WorldWideScience

Sample records for production adaptor-mediated pcr

  1. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  2. Product differentiation during continuous-flow thermal gradient PCR.

    Science.gov (United States)

    Crews, Niel; Wittwer, Carl; Palais, Robert; Gale, Bruce

    2008-06-01

    A continuous-flow PCR microfluidic device was developed in which the target DNA product can be detected and identified during its amplification. This in situ characterization potentially eliminates the requirement for further post-PCR analysis. Multiple small targets have been amplified from human genomic DNA, having sizes of 108, 122, and 134 bp. With a DNA dye in the PCR mixture, the amplification and unique melting behavior of each sample is observed from a single fluorescent image. The melting behavior of the amplifying DNA, which depends on its molecular composition, occurs spatially in the thermal gradient PCR device, and can be observed with an optical resolution of 0.1 degrees C pixel(-1). Since many PCR cycles are within the field of view of the CCD camera, melting analysis can be performed at any cycle that contains a significant quantity of amplicon, thereby eliminating the cycle-selection challenges typically associated with continuous-flow PCR microfluidics.

  3. Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR).

    Science.gov (United States)

    Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J

    2015-04-15

    Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  5. Purification of nanoparticle PCR products and their topography observed with AFM

    International Nuclear Information System (INIS)

    Mi Lijuan; Wang Hubin; Chinese Academy of Sciences, Beijing; Li Bin; Zhou Hualan; Hu Jun

    2007-01-01

    Nanoparticle PCR (NP-PCR) is a new method to optimize PCR amplification. Suitable amount of Au nanoparticles can improve specificity, sensitivity and extension rate of PCR. In this paper, we compare efficiency of purifying NP-PCR products with different methods. In addition, topographies of DNA products in NP-PCR were observed with atomic force microscope (AFM). The results show that most of DNA products purified directly by routing method remain almost free due to less effect of nanoparticales. The yields decrease when the AuNPs were removed by high-speed centrifugation. A little amount of DNA subsided with AuNPs. (authors)

  6. The PCR-GLOBWB global hydrological reanalysis product

    Science.gov (United States)

    Wanders, Niko; Bierkens, Marc; Sutanudjaja, Edwin; van Beek, Rens

    2014-05-01

    fields with consideration of local topographic and orographic effects. Results show that the model parameters can be successfully calibrated, while corrections to the forcing precipitation fields are substantial. Topography has the largest impact on the corrected precipitation and globally the precipitation is reduced by 3%. The calibrated model output is compared to the reference run of PCR-GLOBWB before calibration showing significant improvement in simulation of the global terrestrial water cycle. The RMSE is reduced by 10% on average, leading to improved discharge simulations, especially under base flow situations. The main outcome of this work is a 1960-2010 global reanalysis dataset that includes extensive daily hydrological components, such as precipitation, evaporation and transpiration, snow, soil moisture, groundwater storage and discharge. This reanalysis product may be used for understanding land surface memory processes, initializing regional studies and operational forecasts, as well as evaluating and improving our understanding of spatio-temporal variation of meteorological and hydrological processes. Moreover, The PCR-GLOBWB data assimilation framework developed in this work can also be extended by including more observational data, including remotely sensed data reflecting the distribution of energy and water (e.g., heat fluxes and soil moisture storage).

  7. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR

    OpenAIRE

    Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

    2017-01-01

    Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos t...

  8. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  9. Figure 1. T. tor species. Figure 2. Long PCR products of ...

    Indian Academy of Sciences (India)

    Annam

    Figure 2. Long PCR products of mitochondrial DNA from the fish T. tor. Lane 1, amplified product using L-12321-Leu and S-LA-16S-H primers. Lane 2, amplified product using H-12321 –Leu and S-LA-16S-L primers. Lane M, 1-Kb DNA ladder. 8 kb ...

  10. PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products

    Directory of Open Access Journals (Sweden)

    Y. Erwanto

    2011-04-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 % was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication.

  11. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR)

    NARCIS (Netherlands)

    Ruiz-Villalba, Adrián; van Pelt-Verkuil, Elizabeth; Gunst, Quinn D.; Ruijter, Jan M.; van den Hoff, Maurice J. B.

    2017-01-01

    Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated

  12. PCR assay for the detection of Campylobacter in marinated and non-marinated poultry products

    DEFF Research Database (Denmark)

    Katzav, Marianne; Isohanni, Pauliina; Lund, Marianne

    2008-01-01

    and chicken products, respectively. In August, there was a peak with 28.9% positive Campylobacter samples. Campylobacter inoculation tests were carried out to test the detection limit of both methods. The PCR method used is faster than microbiological analyses. However, enrichment of the samples is necessary...

  13. Application of real-time PCR (qPCR) for characterization of microbial populations and type of milk in dairy food products.

    Science.gov (United States)

    Agrimonti, Caterina; Bottari, Benedetta; Sardaro, Maria Luisa Savo; Marmiroli, Nelson

    2017-09-08

    Dairy foods represent an important sector of the food market for their nutritional qualities and their organoleptic characteristics, which are often linked to tradition and to region. These products are typically protected by labels such as PDO (Protected Designation of Origin) and PGI (Protected Geographical Indication). Real-time PCR (qPCR) is a fundamental tool in "Food Genomics;" a discipline concerned with the residual DNA in food, which, alongside traditional physical and chemical methods, is frequently used to determine product safety, quality and authenticity. Compared to conventional or "end-point" PCR, qPCR incorporates continuous monitoring of reaction progress, thereby enabling quantification of target DNA. This review describes qPCR applications to the analysis of microbiota, and to the identification of the animal species source of milk from which dairy products have been made. These are important aspects for ensuring safety and authenticity. The various applications of qPCR are discussed, as well as advantages and disadvantages in comparison with other analytical methods.

  14. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

    Directory of Open Access Journals (Sweden)

    Adrián Ruiz-Villalba

    2017-12-01

    Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

  15. Molecular quantification of lactic acid bacteria in fermented milk products using real-time quantitative PCR.

    Science.gov (United States)

    Furet, Jean-Pierre; Quénée, Pascal; Tailliez, Patrick

    2004-12-15

    Real-time quantitative PCR assays were developed for the absolute quantification of lactic acid bacteria (LAB) (Streptococcus thermophilus, Lactobacillus delbrueckii, L. casei, L. paracasei, L. rhamnosus, L. acidophilus and L. johnsonii) in fermented milk products. The results of molecular quantification and classic bacterial enumeration did not differ significantly with respect to S. thermophilus and the species of the L. casei group which were detected in the six commercial fermented products tested, thus showing that DNA extraction was efficient and that genomic DNA solutions were free of PCR inhibitors. For L. delbrueckii, the results of bacterial enumeration were generally lower by a factor 10 to 100 than those of PCR quantification, suggesting a loss of viability during storage of the dairy products at 1-8 degrees C for most of the strains in this species. Real-time quantitative assays enabled identification of the species of lactic acid bacterial strains initially present in commercial fermented milk products and their accurate quantification with a detection threshold of 10(3) cells per ml of product.

  16. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  17. A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.

    Directory of Open Access Journals (Sweden)

    Diego Cardeñosa

    Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.

  18. The use of short and long PCR products for improved detection of prunus necrotic ringspot virus in woody plants.

    Science.gov (United States)

    Rosner, A; Maslenin, L; Spiegel, S

    1997-09-01

    The reverse transcriptase-polymerase chain reaction (RT-PCR) was used for detection of prunus necrotic ringspot virus (PNRSV) in dormant peach and almond trees by the application of two different pairs of primers yielding a short and a long product, respectively. The relative amount of the short (200 base pair, bp) product was higher than the longer (785 bp) product. PNRSV was detected better in plant tissues with a low virus concentration (e.g. dormant trees) by amplification of the short PCR product, whereas the long product was product was produced at higher virus titers. Simultaneous amplification of both short and long products was demonstrated using a three-primer mixture in a single reaction tube. In this assay, amplification of either PCR product indicated the presence of PNRSV-specific sequences in the plant tissue examined, thus covering a wide range of virus concentrations in a single test. Dilution of the RNA extracted from infected plant material resulted in a steep decline in the amplification of both short and long PCR products. In contrast, serial dilutions of the intermediate cDNA template differentially affected the amplification patterns: the relative amount of the short product increased whereas that of the long product decreased. These results may explain the preferential amplification of the short PCR product observed in samples containing low virus concentrations.

  19. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

    Directory of Open Access Journals (Sweden)

    Liang Rubing

    2010-08-01

    Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

  20. Automated purification of Borrelia burgdorferi s.l. PCR products with KingFisherTM magnetic particle processor prior to genome sequencing

    International Nuclear Information System (INIS)

    Maekinen, Johanna; Marttila, Harri; Viljanen, Matti K.

    2001-01-01

    Borrelia burgdorferi sensu lato genospecies were differentiated by PCR-based sequencing of the borrelial flagellin gene. To evaluate the usefulness of KingFisher TM magnetic particle processor in PCR product purification, borrelia PCR products were purified with KingFisher TM magnetic particle processor prior to cycle sequencing and the quality of the sequence data received was analyzed. KingFisher was found to offer a rapid and reliable alternative for borrelial PCR product purification

  1. Genotyping by PCR and High-Throughput Sequencing of Commercial Probiotic Products Reveals Composition Biases.

    Directory of Open Access Journals (Sweden)

    Wesley Morovic

    2016-11-01

    Full Text Available Recent advances in microbiome research have brought renewed focus on beneficial bacteria, many of which are available in food and dietary supplements. Although probiotics have historically been defined as microorganisms that convey health benefits when ingested in sufficient viable amounts, this description now includes the stipulation well defined strains, encompassing definitive taxonomy for consumer consideration and regulatory oversight. Here, we evaluated 52 commercial dietary supplements covering a range of labeled species, and determined their content using plate counting, targeted genotyping. Additionally, strain identities were assessed using methods recently published by the United States Pharmacopeial Convention. We also determined the relative abundance of individual bacteria by high-throughput sequencing (HTS of the 16S rRNA sequence using paired-end 2x250bp Illumina MiSeq technology. Using multiple methods, we tested the hypothesis that products do contain the quantitative amount of labeled bacteria, and qualitative list of labeled microbial species. We found that 17 samples (33% were below label claim for CFU prior to their expiration dates. A multiplexed-PCR scheme showed that only 30/52 (58% of the products contained a correctly labeled classification, with issues encompassing incorrect taxonomy, missing species and un-labeled species. The HTS revealed that many blended products consisted predominantly of Lactobacillus acidophilus and Bifidobacterium animalis subsp. lactis. These results highlight the need for reliable methods to qualitatively determine the correct taxonomy and quantitatively ascertain the relative amounts of mixed microbial populations in commercial probiotic products.

  2. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  3. Identification of new isolates of Bacillus thuringiensis using rep-PCR products and delta-endotoxin electron microscopy

    Directory of Open Access Journals (Sweden)

    A.S.G. Lima

    2002-01-01

    Full Text Available PCR has been used to analyze the distribution of REP (Repetitive Extragenic Palindromic and ERIC (Enterobacterial Repetitive Intergenic Consensus sequences (rep-PCR found within the genome of the bacterium Bacillus thuringiensis, with the purpose to analyze the genetic similarities among 56 subspecies samples and 95 field isolates. The PCR products were analyzed by EB-AGE (ethidium bromide-agarose electrophoresis and then submitted to banding comparisons, based on the Phyllip software algorithm. When the banding similarities were considered for comparison purposes among all the strains, the phylogenic tree patterns varied according to the rep-PCR primers considered, but, from a broader point of view, the ERIC sequences produced better results, which, together with electron microscopy analysis of the released parasporal bodies and colony morphology characteristics, allowed to detect two possible new subspecies of B. thuringiensis.

  4. An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

    Science.gov (United States)

    Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

    2014-04-03

    Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

  5. NGS tools for traceability in candies as high processed food products: Ion Torrent PGM versus conventional PCR-cloning.

    Science.gov (United States)

    Muñoz-Colmenero, Marta; Martínez, Jose Luis; Roca, Agustín; Garcia-Vazquez, Eva

    2017-01-01

    The Next Generation Sequencing methodologies are considered the next step within DNA-based methods and their applicability in different fields is being evaluated. Here, we tested the usefulness of the Ion Torrent Personal Genome Machine (PGM) in food traceability analyzing candies as a model of high processed foods, and compared the results with those obtained by PCR-cloning-sequencing (PCR-CS). The majority of samples exhibited consistency between methodologies, yielding more information and species per product from the PGM platform than PCR-CS. Significantly higher AT-content in sequences of the same species was also obtained from PGM. This together with some taxonomical discrepancies between methodologies suggest that the PGM platform is still pre-mature for its use in food traceability of complex highly processed products. It could be a good option for analysis of less complex food, saving time and cost per sample. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Purification and Concentration of PCR Products Leads to Increased Signal intensities with Fewer Allelic Drop-Outs and Artifacts

    DEFF Research Database (Denmark)

    Maria Irlund Pedersen, Line; Stangegaard, Michael; Mogensen, Helle Smidt

    2011-01-01

    and the quality of the DNA profiles without re-amplification of the sample. We have validated and implemented an automated method to purify and 2-fold concentrate PCR products resulting in allelic peaks with higher intensity (a median height across all loci from 130 to 404 RFU), fewer allelic dropouts...

  7. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  8. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Maryam AlTamimi

    2017-01-01

    Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

  9. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.

