinealocyte in female pigs during puberty
International Nuclear Information System (INIS)
Przybylska, B.; Dusza, L.; Lewczuk, B.; Ciesielska-Myszka, L.
1994-01-01
Influence of the administration of prolactin to female swine during puberty on the ultrastructure of pinealocytes has been examined by means of morphometric analysis. Prolactin administration for 15 consecutive days resulted in a decrease in the cytoplasmic dense bodies type MBB-2, lysosomes and multivesicular bodies. Some differences in structure of pinealocytes were also observed. Prolactin appeared to stimulate the process of transformation of cytoplasmic dense bodies. (author). 28 refs, 5 figs
Effect of exogenous prolactin on ultrastructure of pinealocyte in female pigs during puberty
Energy Technology Data Exchange (ETDEWEB)
Przybylska, B.; Dusza, L.; Lewczuk, B.; Ciesielska-Myszka, L. [Akademia Rolniczo-Technicza, Olsztyn (Poland)
1994-12-31
Influence of the administration of prolactin to female swine during puberty on the ultrastructure of pinealocytes has been examined by means of morphometric analysis. Prolactin administration for 15 consecutive days resulted in a decrease in the cytoplasmic dense bodies type MBB-2, lysosomes and multivesicular bodies. Some differences in structure of pinealocytes were also observed. Prolactin appeared to stimulate the process of transformation of cytoplasmic dense bodies. (author). 28 refs, 5 figs.
Prolactin and Male Fertility: The Long and Short Feedback Regulation
Directory of Open Access Journals (Sweden)
M. K. Gill-Sharma
2009-01-01
Full Text Available In the last 20 years, a pituitary-hypothalamus tissue culture system with intact neural and portal connections has been developed in our lab and used to understand the feedback mechanisms that regulate the secretions of adenohypophyseal hormones and fertility of male rats. In the last decade, several in vivo rat models have also been developed in our lab with a view to substantiate the in vitro findings, in order to delineate the role of pituitary hormones in the regulation of fertility of male rats. These studies have relied on both surgical and pharmacological interventions to modulate the secretions of gonadotropins and testosterone. The interrelationship between the circadian release of reproductive hormones has also been ascertained in normal men. Our studies suggest that testosterone regulates the secretion of prolactin through a long feedback mechanism, which appears to have been conserved from rats to humans. These studies have filled in a major lacuna pertaining to the role of prolactin in male reproductive physiology by demonstrating the interdependence between testosterone and prolactin. Systemic levels of prolactin play a deterministic role in the mechanism of chromatin condensation during spermiogenesis.
A high pressure liquid chromatography method for separation of prolactin forms.
Bell, Damon A; Hoad, Kirsten; Leong, Lillian; Bakar, Juwaini Abu; Sheehan, Paul; Vasikaran, Samuel D
2012-05-01
Prolactin has multiple forms and macroprolactin, which is thought not to be bioavailable, can cause a raised serum prolactin concentration. Gel filtration chromatography (GFC) is currently the gold standard method for separating macroprolactin, but is labour-intensive. Polyethylene glycol (PEG) precipitation is suitable for routine use but may not always be accurate. We developed a high pressure liquid chromatography (HPLC) assay for macroprolactin measurement. Chromatography was carried out using an Agilent Zorbax GF-250 (9.4 × 250 mm, 4 μm) size exclusion column and 50 mmol/L Tris buffer with 0.15 mmol/L NaCl at pH 7.2 as mobile phase, with a flow rate of 1 mL/min. Serum or plasma was diluted 1:1 with mobile phase and filtered and 100 μL injected. Fractions of 155 μL were collected for prolactin measurement and elution profile plotted. The area under the curve of each prolactin peak was calculated to quantify each prolactin form, and compared with GFC. Clear separation of monomeric-, big- and macroprolactin forms was achieved. Quantification was comparable to GFC and precision was acceptable. Total time from injection to collection of the final fraction was 16 min. We have developed an HPLC method for quantification of macroprolactin, which is rapid and easy to perform and therefore can be used for routine measurement.
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Anuradha; Krishna, Amitabh
2017-07-01
The aim of this study was to evaluate the role of prolactin as a modulator of luteal steroidogenesis during the period of delayed embryonic development in Cynopterus sphinx. A marked decline in circulating prolactin levels was noted during the months of November through December coinciding with the period of decreased serum progesterone and delayed embryonic development. The seasonal changes in serum prolactin levels correlated positively with circulating progesterone (P) level, but inversely with circulating melatonin level during first pregnancy showing delayed development in Cynopterus sphinx. The results also showed decreased expression of prolactin receptor-short form (PRL-RS) both in the corpus luteum and in the utero-embryonic unit during the period of delayed embryonic development. Bats treated in vivo with prolactin during the period of delayed development showed significant increase in serum progesterone and estradiol levels together with significant increase in the expression of PRL-RS, luteinizing hormone receptor (LH-R), steroidogenic acute receptor protein (STAR) and 3β-hydroxysteroid dehydrogenase (3β-HSD) in the ovary. Prolactin stimulated ovarian angiogenesis (vascular endothelial growth factor) and cell survival (B-cell lymphoma 2) in vivo. Significant increases in ovarian progesterone production and the expression of prolactin-receptor, LH-R, STAR and 3β-HSD proteins were noted following the exposure of LH or prolactin in vitro during the delayed period. In conclusion, short-day associated increased melatonin level may be responsible for decreased prolactin release during November-December. The decline in prolactin level might play a role in suppressing P and estradiol-17β (E2) estradiol levels thereby causing delayed embryonic development in C. sphinx. Copyright © 2017 Elsevier Inc. All rights reserved.
Ferraris, Jimena; Radl, Daniela Betiana; Zárate, Sandra; Jaita, Gabriela; Eijo, Guadalupe; Zaldivar, Verónica; Clapp, Carmen; Seilicovich, Adriana; Pisera, Daniel
2011-01-01
The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry) of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation) of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry). In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic actions of this
Directory of Open Access Journals (Sweden)
Jimena Ferraris
Full Text Available The anterior pituitary is under a constant cell turnover modulated by gonadal steroids. In the rat, an increase in the rate of apoptosis occurs at proestrus whereas a peak of proliferation takes place at estrus. At proestrus, concomitant with the maximum rate of apoptosis, a peak in circulating levels of prolactin is observed. Prolactin can be cleaved to different N-terminal fragments, vasoinhibins, which are proapoptotic and antiproliferative factors for endothelial cells. It was reported that a 16 kDa vasoinhibin is produced in the rat anterior pituitary by cathepsin D. In the present study we investigated the anterior pituitary production of N-terminal prolactin-derived fragments along the estrous cycle and the involvement of estrogens in this process. In addition, we studied the effects of a recombinant vasoinhibin, 16 kDa prolactin, on anterior pituitary apoptosis and proliferation. We observed by Western Blot that N-terminal prolactin-derived fragments production in the anterior pituitary was higher at proestrus with respect to diestrus and that the content and release of these prolactin forms from anterior pituitary cells in culture were increased by estradiol. A recombinant preparation of 16 kDa prolactin induced apoptosis (determined by TUNEL assay and flow cytometry of cultured anterior pituitary cells and lactotropes from ovariectomized rats only in the presence of estradiol, as previously reported for other proapoptotic factors in the anterior pituitary. In addition, 16 kDa prolactin decreased forskolin-induced proliferation (evaluated by BrdU incorporation of rat total anterior pituitary cells and lactotropes in culture and decreased the proportion of cells in S-phase of the cell cycle (determined by flow cytometry. In conclusion, our study indicates that the anterior pituitary production of 16 kDa prolactin is variable along the estrous cycle and increased by estrogens. The antiproliferative and estradiol-dependent proapoptotic
Dopamine inhibits maitotoxin-stimulated pituitary 45Ca2+ efflux and prolactin release
International Nuclear Information System (INIS)
Login, I.S.; Judd, A.M.; MacLeod, R.M.
1986-01-01
The authors examined the hypothesis that dopaminergic inhibition of prolactin release is coupled to modulation of cellular calcium flux. Dispersed female rat pituitary cells were prelabeled in 45 Ca 2+ and perifused to determine simultaneously fractional calcium efflux and prolactin release, as stimulated by maitotoxin, a calcium channel activator. The integrated response of each parameter to 5 ng/ml maitotoxin was obtained in individual perifusion columns in the absence or presence of various concentrations of dopamine. Maitotoxin-stimulated calcium efflux was suppressed by dopamine concentrations of 0.01 μM and greater and achieved a maximal effect at ∼0.1 μM, at which calcium efflux was reduced by 50%. Maitotoxin-stimulated prolactin release was inhibited by 0.03 μM dopamine and greater concentrations, and at a concentration of ∼10.0 μM dopamine the effect became maximal at ∼85% suppression. Haloperidol (0.1 μM) blocked the effects of 0.1 μM dopamine on both parameters. Simultaneous suppression of maitotoxin-stimulated calcium efflux and prolactin release by concentrations of dopamine within the nonomolar range suggests that dopamine receptor activation is negatively coupled to modulation of calcium flux in the physiological regulation of prolactin secretion
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Bukowska, Agnieszka; Sobala, Wojciech; Peplonska, Beata
2015-04-01
The pattern of secretion of many hormones, including prolactin, is dependent on the circadian rhythm. Night shift work involves exposure to artificial light at night and sleep deficiency, which in turn can affect prolactin synthesis. The aim of this study was to evaluate a possible association between night shift work characteristics, sleep quality, lifestyle factors and prolactin concentration, using data from a cross-sectional study of nurses and midwives. A cross-sectional study was conducted among 327 nurses and midwives currently working on rotating night shifts, and 330 nurses and midwives working during the day (aged 40-60 years) (388 premenopausal and 269 postmenopausal). Information about night shift work characteristics, lifestyle, reproductive factors, sleep pattern and other covariates was collected through a face-to-face interview, and from a one-week work and sleep diary completed by the subjects. Weight and height were measured. Prolactin concentration was measured in the morning blood sample using the electrochemiluminesence immunoassay method. Associations were analyzed using linear regression models adjusted for important confounders. Analyses were carried out separately in pre- and postmenopausal women. None of the night shift work or sleep characteristics was significantly associated with prolactin concentration. Prolactin concentration was significantly (p night shift work is not associated with prolactin concentration. Smoking, parity, time of blood collection and age among postmenopausal women were significant determinants of prolactin.
M. Indriati; C. Sumantri; T. Susanti
2016-01-01
Genetic marker linked to loci reproductive traits could be used to increase an effectiveness of improvement in animal breeding. Association between DNA polymorphism and a trait could be considered as candidate genetic marker for marker assisted selection (MAS) programs. Prolactin (PRL) is one of polypeptide hormones secreted by anterior pituitary gland in vertebrates. PRL plays an important role in onset of poultry incubation and brooding behavior. The aim of this study was to investigate the...
Directory of Open Access Journals (Sweden)
Song Yi-Huan
2017-01-01
Full Text Available Background/Aim. There are limited data examining variations in the local expression of inflammatory mediators in anal fistulas where it is anticipated that an improved understanding of the inflammatory milieu might lead to the potential therapeutic option of instillation therapy in complicated cases. The aim of the present study was to examine prolactin receptors (PRLR as inflammatory markers and to correlate their expression with both the complexity of anal fistulas and the likelihood of fistula recurrence. Methods. Microarray was used to screen the differentially expressed gene profile of anal fistula using anal mucosa samples with hemorrhoids with ageand sex-matched patients as controls and then a prospective analysis of 65 patients was conducted with anal fistulas. PRLR immunohistochemistry was performed to define expression in simple, complex and recurrent anal fistula cases. The quantitative image comparison was performed combining staining intensity with cellular distribution in order to create high and low score PRLR immunohistochemical groupings. Results. A differential expression profile of 190 genes was found. PRLR expression was 2.91 times lower in anal fistula compared with control. Sixty-five patients were assessed (35 simple, 30 complex cases. Simple fistulas showed significantly higher PRLR expression than complex cases with recurrent fistulae showing overall lower PRLR expression than de novo cases (p = 0.001. These findings were reflected in measurable integrated optical density for complex and recurrent cases (complex cases, 8.31 ± 4.91 x 104 vs simple cases, 12.30 ± 6.91 x 104; p < 0.01; recurrent cases, 7.21 ± 3.51 x 104 vs primarily healing cases, 8.31 ± 4.91 x 104; p < 0.05. In univariate regression analysis, low PRLR expression correlated with fistula complexity; a significant independent effect maintained in multivariate analysis odds ratio [(OR low to high PRLR expression = 9.52; p = 0.001]. Conclusion. PRLR
Lamberts, S.W.J.; De Quijada, M.; Ree, J.M. van; Wied, D. de
1982-01-01
The effects on prolactin secretion of three peptide-derivatives of β-endorphin which show neuroleptic-like activities in rats were studied. Intravenous administration of γ-endorphin (β-endorphin (βE) 1–17) enhanced plasma prolactin levels. γ-Endorphin did not affect the prolactin secretion by
International Nuclear Information System (INIS)
McNeilly, A.S.; Etches, R.J.; Friesen, H.G.
1978-01-01
A specific heterologous double-antibody radioimmunoassay has been developed to measure turkey prolactin (PRL) using a guinea pig anti-hPRL antiserum and 125 I-labelled ovine PRL [ 125 I]oPRL. Turkey pituitary prolactin and serum give parallel dose-response curves and no cross-rection is seen with turkey growth hormone, LH or FSH, or mammalian LH, FSH, TSH, GH or placental lactogens. The RIA is accurate and precise and is sufficiently sensitive to measure PRL in all physiological situations investigated in the turkey. The RIA will measure PRL in several avian species including the chicken, duck, goose, pheasant, pheasant x chicken F 1 hybrid, pigeon, quail, and rook. Plasma PRL concentrations in laying and broody turkey hens were not significantly different (46.5 +- 2.5 vs. 39.7 +- 3.8 ng/ml) but both were significantly higher (P < 0.001) than in non-laying turkey hens (4.6 +- 0.7 ng/ml). Oestradiol injection into laying hens did not alter PRL levels while the same injection in non-laying hens caused a significant three-fold increse in plasma PRL levels. (author)
Regulatory role of prolactin in paternal behavior in male parents: A narrative review
Directory of Open Access Journals (Sweden)
F Hashemian
2016-01-01
Full Text Available In all mammalian species, a combination of neuroendocrine and experiential factors contributes to the emergence of remarkable behavioral changes observed in parental behavior. Yet, our understanding of neuroendocrine bases of paternal behavior in humans is still preliminary and more research is needed in this area. In the present review, the authors summarized hormonal bases of paternal behavior in both human and nonhuman mammalian species and focused on studies on the regulatory role of prolactin in occurrence of paternal behavior. All peer-reviewed journal articles published before 2015 for each area discussed (parental brain, hormonal bases of maternal behavior, hormonal bases of paternal behavior and the role of prolactin in regulation of paternal behavior in nonhuman mammalian species, hormonal bases of paternal behavior and the role of prolactin in regulation of paternal behavior in humans were searched by PubMed, Medline, and Scopus for original research and review articles. Publications between 1973 and 2015 were included. Similar to female parents, elevated prolactin levels in new fathers most probably contribute to child-caring behavior and facilitate behavioral and emotional states attributed to child care. Moreover, elevated parental prolactin levels after childbirth decrease the parents′ libidos so that they invest more in parental care than in fertility behavior. According to the available clinical studies, elevation in the amounts of prolactin levels after childbirth in male parents are probably associated with paternal behavior observed in humans.
Pituitary Macroprolactinoma with Mildly Elevated Serum Prolactin: Hook Effect
Directory of Open Access Journals (Sweden)
Mahnaz Pejman-Sani
2018-04-01
Full Text Available A 45-year-old man was admitted in our department with complaints of severe headache for over 6 months period. He also suffered from several problems such as visual field defect, decreased energy and libido, body hair loss, cold intolerance, decreased appetite and dry skin. On physical examination, he was afebrile: BP (blood pressure: 110/70 mm/Hg, PR (pulse rate :65 beat/min, BMI (body mass index: 24. He had no terminal hair on face or chest and subcutaneous adipose tissue mass had been decreased substantially. Laboratory tests revealed; Hb: 12 g/dL (N: 14–17 g/dL, Total testosterone: 1.2 ng/mL (N:–-10 ng/mL, Luteinizing hormone (LH:3.3MIU/mL (N:1–8 MIU/mL, Follicle Stimulating hormone (FSH:1.3 MIU/mL (N:1–7 MIU/mL, T4:3.4 micg/dL (N:4–12 micg/dL, TSH:0.6 MIU/mL (N:0.5–5 MIU/mL, Prolactin:100 ng/mL (2–24 ng/mL, serum cortisol:6 MIU/mL (N:4–21 MIU/mL, IGF1:162 ng/mL (50–245. Pituitary MRI showed macroadenoma (29*16*14 mm in left side of sella turcica which bulged to suprasellar cistern with pressure effect on left optic nerve (Figure 1, 2. Visual field examination revealed mild temporal hemianopia. These findings are consistent with macroadenoma and mild prolactin elevation. We also observed a discrepancy between pituitary tumor size and prolactin level. The correct estimate of serum prolactin was obtained after serial dilutional measurement. Serum prolactin after dilution was 6470 ng/mL. With these findings pituitary macroadenoma was diagnosed and treatment with cabergoline (dopamine agonist 0.5 mg/week was started. After one month follow-up he had no symptoms, visual field defect was improved and pituitary MRI showed significant shrinkage of tumor.
Targeting Stromal Androgen Receptor Suppresses Prolactin-Driven Benign Prostatic Hyperplasia (BPH)
Lai, Kuo-Pao; Huang, Chiung-Kuei; Fang, Lei-Ya; Izumi, Kouji; Lo, Chi-Wen; Wood, Ronald; Kindblom, Jon; Yeh, Shuyuan
2013-01-01
Stromal-epithelial interaction plays a pivotal role to mediate the normal prostate growth, the pathogenesis of benign prostatic hyperplasia (BPH), and prostate cancer development. Until now, the stromal androgen receptor (AR) functions in the BPH development, and the underlying mechanisms remain largely unknown. Here we used a genetic knockout approach to ablate stromal fibromuscular (fibroblasts and smooth muscle cells) AR in a probasin promoter-driven prolactin transgenic mouse model (Pb-PRL tg mice) that could spontaneously develop prostate hyperplasia to partially mimic human BPH development. We found Pb-PRL tg mice lacking stromal fibromuscular AR developed smaller prostates, with more marked changes in the dorsolateral prostate lobes with less proliferation index. Mechanistically, prolactin mediated hyperplastic prostate growth involved epithelial-stromal interaction through epithelial prolactin/prolactin receptor signals to regulate granulocyte macrophage-colony stimulating factor expression to facilitate stromal cell growth via sustaining signal transducer and activator of transcription-3 activity. Importantly, the stromal fibromuscular AR could modulate such epithelial-stromal interacting signals. Targeting stromal fibromuscular AR with the AR degradation enhancer, ASC-J9®, led to the reduction of prostate size, which could be used in future therapy. PMID:23893956
Effects of melatonin and prolactin in reproduction: review of literature
Tenorio, Fernanda das Chagas Angelo Mendes; Simões, Manuel de Jesus; Teixeira, Valéria Wanderley; Teixeira, Álvaro Aguiar Coelho
2015-01-01
Summary The pineal gland is responsible for producing a hormone called melatonin (MEL), and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL) also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a ...
Jonsson, J.E.; Afton, A.D.; Alisauskas, R.T.; Bluhm, C.K.; El Halawani, M.E.
2006-01-01
We investigated effects of ecological and physiological factors on brood patch area and prolactin levels in free-ranging Lesser Snow Geese (Chen caerulescens caerulescens; hereafter “Snow Geese”) and Ross's Geese (C. rossii). On the basis of the body-size hypothesis, we predicted that the relationships between prolactin levels, brood patch area, and body condition would be stronger in Ross's Geese than in the larger Snow Geese. We found that brood patch area was positively related to clutch volume and inversely related to prolactin levels in Ross's Geese, but not in Snow Geese. Nest size, nest habitat, and first egg date did not affect brood patch area in either species. Prolactin levels increased as incubation progressed in female Snow Geese, but this relationship was not significant in Ross's Geese. Prolactin levels and body condition (as indexed by size-adjusted body mass) were inversely related in Ross's Geese, but not in Snow Geese. Our findings are consistent with the prediction that relationships between prolactin levels, brood patch area, and body condition are relatively stronger in Ross's Geese, because they mobilize endogenous reserves at faster rates than Snow Geese.
Song, G G; Lee, Y H
2017-10-01
Objective This study aimed to evaluate the relationship between circulating prolactin level and systemic lupus erythematosus (SLE), and to establish a correlation between plasma/serum prolactin levels and SLE activity. Methods We performed a meta-analysis comparing the plasma/serum prolactin levels in patients with SLE to controls, and examined correlation coefficients between circulating prolactin level and SLE disease activity. Results Twenty-five studies with a total of 1056 SLE patients and 426 controls were included. Prolactin levels were significantly higher overall in the SLE group than in the control group (standardized mean difference (SMD) = 0.987, 95% CI = 0.512-1.463, p = 4.7 × 10 -5 ). Stratification by ethnicity showed significantly elevated prolactin levels in the SLE group in Asian, Latin American, and mixed populations (SMD = 0.813, 95% CI = 0.137-1.490, p = 0.018; SMD = 0.981, 95% CI = 0.307-1.655, p = 0.004; SMD = 1.469, 95% CI = 0.443-2.495, p = 0.005, respectively), but not in the European population. Subgroup analysis by sample size showed significantly higher prolactin levels in the SLE group by small ( n 30). Meta-analysis of correlation coefficients showed a significantly positive correlation between circulating prolactin level and SLE activity (correlation coefficient = 0.379, 95% CI = 0.026-0.487, p = 4.0 × 10 -9 ). Circulating prolactin levels were positively associated with SLE activity in European, Asian, and mixed populations (SMD = 0.532, 95% CI = 0.443-0.609 p < 1.0 × 10 -8 ; SMD = 0.427, 95% CI = 0.240-0.583, p = 2.4 × 10 -5 ; SMD = 0.433, 95% CI = 0.212-0.591, p = 2.7 × 10 -5 , respectively). Conclusions Our meta-analysis demonstrated that circulating prolactin levels are higher in patients with SLE, and that a significantly positive correlation exists between prolactin levels and SLE activity.
Involvement of arachidonate metabolism in neurotensin-induced prolactin release in vitro
International Nuclear Information System (INIS)
Canonico, P.L.; Speciale, C.; Sortino, M.A.; Scapagnini, U.