    2017-01-01

    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  10. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  11. Effectiveness of various cleaning and disinfectant products on Clostridium difficile spores of PCR ribotypes 010, 014 and 027

    Directory of Open Access Journals (Sweden)

    N. Kenters

    2017-06-01

    Full Text Available Abstract Background In healthcare facilities, Clostridium difficile infections spread by transmission of bacterial spores. Appropriate sporicidal disinfectants are needed to prevent development of clusters and outbreaks. In this study different cleaning/disinfecting wipes and sprays were tested for their efficacy against spores of distinctive C. difficile PCR ribotypes. Methods Four different products were tested; 1 hydrogen peroxide 1.5%; 2 glucoprotamin 1.5%; 3 a mixture of ethanol, propane and N-alkyl amino propyl glycine; and 4 a mixture of didecyldimonium chloride, benzalkonium chloride, polyaminopropyl, biguanide and dimenthicone as active ingredients. Tiles were contaminated with a test solution containing a concentration of 5x106CFU/ml spores of C. difficile strains belonging to PCR ribotypes 010, 014 or 027. The tiles were left to dry for an hour and then wiped or sprayed with one of the sprays or wipes as intended by the manufacturers. When products neutralized after 5 min, microbiological cultures and ATP measures were performed. Results Irrespective of the disinfection method, the microbial count log10 reduction of C. difficile PCR ribotype 010 was highest, followed by the reduction of C. difficile 014 and C. difficile 027. Overall, the wipes performed better than the sprays with the same active ingredient. On average, although not significantly, a difference in relative light units (RLU reduction between the wipes and sprays was found. The wipes had a higher RLU log10 reduction, but no significant difference for RLU reduction was observed between the different C. difficile strains (p = 0.16. Conclusion C. difficile spores of PCR ribotypes 014 and 027 strains are more difficult to eradicate than non-toxigenic PCR ribotype 010. In general, impregnated cleaning/disinfection wipes performed better than ready-to-use sprays. Wipes with hydrogen peroxide (1.5% showed the highest bactericidal activity.

  12. PCR-mediated recombination in amplification products derived from polyploid cotton.

    Science.gov (United States)

    Richard C. Cronn; M. Cedroni; T. Haselkorn; C. Grover; Jonathan F. Wendel

    2002-01-01

    PCR recombination describes a process of in vitro chimera formation from non-identical templates. The key requirements of this process is the inclusion of two partially homologous templates in one reaction, a condition met when amplifying any locus from polyploid organisms and members of multigene families from diploid organisms. Because polyploids possess two or more...

  13. Multiplex-PCR As a Rapid and Sensitive Method for Identification of Meat Species in Halal-Meat Products.

    Science.gov (United States)

    Alikord, Mahsa; Keramat, Javad; Kadivar, Mahdi; Momtaz, Hassan; Eshtiaghi, Mohammad N; Homayouni-Rad, Aziz

    2017-01-01

    Species identification and authentication in meat products are important subjects for ensuring the health of consumers. The multiplex-PCR amplification and species- specific primer set were used for the identification of horse, donkey, pig and other ruminants in raw and processed meat products. Oligonucleotid primers were designed and patented for amplification of species-specific mitochondrial DNA sequences of each species and samples were prepared from binary meat mixtures. The results showed that meat species were accurately determined in all combinations by multiplex-PCR, and the sensitivity of this method was 0.001 ng, rendering this technique open to and suitable for use in industrial meat products. It is concluded that more fraud is seen in lower percentage industrial meat products than in higher percentage ones. There was also more fraud found in processed products than in raw ones. This rapid and useful test is recommended for quality control firms for applying more rigorous controls over industrial meat products, for the benefit of target consumers. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  15. [Development and application of real-time PCR for identification and detection of horse meat in animal-origin products].

    Science.gov (United States)

    Li, Nan; Wang, Jiahui; Shen, Qing; Han, Chunhui; Zhang, Jing; Li, Fengqin; Xu, Jin; Jiang, Tao

    2013-11-01

    To develop a real-time PCR method for identification and detection of domestic horse meat (Equus caballus) in animal-origin products. The primer and TaqMan-probe was designed and synthesized according to the EU reference laboratory and 87 bp fragments was amplified for horse ingredients. The specificity and sensitivity was tested by artificially spiked horse meat into other domestic meat, such as cattle, sheep, pork, chicken, duck and rabbit. 122 samples of cattle and sheep products were random collected in Beijing market and the detection of horse meat was carried out. The real-time PCR in this study has high specificity and sensitivity for horse meat. No cross-reaction was observed between the horse and sheep, pork, chicken, duck and rabbit meat. There was little cross reaction between horse and cattle when the CT value reach 33. 81. The method can detect 0.1% of horse meat mixed with other domestic animal-origin products. No horse meat ingredients were detected in 122 samples in this survey. There was no horse meat mixed into cattle and sheep products in Beijing marked.

  16. Authentication of traditional game meat products by the use of species-specific PCR

    OpenAIRE

    Santos, Cristina; Melo, Vítor S.; Mafra, I.; Amaral, J.S.; Estevinho, Leticia M.; Oliveira, M.B.P.P.

    2011-01-01

    Authenticity evaluation in meat products encompasses many issues, including the fraudulent substitution of higher commercial valued meats by cheaper meats and the presence of undeclared species. Due to its characteristic and intensive flavour and its healthier composition, game meats are considered as delicacy products and command higher prices compared to other meats, thus being susceptible targets for frauds. The manufacture of traditional meat products is a long-established practice in ...

  17. By-product formation in repetitive PCR amplification of DNA libraries during SELEX.

    Science.gov (United States)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper; Mayer, Günter

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments. Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation and improving the success rate of aptamer selection.

  18. Practical tools to implement massive parallel pyrosequencing of PCR products in next generation molecular diagnostics.

    Directory of Open Access Journals (Sweden)

    Kim De Leeneer

    Full Text Available Despite improvements in terms of sequence quality and price per basepair, Sanger sequencing remains restricted to screening of individual disease genes. The development of massively parallel sequencing (MPS technologies heralded an era in which molecular diagnostics for multigenic disorders becomes reality. Here, we outline different PCR amplification based strategies for the screening of a multitude of genes in a patient cohort. We performed a thorough evaluation in terms of set-up, coverage and sequencing variants on the data of 10 GS-FLX experiments (over 200 patients. Crucially, we determined the actual coverage that is required for reliable diagnostic results using MPS, and provide a tool to calculate the number of patients that can be screened in a single run. Finally, we provide an overview of factors contributing to false negative or false positive mutation calls and suggest ways to maximize sensitivity and specificity, both important in a routine setting. By describing practical strategies for screening of multigenic disorders in a multitude of samples and providing answers to questions about minimum required coverage, the number of patients that can be screened in a single run and the factors that may affect sensitivity and specificity we hope to facilitate the implementation of MPS technology in molecular diagnostics.

  19. By-Product Formation in Repetitive PCR Amplification of DNA Libraries during SELEX

    DEFF Research Database (Denmark)

    Tolle, Fabian; Wilke, Julian; Wengel, Jesper

    2014-01-01

    The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recogniz......The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target......-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments....... Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation...

  20. Sika deer (Cervus nippon)-specific real-time PCR method to detect fraudulent labelling of meat and meat products.

    Science.gov (United States)

    Kaltenbrunner, Maria; Hochegger, Rupert; Cichna-Markl, Margit

    2018-05-08

    Since game meat is more valuable and expensive than meat from domesticated animal species it is a potential target for adulteration. Analytical methods must allow the identification and quantification of meat species to be applicable for the detection of fraudulent labelling. We developed a real-time PCR assay for the authentication of sika deer (Cervus nippon) and products thereof. The primer/probe system amplifies a 71 bp fragment of the kappa-casein precursor gene. Since the target sequence contained only one sika deer-specific base, we introduced a deliberate base mismatch in the forward primer. The real-time PCR assay did not show cross-reactivity with 19 animal and 49 plant species tested. Low cross-reactivity was observed with red deer, fallow deer, reindeer and moose. However, with a ΔCt value of ≥11.79 between sika deer and the cross-reacting species, cross-reactivity will not affect the accuracy of the method. LOD and LOQ, determined by analysing serial dilutions of a DNA extract containing 1% (w/w) sika deer DNA in pig DNA, were 0.3% and 0.5%, respectively. The accuracy was evaluated by analysing DNA mixtures and DNA isolates from meat extract mixtures and meat mixtures. In general, recoveries were in the range from 70 to 130%.

  1. Rep-PCR typing of Staphylococcus spp. strains in meat paste production line and identification of their origin

    Directory of Open Access Journals (Sweden)

    Ivan Manga

    2015-05-01

    Full Text Available A meat paste production line and its microbial parameters have been evaluated in single Czech company. The raw meat paste samples before heat treatment were tested positively for the presence of three staphylococci species: Staphylococcus aureus, Staphylococcus haemolyticus and Staphylococcus epidermidis. Subsequent microbial analysis of meat paste components and ingredients (fresh meat, water, spices, equipment identified only the spices used as positive for S. aureus (coriander, cinnamon, badian, mustard – (10 - 40 cfu/g and S. haemolyticus strains (juniper, ginger. The collection of sixteen collected strains (S. aureus (n = 4, S. haemolyticus (n = 4, S. epidermidis (n = 8 has been typed with the rep-PCR method utilising (GTG5 primer. Analysis of the fingerprints using the unweighted pair-group method using arithmetic averages (UPGMA clustering method revealed presence of eleven strain clusters with similarity lower than 90%: two fingerprint clusters of S. aureus, three individual clusters characteristic for S. haemolyticus and six different S. epidermidis specific clusters. The S. aureus strains from different types of spice were identical, resp. very similar. Molecular tracking composed from the rep-PCR analysis of acquired isolates and comparison among all collected fingerprints confirmed the spices to be the source of both S. aureus and S. haemolyticus strains identified in raw meat paste. The additional rep-PCR analysis of the S. epidermidis collection confirmed usability and performance of this method. The antibiotic susceptibility to fourteen individual antibiotics has been examined among the collected staphylococci strains. The predominant erythromycin resistance (68.8% was followed with the resistance to amoxicillin/clavulanic acid (56.2%. Other resistances observed were less frequent (clindamycin – 12.5%, oxacillin – 6.3%, tetracycline – 6.3%, sulphamethoxazole-trimethoprim – 6.3%, chloramphenicol – 6.3%, novobiocin – 6

  2. Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization

    Science.gov (United States)

    Furuta, Kazuyoshi; Nagashima, Saki; Inukai, Tsuyoshi; Masuta, Chikara

    2017-01-01

    One of the major problems in strawberry production is difficulty in diagnosis of anthracnose caused by Colletotrichum acutatum or Glomerella cingulata in latent infection stage. We here developed a diagnostic tool for the latent infection consisting of initial culturing of fungi, DNA extraction, synthesis of PCR-amplified probes and microtube hybridization (MTH) using a macroarray. The initial culturing step is convenient to lure the fungi out of the plant tissues, and to extract PCR-inhibitor-free DNA directly from fungal hyphae. For specific detection of the fungi, PCR primers were designed to amplify the fungal MAT1-2 gene. The subsequent MTH step using the PCR products as probes can replace the laborious electrophoresis step providing us sequence information and high-throughput screening. Using this method, we have conducted a survey for a few thousands nursery plants every year for three consecutive years, and finally succeeded in eliminating latent infection in the third year of challenge. PMID:28167891

  3. Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization

    Directory of Open Access Journals (Sweden)

    Kazuyoshi Furuta

    2017-02-01

    Full Text Available One of the major problems in strawberry production is difficulty in diagnosis of anthracnose caused by Colletotrichum acutatum or Glomerella cingulata in latent infection stage. We here developed a diagnostic tool for the latent infection consisting of initial culturing of fungi, DNA extraction, synthesis of PCR-amplified probes and microtube hybridization (MTH using a macroarray. The initial culturing step is convenient to lure the fungi out of the plant tissues, and to extract PCR-inhibitor-free DNA directly from fungal hyphae. For specific detection of the fungi, PCR primers were designed to amplify the fungal MAT1-2 gene. The subsequent MTH step using the PCR products as probes can replace the laborious electrophoresis step providing us sequence information and high-throughput screening. Using this method, we have conducted a survey for a few thousands nursery plants every year for three consecutive years, and finally succeeded in eliminating latent infection in the third year of challenge.

  4. Construction of a System for the Strawberry Nursery Production towards Elimination of Latent Infection of Anthracnose Fungi by a Combination of PCR and Microtube Hybridization.

    Science.gov (United States)

    Furuta, Kazuyoshi; Nagashima, Saki; Inukai, Tsuyoshi; Masuta, Chikara

    2017-02-01

    One of the major problems in strawberry production is difficulty in diagnosis of anthracnose caused by Colletotrichum acutatum or Glomerella cingulata in latent infection stage. We here developed a diagnostic tool for the latent infection consisting of initial culturing of fungi, DNA extraction, synthesis of PCR-amplified probes and microtube hybridization (MTH) using a macroarray. The initial culturing step is convenient to lure the fungi out of the plant tissues, and to extract PCR-inhibitor-free DNA directly from fungal hyphae. For specific detection of the fungi, PCR primers were designed to amplify the fungal MAT1-2 gene. The subsequent MTH step using the PCR products as probes can replace the laborious electrophoresis step providing us sequence information and high-throughput screening. Using this method, we have conducted a survey for a few thousands nursery plants every year for three consecutive years, and finally succeeded in eliminating latent infection in the third year of challenge.

  5. Study on sensitivity of southern blotting hybridization using a 32P-labeled probe of PCR products in detecting human cytomegalovirus

    International Nuclear Information System (INIS)

    Bu Hengfu; Chen Juan; Shen Rongsen; Ma Liren; Xu Yongqiang

    1996-01-01

    Southern blotting hybridization (SBH) using a 32 P-labeled probe is one of the most practical methods for genetic diagnosis of pathogen. On the basis of establishing PCR and nested PCR for detecting human cytomegalovirus (HCMV), a 32 P-labeled probe was prepared with the amplified products of 613 bp PCR outer primers and hybridized with 300 bp inner primer amplified product, resulting in increase in detecting sensitivity from 17 ng (in 1.2% agarose electrophoresis) before SBH to 500 pg (autoradiographed), in other words, increasing the sensitivity of detecting HCMV by 10 2 dilutions after using SBH. The method of PCR and SBH using a 32 P-labeled probe could detect less than 1 gene copy of HCMV, therefore, it is a rapid and reliable diagnosis method for detecting HCMV latent infection

  6. Tetraplex PCR assay involving double gene-sites discriminates beef and buffalo in Malaysian meat curry and burger products.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Hossain, S M Azad; Asing; Nizar, Nina Naquiah Ahmad; Uddin, Mohammad Nasir; Ali, Lokman; Asaduzzaman, Md; Akanda, Md Jahurul Haque

    2017-06-01

    Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. LPS-induced cytokine production in the monocytic cell line THP-1 determined by multiple quantitative competitive PCR (QC-PCR)

    DEFF Research Database (Denmark)

    Glue, C; Hansen, J B; Schjerling, P

    2002-01-01

    Quantifying cytokines on the protein level can be problematic because of low concentrations or degradation during sample handling. Aiming towards finding a simple method by which to quantify cytokines on the mRNA level, we combined existing and established molecular biology techniques. Based on t...... on the principle of quantitative competitive RT-PCR with a DNA-competitor, IL-1beta, IL-6, IL-12alpha and the housekeeping enzyme GAPDH are measured at levels down to 200 copies of mRNA.......Quantifying cytokines on the protein level can be problematic because of low concentrations or degradation during sample handling. Aiming towards finding a simple method by which to quantify cytokines on the mRNA level, we combined existing and established molecular biology techniques. Based...

  8. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  9. Quantification of ochratoxin A-producing molds in food products by SYBR Green and TaqMan real-time PCR methods

    DEFF Research Database (Denmark)

    Rodríguez, Alicia; Rodríguez, Mar; Luque, M. Isabel

    2011-01-01

    , usually reported in food products, were used as references. All strains were tested for OTA production by mycellar electrokinetic capillary electrophoresis (MECE) and high-pressure liquid chromatography-mass spectrometry (HPLC-MS). The ability of the optimized qPCR protocols to quantify OTA......Ochratoxin A (OTA) is a mycotoxin synthesized by a variety of different fungi, most of them from the genera Penicillium and Aspergillus. Early detection and quantification of OTA producing species is crucial to improve food safety. In the present work, two protocols of real-time qPCR based on SYBR......-producing molds was evaluated in different artificially inoculated foods. A good linear correlation was obtained over the range 1 x 104 to 10 conidia/g per reaction for all qPCR assays in the different food matrices (cooked and cured products and fruits). The detection limit in all inoculated foods ranged between...

  10. The potential of three different PCR-related approaches for the authentication of mixtures of herbal substances and finished herbal medicinal products.

    Science.gov (United States)

    Doganay-Knapp, Kirsten; Orland, Annika; König, Gabriele M; Knöss, Werner

    2018-04-01

    Herbal substances and preparations thereof play an important role in healthcare systems worldwide. Due to the variety of these products regarding origin, composition and processing procedures, appropriate methodologies for quality assessment need to be considered. A majority of herbal substances is administered as multicomponent mixtures, especially in the field of Traditional Chinese Medicine and ayurvedic medicine, but also in finished medicinal products. Quality assessment of complex mixtures of herbal substances with conventional methods is challenging. Thus, emphasis of the present work was directed on the development of complementary methods to elucidate the composition of mixtures of herbal substances and finished herbal medicinal products. An indispensable prerequisite for the safe and effective use of herbal medicines is the unequivocal authentication of the medicinal plants used therein. In this context, we investigated the potential of three different PCR-related methods in the characterization and authentication of herbal substances. A multiplex PCR assay and a quantitative PCR (qPCR) assay were established to analyze defined mixtures of the herbal substances Quercus cortex, Juglandis folium, Aristolochiae herba, Matricariae flos and Salviae miltiorrhizae radix et rhizoma and a finished herbal medicinal product. Furthermore, a standard cloning approach using universal primers targeting the ITS region was established in order to allow the investigation of herbal mixtures with unknown content. The cloning approach had some limitations regarding the detection/recovery of the components in defined mixtures of herbal substances, but the complementary use of two sets of universal primer pairs increased the detection of components out of the mixture. While the multiplex PCR did not retrace all components in the defined mixtures of herbal substances, the established qPCR resulted in simultaneous and specific detection of the five target sequences in all defined

  11. Quantitative real-time PCR technique for the identification of E. coli residual DNA in streptokinase recombinant product.

    Science.gov (United States)

    Fazelahi, Mansoureh; Kia, Vahid; Kaghazian, Hooman; Paryan, Mahdi

    2017-11-26

    Recombinant streptokinase is a biopharmaceutical which is usually produced in E. coli. Residual DNA as a contamination and risk factor may remain in the product. It is necessary to control the production procedure to exclude any possible contamination. The aim of the present study was to develop a highly specific and sensitive quantitative real-time PCR-based method to determine the amount of E. coli DNA in recombinant streptokinase. A specific primers and a probe was designed to detect all strains of E. coli. To determine the specificity, in addition to using NCBI BLASTn, 28 samples including human, bacterial, and viral genomes were used. The results confirmed that the assay detects no genomic DNA but E. coli's and the specificity was determined to be 100%. To determine the sensitivity and limit of detection of the assay, a 10-fold serial dilution (10 1 to 10 7 copies/µL) was tested in triplicate. The sensitivity of the test was determined to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay were determined to be 0.86 and 1.69%, respectively. Based on the results, this assay can be used as an accurate method to evaluate the contamination of recombinant streptokinase in E. coli.

  12. Lactobacillus genus identification isolated from gastrointestinal tract of chickens after bee products application using FISH and RTQ PCR methods

    Directory of Open Access Journals (Sweden)

    Miroslava Kačániová

    2013-05-01

    Full Text Available The general objective of this study was to examine the effect of bee products on the lactobacilli colonization of chickens. Bee products were administered to both feed mixtures in various amounts in addition to the control group. First experimental group was with propolis in feed mixture with the addition of 400 mg propolis per 1 kg of compound and second group was with pollen in feed mixture with the addition of 450 mg pollen per 1 kg of compound. In this experiment, quantitative counts of lactobacilli in ceca of 49-day-old chicken (Ross 308 using classical and FISH method were investigated. Counts of lactobacilli on MRS agar were monitored. To check the reliability of traditional methods of cultivation samples were evaluated by fluorescence in situ hybridization (FISH. Lactobacillus cells, isolated from gastrointestinal tract, were detected after hybridization of fluorescently labeled probe with bacterial cells. Counts of CFU of lactobacilli were compared in experimental and control treatments, respectively. The lowest count was detected in the control experimental group. The highest count was detected in the third experimental group where was 450 mg of pollen added to 1 kg of feed mixture. Using Real-time PCR method, we identified the species range of the genera Lactobacillus in the intestinal tract of broiler. Detected species from the genus Lactobacillus were L. crispatus, L. salivarius and L. acidophilus.

  13. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    As part of a multi-centre European project, FOOD-PCR, the feasibility of a novel approach for production of dried bacterial DNA that could be used as certified reference materials (CRM) was assessed. Selected strains of Salmonella typhimurium, Listeria monocytogenes, Escherichia coli O157...

  14. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  15. Culture versus PCR for Salmonella Species Identification in Some Dairy Products and Dairy Handlers with Special Concern to Its Zoonotic Importance.

    Science.gov (United States)

    Gwida, Mayada M; Al-Ashmawy, Maha A M

    2014-01-01

    A total of 200 samples of milk and dairy products as well as 120 samples of dairy handlers were randomly collected from different dairy farms and supermarkets in Dakahlia Governorate, Egypt. The conventional cultural and serotyping methods for detection of Salmonella in dairy products were applied and the results were compared with those obtained by molecular screening assay using (ttr sequence). The obtained results revealed that 21% of milk and dairy products (42/200) were positive for Salmonella species using enrichment culture-based PCR method, while 12% of different dairy samples (24/200) were found to be positive for Salmonella species by using the conventional culture methods. Two stool specimens out of 40 apparently healthy dairy handlers were positive by the PCR method. Serotyping of Salmonella isolates revealed that 58.3% (14/24) from different dairy products were contaminated with Salmonella Typhimurium. We conclude that the enrichment culture-based PCR assay has high sensitivity and specificity for detection of Salmonella species in dairy products and handlers. High incidence of Salmonella Typhimurium in the examined dairy samples highlights the important role played by milk and dairy products as a vehicle in disease prevalence. Great effort should be applied for reducing foodborne risk for consumers.

  16. Next-generation sequencing can reveal in vitro-generated PCR crossover products: some artifactual sequences correspond to HLA alleles in the IMGT/HLA database.

    Science.gov (United States)

    Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A

    2014-01-01

    The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Detection and prevalence of pathogenic Yersinia enterocolitica in refrigerated and frozen dairy products by duplex PCR and dot hybridization targeting the virF and ail genes.

    Science.gov (United States)

    Ye, Y W; Ling, N; Han, Y J; Wu, Q P

    2014-11-01

    Pathogenic Yersinia enterocolitica is involved in yersiniosis through expression of chromosome-borne or plasmid-borne virulence factors. Yersinia enterocolitica is a cold-tolerant pathogen frequently isolated from refrigerated or frozen foods. However, little attention has been focused on the prevalence of pathogenic Y. enterocolitica in refrigerated or frozen dairy samples in China. In this study, we developed a new duplex PCR targeting the plasmid-borne virF gene and chromosome-borne ail gene for detection of pathogenic Y. enterocolitica isolates. We established a detection limit for the duplex PCR of 6.5 × 10(2)cfu/mL in artificially contaminated dairy samples. In addition, the duplex PCR could detect directly 4.5 to 5.7 cfu of Y. enterocolitica in 5 mL of brain heart infusion broth after 6 h of enrichment at 28 °C. A newly developed dot hybridization assay further confirmed specificity of the duplex PCR for detection of virulent Y. enterocolitica. Furthermore, 13 Y. enterocolitica and 5 pathogenic strains, from 88 commercial frozen or refrigerated dairy products, were detected successfully by the China National Standard method (GB/T4789.8-2008) and the duplex PCR, respectively. Finally, biotypes and serotypes of pathogenic Y. enterocolitica strains were further characterized. The duplex PCR developed here is reliable for large-scale screening, routine monitoring, and risk assessment of pathogenic Y. enterocolitica in refrigerated or frozen dairy products. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. Treatment of PCR products with exonuclease I and heat-labile alkaline phosphatase improves the visibility of combined bisulfite restriction analysis

    International Nuclear Information System (INIS)

    Watanabe, Kousuke; Emoto, Noriko; Sunohara, Mitsuhiro; Kawakami, Masanori; Kage, Hidenori; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

    2010-01-01

    Research highlights: → Incubating PCR products at a high temperature causes smears in gel electrophoresis. → Smears interfere with the interpretation of methylation analysis using COBRA. → Treatment with exonuclease I and heat-labile alkaline phosphatase eliminates smears. → The elimination of smears improves the visibility of COBRA. -- Abstract: DNA methylation plays a vital role in the regulation of gene expression. Abnormal promoter hypermethylation is an important mechanism of inactivating tumor suppressor genes in human cancers. Combined bisulfite restriction analysis (COBRA) is a widely used method for identifying the DNA methylation of specific CpG sites. Here, we report that exonuclease I and heat-labile alkaline phosphatase can be used for PCR purification for COBRA, improving the visibility of gel electrophoresis after restriction digestion. This improvement is observed when restriction digestion is performed at a high temperature, such as 60 o C or 65 o C, with BstUI and TaqI, respectively. This simple method can be applied instead of DNA purification using spin columns or phenol/chloroform extraction. It can also be applied to other situations when PCR products are digested by thermophile-derived restriction enzymes, such as PCR restriction fragment length polymorphism (RFLP) analysis.

  19. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  20. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  1. Isolation and Identification of Campylobacter spp. from Poultry and Poultry By-Products in Tunisia by Conventional Culture Method and Multiplex Real-Time PCR.

    Science.gov (United States)

    Jribi, Hela; Sellami, Hanen; Mariam, Siala; Smaoui, Salma; Ghorbel, Asma; Hachicha, Salma; Benejat, Lucie; Messadi-Akrout, Feriel; Mégraud, Francis; Gdoura, Radhouane

    2017-10-01

    Thermophilic Campylobacter spp. are one of the primary causes of bacterial human diarrhea. The consumption of poultry meats, by-products, or both is suspected to be a major cause of human campylobacteriosis. The aims of this study were to determine the prevalence of thermophilic Campylobacter spp. in fresh poultry meat and poultry by-products by conventional culture methods and to confirm Campylobacter jejuni and Campylobacter coli isolates by using the multiplex PCR assay. Two hundred fifty fresh poultry samples were collected from a variety of supermarkets and slaughterhouses located in Sfax, Tunisia, including chicken (n =149) and turkey (n =101). The samples were analyzed using conventional microbiological examinations according to the 2006 International Organization for Standardization method (ISO 10272-1) for Campylobacter spp. Concurrently, a real-time PCR was used for identification of C. jejuni and C. coli . Of the 250 samples of poultry meat and poultry by-products, 25.6% (n = 64) were contaminated with Campylobacter spp. The highest prevalence of Campylobacter spp. was found in chicken meat (26.8%) followed by turkey meat (23.7%). Among the different products, poultry breasts showed the highest contamination (36.6%) followed by poultry by-products (30%), poultry wings (28%) and poultry legs (26%) showed the lowest contamination, and no contamination was found on neck skin. Of the 64 thermophilic Campylobacter isolates, C. jejuni (59.7%) was the most frequently isolated species and 10.9% of the isolates were identified as C. coli . All of the 64 Campylobacter isolates identified by the conventional culture methods were further confirmed by PCR. The seasonal peak of Campylobacter spp. contamination was in the warm seasons (spring and summer). The study concluded that high proportions of poultry meat and poultry by-products marketed in Tunisia are contaminated by Campylobacter spp. Furthermore, to ensure food safety, poultry meats must be properly cooked

  2. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products.