1985-01-01
Neurotensin increased in a concentration-dependent manner the level of hypophyseal [ 3 H]arachidonic acid in vitro as well as prolactin release from hemipituitary glands. The effect of 1 microM neurotensin on arachidonate release was already present at 2.5 min, maximal at 5, and disappeared after a 10-min incubation. Neurotensin analogues produced an enhancement of hypophyseal arachidonate similar to their relative potencies in other cellular systems, whereas other peptides (somatostatin and vasoactive intestinal peptide) were devoid of any effect on the concentration of the fatty acid in the pituitary. Seventy micromoles RHC 80267, a rather selective inhibitor of diacylglycerol lipase, completely prevented the neurotensin-stimulated prolactin release and decreased arachidonate release both in basal or in neurotensin-induced conditions. Similar results were obtained with 50 microM quinacrine, a phospholipase A2 inhibitor. To clarify whether arachidonate released by neurotensin requires a further metabolism through specific pathways to stimulate prolactin release, the authors used indomethacin and BW 755c, two blockers of cyclooxygenase and lipoxygenase pathways. Thirty micromoles indomethacin, a dose active to inhibit cyclooxygenase, did not affect unesterified arachidonate levels either in basal or in neurotensin-induced conditions; moreover, the drug did not modify basal prolactin release but slightly potentiated the stimulatory effect of neurotensin on the release of the hormone. On the other hand, 250 microM BW 755c, an inhibitor of both cyclooxygenase and lipoxygenase pathways, significantly inhibited both basal and neurotensin-stimulated prolactin release and further potentiated the increase of the fatty acid concentrations produced by 1 microM neurotensin
Prolactin-inducible proteins in human breast cancer cells
International Nuclear Information System (INIS)
Shiu, R.P.; Iwasiow, B.M.
1985-01-01
The mechanism of action of prolactin in target cells and the role of prolactin in human breast cancer are poorly understood phenomena. The present study examines the effect of human prolactin (hPRL) on the synthesis of unique proteins by a human breast cancer cell line, T-47D, in serum-free medium containing bovine serum albumin. [ 35 S]Methionine-labeled proteins were analysed by sodium dodecyl sulfate-polyacrylamide slab gel electrophoresis and fluorography. Treatment of cells with hPRL (1-1000 ng/ml) and hydrocortisone (1 microgram/ml) for 36 h or longer resulted in the synthesis and secretion of three proteins having molecular weights of 11,000, 14,000, and 16,000. Neither hPRL nor hydrocortisone alone induced these proteins. Of several other peptide hormones tested, only human growth hormone, a hormone structurally and functionally similar to hPRL, could replace hPRL in causing protein induction. These three proteins were, therefore, referred to as prolactin-inducible proteins (PIP). Each of the three PIPs was purified to homogeneity by preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and specific antibodies were generated to them in rabbits. By immunoprecipitation and immunoblotting (Western blot) of proteins secreted by T-47D cells, it was demonstrated that the three PIPs were immunologically identical to one another. In addition, the 16-kDa and 14-kDa proteins (PIP-16 and PIP-14), and not the 11-kDa protein (PIP-11), incorporated [ 3 H]glycosamine. Furthermore, 2-deoxyglucose (2 mM) and tunicamycin (0.5 micrograms/ml), two compounds known to inhibit glycosylation, blocked the production of PIP-16 and PIP-14, with a concomitant increase in the accumulation of PIP-11
Arse, Kh A
1979-01-01
Gel electrophoresis was used in a comparative study of prolactin content in the hypophysis of rats of different age and sex, and at various stages of the estral cycle. The hormone level in the pubertal rats was twice or thrice greater than in the immature ones; it was by 16% less at the diestrus than at the estrus stage. There was no change in the hypophysis prolactin content in male rats at puberty. Ovariectomy was accompained by a sharp reduction of prolactin in the hypophysis. Replacing estradiol therapy increased the amount of prolactin in the hypophysis, without bringing it, however, to the level characteristic of intact rats. Estrogens are responsible for the maintenance of prolactin level, but apparently other factors influencing its content in the hypophysis also exist.
Sharma, S. T.; Raff, H.
2011-01-01
Context: Anomalous venous drainage can lead to false-negative inferior petrosal sinus sampling (IPSS) results. Baseline inferior petrosal sinus to peripheral (IPS/P) prolactin ratio higher than 1.8 ipsilateral to the highest ACTH ratio has been proposed to verify successful catheterization. Prolactin-normalized ACTH IPS/P ratios may differentiate Cushing's disease (CD) from ectopic ACTH syndrome (EAS). Objective: Our objective was to examine the utility of prolactin measurement during IPSS. Design, Setting, and Participants: We conducted a retrospective analysis of prolactin levels in basal and CRH-stimulated IPSS samples in ACTH-dependent Cushing's syndrome (2007–2010). Results: Twenty-five of 29 patients had a pathologically proven diagnosis (17 CD and eight EAS). IPSS results were partitioned into true positive for CD (n = 16), true negative (n = 7), false negative (n = 1), and false positive (n = 1). Prolactin IPS/P ratio suggested successful IPSS in eight of 11 with abnormal venograms. Baseline prolactin IPS/P ratio was helpful in two patients with abnormal venograms and false-negative (catheterization unsuccessful) or true-negative (catheterization successful) IPSS results; the normalized ratio correctly diagnosed their disease. Normalized ACTH IPS/P ratio was at least 1.3 in all with CD, but prolactin IPS/P ratios were misleadingly low in two. One patient with cyclic EAS had a false-positive IPSS when eucortisolemic (baseline prolactin IPS/P = 1.7; normalized ratio = 5.6). All other EAS patients had normalized ratios no higher than 0.7. Conclusion: Prolactin measurement and evaluation of the venogram can improve diagnostic accuracy when IPSS results suggest EAS but is not necessary with positive IPSS results. Confirmation of hypercortisolemia remains a prerequisite for IPSS. A normalized ratio of 0.7–1.3 was not diagnostic. PMID:22031511
Importance of prolactin for lactation in the ewe
Energy Technology Data Exchange (ETDEWEB)
Hooley, R D; Campbell, J J; Findlay, J K [Reproduction Research Section, Melbourne Univ., C/- Animal Research Inst., Werribee (Australia)
1978-12-01
The effect of 2-bromo-..cap alpha..-ergocryptine (bromocriptine) on the induction and maintenance of milk secretion was studied in post-parturient ewes and in ovariectomized ewes artificially induced to lactate by treatment with oestrogen plus progesterone and then dexamethasone. Treatment with bromocriptine (about 0.4 mk/kg every 3 days) lowered and maintained the plasma concentration of prolactin at < 12 ng/ml. Ewes receiving bromocriptine concurrently with oestrogen plus progesterone during the priming phase had a significantly lower (P < 0.05) mean cumulative milk yield than control ewes, although the milk of the treated ewes contained normal amounts of fat, protein and lactose. Administration of bromocriptine during dexamethasone-induced lactogenesis had no significant effect on the mean cumulative milk yield but significantly (P < 0.05) increased the milk fat and protein content. In establishing lactation, bromocriptine markedly reduced the milk yield in both intact and ovariectomised ewes. The concentration of protein was not significantly affected although the milk fat content was higher in the bromocriptine-treated than in the control ewes. The effects of bromocriptine on milk yield and composition during galactopoiesis could be reversed by concurrent infusion of prolactin and the results suggest that prolactin is an important hormone during mammogenesis and galactopoiesis in sheep.
Interferon induced IFIT family genes in host antiviral defense.
Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua
2013-01-01
Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.
Serum Prolactin in Diagnosis of Epileptic Seizures
Directory of Open Access Journals (Sweden)
J Gordon Millichap
2005-09-01
Full Text Available The results of studies in databases and references concerning serum prolactin levels (PRL in patients with suspected seizures were rated for quality and analyzed by members of the Therapeutics Subcommittee of the American Academy of Neurology.
Radioimmunoassay of human homologous prolactin in serum with commercially available reagents
International Nuclear Information System (INIS)
Kao, P.C.; Jiang, N.S.; Abboud, C.F.
1977-01-01
A clinically useful and reproducible radioimmunoassay for human homologous prolactin, established with commercially available reagents, was studied and validated. We present detailed conditions for iodination and purification of labeled prolactin and the optimal conditions for the assay. By the method, we found values (μg/liter) as follows for serum prolactin: normal men, 8.9 +- 5.2 (mean +- SD); normal women, 11.8 +- 5.5; normal women taking contraceptive pills, 9.2 +- 5.0; pregnant women in the third trimester, 188 +- 69.5; patients with various diseases other than of the hypothalamic-pituitary axis, 9.3 +- 6.3; in some patients with amenorrhea and galactorrhea of diverse origin, 78.2 +- 87.4; and in some patients with surgically proven pituitary tumor, 1414 +- 1980. Results under provocative testing are also presented for a patient with normal hypothalamic-pituitary function
The structure of the human interferon alpha/beta receptor gene.
Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G
1992-02-05
Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.
Effects of short- and long-term risperidone treatment on prolactin levels in children with autism.
Anderson, George M; Scahill, Lawrence; McCracken, James T; McDougle, Christopher J; Aman, Michael G; Tierney, Elaine; Arnold, L Eugene; Martin, Andrés; Katsovich, Liliya; Posey, David J; Shah, Bhavik; Vitiello, Benedetto
2007-02-15
The effects of short- and long-term risperidone treatment on serum prolactin were assessed in children and adolescents with autism. Patients with autism (N = 101, 5-17 years of age) were randomized to an 8-week trial of risperidone or placebo and 63 then took part in a 4-month open-label follow-up phase. Serum samples were obtained at Baseline and Week-8 (N = 78), and at 6-month (N = 43) and 22-month (N = 30) follow-up. Serum prolactin was determined by immunoradiometric assay; dopamine type-2 receptor (DRD2) polymorphisms were genotyped. Baseline prolactin levels were similar in the risperidone (N = 42) and placebo (N = 36) groups (9.3 +/- 7.5 and 9.3 +/- 7.6 ng/ml, respectively). After 8 weeks of risperidone, prolactin increased to 39.0 +/- 19.2 ng/ml, compared with 10.1 +/- 8.8 ng/ml for placebo (p autism. Although risperidone-induced increases tended to diminish with time, further research on the consequences of long-term prolactin elevations in children and adolescents is needed.
21 CFR 862.1625 - Prolactin (lactogen) test system.
2010-04-01
... anterior pituitary gland or of the hypothalamus portion of the brain. (b) Classification. Class I (general... system is a device intended to measure the anterior pituitary polypeptide hormone prolactin in serum and...
Montalvo, Itziar; Nadal, Roser; Armario, Antonio; Gutiérrez-Zotes, Alfonso; Creus, Marta; Cabezas, Ángel; Solé, Montse; Algora, Maria José; Sánchez-Gistau, Vanessa; Vilella, Elisabet; Labad, Javier
2018-06-01
Hyperprolactinaemia is commonly observed in people with psychotic disorders due to D2 receptor blockade by antipsychotic drugs, although it may also exist in drug-naïve patients with first-episode psychosis. Recent studies suggest that hyperprolactinaemia may have a negative impact on cognitive function in people with early psychosis. We aimed to explore whether there are sex differences in the association between prolactin levels and cognitive performance in early psychosis patients. We studied 60 young patients with early psychosis (aged 18-35 years, 35% females) and a sex- and age-matched control group of 50 healthy subjects. Cognitive assessment was performed with the MATRICS Consensus Cognitive Battery. Prolactin, total cortisol, follicular-stimulating hormone, luteal hormone and sex steroids (testosterone in men, oestradiol and progesterone in women) were measured in plasma. Salivary cortisol was measured at different sampling times (awakening response, 10:00 and 23:00). Psychopathological status was assessed, and antipsychotic treatment was registered. Multiple linear regression analyses were used to explore the relationship between prolactin and cognitive tasks while adjusting for covariates. Prolactin levels were associated with impaired processing speed in men, and this association was independent of cortisol and testosterone. In women, prolactin levels were not associated with processing speed tasks, although we observed a negative effect of prolactin on verbal learning and spatial working memory in female healthy subjects. The male-dependent effect maintained its significance after adjusting for education status, antipsychotic treatment and negative symptoms. Our study demonstrates that the previously reported association between high prolactin levels and impaired cognitive processes in early psychosis is restricted to men.
Studies on the regulation of anuran metamorphosis by thyroid hormones and prolactin
International Nuclear Information System (INIS)
Ray, L.B.
1985-01-01
Resorption of the tail of the anuran larva during metamorphosis is induced by the thyroid hormones. In contrast, the pituitary hormone prolactin favors growth of the tail fin and inhibits resorption. The present investigations were designed to explore the mechanisms by which the thyroid hormones and prolactin bring about their cellular effects. Incubation of explants of tail fin with derivatives of cAMP was shown to inhibit T 4 -induced resorption of explants in a manner similar to that of prolactin. Likewise, inhibition of phosphodiesterases also inhibited resorption. Prolactin, however, failed to alter the levels of cAMP in cultured explants of tail fin. Although cAMP antagonizes the resorptive effects of T 4 , prolactin apparently does not act by elevating cellular levels of that cyclic nucleotide. Newly synthesized proteins from explants of tail fin were examined by isotopical labeling followed by two-dimensional gel electrophoresis and fluorography. Incorporation of 35 S-methionine into four proteins was increased within 8 to 48 hours after exposure of explants to T 4 . Three of the same proteins appeared to be synthesized more rapidly in explants of fin from tadpoles at metamorphic climax than in fin from tadpoles of premetamorphic stages. These results indicate that treatment of explants with T 4 or elevation of endogenous levels of thyroid hormones during spontaneous metamorphosis increased the relative rates of synthesis of several proteins. Those proteins are potentially involved in initiating the effects of T 4 which lead to cell death and resorption of the tail
The Caenorhabditis chemoreceptor gene families
Robertson Hugh M; Thomas James H
2008-01-01
Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...
A homologous radioimmunoassay for canine prolactin: plasma levels huring the reproductive cycle
International Nuclear Information System (INIS)
Coster, R. De; Beerens, D.; Mey, J. De; Beckers, J.-F.
1983-01-01
A method is described for the purification of canine prolactin, involving preparative isoelectrofocusing. Canine prolactin has a molecular weight of 23 000 daltons, an isoelectric point of 5.7 and exhibits a high degree of homogeneity in polyacrylamide gels stained by means of a silver method. A specific, homologous radioimmunoassay is described using the Bolton-Hunter method for preparation of the labelled ligand, with a sensitivity of 0.1 ng/tube. Basal plasma prolactin levels of 2-4 ng/ml obtained through the oestrous cycle remained fairly constant but a rise of 9 ng/ml was found at the end of dioestrus in non-pregnant bitches. Level also rose 30 days after mating to reach a peak of about 50 ng/ml near parturition and during early lactation. (author)
Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family
Directory of Open Access Journals (Sweden)
Wang Bo
2015-01-01
Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Fang, Feng; Zheng, Jiamao; Galbaugh, Traci L; Fiorillo, Alyson A; Hjort, Elizabeth E; Zeng, Xianke; Clevenger, Charles V
2010-01-01
The effects of prolactin (PRL) during the pathogenesis of breast cancer are mediated in part though Stat5 activity enhanced by its interaction with its transcriptional inducer, the prolyl isomerase cyclophilin B (CypB). We have demonstrated that knockdown of CypB decreases cell growth, proliferation, and migration, and CypB expression is associated with malignant progression of breast cancer. In this study, we examined the effect of CypB knockdown on PRL signaling in breast cancer cells. CypB...
The importance of prolactin for lactation in the ewe
International Nuclear Information System (INIS)
Hooley, R.D.; Campbell, J.J.; Findlay, J.K.
1978-01-01
The effect of 2-bromo-α-ergocryptine (bromocriptine) on the induction and maintenance of milk secretion was studied in post-parturient ewes and in ovariectomized ewes artificially induced to lactate by treatment with oestrogen plus progesterone and then dexamethasone. Treatment with bromocriptine (about 0.4 mk/kg every 3 days) lowered and maintained the plasma concentration of prolactin at < 12 ng/ml. Ewes receiving bromocriptine concurrently with oestrogen plus progesterone during the priming phase had a significantly lower (P < 0.05) mean cumulative milk yield than control ewes, although the milk of the treated ewes contained normal amounts of fat, protein and lactose. Administration of bromocriptine during dexamethasone-induced lactogenesis had no significant effect on the mean cumulative milk yield but significantly (P < 0.05) increased the milk fat and protein content. In establishing lactation, bromocriptine markedly reduced the milk yield in both intact and ovariectomised ewes. The concentration of protein was not significantly affected although the milk fat content was higher in the bromocriptine-treated than in the control ewes. The effects of bromocriptine on milk yield and composition during galactopoiesis could be reversed by concurrent infusion of prolactin and the results suggest that prolactin is an important hormone during mammogenesis and galactopoiesis in sheep. (author)
International Nuclear Information System (INIS)
El-Bayoumy, A.S.A.
2012-01-01
The objective of the present work was to prepare solid phase radioimmunoassay (RIA) reagents. Development as well as optimization and validation of RIA system using solid phase magnetic particles for the measurement of prolactin (PRL) in human serum are described. The production of polyclonal antibodies was carried out by immunizing three Balb/C mice intraperitoneal through primary injection and two booster doses. Low density magnetizable cellulose iron oxide particles have been used to couple covalently to the IgG fraction of polyclonal anti-prolactin using carbonyl diimidazole activation method and applied as a solid phase separating agent for RIA of serum prolactin. Preparation of 125 I-PRL tracer was prepared using lactoperoxidase method and it was purified by gel filtration using sephadex G-100. The PRL standards were prepared using a highly purified PRL antigen with assay buffer as standard matrix. Optimization and validation of the assay were carried out. The results obtained provide a low cost, simple, sensitive, specific and accurate RIA system of prolactin based on magnetizable solid phase separation. These magnetic particles retain their characteristics during storage for 6 months at 4 degree C. In conclusion, this assay could be used as a useful diagnostic tool for pituitary dysfunction and possible reproductive disability.
Growth hormone, prolactin and cortisol response to exercise in patients with depression
DEFF Research Database (Denmark)
Krogh, Jesper; Nordentoft, Merete; Mohammad-Nezhad, Mahdi
2010-01-01
BACKGROUND: A blunted growth hormone and prolactin response to pharmacological stress test have previously been found in depressed patients, as well as an increased cortisol response to psychosocial stress. This study investigated these hormones in response to acute exercise using an incremental...... bicycle test. METHOD: A cross-sectional comparison of cortisol, growth hormone, and prolactin in depressed (n=137) and healthy (n=44) subjects during rest and in response to an incremental bicycle test. Secondly, we tested the depressed patients again after a 4-month randomized naturalistic exercise...... intervention. RESULTS: Resting plasma levels of growth hormone (GH), cortisol, or prolactin (PRL) did not differ between depressed and healthy subjects (all p-values>.12). In response to an incremental bicycle test the GH (p=.02) and cortisol (p=.05) response in depressed was different compared to healthy...
Nota, N M; Dekker, M J H J; Klaver, M; Wiepjes, C M; van Trotsenburg, M A; Heijboer, A C; den Heijer, M
2017-08-01
The cause of prolactin alterations in transgender persons is often assigned to oestrogens, but the precise cause and time course during different phases of cross-sex hormone treatment (CHT) remain unclear. In this study, we prospectively examined prolactin levels in 55 female-to-males (FtMs) and 61 male-to-females (MtFs) during the first year of CHT. Because long-term prolactin data were not available in this population, we studied these levels in a retrospective population of 25 FtMs and 38 MtFs who underwent gonadectomy. FtMs were treated with testosterone and MtFs with estradiol, with or without the anti-androgen cyproterone acetate (CPA) (after gonadectomy CPA is cessated). During the first year of CHT, prolactin decreased with 25% (95CI: -33%, -12%) in FtMs and increased with 193% (95CI: 156%, 219%) in MtFs. Eighteen MtFs developed hyperprolactinemia (≥0.6 IU L -1 ). In the retrospective population, post-gonadectomy levels in FtMs were lower than baseline levels (-39%; 95CI: -51%, -20%) while in MtFs post-gonadectomy levels and baseline levels were comparable (-6%; 95CI: -24%, 15%). No hyperprolactinemia was found after gonadectomy. In conclusion, in FtMs, prolactin decreased consistently during CHT and in MtFs, prolactin increased during pre-surgical CHT but normalised after gonadectomy. It is likely that CPA induces increasing prolactin levels in MtFs. © 2016 Blackwell Verlag GmbH.
Recurrent APC gene mutations in Polish FAP families
Directory of Open Access Journals (Sweden)
Pławski Andrzej
2007-12-01
Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.
The IQD gene family in soybean: structure, phylogeny, evolution and expression.
Directory of Open Access Journals (Sweden)
Lin Feng
Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.
Cyclical Changes in Prolactin Levels among Infertile Women ...
African Journals Online (AJOL)
Michael Horsfall
investigation of infertility while the elevation of prolactin in the 3 study groups might be responsible for the infertility observed. ... dopamine and enhanced by some other hormones. In ... also appears to have a role in the immune response,.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Hypergravity and estrogen effects on avian anterior pituitary growth hormone and prolactin levels
Fiorindo, R. P.; Negulesco, J. A.
1980-01-01
Developing female chicks with fractured right radii were maintained for 14 d at either earth gravity (1 g) or a hypergravity state (2 g). The birds at 1 g were divided into groups which received daily injections of (1) saline, (2) 200 micrograms estrone, and (3) 400 micrograms estrone for 14 d. The 2-g birds were divided into three similarly treated groups. All 2-g birds showed significantly lower body weights than did 1-g birds. Anterior pituitary (AP) glands were excised and analyzed for growth hormone and prolactin content by analytical electrophoresis. The 1-g chicks receiving either dose of daily estrogen showed increased AP growth hormone levels, whereas hypergravity alone did not affect growth hormone content. Chicks exposed to daily estrogen and hypergravity displayed reduced growth hormone levels. AP prolactin levels were slightly increased by the lower daily estrogen dose in 1-g birds, but markedly reduced in birds exposed only to hypergravity. Doubly-treated chicks displayed normal prolactin levels. Reduced growth in 2-g birds might be due, in part, to reduced AP levels of prolactin and/or growth hormone.