    Science.gov (United States)

    Hubalkova, Zora; Rencova, Eva

    2011-10-01

    A one-step polymerase chain reaction (PCR) method for the simultaneous detection of the major allergens of pecan and Brazil nuts was developed. Primer pairs for the amplification of partial sequences of genes encoding the allergens were designed and tested for their specificity on a range of food components. The targeted amplicon size was 173 bp of Ber e 1 gene of Brazil nuts and 72 bp of vicilin-like seed storage protein gene in pecan nuts. The primer pair detecting the noncoding region of the chloroplast DNA was used as the internal control of amplification. The intrinsic detection limit of the PCR method was 100 pg mL(-1) pecan or Brazil nuts DNA. The practical detection limit was 0.1% w/w (1 g kg(-1)). The method was applied for the investigation of 63 samples with the declaration of pecans, Brazil nuts, other different nut species or nuts generally. In 15 food samples pecans and Brazil nuts allergens were identified in the conformity with the food declaration. The presented multiplex PCR method is specific enough and can be used as a fast approach for the detection of major allergens of pecan or Brazil nuts in food. Copyright © 2011 Society of Chemical Industry.

  3. Detection of coding genes for enterotoxins in Bacillus cereus by PCR and their products by BCET-RPLA and ELISA Assay

    Directory of Open Access Journals (Sweden)

    Marcela Vyletělová

    2010-01-01

    Full Text Available Determination of enterotoxin production, diarrhoeal and emetic gene identification was studied in 41 Bacillus cereus strains isolated from raw cows’ and raw goats’ milk, pasteurized milk, dairy products during technological processing and from dairy plant equipment. Presence of enterotoxins was detected by BCET-RPLA (HBL and ELISA immunoassay (NHE. Gene identification (nheA, nheB, nheC, hblA, hblC, hblD, bceT, cytK-1, cytK-2, entFM and ces was achieved by means of PCR. Enterotoxin HBL was detected in 32 strains, enterotoxin NHE in all 41 strains. Presence of all three genes nheA, nheB and nheC was confirmed in 40 strains and genes hblA, hblC and hblD in 29 strains. Comparison of used methods was as follow: 1 BCET-RPLA (which detects L2 component and PCR (positive or negative all three hblA, hblC and hblD gene detection were identical in 30 (73%; 2 ELISA (NheA and PCR (all three nheC, nheB and nheA gene expression were identical in 40 (98% cases isolated strains.

  4. A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

    Science.gov (United States)

    Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

    2015-01-01

    Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

  5. Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

    Science.gov (United States)

    Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

    2013-12-01

    Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    The 19-bp insertion/deletion polymorphism in the 5' flank of the dopamine beta-hydroxylase (DBH) gene has been associated with psychiatric disorders. We have developed a simple, reliable and inexpensive closed-tube assay for genotyping of this polymorphism based upon T(m) determination of amplified...... and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  7. A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR

    OpenAIRE

    Sakalar, Erg?n; Erg?n, Seyma ?z?irak; Akar, Emine

    2015-01-01

    A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN? Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks...

  8. Enumeration of Salmonellae in Table Eggs, Pasteurized Egg Products, and Egg-Containing Dishes by Using Quantitative Real-Time PCR

    DEFF Research Database (Denmark)

    Jakočiūnė, Džiuginta; Pasquali, Frédérique; da Silva, Cristiana Soares

    2014-01-01

    PCR) was employed for enumeration of salmonellae in different matrices: table eggs, pasteurized egg products, and egg-containing dishes. Salmonella enterica serovar Enteritidis and S. enterica serovar Tennessee were used to artificially contaminate these matrices. The results showed a linear regression between...... the numbers of salmonellae and the quantification cycle (Cq) values for all matrices used, with the exception of pasteurized egg white. Standard curves were constructed by using both stationary-phase cells and heat-stressed cells, with similar results. Finally, this method was used to evaluate the fate...

  9. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  10. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    Directory of Open Access Journals (Sweden)

    Mary Scruggs

    2008-04-01

    Full Text Available A polymerase chain reaction (PCR based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme, a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS gene (FUM1- previously FUM5 responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, and 12 of other Fusarium species. In addition, 13 species of other fungal genera, from four phyla, were tested as negative controls. Among the four sets, primer set B consistently amplified a 419- bp fragment from the DNA 96% of all F. verticillioides strains and 83% of F. proliferatum. All other fungi tested were negative using primer set B. A total of 38% of the F. verticillioides strains grown on a selective liquid medium produced fumonisin and 92% formed the toxin on standard rice medium. When fumonisin formed in culture, PCR assay using primer set B detected every strain of F. verticillioides, but only amplified 80% of F. proliferatum strains that produced the toxin. PCR detection was consistent at 100 pg/μl concentration of genomic DNA from 4 F. verticillioides strains, but varied at 10 pg/μl. Two duplicate greenhouse tests using artificially inoculated maize plants, had greater levels of F. verticillioides detected after re-evaluting using primer set B than from culturing of the tissues. The molecular protocols described in this study requires only 1 day for completion compared to approximately 10 days for cultural work and morphological determination. In conclusion, conventional PCR assay using primer set B provides a sensitive and accurate detection assay that can be used as a primary or secondary confirmation method for identification and occurrence of F. verticillioides within the maize tissues. However, studies using primer set B for

  11. PCR screening reveals considerable unexploited biosynthetic potential of ansamycins and a mysterious family of AHBA-containing natural products in actinomycetes.

    Science.gov (United States)

    Wang, H-X; Chen, Y-Y; Ge, L; Fang, T-T; Meng, J; Liu, Z; Fang, X-Y; Ni, S; Lin, C; Wu, Y-Y; Wang, M-L; Shi, N-N; He, H-G; Hong, K; Shen, Y-M

    2013-07-01

    Ansamycins are a family of macrolactams that are synthesized by type I polyketide synthase (PKS) using 3-amino-5-hydroxybenzoic acid (AHBA) as the starter unit. Most members of the family have strong antimicrobial, antifungal, anticancer and/or antiviral activities. We aimed to discover new ansamycins and/or other AHBA-containing natural products from actinobacteria. Through PCR screening of AHBA synthase gene, we identified 26 AHBA synthase gene-positive strains from 206 plant-associated actinomycetes (five positives) and 688 marine-derived actinomycetes (21 positives), representing a positive ratio of 2·4-3·1%. Twenty-five ansamycins, including eight new compounds, were isolated from six AHBA synthase gene-positive strains through TLC-guided fractionations followed by repeated column chromatography. To gain information about those potential ansamycin gene clusters whose products were unknown, seven strains with phylogenetically divergent AHBA synthase genes were subjected to fosmid library construction. Of the seven gene clusters we obtained, three show characteristics for typical ansamycin gene clusters, and other four, from Micromonospora spp., appear to lack the amide synthase gene, which is unusual for ansamycin biosynthesis. The gene composition of these four gene clusters suggests that they are involved in the biosynthesis of a new family of hybrid PK-NRP compounds containing AHBA substructure. PCR screening of AHBA synthase is an efficient approach to discover novel ansamycins and other AHBA-containing natural products. This work demonstrates that the AHBA-based screening method is a useful approach for discovering novel ansamycins and other AHBA-containing natural products from new microbial resources. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.

  12. Real-time PCR detection of Paenibacillus spp. in raw milk to predict shelf life performance of pasteurized fluid milk products.

    Science.gov (United States)

    Ranieri, Matthew L; Ivy, Reid A; Mitchell, W Robert; Call, Emma; Masiello, Stephanie N; Wiedmann, Martin; Boor, Kathryn J

    2012-08-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect Paenibacillus spp. in fluid milk and to discriminate between Paenibacillus and other closely related spore-forming bacteria. Specificity was confirmed using 16 Paenibacillus and 17 Bacillus isolates. All 16 Paenibacillus isolates were detected with a mean cycle threshold (C(T)) of 19.14 ± 0.54. While 14/17 Bacillus isolates showed no signal (C(T) > 40), 3 Bacillus isolates showed very weak positive signals (C(T) = 38.66 ± 0.65). The assay provided a detection limit of approximately 3.25 × 10(1) CFU/ml using total genomic DNA extracted from raw milk samples inoculated with Paenibacillus. Application of the TaqMan PCR to colony lysates obtained from heat-treated and enriched raw milk provided fast and accurate detection of Paenibacillus. Heat-treated milk samples where Paenibacillus (≥1 CFU/ml) was detected by this colony TaqMan PCR showed high bacterial counts (>4.30 log CFU/ml) after refrigerated storage (6°C) for 21 days. We thus developed a tool for rapid detection of Paenibacillus that has the potential to identify raw milk with microbial spoilage potential as a pasteurized product.

  13. Real-time PCR method applied to seafood products for authentication of European sole (Solea solea) and differentiation of common substitute species.

    Science.gov (United States)

    Herrero, Beatriz; Lago, Fátima C; Vieites, Juan M; Espiñeira, Montserrat

    2012-01-01

    Judged by quality and taste, the European sole (Solea solea) is considered one of the finest flatfish and is, thus, of considerable commercial value. In the present work, a specific fast real-time PCR was developed for the authentication of S. solea, i.e. to distinguish it from other related species and avoid substitution of this species, either deliberately or unintentionally. The method is based on a species-specific set of primers and MGB Taqman probe which amplifies a 116-bp fragment of the internal transcribed spacer 1 (ITS 1) ribosomal DNA region. This assay combines the high specificity and sensitivity of real-time PCR with the rapidity of the fast mode, allowing the detection of S. solea in a short period of time. The present methodology was validated for application to all types of manufactured products for the presence of S. solea, with successful results. Subsequently, the method was applied to 40 commercial samples to determine whether correct labeling had been employed in the market. It was demonstrated that the assay is a useful tool in monitoring and verifying food labeling regulations.

  14. A Simultaneous Analytical Method for Duplex Identification of Porcine and Horse in the Meat Products by EvaGreen based Real-time PCR.

    Science.gov (United States)

    Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine

    2015-01-01

    A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.

  15. Isolation and Identification of Lactic Acid Bacteria from Traditional Dairy Products in Baotou and Bayannur of Midwestern Inner Mongolia and q-PCR Analysis of Predominant Species

    Science.gov (United States)

    2016-01-01

    In this study, traditional culture method and 16S rRNA gene analysis were applied to reveal the composition and diversity of lactic acid bacteria (LAB) of fermented cow milk, huruud and urum from Baotou and Bayannur of midwestern Inner Mongolia. Also, the quantitative results of dominant LAB species in three different types of dairy products from Baotou and Bayannur were gained by quantitative polymerase chain reaction (q-PCR) technology. Two hundred and two LAB strains isolated from sixty-six samples were identified and classified into four genera, namely Enterococcus, Lactococcus, Lactobacillus, Leuconostoc, and twenty-one species and subspecies. From these isolates, Lactococcus lactis subsp. lactis (32.18%), Lactobacillus plantarum (12.38%) and Leuconosto mesenteroides (11.39%) were considered as the dominated LAB species under the condition of cultivating in MRS and M17 medium. And the q-PCR results revealed that the number of dominant species varied from samples to samples and from region to region. This study clearly shows the composition and diversity of LAB existing in fermented cow milk, huruud and urum, which could be considered as valuable resources for LAB isolation and further probiotic selection. PMID:27621691

  16. Separation of PCR-ready DNA from dairy products using magnetic hydrophilic microspheres and poly(ethylene glycol)-NaCl water solutions

    Energy Technology Data Exchange (ETDEWEB)

    Rittich, Bohuslav [Masaryk University, Faculty of Science, Institute of Experimental Biology, Tvrdeho 14, CZ-611 37 Brno (Czech Republic); Brno University of Technology, Faculty of Chemistry, Institute of Food Science and Biotechnology, Purkynova 464/118, CZ-612 00 Brno (Czech Republic)], E-mail: rittich@sci.muni.cz; Spanova, Alena [Masaryk University, Faculty of Science, Institute of Experimental Biology, Tvrdeho 14, CZ-611 37 Brno (Czech Republic); Brno University of Technology, Faculty of Chemistry, Institute of Food Science and Biotechnology, Purkynova 464/118, CZ-612 00 Brno (Czech Republic); Salek, Petr [Brno University of Technology, Faculty of Chemistry, Institute of Food Science and Biotechnology, Purkynova 464/118, CZ-612 00 Brno (Czech Republic); Nemcova, Petra [Masaryk University, Faculty of Science, Institute of Experimental Biology, Tvrdeho 14, CZ-611 37 Brno (Czech Republic); Trachtova, Stepanka [Brno University of Technology, Faculty of Chemistry, Institute of Food Science and Biotechnology, Purkynova 464/118, CZ-612 00 Brno (Czech Republic); Horak, Daniel [Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovsky Sq. 2, CZ-162 06 Prague (Czech Republic)

    2009-05-15

    Carboxyl group-containing magnetic nonporous poly(2-hydroxyethyl methacrylate-co-glycidyl methacrylate) (P(HEMA-co-GMA)) and magnetic glass microspheres were used for the isolation of bacterial DNA. P(HEMA-co-GMA) microspheres were prepared by the dispersion polymerization in toluene/2-methylpropan-1-ol mixture in the presence of magnetite nanoparticles obtained by coprecipitation of Fe(II) and Fe(III) salts with ammonium hydroxide. Carboxyl groups were then introduced by oxidation of the microspheres with potassium permanganate. The most extensive DNA recovery was achieved at PEG 6000 concentrations of 12% or 16% and 2 M NaCl. The method proposed was used for bacterial DNA isolation from different dairy products containing Bifidobacterium and Lactobacillus cells. The presence of target DNA and the quality of isolated DNA were checked by polymerase chain reaction (PCR) amplification with specific primers.

  17. Principles and technical aspects of PCR amplification

    National Research Council Canada - National Science Library

    Pelt-Verkuil, Elizabeth van; Belkum, Alex van; Hays, John P

    2008-01-01

    ... to illustrate any particularly important concepts or comments. Indeed, all commercial PCR biotechnology companies offer information about their products on internet sites and in online technical manuals. These online resources will be invaluable for any readers requiring more detailed PCR protocols. The authors have provided references for many PCR co...

  18. Production of Truncated Candida antarctica Lipase B Gene Using Automated PCR Gene Assembly Protocol and Expression in Yeast for use in Ethanol and Biodiesel Production.

    Science.gov (United States)

    An improved column-based process for production of biodiesel was developed using a column containing a strongly basic anion-exchange resin in sequence with a column containing a resin to which a lipase biocatalyst is bound. Currently most biodiesel is produced by transesterification of triglyceride...

  19. Comparative, Collaborative, and On-Site Validation of a TaqMan PCR Method as a Tool for Certified Production of Fresh, Campylobacter-Free Chickens

    DEFF Research Database (Denmark)

    Krause, Michael; Josefsen, Mathilde Hartmann; Lund, Marianne

    2006-01-01

    , a faster, real-time PCR approach was validated in comparative and collaborative trials, based on recommendations from the Nordic system for validation of alternative microbiological methods (NordVal). The comparative real-time PCR trial was performed in comparison to two reference culture protocols...... fulfilled the NordVal validation criteria and has since been implemented at a major abattoir....

  20. A universal mini-vector and an annealing of PCR products (APP)-based cloning strategy for convenient molecular biological manipulations.

    Science.gov (United States)

    Liu, Xia; Li, Tuoping; Hart, Darren J; Gao, Song; Wang, Hongling; Gao, Herui; Xu, Shumin; Zhang, Yifeng; Liu, Yifei; An, Yingfeng

    2018-03-18

    Currently, the most widely used strategies for molecular cloning are sticky-end ligation-based cloning, TA cloning, blunt-end ligation-based cloning and ligase-independent cloning. In this study we have developed a novel mini-vector pANY1 which can simultaneously meet the requirements of all these cloning strategies. In addition, the selection of appropriate restriction digestion sites is difficult in some cases because of the presence of internal sites. In this study, an annealing of PCR products (APP)-based sticky-end cloning strategy was introduced to avoid this issue. Additionally, false positives occur during molecular cloning, which increases the workload of isolating positive clones. The plasmid pANY1 contains a ccdB cassette between multiple cloning sites, which efficiently avoids these false positives. Therefore, this mini-vector should serve as a useful tool with wide applications in biosciences, agriculture, food technologies, etc. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Towards the production of reliable quantitative microbiological data for risk assessment: Direct quantification of Campylobacter in naturally infected chicken fecal samples using selective culture and real-time PCR

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Vigre, Håkan; Josefsen, Mathilde Hasseldam

    2015-01-01

    of Campylobacter by real-time PCR was performed using standard curves designed for two different DNA extraction methods: Easy-DNA™ Kit from Invitrogen (Easy-DNA) and NucliSENS® MiniMAG® from bioMérieux (MiniMAG). Results indicated that the estimation of the numbers of Campylobacter present in chicken fecal samples...... and for the evaluation of control strategies implemented in poultry production. The aim of this study was to compare estimates of the numbers of Campylobacter spp. in naturally infected chicken fecal samples obtained using direct quantification by selective culture and by real-time PCR. Absolute quantification....... Although there were differences in terms of estimates of Campylobacter numbers between the methods and samples, the differences between culture and real-time PCR were not statistically significant for most of the samples used in this study....

  2. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  3. Detection of undeclared animal by-products in commercial canine canned foods: Comparative analyses by ELISA and PCR-RFLP coupled with slab gel electrophoresis or capillary gel electrophoresis.

    Science.gov (United States)

    Hsieh, Ming-Kun; Shih, Pei-Yin; Wei, Chia-Fong; Vickroy, Thomas W; Chou, Chi-Chung

    2016-03-30

    The potential presence of undeclared animal by-products in pet foods is not subject to routine examination. Previously published methods for species-based identification of animal by-products have not been used routinely owing to inconsistent results. The present study evaluated the utility of several approaches for accurate identification of animal by-products in 11 commercial brands of canine canned foods. Canine canned foods from several countries were analysed by ELISA, PCR-RFLP coupled with slab-gel electrophoresis (SGE) and capillary gel electrophoresis (CGE) to test for evidence of by-products derived from cattle, chicken, sheep or pig. While CGE-based analysis detected all (24) animal-derived by-products that were reported for the 11 test samples, SGE and ELISA detected only 22/24 (92%) and 14/24 (58%) of labelled by-products, respectively. In addition, undeclared animal by-products were found using all three analytical approaches with CGE detecting more positives (19) than SGE (17) or ELISA (5). Significant disparities were evident between the labelled contents and the detected content of animal by-products. CGE-based testing for PCR products appears to provide greater sensitivity and accuracy than either SGE or ELISA-based methods. As testing of commercial products becomes more reliable and mainstream, manufacturers will need to develop more thorough and accurate labelling protocols. © 2015 Society of Chemical Industry.

  4. Estimating sensitivity and specificity of a PCR for boot socks to detect Campylobacter in broiler primary production using Bayesian latent class analysis

    DEFF Research Database (Denmark)

    Matt, Monika; Nordentoft, Steen; Ian, Kopacka

    2016-01-01

    samples were collected at slaughter.The results were evaluated in the absence of a gold standard using a Bayesian latent class model. Austrian results showed higher sensitivity for PCR detection in sock samples (0.98; Bayesian credible interval (BCI) [0.93-1]) than for culture of faecal droppings (0....... Therefore the model results for the PCR sensitivity (0.88; BCI [0.83-0.97]) and cultural ISO-method in faecal samples (0.84; BCI [0.76-0.92]) are lower than for caecal samples (0.93; BCI [0.85-0.98]). In our study, PCR detection on boot sock samples is more sensitive than conventional culture. In view...

  5. PCR und ELISA - Alternativen zum Maustest für die Analyse des Botulismus-Neurotoxin-C1 Giftbildungspotentiales in Umweltproben? [PCR and ELISA - in vitro alternatives to the mouse-bioassay for assessing the botulinum-neurotoxin-C1 production potential in environmental samples?

    Science.gov (United States)

    Zechmeister, T.C.; Farnleitner, A.H.; Rocke, T.E.; Pittner, F.; Rosengarten, R.; Mach, R.L.; Herzig, A.; Kirschner, A.K.T.

    2002-01-01

    Botulism is one of the most important bird diseases world-wide and is caused by the intoxication with Botulinum-Neurotoxin-C1 (BoNt-C1), which is produced by toxigenic clostridia under appropriate conditions. Avian botulism leads regularly to large losses among the migrating bird populations breeding and resting at the saltwater pools of the Austrian national park Neusiedler See-Seewinkel. Despite of its ethical dubiousness and its high technical expense the mouse-bioassay is still used as the routine standard method for the detection of BoNt-C1. According to the 3R-concept, in vitro alternative methods for the qualitative detection of BoNt-C1 (immunostick-ELISA) and a corresponding BoNt-C1 gene fragment (nested-PCR) were established. In order to estimate the BoNt-C1 production potential the methods were tested with sediment samples from different saltwater pools subjected to cultivation conditions appropriate for in vitro BoNt-C1-production. With the mouse-bioassay, 52 out of 77 samples were found to have a positive toxin production potential. The immunostick-ELISA showed a similar sensitivity as the mouse-bioassay and exhibited a highly significant positive correlation (r=0.94; pELISA (r=0.09; p=0.46). Obviously, the PCR approach detected the BoNt-C1 gene fragment in some of the samples where no toxin expression has occurred. Thus it is suggested that the qualitative immunostick-ELISA represents a potential in vitro alternative to the mouse-bioassay for assessing the BoNt-C1 production potential in environmental samples. In contrast, qualitative BoNt-C1 gene fragment detection via PCR led to an overestimation of the actual toxin production potential.

  6. Authenticity control of game meat products--a single method to detect and quantify adulteration of fallow deer (Dama dama), red deer (Cervus elaphus) and sika deer (Cervus nippon) by real-time PCR.

    Science.gov (United States)

    Druml, Barbara; Grandits, Stephanie; Mayer, Walter; Hochegger, Rupert; Cichna-Markl, Margit

    2015-03-01

    This contribution presents a single real-time PCR assay allowing the determination of the deer content (the sum of fallow deer (Dama dama), red deer (Cervus elaphus) and sika deer (Cervus nippon)) in meat products to detect food adulteration. The PCR assay does not show cross-reactivity with 20 animal species and 43 botanical species potentially contained in game meat products. The limit of quantification is 0.5% for fallow deer and red deer and 0.1% for sika deer. The deer content in meat products is determined by relating the concentration obtained with the deer PCR assay to that obtained with a reference system which amplifies mammals and poultry DNA. The analysis of binary meat mixtures with pork, a meat mixture containing equal amounts of fallow deer, red deer and sika deer in pork and a model game sausage showed that the quantification approach is very accurate (systematic error generally <25%). Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  8. Detection of seven virulence and toxin genes of Campylobacter jejuni isolates from Danish turkeys by PCR and cytolethal distending toxin production of the isolates

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Borck, Birgitte; Nielsen, Eva Møller

    2004-01-01

    A total of 117 Campylobacter jejuni isolates from Danish turkeys were tested for the presence of seven virulence and toxin genes by PCR. One hundred seventeen (100%) isolates were positive for flaA, cadF, and ceuE gene primers. One hundred three (88%) isolates were positive for cdt gene cluster PCR.......7%) in Colon 205 assays, and 109 (93.2%) in chicken embryo cell assays. The CDT titers were determined in Vero cell assays. Of 117 isolates, 50 (42.7%) produced a CDT titer of 1:100, 29 (24.8%) of 1:50, and 27 (23%) of 1:5 to 1:10; 8 (6.8%) produced a CDT titer at undiluted supernatants and 3 (2.6%) produced...

  9. Real-Time PCR Detection of Paenibacillus spp. in Raw Milk To Predict Shelf Life Performance of Pasteurized Fluid Milk Products

    OpenAIRE

    Ranieri, Matthew L.; Ivy, Reid A.; Mitchell, W. Robert; Call, Emma; Masiello, Stephanie N.; Wiedmann, Martin; Boor, Kathryn J.

    2012-01-01

    Psychrotolerant sporeformers, specifically Paenibacillus spp., are important spoilage bacteria for pasteurized, refrigerated foods such as fluid milk. While Paenibacillus spp. have been isolated from farm environments, raw milk, processing plant environments, and pasteurized fluid milk, no information on the number of Paenibacillus spp. that need to be present in raw milk to cause pasteurized milk spoilage was available. A real-time PCR assay targeting the 16S rRNA gene was designed to detect...

  10. Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.

    Science.gov (United States)

    Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei

    2018-02-02

    As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Market analysis of food products for detection of allergenic walnut (Juglans regia) and pecan (Carya illinoinensis) by real-time PCR.

    Science.gov (United States)

    López-Calleja, Inés María; de la Cruz, Silvia; González, Isabel; García, Teresa; Martín, Rosario

    2015-06-15

    Two real-time polymerase chain reaction (PCR)-based assays for detection of walnut (Juglans regia) and pecan (Carya illinoinensis) traces in a wide range of processed foods are described here. The method consists on a real-time PCR assay targeting the ITS1 region, using a nuclease (TaqMan) probe labeled with FAM and BBQ. The method was positive for walnut and pecan respectively, and negative for all other heterologous plants and animals tested. Using a series of model samples with defined raw walnut in wheat flour and heat-treated walnut in wheat flour with a range of concentrations of 0.1-100,000 mg kg(-1), a practical detection limit of 0.1 mg kg(-1) of walnut content was estimated. Identical binary mixtures were done for pecan, reaching the same limit of detection of 0.1 mg kg(-1). The assay was successfully trialed on a total of 232 commercial foodstuffs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Validation of reference genes for normalization of qPCR mRNA expression levels in Staphylococcus aureus exposed to osmotic and lactic acid stress conditions encountered during food production and preservation.