Schmid, Baptiste; Chastel, Olivier; Jenni, Lukas
2011-10-01
Prolactin plays an important role in mediating parental care in birds, but little is known about changes in prolactin levels when animals disrupt their reproductive behaviour during emergency life-history stages. We investigated the variation of prolactin levels with breeding stage, sex, body condition and as a response to a standardized acute stressor in a small short-lived bird, the Eurasian hoopoe Upupa epops under natural field conditions. We found higher baseline levels of prolactin in females during the brooding phase than in their mates which feed them and their chicks at this stage. Moreover, this is the first report of a differential prolactin stress-response between sexes with contrasting parental care within a breeding phase. Capture, handling and restraint induced a clear decrease of prolactin levels which was less pronounced in females at the very early stage of brooding compared to females in later stages. In contrast, the prolactin stress response in males remained nearly constant over the breeding stages and was stronger than in females. Baseline levels of prolactin, but not handling-induced levels, were positively correlated with body condition. We found a weak relationship between the decrease in prolactin due to acute handling stress and handling-induced levels of corticosterone. Taken together, both baseline and stress response levels of prolactin were related to the amount of parental care, although we found no relationship with reproductive success. It appears that the response to an acute stressor in prolactin levels is finely tuned to parental duties and investment. Hence, prolactin appears to be involved in mediating the trade-off between current reproduction versus self-maintenance and future reproduction. Copyright © 2011 Elsevier Inc. All rights reserved.
Brody, Stuart; Krüger, Tillmann H C
2006-03-01
Research indicates that prolactin increases following orgasm are involved in a feedback loop that serves to decrease arousal through inhibitory central dopaminergic and probably peripheral processes. The magnitude of post-orgasmic prolactin increase is thus a neurohormonal index of sexual satiety. Using data from three studies of men and women engaging in masturbation or penile-vaginal intercourse to orgasm in the laboratory, we report that for both sexes (adjusted for prolactin changes in a non-sexual control condition), the magnitude of prolactin increase following intercourse is 400% greater than that following masturbation. The results are interpreted as an indication of intercourse being more physiologically satisfying than masturbation, and discussed in light of prior research reporting greater physiological and psychological benefits associated with coitus than with any other sexual activities.
Effects of melatonin and prolactin in reproduction: review of literature.
Tenorio, Fernanda das Chagas Angelo Mendes; Simões, Manuel de Jesus; Teixeira, Valéria Wanderley; Teixeira, Álvaro Aguiar Coelho
2015-01-01
The pineal gland is responsible for producing a hormone called melatonin (MEL), and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL) also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a critical point of pregnancy, since a successful pregnancy requires the development of a synchronous interaction between the endometrium and blastocyst for placental development. It is also known that PRL levels during pregnancy are essential for the maintenance of pregnancy, because this hormone induces the corpus luteum to produce progesterone, in addition to stimulating blastocyst implantation to maintain pregnancy and form the placenta. However, melatonin levels in plasma have also been shown to increase during pregnancy, peaking at the end of this period, which suggests that this hormone plays an important role in the maintenance of pregnancy. Thus, it is clear that treatment with prolactin or melatonin interferes with the processes responsible for the development and maintenance of pregnancy.
Effects of melatonin and prolactin in reproduction: review of literature
Directory of Open Access Journals (Sweden)
Fernanda das Chagas Angelo Mendes Tenorio
2015-06-01
Full Text Available Summary The pineal gland is responsible for producing a hormone called melatonin (MEL, and is accepted as the gland that regulates reproduction in mammals. Prolactin (PRL also exhibits reproductive activity in animals in response to photoperiod. It is known that the concentrations of PRL are high in the summer and reduced during winter, the opposite of what is seen with melatonin in these seasons. In placental mammals, both prolactin and melatonin affect implantation, which is considered a critical point of pregnancy, since a successful pregnancy requires the development of a synchronous interaction between the endometrium and blastocyst for placental development. It is also known that PRL levels during pregnancy are essential for the maintenance of pregnancy, because this hormone induces the corpus luteum to produce progesterone, in addition to stimulating blastocyst implantation to maintain pregnancy and form the placenta. However, melatonin levels in plasma have also been shown to increase during pregnancy, peaking at the end of this period, which suggests that this hormone plays an important role in the maintenance of pregnancy. Thus, it is clear that treatment with prolactin or melatonin interferes with the processes responsible for the development and maintenance of pregnancy.
Metabolic and stress-related roles of prolactin-releasing peptide.
Onaka, Tatsushi; Takayanagi, Yuki; Leng, Gareth
2010-05-01
In the modern world, improvements in human health can be offset by unhealthy lifestyle factors, including the deleterious consequences of stress and obesity. For energy homeostasis, humoral factors and neural afferents from the gastrointestinal tract, in combination with long-term nutritional signals, communicate information to the brain to regulate energy intake and expenditure. Energy homeostasis and stress interact with each other, and stress affects both food intake and energy expenditure. Prolactin-releasing peptide, synthesized in discrete neuronal populations in the hypothalamus and brainstem, plays an important role in integrating these responses. This review describes how prolactin-releasing peptide neurons receive information concerning both internal metabolic states and environmental conditions, and play a key role in energy homeostasis and stress responses. 2010 Elsevier Ltd. All rights reserved.
Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?
Directory of Open Access Journals (Sweden)
Philipp H. Schiffer
2016-08-01
Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.
Lajevardi, Vahideh; Hallaji, Zahra; Daneshpazhooh, Maryam; Ghandi, Narges; Shekari, Peyman; Khani, Sepideh
2016-06-01
Prolactin is a hormone; in addition to it known roles, it has immunomodulatory effects on lymphocytes maturation and immunoglobulins production. Hyperprolactinemia has been demonstrated in various autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, type I diabetes mellitus, and Graves' disease. In view of the prolactin immunomodulatory roles, studying prolactin levels in pemphigus as an autoimmune blistering disease may introduce new ways of understanding disease etiology and developing treatment strategies. Our purpose was to determine the prolactin levels in patients with newly diagnosed pemphigus vulgaris and study its correlation with pemphigus disease area index. Our study was limited by the lack of a control group. In this cross-sectional study, prolactin and anti-desmoglein 1 and 3 autoantibodies levels were measured in 50 patients with newly diagnosed pemphigus vulgaris in Razi Dermatology Hospital. Pemphigus severity and extent was estimated using the Pemphigus Disease Area Index. Of the 50 patients, 18 were male and 32 were female with a mean age of 41.56 ± 13.66 years. Mean prolactin (PRL) level was 15.60 ± 11.72 ng/ml (10.68 in males and 18.37 in females). Mean anti-desmoglein 1 and 3 autoantibodies were 135.8 ± 119.8 and 245.8 ± 157.4 U/ml, respectively. Eleven out of 50 patients had a higher than normal prolactin range. No relation was found between prolactin level and disease activity ( p = .982). Also, correlation studies show no relation between prolactin and anti-desmoglein 1 and 3 autoantibodies levels (respectively, p = .771 and .738). In comparing the extent of the disease between the two groups with normal and high prolactin, paired t-test showed no significance ( p = .204). In our study, 22% of patients had hyperprolactinemia, which was greater among females. The highest PRL level was detected in mucocutaneous group. Although serum PRL levels were higher in patients with a greater Pemphigus Disease Area Index
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Repeat-associated plasticity in the Helicobacter pylori RD gene family.
Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J
2009-11-01
The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.
Energy Technology Data Exchange (ETDEWEB)
McKeown, B.A. (Simon Fraser Univ., Burnaby, BC); Peter, R.E.
1976-11-01
A number of experiments were conducted to investigate the effects of photoperiod and temperature on prolactin release from the goldfish pituitary gland. Fish were acclimated to different photoperiods and temperatures, and also were subjected to a change in either of these two parameters after different acclimation conditions. Serum and pituitary samples were collected and analyzed by radioimmunoassay for prolactin levels. In other experiments samples for prolactin analysis were taken every 3 h intermittently over a period of 3 days from fish that were acclimated to different photoperiod and temperature conditions. Longer photoperiods and higher temperatures caused pituitary prolactin release. Serum prolactin changed on a circadian rhythm and the rhythm was modified depending on the length of the photoperiod.
International Nuclear Information System (INIS)
Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.
1987-01-01
The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged
The SPINK gene family and celiac disease susceptibility
Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.
2007-01-01
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
The SPINK gene family and celiac disease susceptibility
Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca
The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was
International Nuclear Information System (INIS)
Camoratto, A.M.
1988-01-01
The role of two lipids, arachidonic acid and 1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine, as modulators or prolactin secretion has been examined. Stimulators of phospholipase A 2 activity, melittin and mastoparan, were found to increase prolactin release. Melittin also caused release of previously incorporated 3 H-arachidonic acid and this effect was associated with loss of radiolabel from the phospholipid fraction. Exogenous arachidonic acid also stimulated prolactin secretion. Conversely, inhibitors of phospholipase A 2 activity, dibromoacetophenone and U10029A, decreased basal and stimulated prolactin release. Prolactin release could also be lowered by ETYA, BW755C and NDGA, inhibitors of arachidonic acid metabolism. In the second series of experiments the effects of the biologically active phospholipid 1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine (platelet activating factor, PAF) on prolactin release were examined. PAF is an ether-linked phospholipid known to stimulate granule release in a variety of cell types including both inflammatory and noninflammatory cells. PAF increased release of prolactin from dispersed rat anterior pituitary cells; stimulation was not due to cell lysis. PAF-induced prolactin release could be blocked by the dopaminergic agonists apomorphine and bromocriptine as well as by two PAF receptor antagonists, SRI 63-072 and L-652-731
Park, Young-Min
2017-01-01
Objective It is unclear whether selective serotonin-reuptake inhibitors (SSRIs) can significantly increase the prolactin level. The purpose of this study was to identify the relationship between the prolactin level and the administration of SSRIs such as escitalopram and sertraline. An additional purpose was to determine whether the elevation of prolactin differs between escitalopram and sertraline treatment. Methods Serum prolactin levels were measured at baseline and after 3 months in 23 pa...
Effect of Sulpirid on blood serum prolactin- and TSH-levels
International Nuclear Information System (INIS)
Foldes, J.; Gyertyanfi, G.; Borvendeg, J.
1979-01-01
Euthyreoid and hyperthyreoid women were subjected to examinations investigating the effect of a dopamine-antagonist (Sulpirid) on serum TSH and prolactin (LTH)-levels. For measurements of serum concentrations the following kits were used: prolactine: CIS; TSH: Ria-mat-TSH (Byk-Mallinkrodt); thyroxine: Tiopac T 4 (Amersham); triiodothyronine: Ria-mat-T 3 (Byk-Mallinkrodt). Sulpirid increased both the LTH and the TSH-levels. In case of hyperthyreosis the effect of Sulpirid on LTH-levels was less pronounced and it had no effect on serum-TSH at all. Pre-treatment with a dopamine-agonist (Bromocryptin) impeded the effect of Sulpirid. It is concluded that dopamine-receptors do have a role in the regulation of TSH-secretion in the hypophysis. (L.E.)
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Salais-López, Hugo; Lanuza, Enrique; Agustín-Pavón, Carmen; Martínez-García, Fernando
2017-03-01
Prolactin is fundamental for the expression of maternal behaviour. In virgin female rats, prolactin administered upon steroid hormone priming accelerates the onset of maternal care. By contrast, the role of prolactin in mice maternal behaviour remains unclear. This study aims at characterizing central prolactin activity patterns in female mice and their variation through pregnancy and lactation. This was revealed by immunoreactivity of phosphorylated (active) signal transducer and activator of transcription 5 (pSTAT5-ir), a key molecule in the signalling cascade of prolactin receptors. We also evaluated non-hypophyseal lactogenic activity during pregnancy by administering bromocriptine, which suppresses hypophyseal prolactin release. Late-pregnant and lactating females showed significantly increased pSTAT5-ir resulting in a widespread pattern of immunostaining with minor variations between pregnant and lactating animals, which comprises nuclei of the sociosexual and maternal brain, including telencephalic (septum, nucleus of the stria terminalis, and amygdala), hypothalamic (preoptic, paraventricular, supraoptic, and ventromedial), and midbrain (periaqueductal grey) regions. During late pregnancy, this pattern was not affected by the administration of bromocriptine, suggesting it to be elicited mostly by non-hypophyseal lactogenic agents, likely placental lactogens. Virgin females displayed, instead, a variable pattern of pSTAT5-ir restricted to a subset of the brain nuclei labelled in pregnant and lactating mice. A hormonal substitution experiment confirmed that estradiol and progesterone contribute to the variability found in virgin females. Our results reflect how the shaping of the maternal brain takes place prior to parturition and suggest that lactogenic agents are important candidates in the development of maternal behaviours already during pregnancy.
Prolactin deficiency, obesity, and enlarged testes--a new syndrome?
Roitman, A; Assa, S; Kauli, R; Laron, Z
1980-01-01
A 4-year-old boy is described who was obese and slightly mentally retarded. His testes were enlarged. The only endocrine disorder present was a failure to increase plasma prolactin after stimulation. Images Figure PMID:7436524
Molecular evolution of the major chemosensory gene families in insects.
Sánchez-Gracia, A; Vieira, F G; Rozas, J
2009-09-01
Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.
Role of Mammary Prolactin in Carcinogenesis
1998-10-01
lactating rats (167) and dairy kines tested, IL-4 was the most potent inhibitor of myome- cows (174) by bromocriptine did not lower immunoreactive trial...of prolactin in dairy cows during lactogenesis. J Dairy 151. Chapitis J, Riddick DH, Betz LM, Brumsted JR, Gibson M, Prior Sci 70:2241-2253 JC, Gout...factors, insulin (30) and EGF (31) stim- ing the presence of functional postreceptor signaling mech- ulate, whereas transforming growth factor-P
The nitrate transporter (NRT gene family in poplar.
Directory of Open Access Journals (Sweden)
Hua Bai
Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.
Growth hormone and prolactin radioimmunoassay in early diagnosis of pituitary tumors
International Nuclear Information System (INIS)
Gembicki, M.; Kosowicz, J.
1978-01-01
Results of prolactin and HGH determination in basal conditions and following stimulation tests in the group of 68 patients with pituitary or suprasellar tumors are presented. In acromegaly elevated level of HGH in fasting state, lack of supression after glucose loading and parodoxical drop of HGH after L-dopa administration were observed. In pituitary tumors without acromegaly determinations of HGH during insulin induced hypoglycemia revealed lack of HGH response to such stimulation in 25 cases which indicated hypopituitarism. In 10 cases elevated prolactin levels (48 - 1000 ng/ml) were observed, this indicates that some of so-called inactive tumors are in fact hormonally active. (author)
Prolactin, cortisol and thyroxine levels and the premature infant
African Journals Online (AJOL)
1983-04-16
Apr 16, 1983 ... and the premature infant ... values in cord and maternal plasma to fetal age and weight and to the incidence of hyaline membrane disease (HMD) was .... thyroxine and prolactin values with an increase in weight has also.
Energy Technology Data Exchange (ETDEWEB)
Caso, R [Centro de Isotopos, La Habana (Cuba); Arranz, C [Instituto Nacional de Endocrinologia, La Habana (Cuba)
1996-07-01
In this work was studied the possibility of using the Prolactin hormone as raw material to produce Kits-RIA of Prolactin. Was used the prolactin, which is obtained in Cuba by the Pharmaceutical Institute Mario Munoz. Was made the labbeling of Prolactin with I-125, was used the hormone as standard and were done the probes of quality control. The Prolactin Hormone had the necesary quality to produce Kits-RIA-Prolactin.
Directory of Open Access Journals (Sweden)
Parker Nadeene
2004-01-01
Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of
Prolactin induces adrenal hypertrophy
Directory of Open Access Journals (Sweden)
E.J. Silva
2004-02-01
Full Text Available Although adrenocorticotropic hormone is generally considered to play a major role in the regulation of adrenal glucocorticoid secretion, several reports have suggested that other pituitary hormones (e.g., prolactin also play a significant role in the regulation of adrenal function. The aim of the present study was to measure the adrenocortical cell area and to determine the effects of the transition from the prepubertal to the postpubertal period on the hyperprolactinemic state induced by domperidone (4.0 mg kg-1 day-1, sc. In hyperprolactinemic adult and young rats, the adrenals were heavier, as determined at necropsy, than in the respective controls: adults (30 days: 0.16 ± 0.008 and 0.11 ± 0.007; 46 days: 0.17 ± 0.006 and 0.12 ± 0.008, and 61 days: 0.17 ± 0.008 and 0.10 ± 0.004 mg for treated and control animals, respectively; P < 0.05, and young rats (30 days: 0.19 ± 0.003 and 0.16 ± 0.007, and 60 days: 0.16 ± 0.006 and 0.13 ± 0.009 mg; P < 0.05. We selected randomly a circular area in which we counted the nuclei of adrenocortical cells. The area of zona fasciculata cells was increased in hyperprolactinemic adult and young rats compared to controls: adults: (61 days: 524.90 ± 47.85 and 244.84 ± 9.03 µm² for treated and control animals, respectively; P < 0.05, and young rats: (15 days: 462.30 ± 16.24 and 414.28 ± 18.19; 60 days: 640.51 ± 12.91 and 480.24 ± 22.79 µm²; P < 0.05. Based on these data we conclude that the increase in adrenal weight observed in the hyperprolactinemic animals may be due to prolactin-induced adrenocortical cell hypertrophy.
Directory of Open Access Journals (Sweden)
Telleria Carlos M
2005-08-01
Full Text Available Abstract Background In pregnant rats, structural luteal regression takes place after parturition and is associated with cell death by apoptosis. We have recently shown that the hormonal environment is responsible for the fate of the corpora lutea (CL. Changing the levels of circulating hormones in post-partum rats, either by injecting androgen, progesterone, or by allowing dams to suckle, was coupled with a delay in the onset of apoptosis in the CL. The objectives of the present investigation were: i to examine the effect of exogenous estradiol on apoptosis of the rat CL during post-partum luteal regression; and ii to evaluate the post-partum luteal expression of the estrogen receptor (ER genes. Methods In a first experiment, rats after parturition were separated from their pups and injected daily with vehicle or estradiol benzoate for 4 days. On day 4 post-partum, animals were sacrificed, blood samples were taken to determine serum concentrations of hormones, and the ovaries were isolated to study apoptosis in situ. In a second experiment, non-lactating rats after parturition received vehicle, estradiol benzoate or estradiol benzoate plus bromoergocryptine for 4 days, and their CL were isolated and used to study apoptosis ex vivo. In a third experiment, we obtained CL from rats on day 15 of pregnancy and from non-lactating rats on day 4 post-partum, and studied the expression of the messenger RNAs (mRNAs encoding the ERalpha and ERbeta genes. Results Exogenous administration of estradiol benzoate induced an increase in the number of apoptotic cells within the CL on day 4 post-partum when compared with animals receiving vehicle alone. Animals treated with the estrogen had higher serum prolactin and progesterone concentrations, with no changes in serum androstenedione. Administration of bromoergocryptine blocked the increase in serum prolactin and progesterone concentrations, and DNA fragmentation induced by the estrogen treatment. ERalpha and
Lacau-Mengido, I M; Libertun, C; Becú-Villalobos, D
1996-05-01
Serotonin (5-HT) receptors can be classified into at least three, possibly up to seven, classes of receptors. They comprise the 5-HT1, 5-HT2, and 5-HT3 classes, the "uncloned' 5-HT4 receptor and the recombinant receptors 5-ht5, 5-ht6 and 5-ht7. We investigated the role of different serotonin receptor types in a neuroendocrine response to the activation of the serotonergic system. Female immature rats were chosen as an experimental model as it has been shown that during the 3rd week of life, and not at later developmental stages, 5-hydroxytryptophan (5-HTP, a serotonin precursor) induces gonadotropin release in females and not in males. Besides, at this age, serotonin releases prolactin in both sexes. 5-HTP (50 mg/kg) released prolactin, luteinizing hormone (LH) and follicle-stimulating hormone (FSH) as expected. Ketanserin (5-HT2A antagonist) and methysergide (5-HT2C antagonist) blocked 5-HTP-induced prolactin release, but did not block the LH or FSH responses. Ondansetron (5-HT3 receptor antagonist) did not modify prolactin response to 5-HTP, whereas it blocked 5-HTP-induced LH and FSH release. Propranolol (5-HT1 and beta-adrenergic antagonist) blocked prolactin, LH and FSH release induced by 5-HTP. The 5-HT2C agonist 1-(3-chlorophenyl)piperazine dihydrochloride released prolactin, without modifying LH or FSH release. Methyl-quipazine and phenylbiguanide (5-HT3 agonists) increased both LH and FSH levels, without altering prolactin secretion. The present experiments indicate that serotonin acting at the 5-HT3 receptor mediates LH and FSH release in infantile female rats, whereas 5-HT2C or 2A receptor types participate in the release of prolactin at this age. 5-HT1 receptor type may be involved in the release of the three hormones, though a beta-adrenergic component of the response cannot be discarded.
Dawson, A; Perrins, C M; Sharp, P J; Wheeler, D; Groves, S
2009-04-01
The aim of the study was to test the hypothesis that decreasing plasma prolactin stimulates or permits the initiation of avian molt. Changes in the concentration of plasma prolactin in Mute swans (Cygnus olor) were compared in non-breeding singletons and breeding pairs. In breeding swans, the onset of molt is delayed compared to non-breeders, and is delayed further in breeding males compared to their female partners. The seasonal decrease in prolactin in non-breeding birds of both sexes started at the end of May and was associated with the initiation of molt 4 weeks later. The decrease in plasma prolactin in incubating females was more pronounced, as a consequence of increased prolactin secretion associated with incubation behavior, but also started at end of May, and was associated the onset of molt 6 weeks later. In breeding males, plasma prolactin increased at the end of May when they started to care for their newly hatched cygnets. Correspondingly, prolactin began to decrease 3-5 weeks later in males than in females. These males started to molt in mid August, at least 4 weeks later than females. It is concluded that molt is related to decreasing plasma prolactin, and is inhibited when plasma prolactin is increasing or high.
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.
Directory of Open Access Journals (Sweden)
Vanessa Rodrigues Paixão-Côrtes
Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
Prolactin, thyrotropin, and growth hormone release during stress associated with parachute jumping.
Noel, G L; Dimond, R C; Earll, J M; Frantz, A G
1976-05-01
Prolactin, growth hormone, and thyrotropin (TSH) release during the stress of parachute jumping has been evaluated in 14 male subjects. Subjects were studied at several times before and immediately after their first military parachute jump. All three hormones had risen significantly 1 to 14 min after the jump, compared to mean levels measured immediately beforehand. Earlier studies of physical exercise by ourselves and others would suggest that emotional stress played a role in producing changes of this magnitude. We conclude that prolactin, TSH, and growth hormone are released in physiologically significant amounts in association with the stress of parachute jumping.
Identification of a novel Gig2 gene family specific to non-amniote vertebrates.
Directory of Open Access Journals (Sweden)
Yi-Bing Zhang
Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.