    Science.gov (United States)

    Sihto, Henna-Maria; Tasara, Taurai; Stephan, Roger; Johler, Sophia

    2014-07-01

    Staphylococcus aureus represents the most prevalent cause of food-borne intoxications worldwide. While being repressed by competing bacteria in most matrices, this pathogen exhibits crucial competitive advantages during growth at high salt concentrations or low pH, conditions frequently encountered in food production and preservation. We aimed to identify reference genes that could be used to normalize qPCR mRNA expression levels during growth of S. aureus in food-related osmotic (NaCl) and acidic (lactic acid) stress adaptation models. Expression stability of nine housekeeping genes was evaluated in full (LB) and nutrient-deficient (CYGP w/o glucose) medium under conditions of osmotic (4.5% NaCl) and acidic stress (lactic acid, pH 6.0) after 2-h exposure. Among the set of candidate reference genes investigated, rplD, rpoB,gyrB, and rho were most stably expressed in LB and thus represent the most suitable reference genes for normalization of qPCR data in osmotic or lactic acid stress models in a rich medium. Under nutrient-deficient conditions, expression of rho and rpoB was highly stable across all tested conditions. The presented comprehensive data on changes in expression of various S. aureus housekeeping genes under conditions of osmotic and lactic acid stress facilitate selection of reference genes for qPCR-based stress response models. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  13. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  14. Thermophilic Alkaline Fermentation Followed by Mesophilic Anaerobic Digestion for Efficient Hydrogen and Methane Production from Waste-Activated Sludge: Dynamics of Bacterial Pathogens as Revealed by the Combination of Metagenomic and Quantitative PCR Analyses.

    Science.gov (United States)

    Wan, Jingjing; Jing, Yuhang; Rao, Yue; Zhang, Shicheng; Luo, Gang

    2018-03-15

    Thermophilic alkaline fermentation followed by mesophilic anaerobic digestion (TM) for hydrogen and methane production from waste-activated sludge (WAS) was investigated. The TM process was also compared to a process with mesophilic alkaline fermentation followed by a mesophilic anaerobic digestion (MM) and one-stage mesophilic anaerobic digestion (M) process. The results showed that both hydrogen yield (74.5 ml H 2 /g volatile solids [VS]) and methane yield (150.7 ml CH 4 /g VS) in the TM process were higher than those (6.7 ml H 2 /g VS and 127.8 ml CH 4 /g VS, respectively) in the MM process. The lowest methane yield (101.2 ml CH 4 /g VS) was obtained with the M process. Taxonomic results obtained from metagenomic analysis showed that different microbial community compositions were established in the hydrogen reactors of the TM and MM processes, which also significantly changed the microbial community compositions in the following methane reactors compared to that with the M process. The dynamics of bacterial pathogens were also evaluated. For the TM process, the reduced diversity and total abundance of bacterial pathogens in WAS were observed in the hydrogen reactor and were further reduced in the methane reactor, as revealed by metagenomic analysis. The results also showed not all bacterial pathogens were reduced in the reactors. For example, Collinsella aerofaciens was enriched in the hydrogen reactor, which was also confirmed by quantitative PCR (qPCR) analysis. The study further showed that qPCR was more sensitive for detecting bacterial pathogens than metagenomic analysis. Although there were some differences in the relative abundances of bacterial pathogens calculated by metagenomic and qPCR approaches, both approaches demonstrated that the TM process was more efficient for the removal of bacterial pathogens than the MM and M processes. IMPORTANCE This study developed an efficient process for bioenergy (H 2 and CH 4 ) production from WAS and elucidates the

  15. Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

    Science.gov (United States)

    Espiñeira, Montserrat; Vieites, Juan M

    2012-12-15

    The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. MDE heteroduplex analysis of PCR products spanning each exon of the fibrillin (FBN1) gene greatly increases the efficiency of mutation detection in the Marfan syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Nijbroek, G.; Dietz, H.C. [Johns Hopkins Univ. School of Med., Baltimore, MD (United States); Pereira, L.; Ramirz, F. [Mount Sinai School of Med., New York, NY (United States)

    1994-09-01

    Defects in fibrillin (FNB1) cause the Marfan syndrome (MFS). Classic Marfan phenotype cosegregates with intragenic and/or flanking marker alleles in all families tested and a significant number of FBN1 mutations have been identified in affected individuals. Using a standard method of mutation detection, SSCP analysis of overlapping RT-PCR amplimers that span the entire coding sequence, the general experience has been a low yield of identifiable mutations, ranging from 10-20%. Possible explanations included low sensitivity of mutation screening procedures, under-representation of mutant transcript in patient samples either due to deletions or mutant alleles containing premature termination codons, clustering of mutations in yet uncharacterized regions of the gene, including regulatory elements, or genetic heterogeneity. In order to compensate for a potential reduced mutant transcript stability, we have devised a method to screen directly from genomic DNA. The intronic boundaries flanking each of the 65 FBN1 exons were characterized and primer pairs were fashioned such that all splice junctions would be included in the resultant amplimers. The entire gene was screened for a panel of 9 probands with classic Marfan syndrome using mutation detection enhancement (MDE) gel heteroduplex analysis. A mutation was identified in 5/9 (55%) of patient samples. All were either missense mutations involving a cysteine residue or small deletions that did not create a frame shift. In addition, 10 novel polymorphisms were found. We conclude that the majority of mutations causing Marfan syndrome reside in the FBN1 gene and that mutations creating premature termination codons are not the predominant cause of inefficient mutation detection using RT-PCR. We are currently modifying screening methods to increase sensitivity and targeting putative FBN1 gene promoter sequences for study.

  17. Real-time PCR in virology.

    Science.gov (United States)

    Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas

    2002-03-15

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.

  18. Development of a real-time PCR method coupled with a selective pre-enrichment step for quantification of Morganella morganii and Morganella psychrotolerans in fish products

    DEFF Research Database (Denmark)

    Podeur, Gaetan; Dalgaard, Paw; Leroi, Francoise

    2015-01-01

    Histamine fish poisoning is common and due to toxic concentrations of histamine often produced by Gram-negative bacteria in fin-fish products with a high content of the free amino acid histidine. The genus Morganella includes two species previously reported to cause incidents of histamine fish po...

  19. PCR in forensic genetics

    DEFF Research Database (Denmark)

    Morling, Niels

    2009-01-01

    Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...

  20. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  1. Development of a PCR-based marker utilizing a deletion mutation in the dihydroflavonol 4-reductase (DFR) gene responsible for the lack of anthocyanin production in yellow onions (Allium cepa).

    Science.gov (United States)

    Kim, Sunggil; Yoo, Kil Sun; Pike, Leonard M

    2005-02-01

    Bulb color in onions (Allium cepa) is an important trait, but the mechanism of color inheritance is poorly understood at the molecular level. A previous study showed that inactivation of the dihydroflavonol 4-reductase (DFR) gene at the transcriptional level resulted in a lack of anthocyanin production in yellow onions. The objectives of the present study were the identification of the critical mutations in the DFR gene (DFR-A) and the development of a PCR-based marker for allelic selection. We report the isolation of two additional DFR homologs (DFR-B and DFR-C). No unique sequences were identified in either DFR homolog, even in the untranslated region (UTR). Both genes shared more than 95% nucleotide sequence identity with the DFR-A gene. To obtain a unique sequence from each gene, we isolated the promoter regions. Sequences of the DFR-A and DFR-B promoters differed completely from one another, except for an approximately 100-bp sequence adjacent to the 5'UTR. It was possible to specifically amplify only the DFR-A gene using primers designed to anneal to the unique promoter region. The sequences of yellow and red DFR-A alleles were the same except for a single base-pair change in the promoter and an approximately 800-bp deletion within the 3' region of the yellow DFR-A allele. This deletion was used to develop a co-dominant PCR-based marker that segregated perfectly with color phenotypes in the F2 population. These results indicate that a deletion mutation in the yellow DFR-A gene results in the lack of anthocyanin production in yellow onions.

  2. pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

    Science.gov (United States)

    Gu, Jingsong; Ye, Chunjiang

    2011-03-01

    A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

  3. PCR detection of potato cyst nematode.

    Science.gov (United States)

    Reid, Alex

    2009-01-01

    Potato cyst nematode (PCN) is responsible for losses in potato production totalling millions of euros every year in the EC. It is important for growers to know which species is present in their land as this determines its subsequent use. The two species Globodera pallida and Globodera rostochiensis can be differentiated using an allele-specific PCR.

  4. PCR, exit stage left ...

    CERN Multimedia

    2004-01-01

    The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...

  5. Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

    Science.gov (United States)

    Ogrean, Christy; Jackson, Ben; Covino, James

    2010-01-01

    The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

  6. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  7. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA

    DEFF Research Database (Denmark)

    Munch, M.; Nielsen, L.P.; Handberg, Kurt

    2001-01-01

    A. A panel of reference influenza strains from various hosts including avian species, human, swine and horse were evaluated in a one tube RT-PCR using primers designed for the amplification of a 218 bp fragment of the NP gene. The PCR products were detected by PCR-ELISA by use of an internal......Avian influenza virus infections are a major cause of morbidity and rapid identification of the virus has important clinical, economical and epidemiological implications. We have developed a one-tube Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) for the rapid diagnosis of avian influenza...... catching probe confirming the NP influenza A origin. The PCR-ELISA was about 100 times more sensitive than detection of PCR products by agarose gel electrophoresis. RT-PCR and detection by PCR-ELISA is comparable in sensitivity to virus propagation in eggs. We also designed primers for the detection...

  8. [A new method of processing quantitative PCR data].

    Science.gov (United States)

    Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

    2003-05-01

    Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

  9. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  10. Digital PCR: A brief history

    OpenAIRE

    Morley, Alexander A.

    2014-01-01

    Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term “limiting dilution PCR” and in 1999 using the term “digital PCR”. It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and...

  11. Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates of E. coli Fingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence of E. coli O25b-ST131clone Harboring blaGES.

    Science.gov (United States)

    El-Badawy, Mohamed F; Tawakol, Wael M; Maghrabi, Ibrahim A; Mansy, Moselhy S; Shohayeb, Mohamed M; Ashour, Mohammed S

    2017-09-01

    The extensive use of β-lactam antibiotics has led to emergence and spread of extended-spectrum β-lactamases (ESBLs). This study was conducted to investigate the prevalence of 7 different ESBL genes (bla TEM , bla SHV , bla CTX-M , bla VEB , bla PER , bla GES , and bla OXA-10 ) and O25b-ST131 high-risk clone among 61 clinical isolates of Escherichia coli. Also, one broad-spectrum β-lactamase (bla OXA-1 ) was investigated. This study was also constructed to evaluate iodometric overlay method in detection of ESBL production. Phenotypic identification of E. coli isolates using API 20E revealed 18 distinct biotypes. DNA fingerprinting using enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) differentiated all isolates into 2 main phylogenetic groups with 60 distinct genetic profiles. Elevated values of minimal inhibitory concentration (MIC) 50 and MIC 90 for third- and fourth-generation cephalosporins were observed. Phenotypic tests revealed that 85.24% of isolates were ESBL producers. The incidence rates of bla TEM , bla SHV , bla CTX-M , bla GES , bla OXA-1 , and bla OXA-10 among E. coli ESBL producer phenotype were 69.23%, 25%, 96.15%, 3.85%, 11.54%, and 48%, respectively. On the other hand, bla VEB and bla PER were not detected. Sequencing of bla TEM and bla SHV revealed that bla TEM-214 and bla SHV-11 were the most prevalent variants. Group characterization of bla CTX-M revealed that bla CTX-M-1 was the most prevalent group of bla CTX-M family. It was found that 30.77% of E. coli ESBL producers belonged to O25b-ST131 clone harboring bla CTX-M-15 . This study concluded that iodometric overlay method was 100% sensitive in detection of ESBL production. To our knowledge, this is the first Egyptian study that declares the emergence of E. coli O25b-ST131 harboring bla GES .

  12. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  13. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  14. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing

    Science.gov (United States)

    Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.

    2006-01-01

    Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529

  15. COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS

    Directory of Open Access Journals (Sweden)

    Tülin GÜVEN GÖKMEN

    Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.

  16. PCR amplification on microarrays of gel immobilized oligonucleotides

    Science.gov (United States)

    Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei

    2003-11-04

    The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.

  17. Analysis of Multiallelic CNVs by Emulsion Haplotype Fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2017-01-01

    Emulsion-fusion PCR recovers long-range sequence information by combining products in cis from individual genomic DNA molecules. Emulsion droplets act as very numerous small reaction chambers in which different PCR products from a single genomic DNA molecule are condensed into short joint products, to unite sequences in cis from widely separated genomic sites. These products can therefore provide information about the arrangement of sequences and variants at a larger scale than established long-read sequencing methods. The method has been useful in defining the phase of variants in haplotypes, the typing of inversions, and determining the configuration of sequence variants in multiallelic CNVs. In this description we outline the rationale for the application of emulsion-fusion PCR methods to the analysis of multiallelic CNVs, and give practical details for our own implementation of the method in that context.

  18. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    Science.gov (United States)

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  19. Development of a competitive PCR assay for the quantification of ...

    African Journals Online (AJOL)

    ONOS

    2010-01-25

    Jan 25, 2010 ... quantification of total Escherichia coli DNA in water. Omar Kousar Banu, Barnard .... Thereafter the product was ligated into the pGEM®T-easy cloning ... agarose gel using the high pure PCR product purification kit. (Roche® ...

  20. Methylation-Specific PCR Unraveled

    Directory of Open Access Journals (Sweden)

    Sarah Derks

    2004-01-01

    Full Text Available Methylation‐specific PCR (MSP is a simple, quick and cost‐effective method to analyze the DNA methylation status of virtually any group of CpG sites within a CpG island. The technique comprises two parts: (1 sodium bisulfite conversion of unmethylated cytosine's to uracil under conditions whereby methylated cytosines remains unchanged and (2 detection of the bisulfite induced sequence differences by PCR using specific primer sets for both unmethylated and methylated DNA. This review discusses the critical parameters of MSP and presents an overview of the available MSP variants and the (clinical applications.