Local production of donkey anti-rabbit's sera for human prolactin radioimmunoassay
International Nuclear Information System (INIS)
Hassan, Ammar Mohamed Elamin
2001-11-01
Pure Rabbit's IgG was used in this study to raise donkey anti rabbit's sera to be used as separating agent in radioimmunoassay. Two healthy donkeys have been immunized. The anti rabbit's sera have been titrated as (i) crude, (ii) purified and dialysed coupled to magnetic particles. Then this antibody was used as separating agent in a radioimmunoassay for measurement of human prolactin (PRL). Coupled Sudanese donkey and rabbit's sera (Sud-DARS) was used as 1/8 titre using chelsea RIA kit for human prolactin while 1/200 of liquid Sud-DARS was found to be the best titre using the Chinese kit. The best condition for estimation of the prolactin were optimized by determining the suitable incubation time and temperature. The assay can be done at room temperature but it should be incubated for 6 hours as recommended by the Chinese kit. Validity tests were done. The regression coefficients were 0.994 and 0.999 for linearity and recovery tests respectively. Measurement of human PRL wa found to be reproducible using Sud-DARS as separating agent since the coefficient of variation (C.V. %) was found to be less than 15% for both within batch and between assays. Comparing Sud D ARS to the Chinese kit, separating agent as reference agent, regression coefficient was found to be 0.977 which indicate that Sud-DARS can be used as separating agent. Prolactin in Sudanese subject was determined using the Chinese kit the Sud-DARS as separating agent. The ranges were 74-398 mIU/L in males and 102-414 mI/L in the preovulatory phase for the females while in the post ovulatory phase it was 114-442 mIU/L. Ovulation was confirmed by measurement of progesterone level 7 days before the next suspected mensuration. (Author)
Reburn, C J; Wynne-Edwards, K E
2000-04-01
Validation of a method for obtaining blood samples that does not change cortisol or prolactin concentrations yet allows serial blood samples to be collected from animals under anesthesia, without prior handling, from freely interacting social groups of small mammals. Results from five experiments are reported. Male dwarf hamsters (Phodopus spp.) were housed in modified home cages under continuous flow of compressed air that could be switched to isoflurane in O2 vehicle without approaching the cages. Dwarf hamsters respond to manual restraint with behavioral distress and increase in the concentration of the dominant glucocorticoid, cortisol, and decrease in prolactin concentration. Both effects are evident within one minute. In contrast, when this new method was used, neither cortisol nor prolactin changed in response to repeated sample collection (up to 8 successive samples at 2 hour intervals), prolonged isoflurane exposure, or substantial blood volume reduction (30%). Prolactin concentration was suppressed and cortisol concentration was increased in response to stimuli from other hamsters tested without anesthesia. Suppression of prolactin concentration was graded in response to the degree of stress and equaled the pharmacologic reduction caused by bromocryptine mesylate (50 microg of CB154 x 3 days). The technique is superior to alternatives for studies of behavioral endocrinology of freely interacting small mammals.
Early evolution of the LIM homeobox gene family
Energy Technology Data Exchange (ETDEWEB)
Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S
2010-01-01
LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural
Early evolution of the LIM homeobox gene family
Directory of Open Access Journals (Sweden)
Degnan Bernard M
2010-01-01
Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In
TreeFam: a curated database of phylogenetic trees of animal gene families
DEFF Research Database (Denmark)
Li, Heng; Coghlan, Avril; Ruan, Jue
2006-01-01
TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...
Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.
Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson
2011-02-01
This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families. A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included. A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta. Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.
Urea, Uric Acid, Prolactin and fT4 Concentrations in Aqueous Humor of Keratoconus Patients.
Stachon, Tanja; Stachon, Axel; Hartmann, Ulrike; Seitz, Berthold; Langenbucher, Achim; Szentmáry, Nóra
2017-06-01
Keratoconus is a noninflammatory disease of the cornea associated with progressive thinning and conical shape. Metabolic alterations in the urea cycle, with changes in collagen fibril stability, oxidative stress, thyroid hormones and prolactin with regulatory effect on biosynthesis and biomechanical stability of corneal stroma, may all play a role in keratoconus etiology. Our purpose was to determine urea, uric acid, prolactin and free thyroxin (fT4) concentrations in human aqueous humor (hAH) of keratoconus and cataract patients. hAH was collected from 100 keratoconus (penetrating keratoplasty) (41.9 ± 14.9 years, 69 males) and 100 cataract patients (cataract surgery) (71.2 ± 12.4 years, 58 males). Urea, uric acid, prolactin and fT4 concentrations were measured by Siemens clinical chemistry or immunoassay system. For statistical analysis, a generalized linear model (GLM) was used. Urea concentration was 11.88 ± 3.03 mg/dl in keratoconus and 16.44 ± 6.40 mg/dl in cataract patients, uric acid 2.04 ± 0.59 mg/dl in keratoconus and 2.18 ± 0.73 mg/dl in cataract groups. Prolactin concentration was 3.18 ± 0.34 ng/ml in keratoconus and 3.33 ± 0.32 ng/ml in cataract patients, fT4 20.57 ± 4.76 pmol/l in KC and 19.06 ± 3.86 pmol/l in cataract group. Urea concentration was effected through gender (p = 0.039), age (p = 0.001) and diagnosis (p = 0.025). Uric acid concentration was not effected through any of the analyzed parameters (p > 0.056). Prolactin and fT4 concentration were effected only through diagnosis (p = 0.009 and p = 0.006). Urea and prolactin concentrations are decreased, fT4 concentration is increased in aqueous humor of keratoconus patients, and uric acid concentration remains unchanged. Urea concentration in aqueous humor is also increased in older and male patients. Therefore, metabolic disorder and hormonal balance may both have an impact on keratoconus development. Further studies are necessary to assess the specific impact.
Montalvo, Itziar; Gutiérrez-Zotes, Alfonso; Creus, Marta; Monseny, Rosa; Ortega, Laura; Franch, Joan; Lawrie, Stephen M.; Reynolds, Rebecca M.; Vilella, Elisabet; Labad, Javier
2014-01-01
Hyperprolactinaemia, a common side effect of some antipsychotic drugs, is also present in drug-naïve psychotic patients and subjects at risk for psychosis. Recent studies in non-psychiatric populations suggest that increased prolactin may have negative effects on cognition. The aim of our study was to explore whether high plasma prolactin levels are associated with poorer cognitive functioning in subjects with early psychoses. We studied 107 participants: 29 healthy subjects and 78 subjects w...
Directory of Open Access Journals (Sweden)
Chakrapani Balijepalli
2018-01-01
Full Text Available Background. Treatment of schizophrenia with first- and second-generation antipsychotics has been associated with elevated prolactin levels, which may increase the risk for prolactin-related adverse events. Methods. Randomized controlled trials (RCTs included in a recent systematic review were considered for this analysis. A Bayesian network meta-analysis was used to compare changes in prolactin levels in pediatric patients diagnosed with schizophrenia or schizophrenia spectrum disorders treated with second-generation antipsychotics (SGAs. Results. Five RCTs, including 989 patients combined, have evaluated the changes in prolactin for pediatric patients after 6 weeks of treatment with risperidone, quetiapine, aripiprazole, olanzapine, and paliperidone. In the overall study population, treatment with risperidone was associated with the highest increase in mean prolactin levels compared to other SGAs. Patients treated with risperidone 4–6 mg/day were found to experience the greatest increases (55.06 ng/ml [95% CrI: 40.53–69.58] in prolactin levels, followed by risperidone 1–3 mg/day, paliperidone 3–6 mg/day, and paliperidone 6–12 mg/day. Conclusions. This study shows that there are differences in SGAs ability to cause hyperprolactinemia. Further, there is clear evidence of safety concerns with risperidone and paliperidone treatment in adolescent schizophrenia patients. Registration. PROSPERO CRD42014009506.
International Nuclear Information System (INIS)
Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.
1988-01-01
Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)
Prolactin-secreting pituitary adenoma in a man with gigantism: a case report.
Peillon, F; Philippon, J; Brandi, A M; Fohanno, D; Laplane, D; Dubois, M P; Decourt, J
1979-12-01
A prolactin-secreting pituitary adenoma was removed trans-sphenoidally from a 37 years old man with gigantism (218 cm). Serum levels of prolactin (PRL) were elevated pre-operatively and decreased after administration of L-Dopa with no increase after TRH as is usually observed in PRL-secreting adenomas. Growth hormone (GH) and somatomedin serum levels were normal with no modification of GH after insulin hypoglycemia, oral glucose loading or L-Dopa. Morphological examination of the tumour demonstrated the presence of lactotrophs by light and electron microscopy and by immunofluorescense staining. No somatotrophs were found. In this unique case, the relationship between a PRL-secreting adenoma and gigantism is discussed.
Suppressed serum prolactin in sinoaortic-denervated rats
International Nuclear Information System (INIS)
Alexander, N.; Melmed, S.; Morris, M.
1987-01-01
The authors investigated the effect of arterial baroreceptor deafferentation on serum and pituitary prolactin (PRL) and on catecholamines in median eminence (ME) and anterior and posterior pituitaries. Male Wistar rats were sinoaortic denervated (SAD) or sham operated (SO). Three days after surgery serum prolactin, measured by radioimmunoassay, was suppressed in SAD rats, and dopamine (DA) and norepinephrine (NE) concentrations, measured by radioenzymatic or high-performance liquid chromatography electron capture methods, were significantly reduced in ME of SAD rats. Simultaneously, anterior pituitary of SAD rats had significant increases in both catecholamines, whereas posterior pituitary showed no changes. Four hours after surgery serum PRL was also reduced in SAD rats, but no changes in ME catecholamines were found. Mean arterial pressure (MAP) and heart rate were measured before and after injection of bromocriptine in SAD and SO rats 3 days after surgery. Bromocriptine markedly suppressed serum PRL in both groups and reduced MAP from 144 +/- 10 to 84 +/- 5 and from 116 +/- 2 to 99 +/- 3 in SAD and SO rats, respectively; heart rate was reduced in SAD rats. They conclude that the SAD rat is a model of hypertension with suppressed serum PRL and that interruption of arterial baroreceptor nerves suppresses PRL secretion probably by modulating tuberoinfundibular turnover of catecholamines
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Roke, Yvette; van Harten, Peter N.; Boot, Annemieke M.; Buitelaar, Jan K.
Objective: This review reports the incidence of hyperprolactinemia, its relationship with genotype, and prolactin-related side effects in children and adolescents treated with antipsychotics. Method: Data on prolactin levels were available for haloperidol, pimozide, risperidone, olanzapine,
Roke, Y.; Harten, P.N. van; Boot, A.M.; Buitelaar, J.K.
2009-01-01
OBJECTIVE: This review reports the incidence of hyperprolactinemia, its relationship with genotype, and prolactin-related side effects in children and adolescents treated with antipsychotics. METHOD: Data on prolactin levels were available for haloperidol, pimozide, risperidone, olanzapine,
Prolactin-releasing peptide: a new tool for obesity treatment
Czech Academy of Sciences Publication Activity Database
Kuneš, Jaroslav; Pražienková, V.; Popelová, A.; Mikulášková, Barbora; Zemenová, J.; Maletínská, L.
2016-01-01
Roč. 230, č. 2 (2016), R51-R58 ISSN 0022-0795 R&D Projects: GA ČR(CZ) GA15-08679S Institutional support: RVO:67985823 Keywords : prolactin-releasing peptide * lipidization * obesity * GPR10 * anorexigenic * mice Subject RIV: ED - Physiology Impact factor: 4.706, year: 2016
Inhibition of growth hormone and prolactin secretion by a serine proteinase inhibitor
International Nuclear Information System (INIS)
Rappay, G.; Nagy, I.; Makara, G.B.; Horvath, G.; Karteszi, M.; Bacsy, E.; Stark, E.
1984-01-01
The action of the tripeptide aldehyde t-butyloxycarbonyl-DPhe-Pro-Arg-H (boc-fPR-H), belonging to a family of serine proteinase inhibitors, on the release of immunoreactive prolactin (iPRL) and growth hormone (iGH) has been studied. In rat anterior pituitary cell cultures and pituitary quarters 1 mM boc-fPR-H inhibited basal iPRL and iGH release. Thyroliberin-induced iPRL release by cultured cells was also markedly inhibited with a concomitant accumulation of intracellular iPRL. During the short- and long-term exposure of cells to boc-fPR-H there were no changes in total cell protein contents and in activities of some lysosomal marker enzymes. The marked inhibition of basal as well as stimulated hormone release in the presence of the enzyme inhibitor might suggest that at least a portion of the hormones is released via a proteolytic enzyme-dependent process
Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families
Directory of Open Access Journals (Sweden)
Besic Nikola
2008-09-01
Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of
Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families
Energy Technology Data Exchange (ETDEWEB)
Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others
1994-09-01
Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.
The human protein disulfide isomerase gene family
Directory of Open Access Journals (Sweden)
Galligan James J
2012-07-01
Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.
Arnold, Edith; Thebault, Stéphanie; Baeza-Cruz, German; Arredondo Zamarripa, David; Adán, Norma; Quintanar-Stéphano, Andrés; Condés-Lara, Miguel; Rojas-Piloni, Gerardo; Binart, Nadine; Martínez de la Escalera, Gonzalo; Clapp, Carmen
2014-01-29
Retinal degeneration is characterized by the progressive destruction of retinal cells, causing the deterioration and eventual loss of vision. We explored whether the hormone prolactin provides trophic support to retinal cells, thus protecting the retina from degenerative pressure. Inducing hyperprolactinemia limited photoreceptor apoptosis, gliosis, and changes in neurotrophin expression, and it preserved the photoresponse in the phototoxicity model of retinal degeneration, in which continuous exposure of rats to bright light leads to retinal cell death and retinal dysfunction. In this model, the expression levels of prolactin receptors in the retina were upregulated. Moreover, retinas from prolactin receptor-deficient mice exhibited photoresponsive dysfunction and gliosis that correlated with decreased levels of retinal bFGF, GDNF, and BDNF. Collectively, these data unveiled prolactin as a retinal trophic factor that may regulate glial-neuronal cell interactions and is a potential therapeutic molecule against retinal degeneration.
Prolactin-releasing peptide: a new tool for obesity treatment
Czech Academy of Sciences Publication Activity Database
Kuneš, Jaroslav; Pražienková, Veronika; Popelová, Andrea; Mikulášková, Barbora; Zemenová, Jana; Maletínská, Lenka
2016-01-01
Roč. 230, č. 2 (2016), R51-R58 ISSN 0022-0795 R&D Projects: GA ČR(CZ) GA15-08679S Institutional support: RVO:61388963 Keywords : prolactin-releasing peptide * lipidization * obesity * GPR10 * anorexigenic * mice Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 4.706, year: 2016
International Nuclear Information System (INIS)
Borski, R.J.; Helms, L.M.H.; Richman, N.H. III; Grau, E.G.
1991-01-01
During in vitro incubation, prolactin release is inhibited in a dose-related manner by cortisol. This action is mimicked by the synthetic glucocorticoid agonist dexamethasone but not by other steroids tested. Perifusion studies indicate that the inhibition of [ 3 H]prolactin release by cortisol occurs within 20 min. Cortisol (50 nM) also inhibits cAMP accumulation and reduces 45 Ca 2+ accumulation in the tilapia rostral pars distalis within 15 min. Cortisol's action on prolactin release is blocked in the presence of either the Ca 2+ ionophore A23187 or a combination of dibutyryl cAMP and 3-isobutyl-1-methylxanthine, which increase intracellular Ca 2+ and cAMP, respectively. Taken together, these findings suggest that cortisol may play a physiologically relevant role in the rapid modulation of prolactin secretion in vivo. These studies also suggest that the inhibition of prolactin release by cortisol is a specific glucocorticoid action that may be mediated, in part, through cortisol's ability to inhibit intracellular cAMP and Ca 2+ metabolism
DEFF Research Database (Denmark)
Hansen, Martin A; Nielsen, John E; Retelska, Dorota
2008-01-01
, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...
Dichotomy in the NRT gene families of dicots and grass species.
Directory of Open Access Journals (Sweden)
Darren Plett
Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.
Inokuchi, Mayu; Breves, Jason P; Moriyama, Shunsuke; Watanabe, Soichi; Kaneko, Toyoji; Lerner, Darren T; Grau, E Gordon; Seale, Andre P
2015-11-15
This study characterized the local effects of extracellular osmolality and prolactin (PRL) on branchial ionoregulatory function of a euryhaline teleost, Mozambique tilapia (Oreochromis mossambicus). First, gill filaments were dissected from freshwater (FW)-acclimated tilapia and incubated in four different osmolalities, 280, 330, 380, and 450 mosmol/kg H2O. The mRNA expression of Na(+)/K(+)-ATPase α1a (NKA α1a) and Na(+)/Cl(-) cotransporter (NCC) showed higher expression with decreasing media osmolalities, while Na(+)/K(+)/2Cl(-) cotransporter 1a (NKCC1a) and PRL receptor 2 (PRLR2) mRNA levels were upregulated by increases in media osmolality. We then incubated gill filaments in media containing ovine PRL (oPRL) and native tilapia PRLs (tPRL177 and tPRL188). oPRL and the two native tPRLs showed concentration-dependent effects on NCC, NKAα1a, and PRLR1 expression; Na(+)/H(+) exchanger 3 (NHE3) expression was increased by 24 h of incubation with tPRLs. Immunohistochemical observation showed that oPRL and both tPRLs maintained a high density of NCC- and NKA-immunoreactive ionocytes in cultured filaments. Furthermore, we found that tPRL177 and tPRL188 differentially induce expression of these ion transporters, according to incubation time. Together, these results provide evidence that ionocytes of Mozambique tilapia may function as osmoreceptors, as well as directly respond to PRL to modulate branchial ionoregulatory functions. Copyright © 2015 the American Physiological Society.
Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin
Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192
Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.
Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S
2016-10-01
Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression
Directory of Open Access Journals (Sweden)
Li Guo
2014-01-01
Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.
Novel genetic variants in miR-191 gene and familial ovarian cancer
International Nuclear Information System (INIS)
Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua
2010-01-01
Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer
Prolactin-stimulated mitogenesis in the Nb2 rat lymphoma cell: Lack of protoporphyrin IX effects
Energy Technology Data Exchange (ETDEWEB)
Gerrish, K.E.; Putnam, C.W.; Laird, H.E. II (Univ. of Arizona, Tucson (USA))
1990-01-01
Pharmacological characterization of the Nb2 cell peripheral-type benzodiazepine receptor (PBR) was determined using selected 1,4-benzodiazepines, PK 11195, and protoporphyrin IX (PPIX) to compete for specific ({sup 3}H) Ro5-4864 binding. These data suggest that PPIX possesses an affinity for the Nb2 cell PBR. We have previously reported that the peripheral benzodiazepine ligands, Ro5-4864 and PK 11195, modulate prolactin-stimulated mitogenesis in the Nb2 cell. In contrast, PPIX, a putative endogenous ligand for the PBR had no effect on prolactin-stimulated mitogenesis in the Nb2 cell over the concentration range from 10{sup {minus}15} M to 10{sup {minus}6} M. Taken together these data show that PPIX has an affinity for the Nb2 cell PBR but does not modulate prolactin-stimulated mitogenesis at concentrations which should bind to the Nb2 cell PBR.
Molecular analysis of the NDP gene in two families with Norrie disease.
Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto
2005-04-01
To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.
Simultaneous radioimmunoassay for luteinizing hormone and prolactin
International Nuclear Information System (INIS)
Steele, M.K.; Deschepper, C.F.
1985-01-01
A combined radioimmunoassay (RIA) for the measurement of the anterior pituitary proteins luteinizing hormone (LH) and prolactin (PRL) is described and compared with individual RIAs for these hormones. The standard curves and the sample values for LH and PRL were identical when determined in a combined or in an individual RIA. This technique may prove useful to a number of laboratories where it is desirable to determine levels of more than one hormone in limited sample volumes
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Polymorphism in the interferon-{alpha} gene family
Energy Technology Data Exchange (ETDEWEB)
Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)
1996-09-01
A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.
msh/Msx gene family in neural development.
Ramos, Casto; Robert, Benoît
2005-11-01
The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.
Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape
Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping
2012-01-01
Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514
Prolactin, cortisol and thyroxine levels and the premature infant ...
African Journals Online (AJOL)
The relationship of prolactin, cortisol and thyroxine values in cord and maternal plasma to fetal age and weight and to the incidence of hyaline membrane disease (HMD) was investigated in 80 neonates of whom 40 were born at more than 37 weeks' gestation. Of the 40 born at less than 36 weeks 11 developed HMD.
high doses of prolactin inhibit testosterone secretion in rat leydig cells
African Journals Online (AJOL)
Femi Olaleye
1 The effect of prolactin on dispersed rat Leydig cells was investigated. Leydig cells from adult rat testes of proven fertility were isolated via collagenase digestion and dispersion. About 100,000 Leydig .... Hormones, Drugs and Reagents.
Rustembegovic, Avdo; Sofic, Emin; Wichart, Ildiko
2006-01-01
Weight gain is a common adverse effect associated with the use of most typical and atypical antipsychotic. Aim of this study was to investigate serum prolactin, leptin, cholesterol, triglyceride, lipoproteins, such high density lipoprotein (HDL), and low density lipoprotein (LDL) levels in patients with Parkinson's disease (PD)-related psychosis during long-term medication with atypical antipsychotic. The study population comprised 40 patients, who were divided into 4 groups: olanzapine (n=10), risperidone (n=10), seroquel (n=10) monotherapy, a group of 10 patients receiving only antiparkinson drugs and a control group of 8 healthy persons. The patients were evaluated at baseline and at the sixth and twelfth week according to the Positive and Negative Syndrome Scale (PANSS), body mass index (BMI), and fasting serum prolactin, leptin, lipids and lipoproteins levels. Treatment of patients with olanzapine caused marked increase of serum LDL, cholesterol, triglyceride, and leptin levels (prelationship between serum leptin, lipid levels and BMI. However, treatment of patients with seroquel did not cause changes in serum prolactin, leptin, lipids, and lipoproteins levels. Our results suggest that treatment of patients with PD-related psychosis with seroquel appears to have minimal influence on serum leptin, prolactin, lipids, lipoproteins and BMI compared with olanzapine and risperidone.
Energy Technology Data Exchange (ETDEWEB)
Kao, P.C.; Jiang, N.S.; Abboud, C.F.
1977-09-01
A clinically useful and reproducible radioimmunoassay for human homologous prolactin, established with commercially available reagents, was studied and validated. We present detailed conditions for iodination and purification of labeled prolactin and the optimal conditions for the assay. By the method, we found values (..mu..g/liter) as follows for serum prolactin: normal men, 8.9 +- 5.2 (mean +- SD); normal women, 11.8 +- 5.5; normal women taking contraceptive pills, 9.2 +- 5.0; pregnant women in the third trimester, 188 +- 69.5; patients with various diseases other than of the hypothalamic-pituitary axis, 9.3 +- 6.3; in some patients with amenorrhea and galactorrhea of diverse origin, 78.2 +- 87.4; and in some patients with surgically proven pituitary tumor, 1414 +- 1980. Results under provocative testing are also presented for a patient with normal hypothalamic-pituitary function.
Directory of Open Access Journals (Sweden)
Forough Riahi
2016-01-01
Full Text Available Background. The present study aimed to compare plasma levels of cortisol, testosterone, dehydroepiandrosterone (DHEA, and prolactin in patients with schizophrenia and healthy individuals. Method. A total of 100 patients with schizophrenia disorder (69 men and 31 women and 190 healthy individuals (94 men and 96 women participated in this cross-sectional study. They were tested for hormone levels and completed demographic questionnaires. Data were analyzed using multivariate analysis of variance (MANOVA and one-way analysis of variance. Results. Serum testosterone level was significantly higher in men with schizophrenia than in healthy men. Women with schizophrenia had a significantly higher level of testosterone and lower level of prolactin compared to healthy women. There were no significant differences in hormone levels across various subtypes of schizophrenia. No significant differences also were observed in hormones levels in patients with first-episode schizophrenia disorder compared to those in patients with recurrent episodes. Conclusion. This study indicated that abnormal testosterone and prolactin levels might be associated with pathophysiology of schizophrenia disorder.
Karolewicz, Bozena; Pawlik-Gałczyńska, Anna; Pluta, Janusz; Ryszka, Florian
2011-01-01
The aim of this study was to prepare a thermoresponsive formulations, which are a carrier for proteins--prolactin administered directly into solid tumor and which obtain sol-gel transitions at physiological ranges of temperature. Prolactin (PRL) is a hormone that in vivo and in vitro exhibits antiangiogenic properties. Application of this protein in the proposed formulations can be particularly advantageous because of its relatively low stability and limited ability to transmembrane penetration. The paper prepared thermoresponsive carriers, based on nonionic polymer Pluronic F-127 with selected excipients such as dextran 7000, PEG 400, Tween 20 and Tween 80. The sol-gel transition temperature of the formulations was investigated and their physicochemical properties such as pH, density, osmotic pressure were studied. In the remainder of the work carried out tests of prolactin release from the proposed media. The results obtained indicate that a significant influence on the theological parameters obtained carriers and the availability of pharmaceutical composition of prolactin was developed formulation.
Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui
2016-01-01
WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.
Osmoregulatory effects of hypophysectomy and homologous prolactin replacement in hybrid striped bass
DEFF Research Database (Denmark)
Jackson, Leslie F; McCormick, Stephen D; Madsen, Steffen S
2005-01-01
The effects of ovine prolactin (oPRL) and striped bass prolactin (sbPRL; Morone saxatilis) on plasma osmolality, electrolyte balance, and gill Na+,K+-ATPase activity were investigated in hypophysectomized (Hx), freshwater (FW)-acclimated, hybrid striped bass (M. saxatilis x Morone chrysops...... or 100 ng/g), or hormone vehicle (0.9% NaCl) at 48-h intervals (days 0, 2, 4, and 6) in FW and then sampled for blood plasma 24 h after the fourth injection (day 7). In Hx fish, oPRL (5 and 20 microg/g) and sbPRL (10 and 100 ng/g) were effective in maintaining plasma osmolality and levels of Na+, Cl...... balance in FW-adapted hybrid striped bass, and that this may involve downregulation of branchial Na+,K+-ATPase activity....
Hyperprolactinemia with normal serum prolactin: Its clinical significance
Directory of Open Access Journals (Sweden)
Manika Agarwal
2010-01-01
Full Text Available Amenorrhea and infertility with an added feature of galactorrhea makes a provisional diagnosis of hyperprolactinemia. But again, normal serum prolactin with all clinical features of hyperprolactinemia might question the diagnosis and further management. The answer lies in the heterogeneity of the peptide hormone - the immunoactive and the bioactive forms. This has been further illustrated with the help of a case which had been treated with cabergoline.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Overgaard, Martin; Pedersen, Susanne Møller
2017-10-26
Hyperprolactinemia diagnosis and treatment is often compromised by the presence of biologically inactive and clinically irrelevant higher-molecular-weight complexes of prolactin, macroprolactin. The objective of this study was to evaluate the performance of two macroprolactin screening regimes across commonly used automated immunoassay platforms. Parametric total and monomeric gender-specific reference intervals were determined for six immunoassay methods using female (n=96) and male sera (n=127) from healthy donors. The reference intervals were validated using 27 hyperprolactinemic and macroprolactinemic sera, whose presence of monomeric and macroforms of prolactin were determined using gel filtration chromatography (GFC). Normative data for six prolactin assays included the range of values (2.5th-97.5th percentiles). Validation sera (hyperprolactinemic and macroprolactinemic; n=27) showed higher discordant classification [mean=2.8; 95% confidence interval (CI) 1.2-4.4] for the monomer reference interval method compared to the post-polyethylene glycol (PEG) recovery cutoff method (mean=1.8; 95% CI 0.8-2.8). The two monomer/macroprolactin discrimination methods did not differ significantly (p=0.089). Among macroprolactinemic sera evaluated by both discrimination methods, the Cobas and Architect/Kryptor prolactin assays showed the lowest and the highest number of misclassifications, respectively. Current automated immunoassays for prolactin testing require macroprolactin screening methods based on PEG precipitation in order to discriminate truly from falsely elevated serum prolactin. While the recovery cutoff and monomeric reference interval macroprolactin screening methods demonstrate similar discriminative ability, the latter method also provides the clinician with an easy interpretable monomeric prolactin concentration along with a monomeric reference interval.
Genome-wide identification of the SWEET gene family in wheat.
Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu
2018-02-05
The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sonia A Ronchetti
Full Text Available Cadmium (Cd is a heavy metal of considerable occupational and environmental concern affecting wildlife and human health. Recent studies indicate that Cd, like other heavy metals, can mimic effects of 17β-estradiol (E2 involving E2 receptor (ER activation. Lactotrophs, the most abundant cell type in anterior pituitary gland, are the main target of E2, which stimulates cell proliferation and increases prolactin secretion through ERα. The aim of this work was to examine whether Cd at nanomolar concentrations can induce cell proliferation and prolactin release in anterior pituitary cells in culture and whether these effects are mediated through ERs. Here we show that 10 nM Cd was able to stimulate lactotroph proliferation in anterior pituitary cell cultures from female Wistar rats and also in GH3 lactosomatotroph cell line. Proliferation of somatotrophs and gonadotrophs were not affected by Cd exposure. Cd promoted cell cycle progression by increasing cyclins D1, D3 and c-fos expression. Cd enhanced prolactin synthesis and secretion. Cd E2-like effects were blocked by the pure ERs antagonist ICI 182,780 supporting that Cd acts through ERs. Further, both Cd and E2 augmented full-length ERαexpression and its 46 kDa-splicing variant. In addition, when co-incubated Cd was shown to interact with E2 by inducing ERα mRNA expression which indicates an additive effect between them. This study shows for the first time that Cd at nanomolar concentration displays xenoestrogenic activities by inducing cell growth and stimulating prolactin secretion from anterior pituitary cells in an ERs-dependent manner. Cd acting as a potent xenoestrogen can play a key role in the aetiology of different pathologies of the anterior pituitary and in estrogen-responsive tissues which represent considerable risk to human health.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
Prolactin-secreting adenoma as part of the multiple endocrine neoplasia--type I (MEN-I) syndrome.
Levine, J H; Sagel, J; Rosebrock, G; Gonzalez, J J; Nair, R; Rawe, S; Powers, J M
1979-06-01
Two patients presented with the galactorrhea-amenorrhea syndrome. One patient had previously had parathyroid hyperplasia and the other an insulinoma. Preoperative evaluation of each patient revealed hyperprolactinemia and radiological evidence of an abnormal sella turcica. Pituitary adenomas were identified and removed at surgery. Immunostaining techniques confirmed the presence of prolactin-containing cells in both tumors. We propose that prolactin-secreting tumors be considered as part of the MEN-I syndrome, and that patients presenting with the galactorrhea-amenorrhea syndrome be screened and followed sequentially for evidence of other endocrine neoplasia.
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
International Nuclear Information System (INIS)
Dauder, S.; Young, G.; Hass, L.; Bern, H.A.
1990-01-01
Specific binding of 125 I-ovine prolactin (oPRL) to microsomal fractions from gill, kidney, and liver of adult tilapia was determined. Specific binding varied among tissues, the highest values being displayed by kidney membranes. In the liver, the binding of oPRL was not strongly displaced by tilapia prolactins (tPRL177 and tPRL188), although tPRL177 was six times more potent than tPRL188. On the other hand, in kidney and gill membranes, the two tPRLs were equipotent. Tilapia PRLs showed low potency in competing for oPRL-binding sites when pregnant rat liver membranes were utilized. Tilapia growth hormone (tGH) and human growth hormone (hGH) displaced 125 I-oPRL from liver as well as did tPRL177 but were not recognized well by renal or branchial receptors. Two 125 I-oPRL-binding sites were detected in every tissue tested. These binding sites are subject to physiological regulation since adaptation to seawater resulted in a significant decrease in specific binding
EFFECT OF MORINGA OLEIFERA ON LEVEL OF PROLACTIN AND BREAST MILK PRODUCTION IN POSTPARTUM MOTHERS
Directory of Open Access Journals (Sweden)
Yuni Sulistiawati
2017-04-01
Full Text Available Background: Breastfeeding among postpartum mothers has been a problem due to low milk supply. As a result, mothers often decide to give formula milk or other additional foods, which might affect to the infant’s growth and development. Objective: This study aims to investigate the effect of Moringa Oliefera on the levels of prolactin and breast milk production (baby’s weight and sleep duration in postpartum mothers. Methods: Quasi-Experimental study with Non Equivalent control group design. There were 30 respondents recruited by purposive sampling, consisted of 15 respondents in intervention group and 15 respondents in the control group. This study was conducted from November until December 2016 in Four Midwive Independent Practice (BPM in the working area of the Health Center of Tlogosari wetan Semarang. Data were analyzed using Independent t-test. Results: Findings showed that there was a mean difference of prolactin level in the intervention group (231.72 ng / ml, and the control group (152.75 ng / ml; and a significant effect on increasing the levels of prolactin (p = 0.002. The mean of baby’s weight in the intervention group was 3783.33 grams, and in the control group was 3599.00 grams. However, there was no significant effect of moringa oleifera on baby’s weight (p = 0.313> 0.05. While the mean difference on sleep duration was 128.20 minutes in the intervention group and 108.80 minutes in the control group. There was a significant effect on baby’s sleep duration (p= 0.000. Conclusion: There were significant effects of moringa oleifera on mother’s prolactin and sleep duration of the baby. However, there was no significant effect on baby’s weight. Thus, it can be suggested that moringa oleifera can be used as an alternative treatment to increase breast milk production and prolactin hormones. Midwives should promote the benefits of moringa leaves as one of alternative supplements.
Abu El-Hamd, M; Farah, A
2018-02-01
Premature ejaculation (PE) is the most common male sexual dysfunction. This study aimed to investigate the role of serum testosterone, gonadotropins and prolactin in patients with PE. In a prospective a case-controlled study, it was conducted on 90 male patients with PE and 90 male healthy participants as controls. Patients were evaluated by Premature Ejaculation Diagnostic Tool (PEDT) and intravaginal ejaculatory latency time (IELT). Patients with mean IELT values ≤60 s and PEDT total scores ≥11 were considered to have PE. Serum levels of total testosterone (TT), free testosterone (FT), follicle-stimulating hormone (FSH), luteinising hormone (LH) and prolactin (PL) were investigated in patients with PE and controls. There was no statistically significant difference between patients with PE and controls regarding the serum levels of TT, FT, FSH, LH and PL (p value ˃.05). There was no significant correlation between the sex hormones levels (TT, FT, FSH, LH and PL) and (age, body mass index (BMI), IELTS and total PEDT scores of the patients; p value ˃.05). This study concluded that there was no disturbance in serum levels of testosterone, gonadotropins and prolactin in patients with PE and controls. These hormones could not relate to pathogenesis of PE. © 2017 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Mohammad H Dezfulian
Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.
Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
International Nuclear Information System (INIS)
El-Bayoumy, A.S.A.; Sallam, Kh.M.; Shafik, H.M.
2012-01-01
The objective of the present study was oriented to produce purified polyclonal antibody to prepare a prolactin solid phase coated tubes radioimmunoassay system. In the present study, production of polyclonal antibodies was carried out through immunization of three healthy white male mature New Zealand rabbits with a highly purified sheep prolactin antigen. The obtained anti-sera was purified using an anion exchange reactive group, diethylamino ethyle (DEAE) covalently linked to Sepharose. The purified polyclonal antibody was used for coating polystyrene tubes. The preparation of 125 I-prolactin tracer was carried out using chloramine-T method. The preparation of standards was performed using assay buffer to cover the range from 2 to 200 ng/ml. The optimization and validation tests of the assay were performed to evaluate the validity of the prepared system. In conclusion, this low cost assay would be used in diagnosis of pituitary dysfunction and diagnosis of infertility in males and females
International Nuclear Information System (INIS)
El-Bayoumy, A.S.A.; Sallam, Kh.M.; Shafik, H.M.
2014-01-01
The objective of the present study was oriented to produce purified polyclonal antibody to prepare a prolactin solid phase coated tubes radioimmunoassay system. In the present study, production of polyclonal antibodies was carried out through immunization of three healthy white male mature New Zealand rabbits with a highly purified sheep prolactin antigen. The obtained anti-sera was purified using an anion exchange reactive group, diethylamino ethyle (DEAE) covalently linked to Sepharose. The purified polyclonal antibody was used for coating polystyrene tubes. The preparation of 125 I-prolactin tracer was carried out using chloramine-T method. The preparation of standards was performed using assay buffer to cover the range from 2 to 200 ng/ml. The optimization and validation tests of the assay were performed to evaluate the validity of the prepared system. In conclusion, this low cost assay would be used in diagnosis of pituitary dysfunction and diagnosis of infertility in males and females.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.
Rawal, H C; Singh, N K; Sharma, T R
2013-01-01
Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants
Directory of Open Access Journals (Sweden)
H. C. Rawal
2013-01-01
Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.
Cottin, Manuelle; Chastel, Olivier; Kato, Akiko; Debin, Marion; Takahashi, Akinori; Ropert-Coudert, Yan; Raclot, Thierry
2014-02-01
Current research on seabirds suggests a key role of hormones in the trade-off between self-maintenance and parental investment through their influence on foraging decisions during the breeding period. Although prolactin is known to have major effects on parental care, its role in foraging behavior has rarely been investigated in seabirds to date. The aim of this study was to assess the influence of an experimental decrease in prolactin levels on foraging decisions and its consequences on breeding success in free-living seabirds. To achieve this, we implanted bromocriptine (an inhibitor of prolactin secretion) in male Adélie penguins (Pygoscelis adeliae), monitored their foraging behavior using time-depth recorders over several trips, and recorded their reproductive output. On average 8±0.5days after implantation, we showed that bromocriptine administration led to an efficient decrease in prolactin levels. However, no differences were seen in foraging trip durations between bromocriptine-implanted birds and controls. Moreover, the time spent diving and the number of dives performed per trip were similar in both groups. By contrast, all diving parameters (including diving efficiency) were negatively affected by the treatment during the first at-sea trip following the treatment. Finally, the treatment did not affect adult body condition or chick growth and survival. Our study highlights the short-term negative effect of low prolactin levels on diving effort, but indicates that a short-term and/or low-magnitude decrease in prolactin levels alone is not sufficient to modify consistently the body maintenance or the parental investment of Adélie penguins. Copyright © 2013 Elsevier Inc. All rights reserved.
Pal, Shyamali
2017-12-01
The presence of Macro prolactin is a significant cause of elevated prolactin resulting in misdiagnosis in all automated systems. Poly ethylene glycol (PEG) pretreatment is the preventive process but such process includes the probability of loss of a fraction of bioactive prolactin. Surprisingly, PEG treated EQAS & IQAS samples in Cobas e 411 are found out to be correlating with direct results of at least 3 immunoassay systems and treated and untreated Cobas e 411 results are comparable by a correlation coefficient. Comparison of EQAS, IQAS and patient samples were done to find out the trueness of such correlation factor. Study with patient's results have established the correlation coefficient is valid for very small concentration of prolactin also. EQAS, IQAS and 150 patient samples were treated with PEG and prolactin results of treated and untreated samples obtained from Roche Cobas e 411. 25 patient's results (treated) were compared with direct results in Advia Centaur, Architect I & Access2 systems. Correlation coefficient was obtained from trend line of the treated and untreated results. Two tailed p-value obtained from regression coefficient(r) and sample size. The correlation coefficient is in the range (0.761-0.771). Reverse correlation range is (1.289-1.301). r value of two sets of calculated results were 0.995. Two tailed p- value is zero approving dismissal of null hypothesis. The z-score of EQAS does not always assure authenticity of resultsPEG precipitation is correlated by the factor 0.761 even in very small concentrationsAbbreviationsGFCgel filtration chromatographyPEGpolyethylene glycolEQASexternal quality assurance systemM-PRLmacro prolactinPRLprolactinECLIAelectro-chemiluminescence immunoassayCLIAclinical laboratory improvement amendmentsIQASinternal quality assurance systemrregression coefficient.
Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro
2018-02-16
For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.
Genetic variation of Pit-1 gene in Chinese indigenous and Western ...
African Journals Online (AJOL)
STORAGESEVER
2009-07-20
Jul 20, 2009 ... regulates pituitary development and expression of the growth hormone, prolactin and thyrotropin β- submit genes. Pit-1 ... mice (Camper et al., 1990), as well as including the .... logy Company, Shanghai, China). Statistical ...
Genomewide analysis of MATE-type gene family in maize reveals ...
Indian Academy of Sciences (India)
Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Prolactin cycling and the management of breast-feeding failure.
Weichert, C E
1980-01-01
Various studies (Tyson et.al.; Frantz; Aono et.al.) show that cycling of prolactin is critical to the establishment of successful lactation in the first 60 to 80 days postpartum, and that a 2-hour nursing interval is associated with a statistically significant earlier onset of milk production (Salarija et.al.). However, in the patient with a lactational insufficiency, efforts to increase the frequency of nursing more often than every 2 hours may be counterproductive, as experimental evidence shows that prolactin exerts a negative feedback upon itself, and the patient with a breastfeeding problems may experience increased episodes of anxiety and fatigue. The patient with breast milk insufficiency can be managed by ensuring that a sucking stimulus of 30 minutes (15 minutes bilaterally) be present and repeated every 2-3 hours to provide adequate stimulation for prolactin release. Maternal anxiety about milk supply can be relieved by using the Lact-Aid nursing supplementer, a device which provides an additional source of milk to the infant at the breast. Nursing should be carried out in a sheltered situation to provide an uninterrupted sucking stimulus devoid of distraction. The mother should be directed to focus on pleasant associations while nursing to keep her from worrying about whether she will have enough milk. Symptoms of lactational insufficiency can be corrected with proper hormonal regulation. Evaluation of a breastfeeding disorder depends upon a careful physical examination of the breast, preferably to be done prior to and during infant nursing. Observation of infant nursing has not been a standard part of physical examination, although it is critical to making a diagnosis of the problem. The principles of breastfeeding management are illustrated in 3 cases in this chapter. In cases where there is no response to treatment, additional evaluation of the patient's developmental (e.g., adolescent attitude towards the breast) attitude and sexual function history
Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa
Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying
2014-01-01
Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
DEFF Research Database (Denmark)
Christiansen, Michael W; Gregersen, Per L.
2014-01-01
-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...
Directory of Open Access Journals (Sweden)
Behzad Davarniya
Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.
Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein
2015-01-01
Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914
The ACBP gene family in Rhodnius prolixus
DEFF Research Database (Denmark)
Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C
2016-01-01
The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...
Identification of the 14-3-3 gene family in Rafflesia cantleyi
Rosli, Khadijah; Wan, Kiew-Lian
2018-04-01
Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
Growth hormone, prolactin and cortisol response to exercise in patients with depression
DEFF Research Database (Denmark)
Krogh, Jesper; Nordentoft, Merete; Mohammad-Nezhad, Mahdi
2010-01-01
BACKGROUND: A blunted growth hormone and prolactin response to pharmacological stress test have previously been found in depressed patients, as well as an increased cortisol response to psychosocial stress. This study investigated these hormones in response to acute exercise using an incremental...... bicycle test. METHOD: A cross-sectional comparison of cortisol, growth hormone, and prolactin in depressed (n=137) and healthy (n=44) subjects during rest and in response to an incremental bicycle test. Secondly, we tested the depressed patients again after a 4-month randomized naturalistic exercise...... controls. The effect of acute exercise stress on PRL (p=.56) did not differ between depressed and healthy subjects. Apart from a decrease in GH response in the strength-training group (p=.03) the pragmatic exercise intervention did not affect resting hormonal levels, or the response to acute exercise...
Histaminergic regulation of prolactin secretion
DEFF Research Database (Denmark)
Knigge, U P
1990-01-01
Histamine (HA), which acts as a neurotransmitter in the central nervous system, participates in the neuroendocrine regulation of prolactin (PRL) secretion. HA has a predominant stimulatory effect which is mediated via H2-receptors following central administration and via H1-receptors following...... systemic infusion of the amine. In addition, HA seems to exert a minor inhibitory effect on PRL secretion, an effect unmasked only during blockade of the receptor mediating the stimulatory effect. Following central administration the inhibitory effect is mediated via H1-receptors, while following systemic...... administration this effect is mediated via H2-receptors. In accordance with these findings, the H2-receptor antagonist cimetidine (CIM) has an inhibitory (following central administration) or stimulatory (following systemic administration) effect on PRL secretion. However, high doses of CIM possess an additional...
International Nuclear Information System (INIS)
Caso, R.; Perez, E.; Mosquera, M.; Arranz, C.
1996-01-01
In this work described the production of second antibodies in sheep against rabbit IgG for being used in radioimmunoassays for determination LH, FSH and Prolactin. There was made the comparison between the results obtained using the Kits-RIA produced by us and the commercial WHO Kits-RIA, using these antibodies. The results allowed us to use these antibodies for production Kits-RIA of LH, FSH and Prolactin
APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis
Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.
1997-01-01
Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven
Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori
Directory of Open Access Journals (Sweden)
Yi Yong-Zhu
2006-08-01
Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.