  1. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Directory of Open Access Journals (Sweden)

    Roman Wölfel

    2012-08-01

    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  2. IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR

    Directory of Open Access Journals (Sweden)

    Ervi Salwati

    2012-09-01

    Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results.   Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction

  3. DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

    Science.gov (United States)

    Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

    2004-01-01

    Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

  4. Human papillomavirus detection using the Abbott RealTime high-risk HPV tests compared with conventional nested PCR coupled to high-throughput sequencing of amplification products in cervical smear specimens from a Gabonese female population.

    Science.gov (United States)

    Moussavou-Boundzanga, Pamela; Koumakpayi, Ismaël Hervé; Labouba, Ingrid; Leroy, Eric M; Belembaogo, Ernest; Berthet, Nicolas

    2017-12-21

    Cervical cancer is the fourth most common malignancy in women worldwide. However, screening with human papillomavirus (HPV) molecular tests holds promise for reducing cervical cancer incidence and mortality in low- and middle-income countries. The performance of the Abbott RealTime High-Risk HPV test (AbRT) was evaluated in 83 cervical smear specimens and compared with a conventional nested PCR coupled to high-throughput sequencing (HTS) to identify the amplicons. The AbRT assay detected at least one HPV genotype in 44.57% of women regardless of the grade of cervical abnormalities. Except for one case, good concordance was observed for the genotypes detected with the AbRT assay in the high-risk HPV category determined with HTS of the amplicon generated by conventional nested PCR. The AbRT test is an easy and reliable molecular tool and was as sensitive as conventional nested PCR in cervical smear specimens for detection HPVs associated with high-grade lesions. Moreover, sequencing amplicons using an HTS approach effectively identified the genotype of the hrHPV identified with the AbRT test.

  5. pcr

    African Journals Online (AJOL)

    DR. AMINU

    Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections. INTRODUCTION ... used to amplify a piece of DNA by in-vitro enzymatic replication (David and .... receiving antimicrobial treatment, or when the causative agents are small ...

  6. Halal authenticity of gelatin using species-specific PCR.

    Science.gov (United States)

    Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

    2015-10-01

    Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Assessing gene expression during pathogenesis: Use of qRT-PCR to follow toxin production in the entomopathogenic fungus Beauveria bassiana during infection and immune response of the insect host Triatoma infestans.

    Science.gov (United States)

    Lobo, Luciana S; Luz, Christian; Fernandes, Éverton K K; Juárez, M Patricia; Pedrini, Nicolás

    2015-06-01

    Entomopathogenic fungi secrete toxic secondary metabolites during the invasion of the insect hemocoel as part of the infection process. Although these compounds have been frequently mentioned as virulence factors, the roles of many of them remain poorly understood, including the question of whether they are expressed during the infection process. A major hurdle to this issue remains the low sensitivity of biochemical detection techniques (e.g., HPLC) within the complex samples that may contain trace quantities of fungal molecules inside the insect. In this study, quantitative reverse transcription real-time PCR (qRT-PCR) was used to measure the transcript levels within the insect fungal pathogen Beauveria bassiana, that encode for the synthetase enzymes of the secondary metabolites tenellin (BbtenS), beauvericin (BbbeaS) and bassianolide (BbbslS) during the infection of Triatoma infestans, a Chagas disease insect vector. Absolute quantification was performed at different time periods after insect treatment with various concentrations of propagules, either by immersing the insects in conidial suspensions or by injecting them with blastospores. Both BbtenS and BbbeaS were highly expressed in conidia-treated insects at days 3 and 12 post-treatment. In blastospore-injected insects, BbtenS and BbbeaS expression peaked at 24h post-injection and were also highly expressed in insect cadavers. The levels of BbbslS transcripts were much lower in all conditions tested. The expression patterns of insect genes encoding proteins that belong to the T. infestans humoral immune system were also evaluated with the same technique. This qPCR-based methodology can contribute to decifering the dynamics of entomopathogenic fungal infection at the molecular level. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. The effect of feeding a commercial essential oil product on Clostridium perfringens numbers in the intestine of broiler chickens measured by real-time PCR targeting the α-toxin-encoding gene (plc)

    DEFF Research Database (Denmark)

    Abildgaard, Lone; Højberg, Ole; Schramm, Andreas

    2010-01-01

    Proliferation of Clostridium perfringens type A in the broiler intestinal tract is related to poor growth and litter quality, and can under certain conditions lead to the development of necrotic enteritis (NE), a severe gastrointestinal disease in broilers. The aim of the present study was to inv...... quantification of C. perfringens type A in broilers, a real-time PCR assay, targeting the α-toxin-encoding plc gene, was developed for use in ileal and caecal samples and was shown to be a fast and reliable alternative to conventional plate counting....

  9. [Optimized application of nested PCR method for detection of malaria].

    Science.gov (United States)

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  10. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Directory of Open Access Journals (Sweden)

    Tian-Min Qiao

    2016-10-01

    Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  11. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  12. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    Science.gov (United States)

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  13. Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

    Science.gov (United States)

    Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

    2018-05-01

    Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

  14. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas

    2010-05-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  15. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Sheng, Ping; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yu, Vivian

    2010-01-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  16. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  17. Fuel utilization in a progressive conversion reactor (PCR)

    International Nuclear Information System (INIS)

    Leyse, C.F.; Judd, J.L.

    1981-05-01

    Preliminary studies indicate that for once-through fuel cycles, the PCR offers potential improvements over current LWRs in the following major areas: improved uranium utilization (reduced uranium demand), degraded plutonium product in spent fuel, reduced plutonium content of spent fuel, reduced amount of spent fuel, reduced fissile content of spent fuel, and reduced separative work

  18. Development of a multiplex PCR assay detecting 52 autosomal SNPs

    DEFF Research Database (Denmark)

    Sanchez Sanchez, Juan Jose; Phillips, C.; Børsting, Claus

    2006-01-01

    for amplifying 52 genomic DNA fragments, each containing one SNP, in a single tube, and accurately genotyping the PCR product mixture using two single base extension reactions. This multiplex approach reduces the cost of SNP genotyping and requires as little as 0.5 ng of genomic DNA to detect 52 SNPs. We used...

  19. Pathogen Causing Disease of Diagnosis PCR Tecnology

    OpenAIRE

    SEVİNDİK, Emre; KIR, A. Çağrı; BAŞKEMER, Kadir; UZUN, Veysel

    2013-01-01

    Polimerase chain reaction (PCR) with which, the development of recombinant DNA tecnology, a technique commonly used in field of moleculer biology and genetic. Duplication of the target DNA is provided with this technique without the need for cloning. Some fungus species, bacteria, viruses constitutent an important group of pathogenicity in human, animals and plants. There are routinely applied types of PCR in the detection of pathogens infections diseases. These Nested- PCR, Real- Time PCR, M...

  20. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein

    DEFF Research Database (Denmark)

    Gram, Trine; Ahrens, Peter

    1998-01-01

    species related to A. pleuropneumoniae or isolated from pigs were assayed. They were all found negative in the PCR, as were tonsil cultures from 50 pigs of an A. pleuropneumoniae-negative herd. The sensitivity assessed by agarose gel analysis of the PCR product was 10(2) CFU/PCR test tube. The specificity...

  1. Quantitative analysis of food and feed samples with droplet digital PCR.

    Directory of Open Access Journals (Sweden)

    Dany Morisset

    Full Text Available In this study, the applicability of droplet digital PCR (ddPCR for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs. Real-time quantitative polymerase chain reaction (qPCR is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed.

  2. The PCR revolution: basic technologies and applications

    National Research Council Canada - National Science Library

    Bustin, Stephen A

    2010-01-01

    ... by leading authorities on the many applications of PCR and how this technology has revolutionized their respective areas of interest. This book conveys the ways in which PCR has overcome many obstacles in life science and clinical research and also charts the PCR's development from time-consuming, low throughput, nonquantitative proced...

  3. Detection of hepatitis C virus RNA using reverse transcription PCR

    International Nuclear Information System (INIS)

    Yap, S.F.

    1998-01-01

    Detection of the viral genome (HCV RNA) is by a combination of cDNA synthesis and PCR followed by gel analysis and/or hybridization assay. In principle, cDNA is synthesized using the viral RNA as template and the enzyme, reverse transcriptase. The cDNA is then amplified by PCR and the product detected. Agarose gel electrophoresis provides a rapid and simple detection method; however, it is non-quantitative. The assay protocol described in this paper is adapted from that published by Chan et al. Comments on various aspects of the assay are based on experience with the method in our laboratory

  4. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  5. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  6. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  7. [Application of rapid PCR to authenticate medicinal snakes].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  8. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  9. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen

    2014-01-01

    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  10. Synthesis of the human VEGF165 gene based on overlap PCR and ...

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... recombinant human VEGF165 (rhVEGF165) protein in CHO cells. ... The PCR program consisted of a denaturation step at 95°C for 3 min, then 25 cycles at ... PCR product for template and two oligos introduced at one end for.

  11. Comparative validation using quantitative real-time PCR (qPCR and conventional PCR of bovine semen centrifuged in continuous density gradient

    Directory of Open Access Journals (Sweden)

    M.V. Resende

    2011-06-01

    Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.

  12. [Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

    Science.gov (United States)

    Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

    2015-02-01

    To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

  13. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  14. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    Science.gov (United States)

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  15. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    Science.gov (United States)

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  16. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  17. Pitfalls in PCR troubleshooting: Expect the unexpected?

    Directory of Open Access Journals (Sweden)

    Livia Schrick

    2016-01-01

    Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.

  18. Absolute quantification by droplet digital PCR versus analog real-time PCR

    Science.gov (United States)

    Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh

    2014-01-01

    Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387

  19. Absolute quantification of olive oil DNA by droplet digital-PCR (ddPCR): Comparison of isolation and amplification methodologies.

    Science.gov (United States)

    Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar

    2016-12-15

    Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.

    Science.gov (United States)

    Smith, Cindy J; Osborn, A Mark

    2009-01-01

    Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.

  1. Development and application of a real-time quantitative PCR assay ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-01

    Dec 1, 2009 ... and a gel band purification kit (GE Health Care, UK), the PCR products obtained were ... amino acid sequences from various species, sequence alignment ..... sequence weighting, positions-specific gap penalties and weight.

  2. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  3. [E-MTAB-587] PCR_artifacts

    NARCIS (Netherlands)

    Muino Acuna, J.M.

    2011-01-01

    WARNING: This library was yield low amount of material and it was over-amplified by PCR. This libraries are used study the robustness of several statitical methods against PCR artifacts. ChIP experiments were performed on Arabidopsis wildtype inflorescences using an antibody raised against a

  4. Digital PCR for detection of citrus pathogens

    Science.gov (United States)

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  5. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  6. Validation of RNAi by real time PCR

    DEFF Research Database (Denmark)

    Josefsen, Knud; Lee, Ying Chiu

    2011-01-01

    Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...

  7. PCR specific for Actinobacillus pleuropneumoniae serotype 3

    DEFF Research Database (Denmark)

    Zhou, L.; Jones, S.C.P.; Angen, Øystein

    2008-01-01

    , but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...

  8. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  9. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  10. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  11. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  12. Detection of Trypanosoma congolense type savannah in field samples of buffy coats of bovins using PCR-ELISA

    International Nuclear Information System (INIS)

    Sidibe, I.

    2007-01-01

    PCR-ELISA was set up to detect strain of Trypanosoma congolense type savannah in field samples of buffy coats. Results of PCR-ELISA and PCR were compared and the sensibility and specificity of both techniques were also compared with those of the method of Murray [1] for the detection of TCS in 257 samples. The PCR products were labelling with DIG-dUTP during amplification cycles of the repetitive satellite DNA. A DNA biotinyled capture probe was used to detect the amplicon by ELISA in streptavidine coated microplates. Both of PCR-ELISA and PCR were more sensible and more specific than the method of Murray. Indeed, for the 257 samples analysed by the three techniques, PCR-ELISA and PCR have detected TCS in 98 and 97 samples respectively, whereas the method of Murray has detected TCS in only 39 samples. In addition, PCRELISA and PCR had almost the same sensibility and specificity. So, PCR-ELISA and PCR have respectively detected TCS in 38.62% and 39.22% of all the 334 samples analysed by both techniques during this study. At the end of this study, the cost of analyse by PCR-ELISA of a sample of buffy coat, was evaluated at 1993 FCFA or Euro 3,04. (author) [fr

  13. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  14. Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.

  15. Use of species-specific PCR for the identification of 10 sea cucumber species

    Science.gov (United States)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  16. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas; Chang, Donald Choy; Gong, Xiuqing; Wen, Weijia; Wu, Jinbo; Xiao, Kang; Yi, Xin

    2010-01-01

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  17. Material Biocompatibility for PCR Microfluidic Chips

    KAUST Repository

    Kodzius, Rimantas

    2010-04-23

    As part of the current miniaturization trend, biological reactions and processes are being adapted to microfluidics devices. PCR is the primary method employed in DNA amplification, its miniaturization is central to efforts to develop portable devices for diagnostics and testing purposes. A problem is the PCR-inhibitory effect due to interaction between PCR reagents and the surrounding environment, which effect is increased in high-surface-are-to-volume ration microfluidics. In this study, we evaluated the biocompatibility of various common materials employed in the fabrication of microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most of the cases, addition of bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, whereas they did show noticeable interaction with the DNA polymerase. Our test, instead of using microfluidic devices, can be easily conducted in common PCR tubes using a standard bench thermocycler. Our data supports an overview of the means by which the materials most bio-friendly to microfluidics can be selected.