Directory of Open Access Journals (Sweden)
Jaafar Kh. Ali
2018-04-01
Full Text Available Background: Globally, one million women are diagnosed with breast cancer and nearly half million die because of it. Breast cancer is one of the most common cancer which leads to mortality among women. Objectives: The main aim of this research is to find the relationship of prolactin level in women with breast cancer. Methods: The research was conducted in the Al-Hussein Medical City at Al-Hussein Center for the treatment of tumors and blood diseases. A total of 71 specimens were collected from females with breast cancer. Blood specimens were collected, and a blood group, PCV, Hb, ESR and prolactin level was evaluated. Results: The results show that most breast cancer cases were in age group 40-50 years, and less common among other age groups. The married women were 97% and the unmarried was 3% only. Most studied cases (43% were O +ve and 26% were A +ve blood group, in comparison to other blood groups. Also, many women show a slightly decrease in hemoglobin and PCV level (0.05. The prolactin levels were increased (31.5 ng/ml significantly in compare to normal range (2-27 ng/ml in women in all age groups. Conclusion: The study concludes that there was a relationship between prolactin level and breast cancer with a highly significant value.
Immunological properties of prolactin and studies on a gonadotropin binding inhibitor
International Nuclear Information System (INIS)
Chang, Y.S.
1985-01-01
The physiological role of prolactin in horses has not yet been well defined. With the availability of highly purified ePRL for inducing antibody formation in rabbits and for radiolabeling with Na 125 I, a very sensitive (0.4-0.6 ng/ml) and highly specific homologous RIA for ePRL was developed. A heterologous RIA using 125 I-labeled ovine PRL and anti-ePRL antiserum was also developed and compared to the homologous RIA for ePRL. Of the two systems, it is concluded that this homologous RIA system is more suitable and more reliable for measuring prolactin concentration in horse serum samples. Until now, biochemical information on PRL has not been available for reptilian species. Sea turtle (Chelonia mydas) prolactin was purified from pituitary extracts by selective precipitation, DEAE-cellulose chromatography and gel filtration. Similar to other species of PRL, sea turtle PRL is a 22,000-24,000 daltons protein and contains a high content of glutamic acid, aspartic acid, serine and leucine, the N-terminal amino acid residue. Gonadotropin (FSH) binding inhibitor was partially purified from sheep testes by ammonium sulfate fractionation and ion exchange chromatography. The FSH-BI (molecular weight: 50,000 daltons, estimated by gel filtration) contains a protein moiety necessary for binding inhibitory activity. The inhibition of the binding of 125 I-labeled ovine FSH to its receptor by the FSH-BI is not competitive. Both in vivo and in vitro biological studies of FSH-BI preparations in rats indicated various effects on FSH and LH activities at the gonadal level. These findings suggest a physiological role for FSH-BI in the regulation of reproduction
Directory of Open Access Journals (Sweden)
Iva Tomalova
Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.
Search for intracranial aneurysm susceptibility gene(s using Finnish families
Directory of Open Access Journals (Sweden)
Ryynänen Markku
2002-08-01
Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.
Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family
Institute of Scientific and Technical Information of China (English)
Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang
2007-01-01
The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.
A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.
Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P
2005-10-01
We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.
Natural killer cell receptor genes in the family Equidae: not only Ly49.
Directory of Open Access Journals (Sweden)
Jan Futas
Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for
Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49
Futas, Jan; Horin, Petr
2013-01-01
Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of
[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].
Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe
2014-01-01
Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.
NDP gene mutations in 14 French families with Norrie disease.
Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul
2003-12-01
Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.
Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan
2017-01-25
Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.
Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene
International Nuclear Information System (INIS)
Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.
2000-01-01
Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)
Evolution of the MAGUK protein gene family in premetazoan lineages
Directory of Open Access Journals (Sweden)
Ruiz-Trillo Iñaki
2010-04-01
Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK
Genome-wide analysis of the WRKY gene family in cotton.
Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun
2014-12-01
WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.
Genome organization and expression of the rat ACBP gene family
DEFF Research Database (Denmark)
Mandrup, S; Andreasen, P H; Knudsen, J
1993-01-01
pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Leehy, Katherine A; Truong, Thu H; Mauro, Laura J; Lange, Carol A
2018-02-01
Estrogen is the major mitogenic stimulus of mammary gland development during puberty wherein ER signaling acts to induce abundant PR expression. PR signaling, in contrast, is the primary driver of mammary epithelial cell proliferation in adulthood. The high circulating levels of progesterone during pregnancy signal through PR, inducing expression of the prolactin receptor (PRLR). Cooperation between PR and prolactin (PRL) signaling, via regulation of downstream components in the PRL signaling pathway including JAKs and STATs, facilitates the alveolar morphogenesis observed during pregnancy. Indeed, these pathways are fully integrated via activation of shared signaling pathways (i.e. JAKs, MAPKs) as well as by the convergence of PRs and STATs at target genes relevant to both mammary gland biology and breast cancer progression (i.e. proliferation, stem cell outgrowth, tissue cell type heterogeneity). Thus, rather than a single mediator such as ER, transcription factor cascades (ER>PR>STATs) are responsible for rapid proliferative and developmental programming in the normal mammary gland. It is not surprising that these same mediators typify uncontrolled proliferation in a majority of breast cancers, where ER and PR are most often co-expressed and may cooperate to drive malignant tumor progression. This review will primarily focus on the integration of PR and PRL signaling in breast cancer models and the importance of this cross-talk in cancer progression in the context of mammographic density. Components of these PR/PRL signaling pathways could offer alternative drug targets and logical complements to anti-ER or anti-estrogen-based endocrine therapies. Copyright © 2017 Elsevier Ltd. All rights reserved.
[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].
Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun
2017-08-10
To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.
A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.
Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E
2016-03-01
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Energy Technology Data Exchange (ETDEWEB)
Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.
2006-05-25
Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.
Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.
Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T
1995-05-20
Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Tipsmark, Christian K; Breves, Jason P; Rabeneck, D Brett; Trubitt, Rebecca T; Lerner, Darren T; Grau, E Gordon
2016-09-01
In euryhaline teleosts, reorganization of gill tight junctions during salinity acclimation involves dynamic expression of specific claudin (Cldn) paralogs. We identified four transcripts encoding Cldn tight junction proteins in the tilapia gill transcriptome: cldn10c, cldn10e, cldn28a and cldn30. A tissue distribution experiment found cldn10c and cldn10e expression levels in the gill to be 100-fold higher than any other tissues examined. cldn28a and cldn30 levels in the gill were 10-fold greater than levels in other tissues. Expression of these genes in Mozambique tilapia was examined during acclimation to fresh water (FW), seawater (SW), and in response to hormone treatments. Transfer of tilapia from FW to SW elevated cldn10c and cldn10e, while cldn28a and cldn30 were stimulated following transfer from SW to FW. In hypophysectomized tilapia transferred to FW, pituitary extirpation induced reduced expression of cldn10c, cldn10e and cldn28a; these effects were mitigated equally by either prolactin or cortisol replacement. In vitro experiments with gill filaments showed that cortisol stimulated expression of all four cldns examined, suggesting a direct action of cortisol in situ. Our data indicate that elevated cldn10c and cldn10e expression is important during acclimation of tilapia to SW possibly by conferring ion specific paracellular permeability. On the other hand, expression of cldn28a and cldn30 appears to contribute to reorganization of branchial epithelium during FW acclimation. Hormone treatment experiments showed that particular FW- and SW-induced cldns are controlled by cortisol and prolactin. Copyright © 2016 Elsevier Inc. All rights reserved.
Common mutations identified in the MLH1 gene in familial Lynch syndrome
Directory of Open Access Journals (Sweden)
Jisha Elias
2017-12-01
In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.
Familial occurrence of cerebral gigantism, Sotos' syndrome.
Hansen, F J; Friis, B
1976-05-01
Since the original description of cerebral gigantism, about 85 cases have been reported. Four papers comment on familial occurrence but never in parents and their children. This paper describes the syndrome in a mother and her child, which, together with facts pointing towards prenatal etiology, such as excessive birthweight, striking mutual resemblance and abnormal dermatoglyphics, points to a genetic defect. Previous endocrine studies are enlarged by the findings of normal serum somatomedin and serum prolactin.
The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.
Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki
2018-05-01
Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Directory of Open Access Journals (Sweden)
Panglukies Ratna Agustie
2017-08-01
Full Text Available Background: Low milk production is one of the barries to exclusive breastfeeding. Oxytocin massage is considered as an alternative treatment, which combined with lavender essential oil as an aromatherapy. Objective: This study aims to examine the effect of oxytocin massage using lavender essential oil on the increase of levels of prolactin and milk production in primiparaous mothers after caesarean section. Methods: This was a quasi-experimental study with non-equivalent control group design conducted in October-December 2016 at the General Hospital of Dr.H. Soewondo Kendal. There were 32 recruited by consecutive sampling, divided to be intervention (16 participants and control group (16 participants. Prolactin hormone levels were measured using Enzyme-linked immunosorbent assay (ELIZA, breast milk production was measured based on the indicators of milk volume, urination and defecation frequency and sleep duration of babies; and infant’s weight was also measured by digital scale. Data were analyzed using Mann Whitney and Wilcoxon test. Results: The mean difference of prolactin hormone level in control group was 17.82 ng / ml while mean of difference of hormone prolactin level in intervention group was 132.13 ng / ml. There were statistically significant differences between intervention and control group in prolactin levels (p-value 0.000, milk volume (p-value 0.000, infant weight (p-value 0.000, urination frequency (p-value 0.017, defecation frequency (p-value 0.002, and infant sleep duration (p-value 0.000. Conclusion: There was a significant effect of the oxytocin massage using lavender essential oil on the increase of breast milk production and prolactin levels. Therefore, oxytocin massage using lavender essential oil can be used as an alternative treatment for midwives and other health professionals in an effort to increase milk production in postpartum.
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Evolutionary relationship and structural characterization of the EPF/EPFL gene family.
Directory of Open Access Journals (Sweden)
Naoki Takata
Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.
Directory of Open Access Journals (Sweden)
Yan Liangzhen
2012-11-01
Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a
Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J
2018-02-01
WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M
2013-12-01
Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.
Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P
2007-01-31
Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.
Selective serotonin reuptake inhibitor (SSRI antidepressants, prolactin and breast cancer
Directory of Open Access Journals (Sweden)
Janet eAshbury
2012-12-01
Full Text Available Selective serotonin reuptake inhibitors (SSRIs are a widely prescribed class of anti-depressants. Laboratory and epidemiologic evidence suggests that a prolactin-mediated mechanism secondary to increased serotonin levels at neuronal synapses could lead to a potentially carcinogenic effect of SSRIs. In this population-based case-control study, we evaluated the association between SSRI use and breast cancer risk as a function of their relative degree of inhibition of serotonin reuptake as a proxy for their impact on prolactin levels. Cases were 2,129 women with primary invasive breast cancer diagnosed from 2003-2007, and controls were 21,297 women randomly selected from the population registry. Detailed information for each SSRI prescription dispensed was compiled using the Saskatchewan prescription database. Logistic regression was used to evaluate the impact of use of high and lower inhibitors of serotonin reuptake and duration of use, as well as to assess the effect of individual high inhibitors on the risk of breast cancer. Exclusive users of high or lower inhibitors of serotonin reuptake were not at increased risk for breast cancer compared with nonusers of SSRIs (OR = 1.01, CI = 0.88-1.17 and OR = 0.91, CI = 0.67-1.25 respectively, regardless of their duration of use or menopausal status. While we cannot rule out the possibility of a clinically important risk increase (OR = 1.83, CI = 0.99-3.40 for long-term users of sertraline (≥24 prescriptions, given the small number of exposed cases (n=12, the borderline statistical significance and the wide confidence interval, these results need to be interpreted cautiously. In this large population-based case-control study, we found no conclusive evidence of breast cancer risk associated with the use of SSRIs even after assessing the degree of serotonin reuptake inhibition and duration of use. Our results do not support the serotonin-mediated pathway for the prolactin-breast cancer hypothesis.
Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).
Deokar, Amit A; Tar'an, Bunyamin
2016-01-01
Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness
International Nuclear Information System (INIS)
Girgis, R.B.; Abdel-Fattah, K.I.; Khamis, F.I.; Abu Zaid, N.M.
2004-01-01
The present study aims to investigate the role of serotonin (5-HT) on the homeostasis of plasma prolactin and glucose in rats induced by gamma irradiation and food deprivation. Animals were divided into seven groups; control, irradiated at a dose level of 6 Gy, injected with 500 mg/kg b.wt. 5-HT intra-peritoneally, injected with 5-HT before irradiation food deprived for 48 hrs then irradiated, food deprived then injected with 5-HT, and food deprived then injected with 5-HT before whole body irradiation. Samples were collected at 1,3, 7 and 14 days post irradiation. The results showed that gamma irradiation firstly elevated prolactin (PRL) levels in plasma (1 and 3 days) then the levels decreased after 7 and 14 days as compared to control values. Rats received serotonin before irradiation exhibited an increased level of PRL after 14 days post irradiation compared to control value, while the level decreased after 1, 3, 7 days post irradiation. Food deprivation for 48 hrs altered the effect of serotonin and /or irradiation on PRL levels in plasma. Rats injected with serotonin showed a decreased level of plasma prolactin in food deprived rats, 3 days post injection. The obtained results showed that serotonin causes variable effects on plasma prolactin compared to control values. Glucose plasma levels were increased in both irradiated and serotonin injected rats before irradiation, and also in serotonin injected rats as compared to control values. Irradiation of rats after 48 hrs food deprivation induced an increase in plasma glucose levels measured throughout the different experimental periods. Injection of serotonin to rats after 48 hrs food deprivation before irradiation increased plasma glucose levels after 1, 3, 7 and 14 days compared to control value. Also, injection of serotonin to 48 hrs food deprived rats increased glucose levels during all examined days of experiment.It could be concluded that serotonin may have a variable mechanism controlling prolactin
Massive expansion of the calpain gene family in unicellular eukaryotes
Directory of Open Access Journals (Sweden)
Zhao Sen
2012-09-01
Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Massive expansion of the calpain gene family in unicellular eukaryotes.
Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran
2012-09-29
Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.
Vedin, Amy M; Garcia-Filion, Pamela; Fink, Cassandra; Borchert, Mark; Geffner, Mitchell E
2012-01-01
The majority of children with optic nerve hypoplasia (ONH) develop hypopituitarism and many also become obese. These associated conditions are a major cause of morbidity and are possibly due to hypothalamic dysfunction. Because mild hyperprolactinemia often occurs in subjects with disorders of the hypothalamus, we examined whether hyperprolactinemia was present in children with ONH during the first 3 years of life and whether it was a marker for hypopituitarism and/or obesity. Data were retrospectively analyzed from a registry study of children with ONH. The initial serum prolactin was obtained prior to age 36 months (n = 125) and compared with pituitary function and body mass index at age 5. 72% of subjects had an elevated initial serum prolactin and 60% had hypopituitarism. An elevated initial prolactin was associated with hypopituitarism (OR 2.58; 95% CI 1.16, 5.73), specifically with growth hormone deficiency (OR 2.77; 95% CI 1.21, 6.34). 31% of subjects had a body mass index ≥ 85th percentile, but this did not correlate with initial hyperprolactinemia. Early hyperprolactinemia correlates with the presence of hypopituitarism in children with ONH, but it is not a reliable prognosticator of hypopituitarism. Additionally, hyperprolactinemia does not predict future weight excess. Copyright © 2012 S. Karger AG, Basel.
Plasma homovanillic acid and prolactin in Huntington's disease.
Markianos, Manolis; Panas, Marios; Kalfakis, Nikos; Vassilopoulos, Dimitrios
2009-05-01
Dopaminergic activity is expected to be altered in patients with Huntington's disease (HD) and be related to factors like duration and severity of illness or patients' specific symptomatology like dementia, depression, or psychotic features. We assessed plasma homovanillic acid (pHVA) and plasma prolactin (pPRL), two correlates of dopaminergic activity, in 116 subjects with CAG repeats expansion in the HD gene, 26 presymptomatic (18 females) and 90 with overt symptomatology (43 females). Patients were evaluated using the Unified HD Rating Scale and the Total Functional Capacity Scale. Presence of dementia, depression, and psychotic features were also assessed. The age range of the patients was 22-83 years, duration of illness from 0.5 to 27 years, and CAG repeat number from 34 to 66. A group of 60 age and sex matched healthy subjects served as control group. Plasma PRL in subjects at risk and in neuroleptic-free patients, evaluated separately for males and females, did not differ from controls. Plasma HVA levels did not differ from controls in the group of presymptomatic subjects, but were significantly higher in the patients group. This increase was positively associated mainly with severity of illness and functional capacity of the patients, and not with presence of depression or dementia. Plasma HVA levels may be proven to be a peripheral index of disease progression. Reducing dopaminergic activity may have not only symptomatic, but also neuroprotective effects in HD.
Yarlagadda, Atmaram; Acharya, Ganesh; Kasaraneni, Jayaprada; Hampe, Christiane S; Clayton, Anita H
2015-01-01
Dopamine and prolactin exhibit opposite effects on lactation. However, a possible role for increased prolactin/dopamine ratio in postpartum mood and thought disorders and as a prognostic indicator of the mother's future mental health has not been well investigated. Postpartum depression is a serious condition with potentially devastating outcomes for both the mother and the infant. Early detection and treatment of this condition can have impressive results. Treatment options include antidepressant medications for mood disorders and use of antipsychotics and electroconvulsive therapy to address postpartum psychosis. Although there are obvious benefits of such treatments on the welfare of the mother and her child, broader implications of these treatments on lactation and child growth and development are not known. This review article explores a possible link between in-utero exposure to a high maternal prolactin/dopamine ratio and subsequent development of autism spectrum disorders. We hypothesize that a comprehensive, biologically oriented approach to the use of psychotropics in the regulation of neurotransmission during pre- and postpartum periods may result in better outcomes in this population.
The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns
Directory of Open Access Journals (Sweden)
kun feng
2016-08-01
Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.
Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula
Directory of Open Access Journals (Sweden)
Wei Li
2016-04-01
Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.
The Influence of Phytotherapy on Prolactin Level in Macroprolactinoma Patients
Trogrlić, Ivo; Trogrlić, Dragan; Trogrlić, Zoran
2011-01-01
The study aims at demonstrating the efficiency of phytotherapy in regulation of prolactin levels in patients diagnosed with pituitary macroprolactinoma. The study made use of workup outcomes submitted by treating healthcare facilities where the patients were first diagnosed with macroprolactinomas based on diagnostic imaging (MRI and/or CT), laboratory workup, and hormone status estimation. The data in reference served as the baseline for a comparative follow-up of phytotherapeutic efficiency...
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].
Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang
2011-12-01
To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.
Sato, Takahiro; Tran, Thai H.; Peck, Amy R.; Girondo, Melanie A.; Liu, Chengbao; Goodman, Chelain R.; Neilson, Lynn M.; Freydin, Boris; Chervoneva, Inna; Hyslop, Terry; Kovatich, Albert J.; Hooke, Jeffrey A.; Shriver, Craig D.; Fuchs, Serge Y.; Rui, Hallgeir
2014-01-01
Prolactin controls the development and function of milk-producing breast epithelia but also supports growth and differentiation of breast cancer, especially luminal subtypes. A principal signaling mediator of prolactin, Stat5, promotes cellular differentiation of breast cancer cells in vitro, and loss of active Stat5 in tumors is associated with anti-estrogen therapy failure in patients. In luminal breast cancer progesterone induces a cytokeratin-5 (CK5)-positive basal cell-like population. This population possesses characteristics of tumor stem cells including quiescence, therapy-resistance, and tumor-initiating capacity. Here we report that prolactin counteracts induction of the CK5-positive population by the synthetic progestin R5020 in luminal breast cancer cells both in vitro and in vivo. CK5-positive cells were chemoresistant as determined by four-fold reduced rate of apoptosis following docetaxel exposure. Progestin-induction of CK5 was preceded by marked up-regulation of BCL6, an oncogene and transcriptional repressor critical for the maintenance of leukemia-initiating cells. Knockdown of BCL6 prevented induction of CK5-positive cell population by progestin. Prolactin suppressed progestin-induced BCL6 through Jak2-Stat5 but not Erk- or Akt-dependent pathways. In premenopausal but not postmenopausal patients with hormone receptor-positive breast cancer, tumor protein levels of CK5 correlated positively with BCL6, and high BCL6 or CK5 protein levels were associated with unfavorable clinical outcome. Suppression of progestin-induction of CK5-positive cells represents a novel pro-differentiation effect of prolactin in breast cancer. The present progress may have direct implications for breast cancer progression and therapy since loss of prolactin receptor-Stat5 signaling occurs frequently and BCL6 inhibitors currently being evaluated for lymphomas may have value for breast cancer. PMID:23708665
Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline
2017-06-09
Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.
Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro
2018-04-01
In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.
Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.
Juranić, Martina; Dresselhaus, Thomas
2014-01-01
MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.
DEFF Research Database (Denmark)
Davis, Margaret R.; Andersson, Robin; Severin, Jessica
2014-01-01
in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...
Genome-wide analysis of the GRAS gene family in Prunus mume.
Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang
2015-02-01
Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.
[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].
Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan
2016-08-01
To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Nogami, H; Hoshino, R; Ogasawara, K; Miyamoto, S; Hisano, S
2007-08-01
Recent studies have revealed the occurrence of five first exon variants of the rat prolactin receptor mRNA, suggesting that multiple promoters direct prolactin receptor transcription in response to different regulatory factors. In the present study, regional expression of these first exon variants, as well as two prolactin receptor subtypes generated by alternative splicing, was examined in the brains and anterior pituitary glands of female rats. Expression of the long-form was detected in the choroid plexus, hypothalamus, hippocampus, cerebral cortex and anterior pituitary gland, whereas the short form was detected only in the choroid plexus. E1-3 mRNA, a first exon variant, was detected in the choroid plexus, hypothalamus, and anterior pituitary gland, whereas E1-4 was detected only in the choroid plexus. Other variants were not detectable by the polymerase chain reaction protocol employed in this study. Ovariectomy increased the short form in the choroid plexus and the E1-3 expression in the choroid plexus and pituitary gland, but changes in the long-form and E1-4 expression were minimal. Replacement of oestrogens and prolactin suggest that oestrogens down-regulate E1-3 expression in the choroid plexus and pituitary gland, and that the negative effect of oestrogen is mediated by prolactin in the pituitary gland. The present results revealed the region-specific promoter usage in prolactin receptor mRNA transcription, as well as the involvement of oestrogens in the regulation of E1-3 mRNA expression in the brain and pituitary gland.
Lipidized prolactin-releasing peptide analogs: A new tool for obesity treatment
Czech Academy of Sciences Publication Activity Database
Maletínská, Lenka; Pražienková, Veronika; Zemenová, Jana; Popelová, Andrea; Blechová, Miroslava; Mikulášková, Barbora; Holubová, Martina; Železná, Blanka; Kuneš, Jaroslav
2016-01-01
Roč. 22, Suppl S2 (2016), S179-S180 ISSN 1075-2617. [European Peptide Symposium /34./ and International Peptide Symposium /8./. 04.09.2016-09.09.2016, Leipzig] R&D Projects: GA TA ČR(CZ) TE01020028; GA ČR(CZ) GA15-08679S Institutional support: RVO:61388963 Keywords : prolactin-releasing peptide * food intake * obesity Subject RIV: CE - Biochemistry
Huang, Qin; Wang, Meiping; Xia, Zongliang
2018-01-01
Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.
Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.
Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.
Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine
2011-11-01
The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping
2018-02-21
Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.
A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene
Directory of Open Access Journals (Sweden)
Sanambar Sadighi
2017-02-01
Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
2014-12-09
Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.
Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B
2015-12-01
Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther
2013-04-01
Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.
Evaluation of the norrie disease gene in a family with incontinentia pigmenti.
Shastry, B S; Trese, M T
2000-01-01
Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel
The claudin gene family: expression in normal and neoplastic tissues
International Nuclear Information System (INIS)
Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J
2006-01-01
The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4
Genome-wide identification and expression analysis of the WRKY gene family in cassava
Directory of Open Access Journals (Sweden)
Yunxie eWei
2016-02-01
Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.
Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian
2016-01-01
The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.
Immunoradiometric assay for prolactin in serum and tissue; Comparison with radioimmunoassay
Energy Technology Data Exchange (ETDEWEB)
Ohnami, Shumpei; Nakata, Hajime; Eto, Sumiya (University of Occupational and Environmental Health Hospital, Kitakyushu, Fukuoka (Japan))
1990-09-01
Prolactin (PRL) concentrations in sera and tumors of patients with various pituitary tumors were measured by both immunoradiometric assay (IRMA) and radioimmunoassay (RIA). PRL concentrations in sera and tumor tissues measured by IRMA were well correlated with those measured by RIA. PRL concentrations in sera reflected those of tumors removed. This IRMA is a simple and useful method for PRL determination in serum and tissue. (author).
Directory of Open Access Journals (Sweden)
LISTYA UTAMI KARMAWAN
2009-03-01
Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...
Diverse roles of ERECTA family genes in plant development.
Shpak, Elena D
2013-12-01
Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Atanassova Rossitza
2010-11-01
Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and
Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill
2013-02-01
Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.
Primary Hypothyroidism With Markedly High Prolactin
Directory of Open Access Journals (Sweden)
MOHD SALEEM ANSARI
2016-04-01
Full Text Available Secondary Pituitary enlargement due to primary hypothyroidism is not a common manifestation. The loss of thyroxin feedback inhibition in primary hypothyroidism causes overproduction of thyroid-releasing hormone (TRH, which results in secondary pituitary enlargement.TRH has a weak stimulatory effect on lactotroph cells of pituitary, so mild to moderate rise in prolactin (PRL level is expected. We report a 67 years old female who presented with a large pituitary mass and very high level of TSH with a significant rise in PRL level. In this case the diagnosis of seller mass was challenging, it was difficult to distinguish between pituitary prolactinoma and primary hypothyroidism with secondary pituitary hyperplasia. The thyroid hormone replacement proved that hyperprolactinemia was due to hyperplasia of the pituitary gland.Hence, the correct diagnosis and thyroid hormone therapy can prevent unnecessary treatment with dopamine agonist.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Structure and regulated expression of bovine prolactin and bovine growth hormone genes
International Nuclear Information System (INIS)
Rottman, F.; Camper, S.; Goodwin, E.; Hampson, R.; Lyons, R.
1986-01-01
This paper presents a description of several studies which utilize the transfection of cloned chimeric genes in an attempt to analyze the regulatory signals found in the bPRL and bGH genes. Examination of 5' flanking region of PRL genes reveals a high degree of sequence homology between the bovine, human, and rat species. In order to assess the existence of possible regulatory sequences in a more direct manner, the authors transfected homologous and heterologous cells with chimeric gene constructs containing possible regulatory sequences derived from both the bPRL and bGH genes. An analysis is presented of the polyadenylation signal contained in the bGH 3' flanking sequence
Molecular study of the perforin gene in familial hematological malignancies
Directory of Open Access Journals (Sweden)
El Abed Rim
2011-09-01
Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.
Evolution of the defensin-like gene family in grass genomes
Indian Academy of Sciences (India)
that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing
2014-06-01
Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
A comprehensive family-based replication study of schizophrenia genes
DEFF Research Database (Denmark)
Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef
2013-01-01
768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...
Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X
DEFF Research Database (Denmark)
Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas
2013-01-01
Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....
Small Mutations of the DMD Gene in Taiwanese Families
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2008-06-01
Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...
African Journals Online (AJOL)
The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...
Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana
Czech Academy of Sciences Publication Activity Database
Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav
2007-01-01
Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007
GDNF gene is associated with tourette syndrome in a family study.
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo
2015-07-01
Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.
GDNF Gene Is Associated With Tourette Syndrome in a Family Study
Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo
2016-01-01
Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985
Directory of Open Access Journals (Sweden)
S. Pamela K. Shiao
2018-02-01
Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.
[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].
Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi
2014-12-01
To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
International Nuclear Information System (INIS)
Szafranska, B.; Przala, J.; Grazul-Bilska, A.
1992-01-01
The study was performed using luteal tissue obtained from 24 pregnant gilts. Group 1 was treated with bromocriptine (BR) from 37th to 42nd day of day of pregnancy. Group 2 was treated with homologous anti-pLH serum from 37th to 42nd day of pregnancy. Group 3 was given BR from 67th to 72nd day of gestation. Group 4 received anti-pLH serum from 67th to 72nd day of pregnancy. The effect of exogenous LH or prolactin (100 ng/ml) on secretion of progesterone (P 4 ) and estradiol (E 2 ) by luteal tissue was studied using perfusion technique. Prolactin caused a significant (P 4 secretion by luteal tissue from gilts in groups 1 and 4. Both LH and prolactin decreased (P 4 and E 2 secretion by luteal tissue from gilts from groups 4 and 2, respectively. The results demonstrate that both LH and prolactin have a regulatory role in steroid secretion by luteal tissue of gilts in the mid- and late period of pregnancy. (author). 28 refs, 2 figs
Gene screening in a Chinese family with Marfan syndrome
Directory of Open Access Journals (Sweden)
Wen-Jiao Xia
2016-05-01
Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.
Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.
Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin
2018-03-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.
He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun
2017-08-23
The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.
Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B
2016-12-07
Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.
Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan
2018-04-01
Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.
Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang
2017-01-01
Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.
Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome
Directory of Open Access Journals (Sweden)
Srivastava Satish
2003-07-01
Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.
Directory of Open Access Journals (Sweden)
Okta Kuswaningrum
2017-10-01
Full Text Available Background: Breast milk is the best natural nutrient for the baby. However, some mothers have problems with breastfeeding due to lack of breast milk production. Spinach leaf (Amaranthus Spinosus L is considered as one of the plants that have the effect of non-synthesis lactagogues to increase milk production. Objective: To analysis the effect of spinach leaf (Amaranthus Spinosus L extract on prolactin and breast milk production in postpartum mothers. Methods: This was a quasy-experimental study with pretest posttest with control group design conducted in the Community Health Center of Wonogiri II from December 2016 to January 2017. There were 30 participants were selected using purposive sampling, with 15 participants assigned in the experiment and control group. Data were analyzed using independent and paired t-test. Results: The results showed significant differences in prolactin levels (p = 0.000, breast milk production (p = 0.000, and infant weight (p = 0.000 (<0.05 after given spinach leaf (Amaranthus Spinosus L extract. Conclusion: Spinach leaf (Amaranthus Spinosus L extract had a significant effect in increasing the prolactin levels and breast milk production in postpartum mothers.
Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).
Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L
1997-04-01
Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.
AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families
International Nuclear Information System (INIS)
Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen
2007-01-01
Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population
[Analysis of gene mutation in a Chinese family with Norrie disease].
Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue
2012-09-01
To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.
Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping
2016-10-03
The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.
From Bench to Bedside: Translating the Prolactin/Vasoinhibin Axis
Directory of Open Access Journals (Sweden)
Jakob Triebel
2017-12-01
Full Text Available The prolactin/vasoinhibin axis defines an endocrine system, in which prolactin (PRL and vasoinhibins regulate blood vessel growth and function, the secretion of other hormones, inflammatory and immune processes, coagulation, and behavior. The core element of the PRL/vasoinhibin axis is the generation of vasoinhibins, which consists in the proteolytic cleavage of their precursor molecule PRL. Vasoinhibins can interact with multiple different partners to mediate their effects in various tissues and anatomical compartments, indicating their pleiotropic nature. Based on accumulating knowledge about the PRL/vasoinhibin axis, two clinical trials were initiated, in which vasoinhibin levels are the target of therapeutic interventions. One trial investigates the effect of levosulpiride, a selective dopamine D2-receptor antagonist, on retinal alterations in patients with diabetic macular edema and retinopathy. The rationale of this trial is that the levosulpiride-induced hyperprolactinemia resulting in increased retinal vasoinhibins could lead to beneficiary outcomes in terms of a vasoinhibin-mediated antagonization of diabetes-induced retinal alterations. Another trial investigated the effect of bromocriptine, a dopamine D2-receptor agonist, for the treatment of peripartum cardiomyopathy. The rationale of treatment with bromocriptine is the inhibition of vasoinhibin generation by substrate depletion to prevent detrimental effects on the myocardial microvascularization. The trial demonstrated that bromocriptine treatment was associated with a high rate of left ventricular recovery and low morbidity and mortality. Therapeutic interventions into the PRL/vasoinhibin axis bear the risk of side effects in the areas of blood coagulation, blood pressure, and alterations of the mental state.
Directory of Open Access Journals (Sweden)
Melyana Nurul Widyawati
2016-08-01
Full Text Available Background: Exclusive breastfeeding in Semarang during the past five years remains low. Only 20 to 64% of mothers were breastfed exclusively in 2010-2012. The incidence of postpartum blues was reported by 29.9% mothers, and mostly (56.6% was primiparous. Objective: This study aims to determine the effect of Loving Massage, aromatherapy, and a combination of Loving Massage and aromatherapy on stress levels, and changes in levels of prolactin in primiparous puerperal in Semarang. Method: A true experimental study with a randomized pretest-posttest control group design. Cluster random sampling was used to select 12 health centers from the 37 health centers in Semarang. A random assignment with a sealed envelope was performed to divide study participants into four groups; loving massage group, aromatherapy group, and a combination group of loving massage and aromatherapy, and a control group. A total of 52 primiparous puerperal mothers was involved, with 13 mothers were distributed equally in each group. Results: Loving Massage, aromatherapy, and a combination of Loving Massage and aromatherapy effectively changed mother’s stress and prolactin levels. Effectiveness of each treatment assessed from the average difference in scores before and after treatment. Combination of Loving Massage and aromatherapy had proven as the most effective treatment in reducing stress levels (11.61 ± 6.76, and increasing prolactin level (83.13 ± 6.41 ng/ml. Conclusions: Loving Massage & Aromatherapy shown to lower the levels of stress, and can increase the levels prolactin in postpartum primiparous. Therefore, it is recommended to provide Loving Massage therapy and aromatherapy to postpartum primiparous mothers.
International Nuclear Information System (INIS)
Apud, J.A.; Masotto, C.; Racagni, G.
1987-01-01
In the present study, the ability of three direct GABA agonists, muscimol, THIP and SL 76002 to displace 3 H-GABA binding from anterior pituitary and medio-basal hypothalamus membranes was evaluated. Further, the effect of both THIP and SL 76002 on baseline prolactin levels or after stimulation of hormone release with haloperidol has been also studied. Either muscimol, THIP or SL 76002 have shown to posses 7-, 7- and 3-fold higher affinity, respectively, for the central nervous system than for the anterior pituitary 3 H-GABA binding sites. Moreover, THIP and SL 76002 have demonstrated to be respectively, 25- and 1000- fold less potent than muscimol in inhibiting 3 H- GABA binding at the level of the anterior pituitary and about 25- and 2700-fold less potent at the level of the medio-basal hypothalamus. Under basal conditions, either THIP or SL 76002 were ineffective to reduce prolactin release. However, after stimulation of prolactin secretion through blockade of the dopaminergic neurotransmission with haloperidol (0.1 mg/kg), both THIP (10 mg/kg) and SL 76002 (200 mg/kg) significantly counteracted the neuroleptic-induced prolactin rise with a potency which is in line with their ability to inhibit 3 H-GABA binding in the anterior pituitary. The present results indicate that both compounds inhibit prolactin release under specific experimental situations probably through a GABAergic mechanism. In view of the endocrine effects of these GABA-mimetic compounds, the possibility arises for an application of these type of drugs in clinical neuroendocrinology. 35 references, 3 figures, 2 tables
Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E
2015-05-01
Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family
Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li
2015-11-24
Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.
PAK1 translocates into nucleus in response to prolactin but not to estrogen
Energy Technology Data Exchange (ETDEWEB)
Oladimeji, Peter, E-mail: Peter.Oladimeji@rockets.utoledo.edu; Diakonova, Maria, E-mail: mdiakon@utnet.utoledo.edu
2016-04-22
Tyrosyl phosphorylation of the p21-activated serine–threonine kinase 1 (PAK1) has an essential role in regulating PAK1 functions in breast cancer cells. We previously demonstrated that PAK1 serves as a common node for estrogen (E2)- and prolactin (PRL)-dependent pathways. We hypothesize herein that intracellular localization of PAK1 is affected by PRL and E2 treatments differently. We demonstrate by immunocytochemical analysis that PAK1 nuclear translocation is ligand-dependent: only PRL but not E2 stimulated PAK1 nuclear translocation. Tyrosyl phosphorylation of PAK1 is essential for this nuclear translocation because phospho-tyrosyl-deficient PAK1 Y3F mutant is retained in the cytoplasm in response to PRL. We confirmed these data by Western blot analysis of subcellular fractions. In 30 min of PRL treatment, only 48% of pTyr-PAK1 is retained in the cytoplasm of PAK1 WT clone while 52% re-distributes into the nucleus and pTyr-PAK1 shuttles back to the cytoplasm by 60 min of PRL treatment. In contrast, PAK1 Y3F is retained in the cytoplasm. E2 treatment causes nuclear translocation of neither PAK1 WT nor PAK1 Y3F. Finally, we show by an in vitro kinase assay that PRL but not E2 stimulates PAK1 kinase activity in the nuclear fraction. Thus, PAK1 nuclear translocation is ligand-dependent: PRL activates PAK1 and induces translocation of activated pTyr-PAK1 into nucleus while E2 activates pTyr-PAK1 only in the cytoplasm. - Highlights: • Prolactin but not estrogen causes translocation of PAK1 into nucleus. • Tyrosyl phosphorylation of PAK1 is required for nuclear localization. • Prolactin but not estrogen stimulates PAK1 kinase activity in nucleus.
Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T
2015-11-27
Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.
2015-01-01
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Energy Technology Data Exchange (ETDEWEB)
Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)
2015-11-27
Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.
Pituitary Androgen Receptor Signalling Regulates Prolactin but Not Gonadotrophins in the Male Mouse
O’Hara, Laura; Curley, Michael; Tedim Ferreira, Maria; Cruickshanks, Lyndsey; Milne, Laura; Smith, Lee B.
2015-01-01
Production of the androgen testosterone is controlled by a negative feedback loop within the hypothalamic-pituitary-gonadal (HPG) axis. Stimulation of testicular Leydig cells by pituitary luteinising hormone (LH) is under the control of hypothalamic gonadotrophin releasing hormone (GnRH), while suppression of LH secretion by the pituitary is controlled by circulating testosterone. Exactly how androgens exert their feedback control of gonadotrophin secretion (and whether this is at the level of the pituitary), as well as the role of AR in other pituitary cell types remains unclear. To investigate these questions, we exploited a transgenic mouse line (Foxg1Cre/+; ARfl/y) which lacks androgen receptor in the pituitary gland. Both circulating testosterone and gonadotrophins are unchanged in adulthood, demonstrating that AR signalling is dispensable in the male mouse pituitary for testosterone-dependent regulation of LH secretion. In contrast, Foxg1Cre/+; ARfl/y males have a significant increase in circulating prolactin, suggesting that, rather than controlling gonadotrophins, AR-signalling in the pituitary acts to suppress aberrant prolactin production in males. PMID:25799562
Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family
Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu
2013-01-01
EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...
FGF: A web tool for Fishing Gene Family in a whole genome database
DEFF Research Database (Denmark)
Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong
2007-01-01
Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...
Energy Technology Data Exchange (ETDEWEB)
Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)
2012-07-13
Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
International Nuclear Information System (INIS)
Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin
2012-01-01
Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.
Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.
Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo
2015-01-01
To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.
Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin
2015-11-01
The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.
Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S
2017-11-01
Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.
DEFF Research Database (Denmark)
Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen
2004-01-01
Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...
DEFF Research Database (Denmark)
Glintborg, Dorte; Altinok, Magda; Mumm, Hanne
2014-01-01
-hydroxyprogesterone and cortisol levels. In multiple regression analyses, prolactin was inversely associated with LDL and positively associated with estradiol, 17-hydroxyprogesterone and cortisol after correcting for age, BMI and smoking status in patients with PCOS. LIMITATIONS, REASONS FOR CAUTION: The study design...
Identification of the trehalose-6-phosphate synthase gene family in ...
Indian Academy of Sciences (India)
2015-03-04
Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.
International Nuclear Information System (INIS)
Milkov, V.; Maleeva, A.; Tsvetkov, M.; Visheva, N.
1986-01-01
The hormone levels were measured before and after hormonal therapy. Statistically significant changes in the levels of the hormones in this study were recognized (p<0,001) as a result of treatment with estrogen preparations. Plasma prolactin was raised before estrogen therapy (statistically significant rise, p<0,001), as compared to the levels in a control group of normal subjects. A mild tendency was observed toward its increase, depending on the duration of treatment. The results of this study show that control of the hormonal status of patients with prostate cancer may serve as reliable criterion in evaluating the effectiveness of hormonal therapy. The changes in prolactin levels are evidence of hormonal disbalance, which may be observed in these patients
International Nuclear Information System (INIS)
Kelly, W.F.; Mashiter, K.; Doyle, F.H.; Banks, L.M.; Joplin, G.F.
1978-01-01
Twenty one young female patients with amenorrhoea, galactorrhoea or infertility were treated by 90 Y pituitary implantation of 20,000 rads. There was no morbidity. In all patients serum prolactin values were elevated and radiographs of the pituitary fossa were abnormal. After implantation the median fall in prolactin values was 60 per cent while there was no deterioration in pituitary function if normal pre-operatively. Luteinizing hormone values, both basally and following godanotrophin-releasing hormone, rose to normal after operation; several instances of sellar remodelling were observed radiologically, and no instance of relapse was found. So far nine patients desiring fertility have become pregnant, three without any additional therapy. No case of tumour expansion was observed during pregnancy. 90 Y implantation in patients requiring fertility is competitive with surgical methods, and together with a short course of bromocriptine if needed, could prove to be the treatment of choice. (author)
Phylogenetic analysis of the MS4A and TMEM176 gene families.
Directory of Open Access Journals (Sweden)
Jonathan Zuccolo
2010-02-01
Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.
Expression of REG family genes in human inflammatory bowel diseases and its regulation
Directory of Open Access Journals (Sweden)
Chikatsugu Tsuchida
2017-12-01
Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.
Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon
Directory of Open Access Journals (Sweden)
Qing XU
2018-01-01
Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia
2014-10-01
MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.
Bessone, S; Vidal, F; Le Bouc, Y; Epelbaum, J; Bluet-Pajot, M T; Darmon, M
1999-10-01
Gene trapping was used in embryonic stem (ES) cells in an attempt to inactivate genes involved in development. The Emk (ELKL motif kinase) gene has been disrupted and a mutant mouse line derived. Previous work had shown that EMK kinases, called MARK in the rat, exert a major control on microtubule stability by phosphorylating microtubule-associated proteins and that genes homologous to Emk in yeast or Caenorhabditis elegans are essential for cell and embryonic polarity. Although we found the Emk gene to be active in the preimplantation mouse embryo and then to show a widespread expression, Emk-null mice had no embryonic defect and were viable. They show an overall proportionate dwarfism and a peculiar hypofertility: homozygotes are not fertile when intercrossed, but are fertile in other types of crosses. Insulin-like growth factor I (IGF I) and IGF-binding protein 3 (IGFBP3) were reduced in the plasma of homozygotes of both sexes. A direct implication of the EMK kinase in IGF I plasmatic production is unlikely because the Emk gene does not seem to be expressed in hepatocytes. Nevertheless, GH assayed at arbitrary times in plasma did not show differences between genotypes and GH concentrations in pituitary extracts were not found to be altered in homozygotes. Our results, though, do not exclude the possibility that in the mutants the overall quantity of GH secreted daily is reduced. Our observation of a smaller size of the pituitaries of the mutants is in favor of this hypothesis. The prolactin concentration in the pituitaries was much lowered in homozygous females, but it was normal in males. The possible involvement of EMK protein kinase in hormone secretion in the pituitary and/or the hypothalamus, via the microtubule network, is discussed. Copyright 1999 Academic Press.
Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.
Directory of Open Access Journals (Sweden)
Rocio Toro
Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.
International Nuclear Information System (INIS)
Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.
2010-01-01
Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels
Energy Technology Data Exchange (ETDEWEB)
Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)
2010-10-01
Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten
Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W
1993-10-01
Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].
Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian
2015-05-01
The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.
The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.
Directory of Open Access Journals (Sweden)
Daniel Menendez
2011-03-01
Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.
Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo
2017-11-01
Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease
Directory of Open Access Journals (Sweden)
Xiaoyan Huang
2017-01-01
Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.
Papp, Eszter; Balogun, Kayode; Banko, Nicole; Mohammadi, Hakimeh; Loutfy, Mona; Yudin, Mark H; Shah, Rajiv; MacGillivray, Jay; Murphy, Kellie E; Walmsley, Sharon L; Silverman, Michael; Serghides, Lena
2016-05-15
It has been reported that pregnant women receiving protease inhibitor (PI)-based combination antiretroviral therapy (cART) have lower levels of progesterone, which put them at risk of adverse birth outcomes, such as low birth weight. We sought to understand the mechanisms involved in this decline in progesterone level. We assessed plasma levels of progesterone, prolactin, and lipids and placental expression of genes involved in progesterone metabolism in 42 human immunodeficiency virus (HIV)-infected and 31 HIV-uninfected pregnant women. In vitro studies and a mouse pregnancy model were used to delineate the effect of HIV from that of PI-based cART on progesterone metabolism. HIV-infected pregnant women receiving PI-based cART showed a reduction in plasma progesterone levels (P= .026) and an elevation in placental expression of the progesterone inactivating enzyme 20-α-hydroxysteroid dehydrogenase (20α-HSD; median, 2.5 arbitrary units [AU]; interquartile range [IQR], 1.00-4.10 AU), compared with controls (median, 0.89 AU; IQR, 0.66-1.26 AU;P= .002). Prolactin, a key regulator of 20α-HSD, was lower (P= .012) in HIV-infected pregnant women. We observed similar data in pregnant mice exposed to PI-based cART. In vitro inhibition of 20α-HSD activity in trophoblast cells reversed PI-based cART-induced decreases in progesterone levels. Our data suggest that the decrease in progesterone levels observed in HIV-infected pregnant women exposed to PI-based cART is caused, at least in part, by an increase in placental expression of 20α-HSD, which may be due to lower prolactin levels observed in these women. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates
Directory of Open Access Journals (Sweden)
Eliane Evanovich
2016-01-01
Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.
Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).
Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2013-07-25
The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexity of rice Hsp100 gene family: lessons from rice genome ...
Indian Academy of Sciences (India)
Madhu Sudhan
2007-03-29
Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...
Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri
2011-03-28
A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran
2010-01-15
The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.
Neurexin gene family variants as risk factors for autism spectrum disorder.
Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran
2018-01-01
Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Yan Liu
2018-03-01
Full Text Available The fish brain plays an important role in controlling growth, development, reproduction, and adaptation to environmental change. However, few studies stem from the perspective of whole transcriptome change in a fish brain and its response to long-term hypersaline stress. This study compares the differential transcriptomic responses of juvenile Nile tilapia (Oreochromis niloticus maintained for 8 weeks in brackish water (16 practical salinity units, psu and in freshwater. Fish brains from each treatment were collected for RNA-seq analysis to identify potential genes and pathways responding to hypersaline stress. A total of 27,089 genes were annotated, and 391 genes were expressed differently in the salinity treatment. Ten pathways containing 40 differentially expressed genes were identified in the tilapia brain. Antigen processing and presentation and phagosome were the two principally affected pathways in the immune system. Thirty-one of 40 genes were involved in various expressions associated with environmental information processing pathways such as neuroactive ligand-receptor interaction, cytokine-cytokine receptor interaction, the Jak-STAT signaling pathway, cell adhesion molecules (CAMs, and the PI3K-Akt signaling pathway, which are the upstream pathways for modulation of immunity and osmoregulation. The most-changed genes (>5-fold were all down-regulated, including four growth hormone/prolactin gene families, i.e., prolactin precursor (−10.62, prolactin-1 (−11, somatotropin (−10.15, somatolactin-like (−6.18, and two other genes [thyrotropin subunit beta (−7.73 and gonadotropin subunit beta-2 (−5.06] that stimulated prolactin release in tilapia. The downregulation pattern of these genes corroborates the decrease in tilapia immunity with increasing salinity and reveals an adaptive mechanism of tilapia to long-term hypersaline stress. Ovarian steroidogenesis, isoquinoline alkaloid biosynthesis, and phenylalanine metabolism are the
Genetic diversity of bitter taste receptor gene family in Sichuan
Indian Academy of Sciences (India)
Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or
X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes
DEFF Research Database (Denmark)
Hu, H; Haas, S A; Chelly, J
2016-01-01
X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Directory of Open Access Journals (Sweden)
Carolina eRípodas
2015-01-01
Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.
Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.
Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng
2014-04-18
The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ashutosh ePandey
2016-02-01
Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.
Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming
2013-02-01
Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.
[Genome-wide identification and expression analysis of the WRKY gene family in peach].
Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long
2016-03-01
The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.
Genome-wide identification and expression analysis of the CIPK gene family in cassava
Directory of Open Access Journals (Sweden)
Wei eHu
2015-10-01
Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.
Stimulatory effect of clebopride on human prolactin secretion.
Perez-Lopez, F R; Legido, A; Sisskin, M; Abos, M D
1980-11-01
Serum levels of prolactin (PRL), luteinizing hormone (LH), and follicle-stimulating hormone (FSH) were measured in normally cycling women and normal men before and after oral admiministration of 1 mg of clebopride, a derivative of procainamide used in the treatment of gastrointestinal diseases. Clebopride produced a significant increase (P clebopride were noted upon the circulating levels of LH and FSH. The peak PRL response to clebopride was unaffected by pretreatment with 100 mg of nomifensine, although the secretory area from 120 to 210 minutes after clebopride was greater (P clebopride, the PRL response was completely abolished as compared with the control experiment (P clebopride could be the explanation for the occasional menstrual disorders and galactorrhea registered in some cases of long-term treatment.
Directory of Open Access Journals (Sweden)
Heger Christopher D
2010-12-01
Full Text Available Abstract Background Prolactin is a polypeptide hormone responsible for proliferation and differentiation of the mammary gland. More recently, prolactin's role in mammary carcinogenesis has been studied with greater interest. Studies from our laboratory and from others have demonstrated that three specific isoforms of the prolactin receptor (PRLR are expressed in both normal and cancerous breast cells and tissues. Until now, reliable isoform specific antibodies have been lacking. We have prepared and characterized polyclonal antibodies against each of the human PRLR isoforms that can effectively be used to characterize human breast cancers. Methods Rabbits were immunized with synthetic peptides of isoform unique regions and immune sera affinity purified prior to validation by Western blot and immunohistochemical analyses. Sections of ductal and lobular carcinomas were stained with each affinity purified isoform specific antibody to determine expression patterns in breast cancer subclasses. Results We show that the rabbit antibodies have high titer and could specifically recognize each isoform of PRLR. Differences in PRLR isoform expression levels were observed and quantified using histosections from xenografts of established human breast cancer cells lines, and ductal and lobular carcinoma human biopsy specimens. In addition, these results were verified by real-time PCR with isoform specific primers. While nearly all tumors contained LF and SF1b, the majority (76% of ductal carcinoma biopsies expressed SF1a while the majority of lobular carcinomas lacked SF1a staining (72% and 27% had only low levels of expression. Conclusions Differences in the receptor isoform expression profiles may be critical to understanding the role of PRL in mammary tumorigenesis. Since these antibodies are specifically directed against each PRLR isoform, they are valuable tools for the evaluation of breast cancer PRLR content and have potential clinical importance in
Zingler, Emilie; Amato, Angélica Amorim; Zanatta, Alysson; Vogt, Maria de Fátima Brito; Wanderley, Miriam da Silva; Mariani Neto, Coríntio; Zaconeta, Alberto Moreno
2017-02-01
Case report of a 39-year-old intended mother of a surrogate pregnancy who underwent induction of lactation by sequential exposure to galactagogue drugs (metoclopramide and domperidone), nipple mechanical stimulation with an electric pump, and suction by the newborn. The study aimed to analyze the effect of each step of the protocol on serum prolactin levels, milk secretion and mother satisfaction, in the set of surrogacy. Serum prolactin levels and milk production had no significant changes. Nevertheless, the mother was able to breastfeed for four weeks, and expressed great satisfaction with the experience. As a conclusion, within the context of a surrogate pregnancy, breastfeeding seems to bring emotional benefits not necessarily related to an increase in milk production. Thieme-Revinter Publicações Ltda Rio de Janeiro, Brazil.
Prolactin-dependent modulation of organogenesis in the vertebrate: Recent discoveries in zebrafish.
Nguyen, Nhu; Stellwag, Edmund J; Zhu, Yong
2008-11-01
The scientific literature is replete with evidence of the multifarious functions of the prolactin (PRL)/growth hormone (GH) superfamily in adult vertebrates. However, little information is available on the roles of PRL and related hormones prior to the adult stage of development. A limited number of studies suggest that GH functions to stimulate glucose transport and protein synthesis in mouse blastocytes and may be involved during mammalian embryogenesis. In contrast, the evidence for a role of PRL during vertebrate embryogenesis is limited and controversial. Genes encoding GH/PRL hormones and their respective receptors are actively transcribed and translated in various animal models at different time points, particularly during tissue remodeling. We have addressed the potential function of GH/PRL hormones during embryonic development in zebrafish by the temporary inhibition of in vivo PRL translation. This treatment caused multiple morphological defects consistent with a role of PRL in embryonic-stage organogenesis. The affected organs and tissues are known targets of PRL activity in fish and homologous structures in mammalian species. Traditionally, the GH/PRL hormones are viewed as classical endocrine hormones, mediating functions through the circulatory system. More recent evidence points to cytokine-like actions of these hormones through either an autocrine or a paracrine mechanism. In some situations they could mimic actions of developmentally regulated genes as suggested by experiments in multiple organisms. In this review, we present similarities and disparities between zebrafish and mammalian models in relation to PRL and PRLR activity. We conclude that the zebrafish could serve as a suitable alternative to the rodent model to study PRL functions in development, especially in relation to organogenesis.
Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth
2012-06-06
As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.
Chromosomal evolution of the PKD1 gene family in primates
Directory of Open Access Journals (Sweden)
Krawczak Michael
2008-09-01
Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative
Directory of Open Access Journals (Sweden)
Serbielle Céline
2012-12-01
Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in
Directory of Open Access Journals (Sweden)
Saleha S
2016-06-01
Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.
Ajmal, M; Zafar, S; Hameed, A
2016-01-01
ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411
Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.
Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge
2016-01-01
The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.
Directory of Open Access Journals (Sweden)
Tianyu Zhou
2015-01-01
Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.
Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang
2015-01-01
Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
DEFF Research Database (Denmark)
Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.
2011-01-01
challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...
Phylogenetic Analysis of the MS4A and TMEM176 Gene Families
Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.
2010-01-01
Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.
Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang
2012-04-01
Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress
Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na
2017-07-15
Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Yokoro Kenjiro
1984-01-01
Female W/Fu rats were exposed to various doses of respective radiation and some of these irradiated rats further received a continuous supply of prolactin by means of grafting a prolactin producing pituitary tumor as a promoter to make easier the detection of carcinogenic effect of radiation. The results show that, the carcinogenic effect of 2.0 MeV fission neutrons is surprisingly higher than those of others; being about 30, 14 and 4.5 times as high as X-rays, 14.1 MeV fast neutrons and 0.025 eV thermal neutrons respectively. The irradiation field of fission radiation is equivalent to the atomic bomb that exploded in Hiroshima in 1945, so these experimental findings may have some relevance to the recent study on the reassessment of radiation dose of both neutrons and gamma-rays produced by atomic bomb in Hiroshima and Nagasaki
Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.
1993-01-01
The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.
Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei
2015-02-01
WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.
Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.
Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan
2015-09-08
WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought
International Nuclear Information System (INIS)
Simionescu, L.
1979-10-01
Radioimmunoassay procedures for testosterone, thyroglobulin, gonadotropin-inhibiting urinary substance (GIS), prolactin, follicle-stimulating hormone, luteinizing hormone (LH) and vasopressin were developed with reagents either locally produced or obtained from other sources. Studies of the effects of a pesticide, Malathion, on serum prolactin, FSH and LH levels in rats and of the effects of two herbicides, Amitrol and Atrazin, on thyroglobulin levels in human thyroid cell cultures were carried out. In the former, significant effects of Malathion on serum prolactin, FSH and LH levels, depending on dose level and mode of administration, were observed. In the latter, thyroglobulin levels in the cell cultures were proved resistant to Amitrol and Atrazin. The significance of these findings is discussed
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D
2017-11-07
The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.
Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A
2016-12-01
Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Directory of Open Access Journals (Sweden)
Ogunjumo Oluwasanmi
2004-06-01
Full Text Available Abstract Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.
The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains
Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A
2004-01-01
Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903
Hobson, Neil; Deyholos, Michael K
2013-05-23
Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require
Prolactin induces apoptosis of lactotropes in female rodents.
Directory of Open Access Journals (Sweden)
Jimena Ferraris
Full Text Available Anterior pituitary cell turnover occurring during female sexual cycle is a poorly understood process that involves complex regulation of cell proliferation and apoptosis by multiple hormones. In rats, the prolactin (PRL surge that occurs at proestrus coincides with the highest apoptotic rate. Since anterior pituitary cells express the prolactin receptor (PRLR, we aimed to address the actual role of PRL in the regulation of pituitary cell turnover in cycling females. We showed that acute hyperprolactinemia induced in ovariectomized rats using PRL injection or dopamine antagonist treatment rapidly increased apoptosis and decreased proliferation specifically of PRL producing cells (lactotropes, suggesting a direct regulation of these cell responses by PRL. To demonstrate that apoptosis naturally occurring at proestrus was regulated by transient elevation of endogenous PRL levels, we used PRLR-deficient female mice (PRLRKO in which PRL signaling is totally abolished. According to our hypothesis, no increase in lactotrope apoptotic rate was observed at proestrus, which likely contributes to pituitary tumorigenesis observed in these animals. To decipher the molecular mechanisms underlying PRL effects, we explored the isoform-specific pattern of PRLR expression in cycling wild type females. This analysis revealed dramatic changes of long versus short PRLR ratio during the estrous cycle, which is particularly relevant since these isoforms exhibit distinct signaling properties. This pattern was markedly altered in a model of chronic PRLR signaling blockade involving transgenic mice expressing a pure PRLR antagonist (TGΔ1-9-G129R-hPRL, providing evidence that PRL regulates the expression of its own receptor in an isoform-specific manner. Taken together, these results demonstrate that i the PRL surge occurring during proestrus is a major proapoptotic signal for lactotropes, and ii partial or total deficiencies in PRLR signaling in the anterior pituitary
Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi
2007-03-01
To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H
2016-01-01
The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.
Directory of Open Access Journals (Sweden)
Ridhi eGoel
2016-03-01
Full Text Available The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/ development including fruit ripening process respectively.
The Role of the S40 Gene Family in Leaf Senescence
Directory of Open Access Journals (Sweden)
Muhammad Jehanzeb
2017-10-01
Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.
[Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].
Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen
2015-08-01
To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.
New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands
Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.
2006-01-01
Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the
International Nuclear Information System (INIS)
Affonso, Regina
2000-01-01
Different vector elements, that can determine a high expression level of a form of human prolactin (taghPrl) in bacterial cytoplasm, were studied. Expression conditions were first optimized for a reference vector, which was used to transform different strains of E. coli: HB2151, RRI and RB791. The highest expression level (113 ±16 μg/mL.A 600 ) was obtained in HB2151, after activation with only 0.1 mM IPTG. At this point the influence of the transcription terminator (g32 from bacteriophage T4), of the translation enhancer (g10 from bacteriophage T7), of the promoter (λP L or tac) and of the antibiotic resistance gene (amp r or kan r ) were studied. The first three elements did not show any significant influence, at least in our systems. On the contrary, the analysis of the influence of amp r and kan r genes showed, unexpectedly, that the presence of the last one provides an approximately 5-fold higher expression for taghPrl in E. coli cytoplasm. Finally, an appropriate extraction, solubilization, renaturation and purification process, able to provide a monomeric form of taghPrl, was studied. A method utilizing urea and mercaptoethanol as solubilizing agents and a dialysis as a renaturation procedure, provided with some modifications, one of the highest yields ever reported in the literature: 35.4 ± 4.5% of total recovery. Moreover, the biological activity of the taghPrl obtained, when tested in the Nb2 cell proliferation assay, was of the same order of that shown by the International Standard of human prolactin of pituitary origin. These data show that the cytoplasmic expression system here described, which can provide an expression efficiency 50-100 - fold higher than the periplasmic expression, can represent a valid alternative for the production of this and of other hormones of pharmaceutical interest and grade. (author)
Institute of Scientific and Technical Information of China (English)
Zhen-lin ZHANG; Jin-wei HE; Yue-juan QIN; Yun-qiu HU; Miao LI; Yu-juan LIU; Hao ZHANG; Wei-wei HU
2007-01-01
Aim: To assess the contribution of single nucleotide polymorphisms (SNP) and haplotypes in the peroxisome proliferator-activated receptor-γ co-activator-1(PPARGC1) and adiponectin genes to normal bone mineral density (BMD) variation in healthy Chinese women and men. Methods: We performed population-based (ANOVA) and family-based (quantitative trait locus transmission disequi-librium test) association studies of PPARGC1 and adiponectin genes. SNP in the 2 genes were genotyped. BMD was measured using dual-energy X-ray absorptiometry in the lumbar spine and hip in 401 nuclear families with a total of1260 subjects, including 458 premenopausal women, 20-40 years of age; 401 post-menopausal women (mothers), 43-74 years of age; and 401 men (fathers), 49-76years of age. Results: Significant within-family association was found between the Thr394Thr polymorphism in the PPGAGC1 gene and peak BMD in the femoral neck (P=0.026). Subsequent permutations were in agreement with this significant within-family association result (P=0.016), but Thr394Thr SNP only accounted for0.7% of the variation in femoral neck peak BMD. However, no significant within-family association was detected between each SNP in the adiponect in gene and peak BMD. Although no significant association was found between BMD and SNP in the PPARGC1 and adiponectin genes in both men and postmenopausal women, haplotype 2 (T-T) in the adiponect in gene was associated with lumbar spine BMD in postmenopausal women (P=0.019). Conclusion: Our findings sug-gest that Thr394Thr SNP in the PPARGC1 gene was associated with peak BMD in the femoral neck in Chinese women. Confirmation of our results is needed in other populations and with more functional markers within and flanking the PPARGC1 or adiponectin genes region.
International Nuclear Information System (INIS)
Poland, R.E.; Rubin, R.T.
1981-01-01
A radioimmunoassay (RIA) for measurement of serum haloperidol is described. Compared to gaschromatography (GC), RIA vaues average 40% higher. However, a simple organic extraction of serum yields statistically equivalent RIA and GC haloperidol determinations. For both men and women combined, there was a positive correlation between dose (mg/kg/day) and steady-state serum haloperidol level (r = +0.86) and between steady-state serum haloperidol and serum prolactin (PRL) concentration
International Nuclear Information System (INIS)
Oliveira, B.C. de.
1979-01-01
Stimulus and supression tests of prolactin secretion and reserve evaluation of others hypophyseal trophin in thirty-seven patients, of feminine sex with galactorrhea and twelve normal volunteers with the objective of determinate the validity for etiologic diagnostic of pathologic galactorrhea are described. Simple radiography of brain and sella turcica on anteroposterior incidence and profile followed by plane tomography in all patients with pathological galactorrhea are also presented. (author)
Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J
2018-05-01
Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Leiomodins: larger members of the tropomodulin (Tmod) gene family
Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.
2001-01-01
The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.
Prolactin-Induced Tyrosine Phosphorylation, Activation and ReceptorAssociation of Focal Adhesion Kinase (FAK) in Mammary Epithelial Cells. Suzanne E. Fenton1 and Lewis G. Sheffield2. 1U.S. Environmental ProtectionAgency, MD-72, Research Triangle Park, NC 27711, and
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Cushing's Syndrome caused by pigmented adrenocortical micro nodular dysplasia - A familial case
Energy Technology Data Exchange (ETDEWEB)
Gomez-Segovia, I; Gallowitsch, H J; Kresnik, E; Kumnig, G; Mikosch, P; Lind, P [Dept.of Nuclear Medicine and Endocrinology, LKH Klagenfurt (Austria)
2002-09-01
Introduction: We present a Case of Cushing's syndrome (CS) in a 16 year old male adolescent. Adrenocortical micro nodular dysplasia is a rare cause of CS. It mostly develops in the first two decades of life. In pathogenesis a stimulatory effect of circulating Immunoglobulins on adrenal steroidogenesis has been postulated. Familial cases have been reported in relation to Carney's Syndrome. We report the clinical case at first diagnosis and preoperative follow up of 1 year prior to treatment. The leading symptoms were severe bilateral (fibrotic) gynaecomastia, weight gain and growth retardation, without hypertension,but osteoporosis, secondary hypogonadism and glucose intolerance. Laboratory findings and the results of functional tests were diagnostic for CS. In addition LDH (I-131 Isotopes), CK, Lipoproteins, GPT, Androstendion, Prolactin were elevated. MRI abdomen revealed a slight enlargement of the adrenals, and suspected a bilateral micro nodular dysplasia. Iodo-cholesterol-scan under dexamethason suppression showed a diffuse bilateral Iodo-cholesterol uptake confirming the autonomous production of cortisol bilateral in the adrenals.Whole body bone scan showed a diffuse reduced diphosphonate uptake in the skeleton and the growth plates. The bone mineral density was significantly reduced.Radiologically osteoporosis was overt. The rapid increase of free urinary cortisol excretion/24h within one year of observation led to a total bilateral adrenalectomy. Postoperative 5 year follow up examinations. Documentation of the outcome and recovery of clinical signs,symptoms and laboratory findings, discussion about the most appropriate long-term substitution therapy. Familial anamnesis:affected family member was the father (micro nodular bilateral adrenocortical dysplasia), the aunt (pararenal incidentaloma, histologically lipoma) and a cousin (micro nodular adrenocortical dysplasia). Sequential analysis of the menin gene from the patient was negative.The detection of
Cushing's Syndrome caused by pigmented adrenocortical micro nodular dysplasia - A familial case
International Nuclear Information System (INIS)
Gomez-Segovia, I.; Gallowitsch, H.J.; Kresnik, E.; Kumnig, G.; Mikosch, P.; Lind, P.
2002-01-01
Introduction: We present a Case of Cushing's syndrome (CS) in a 16 year old male adolescent. Adrenocortical micro nodular dysplasia is a rare cause of CS. It mostly develops in the first two decades of life. In pathogenesis a stimulatory effect of circulating Immunoglobulins on adrenal steroidogenesis has been postulated. Familial cases have been reported in relation to Carney's Syndrome. We report the clinical case at first diagnosis and preoperative follow up of 1 year prior to treatment. The leading symptoms were severe bilateral (fibrotic) gynaecomastia, weight gain and growth retardation, without hypertension,but osteoporosis, secondary hypogonadism and glucose intolerance. Laboratory findings and the results of functional tests were diagnostic for CS. In addition LDH (I-131 Isotopes), CK, Lipoproteins, GPT, Androstendion, Prolactin were elevated. MRI abdomen revealed a slight enlargement of the adrenals, and suspected a bilateral micro nodular dysplasia. Iodo-cholesterol-scan under dexamethason suppression showed a diffuse bilateral Iodo-cholesterol uptake confirming the autonomous production of cortisol bilateral in the adrenals.Whole body bone scan showed a diffuse reduced diphosphonate uptake in the skeleton and the growth plates. The bone mineral density was significantly reduced.Radiologically osteoporosis was overt. The rapid increase of free urinary cortisol excretion/24h within one year of observation led to a total bilateral adrenalectomy. Postoperative 5 year follow up examinations. Documentation of the outcome and recovery of clinical signs,symptoms and laboratory findings, discussion about the most appropriate long-term substitution therapy. Familial anamnesis:affected family member was the father (micro nodular bilateral adrenocortical dysplasia), the aunt (pararenal incidentaloma, histologically lipoma) and a cousin (micro nodular adrenocortical dysplasia). Sequential analysis of the menin gene from the patient was negative.The detection of
Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping
2013-09-01
SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Myo-Jing Kim
2014-12-01
Full Text Available Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP. Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T. This is the first report of such a case in Korea.
Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria
Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.
2003-01-01
The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.
Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A
2017-02-01
There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.