  18. Productivity

    DEFF Research Database (Denmark)

    Spring, Martin; Johnes, Geraint; Hald, Kim Sundtoft

    Productivity is increasingly critical for developed economies. It has always been important: as Paul Krugman puts it, “Productivity isn’t everything, but in the long run it is almost everything. A country’s ability to improve its standard of living over time depends almost entirely on its ability...... to raise its output per worker”(Krugman, 1994). Analyses of productivity have, by and large, been the preserve of economists. Operations Management (OM) is rooted in a similar concern for the efficient use of scarce resources; Management Accounting (MA) is concerned with the institutionalised measurement...... and management of productivity. Yet the three perspectives are rarely connected. This paper is a sketch of a literature review seeking to identify, contrast and reconcile these three perspectives. In so doing, it aims to strengthen the connections between policy and managerial analyses of productivity....

  19. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  20. Real-time PCR in virology

    OpenAIRE

    Mackay, Ian M.; Arden, Katherine E.; Nitsche, Andreas

    2002-01-01

    The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of P...

  1. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  2. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Science.gov (United States)

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  3. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Directory of Open Access Journals (Sweden)

    Karolina Stojowska

    Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  4. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    Science.gov (United States)

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  5. A random PCR screening system for the identification of type 1 human herpes simplex virus.

    Science.gov (United States)

    Yu, Xuelian; Shi, Bisheng; Gong, Yan; Zhang, Xiaonan; Shen, Silan; Qian, Fangxing; Gu, Shimin; Hu, Yunwen; Yuan, Zhenghong

    2009-10-01

    Several viral diseases exhibit measles-like symptoms. Differentiation of suspected cases of measles with molecular epidemiological techniques in the laboratory is useful for measles surveillance. In this study, a random PCR screening system was undertaken for the identification of isolates from patients with measles-like symptoms who exhibited cytopathic effects, but who had negative results for measles virus-specific reverse transcription (RT)-PCR and indirect immunofluorescence assays. Sequence analysis of random amplified PCR products showed that they were highly homologous to type 1 human herpes simplex virus (HSV-1). The results were further confirmed by an HSV-1-specific TaqMan real-time PCR assay. The random PCR screening system described in this study provides an efficient procedure for the identification of unknown viral pathogens. Measles-like symptoms can also be caused by HSV-1, suggesting the need to include HSV-1 in differential diagnoses of measles-like diseases.

  6. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

    DEFF Research Database (Denmark)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

    2013-01-01

    as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

  7. Two-temperature LATE-PCR endpoint genotyping

    Directory of Open Access Journals (Sweden)

    Reis Arthur H

    2006-12-01

    Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of

  8. Authentication of Meat Species in Sucuk by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Osman İrfan İLHAK

    2015-01-01

    Full Text Available The identification of meat species used in meat products is important by reason of economic considerations, religious factors, verification of label, and prevention of unfair-market competition. In this paper, multiplex PCR method was experienced for routine detection of equine (horse and donkey, poultry (chicken and turkey, pig and cattle meat in sucuk (sausage. The primers used for these animals generated specific fragments, and they did not show cross reactions with the DNA from the other genus of animal. After multiplex PCR was successfully optimized, a field study was carried out to investigate the presence of horse, donkey, chicken, turkey and pig meat in 50 sucuks (30 beef and 20 beef + poultry collected from markets. The result of the field study indicated that 23.3% of 30 beef sucuk samples were containing poultry meat. None of the 50 sucuk samples was containing pig meat, but one (2% of the samples generated equine fragment. The present study showed that the multiplex PCR method can be used for routine analysis of meat species identification, verification and control of label information of meat products.

  9. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  10. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

    Science.gov (United States)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

    2013-11-01

    In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

  11. Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

    Science.gov (United States)

    Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

    2017-08-01

    Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

  12. Calibrated user-friendly reverse transcriptase-PCR assay

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Rammer, P

    1998-01-01

    We report a competitive reverse transcriptase-PCR (RT-PCR) assay and a calibrated user-friendly RT-PCR assay (CURT-PCR) for epidermal growth factor receptor (EGFR) mRNA. A calibrator was prepared from isolated rat liver RNA, and the amount of EGFR mRNA was determined by competitive RT-PCR. In CUR...

  13. Identification of Tilletia species using rep-PCR fingerprinting technique

    Directory of Open Access Journals (Sweden)

    Župunski Vesna

    2011-01-01

    Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.

  14. Transgene detection by digital droplet PCR.

    Directory of Open Access Journals (Sweden)

    Dirk A Moser

    Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.

  15. Diagnosis of trichomonas vaginalis infection by PCR

    International Nuclear Information System (INIS)

    Issa, R.M.; Shalaby, M.A.

    2007-01-01

    To compare the sensitivity of PCR, wet preparation and culture in detecting Trichomonas vaginalis in urine and vaginal fluid. A PCR targeting the beta-tubulin genes of T. vaginalis was used for the detection of the organism in both vaginal swab and urine specimens from infected patients. Random urine samples were collected from 30 patients (23 females and 7 males), and tested for T. vaginalis by wet preparation and the Inpouch T. vaginalis culture systeme. Two vaginal swabs were collected by each woman. PCR detection. was carried out on samples negative by first methods. The positive result was found in 28.57% in male urine and 39.13% in female urine samples, 65.21% in 1st swab and 78.26 % in 2nd swab by wet preparation. By culture, the male urine samples showed 42.85% positive, female urine 69.56% while 1st swab showed 86.95% positive and 2nd swab 91.30% positive. All negative cases by culture in urine and vaginal samples were tested by PCR, which showed 2 cases to be positive in male urine samples and 5 cases positive in female urine sample. PCR assay was as good as or more sensitive than wet preparation and culture and resulted in practical advantage of providing results in shorter time. However, PCR test is still very expensive. (author)

  16. Evaluation of droplet digital PCR for quantification of residual leucocytes in red blood cell concentrates.

    Science.gov (United States)

    Doescher, A; Loges, U; Petershofen, E K; Müller, T H

    2017-11-01

    Enumeration of residual white blood cells in leucoreduced blood components is essential part of quality control. Digital PCR has substantially facilitated quantitative PCR and was thus evaluated for measurements of leucocytes. Target for quantification of leucocytes by digital droplet PCR was the blood group gene RHCE. The SPEF1 gene was added as internal control for the entire assay starting with automated DNA extraction. The sensitivity of the method was determined by serial dilutions of standard samples. Quality control samples were analysed within 24 h, 7 days and 6 months after collection. Routine samples from leucodepleted red blood cell concentrates (n = 150) were evaluated in parallel by flow-cytometry (LeucoCount) and by digital PCR. Digital PCR reliably detected at least 0·4 leucocytes per assay. The mean difference between PCR and flow-cytometric results from 150 units was -0·01 (±1·0). DNA samples were stable for up to at least six months. PCR measurement of leucocytes in samples from plasma and platelet concentrates also provided valid results in a pilot study. Droplet digital PCR to enumerate leucocytes offers an alternative for quality control of leucoreduced blood products. Sensitivity, specificity and reproducibility are comparable to flow-cytometry. The option to collect samples over an extended period of time and the automatization introduce attractive features for routine quality control. © 2017 International Society of Blood Transfusion.

  17. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  19. Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.

    Science.gov (United States)

    West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D

    1995-01-01

    A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625

  20. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  1. Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

    Science.gov (United States)

    Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

    2015-02-01

    Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

  2. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  3. STS for minisatellite 33. 1 (D9S49): Direct typing by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Armour, J.A.L.; Neumann, R.; Jeffreys, A.J. (Univ. of Leicester (United Kingdom))

    1991-09-11

    The minisatellite locus 33.1 was initially isolated from a human genomic library by hybridization screening with a tandem repeat probe. This locus has since been localized by somatic cell hybrid analysis and linkage mapping to the long arm of chromosome. PCR typing at this minisatellite locus has already been described in which PCR products were detected by hybridization. Here the authors describe the direct typing of this locus by PCR, a process which may also be used to generate a probe for use in Southern blot analysis of genomic DNA.

  4. PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

    Directory of Open Access Journals (Sweden)

    Iris Wundrack

    1994-01-01

    Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

  5. Diagnostic PCR tests for Microsporum audouinii, M. canis and Trichophyton infections

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, Anna; Swierkowska, Aleksandra; Lindhardt Saunte, Ditte Marie

    2010-01-01

    ; 25 routine specimens from patients suspected of having dermatophytosis; 10 hair specimens from guinea pigs experimentally infected with M. canis; and two samples from un-infected control animals. DNA was prepared by a 10-min procedure from pure cultures as previously described. The 302 bp PCR product....... Finally, the Microsporum PCR was positive for 10/10 guinea pig specimens from infected animals but for 0/2 of the control animal samples. The evaluation of the two PCR tests indicated excellent sensitivity and specificity....

  6. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  7. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

    Science.gov (United States)

    Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

    2017-09-07

    Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

  9. PCR+ In Diesel Fuels and Emissions Research

    Energy Technology Data Exchange (ETDEWEB)

    McAdams, H.T.

    2002-04-15

    In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.

  10. Association between absence of vaginal lactobacilli PCR products ...

    African Journals Online (AJOL)

    Context: The most common cause of abnormal vaginal discharge in women of childbearing age is bacterial vaginosis (BV). This condition predisposes women to increased susceptibility to sexually transmitted diseases, including human immunodeficiency virus (HIV) infections and preterm birth. The diagnostic methods ...

  11. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  12. SCREENING OF COMMON FLAX FAD GENES BY PCR

    Directory of Open Access Journals (Sweden)

    Veronika Štefúnová

    2013-02-01

    Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

  13. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  14. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    Science.gov (United States)

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  15. A PCR-based method for identification of bifidobacteria from the human alimentary tract at the species level

    NARCIS (Netherlands)

    Venema, K.; Maathuis, A.J.H.

    2003-01-01

    A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12

  16. From the 'PCR' function to the 'PCR' profession; de la fonction 'PCR' au metier 'PCR'

    Energy Technology Data Exchange (ETDEWEB)

    Perrin, L. [CERAP, 91 - Gif sur Yvette (France)

    2008-07-01

    After having recalled the legal context concerning the appointment and training of a radiation protection expert (PCR for 'personne competente en radioprotection'), the author outlines that the PCR's role has notably evolved: his function is now of primary importance in the company and his activity does not correspond to the legal framework any longer. Moreover, with the application of a European directive, some small establishments possessing ionizing radiation sources are disadvantaged, and the PCR is now facing an increasing number of missions and tasks. The author gives a list of them and assesses a needed time of 146 days per year: this means PCRs cannot have an other activity within their company

  17. PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Nowak Magdalena

    2009-11-01

    Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

  18. Propidium monoazide reverse transcription PCR and RT-qPCR for detecting infectious enterovirus and norovirus

    Science.gov (United States)

    Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...

  19. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  20. Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M Heiat

    2010-07-01

    Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

  1. Development of PCR for WWTP based on a case study

    International Nuclear Information System (INIS)

    Del Borghi, A.; Gallo, M.; Strazza, C.; Gaggero, P.L.

    2009-01-01

    In order to apply the Environmental Product Declaration (EPD) to products or services, specific rules (PCR, Product Category Rules) have to be issued to ensure comparability among different declarations within the same service group. The aim of the present study is to describe the reasons leading to each choice in the development of PCR applied to collecting and treatment service of municipal wastewater and to evaluate, through life cycle analysis (LCA), their influence on the potential environmental impact of a wastewater treatment plant (WWTP), analysed as a case study. Specific data were collected during the year 2003 from an Italian active sludge treatment plant with separate wastewater and sludge treatment lines. The life-cycle approach applied to the case study shows that LCA represents an environmental management tool able both to communicate environmental information by the Type 3. environmental label EPD, and to look for different scenarios that can improve the environmental performance of the Collecting and Treatment Service of Municipal Wastewater. [it

  2. Reduction of heteroduplex formation in PCR amplification

    Czech Academy of Sciences Publication Activity Database

    Michu, Elleni; Mráčková, Martina; Vyskot, Boris; Žlůvová, Jitka

    2010-01-01

    Roč. 54, č. 1 (2010), s. 173-176 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) KJB600040801; GA ČR(CZ) GD204/09/H002; GA AV ČR(CZ) IAA600040801; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : polymerase chain reaction * reconditioning PCR * mixed-template PCR Subject RIV: BO - Biophysics Impact factor: 1.582, year: 2010

  3. A naked-eye colorimetric "PCR developer"

    Science.gov (United States)

    Valentini, Paola; Pompa, Pier Paolo

    2016-04-01

    Despite several advances in molecular biology and diagnostics, Polymerase Chain Reaction (PCR) is currently the gold standard for nucleic acids amplification and detection, due to its versatility, low-cost and universality, with estimated genetically modified organisms, and pathogens). The PCR developer proved to be highly specific and ultra-sensitive, discriminating down to few copies of HIV viral DNA, diluted in an excess of interfering human genomic DNA, which is a clinically relevant viral load. Hence, it could be a valuable tool for both academic research and clinical applications.

  4. Escherichia coli H-Genotyping PCR: a Complete and Practical Platform for Molecular H Typing.

    Science.gov (United States)

    Banjo, Masaya; Iguchi, Atsushi; Seto, Kazuko; Kikuchi, Taisei; Harada, Tetsuya; Scheutz, Flemming; Iyoda, Sunao

    2018-06-01

    In Escherichia coli , more than 180 O groups and 53 H types have been recognized. The O:H serotyping of E. coli strains is an effective method for identifying strains with pathogenic potential and classifying them into clonal groups. In particular, the serotyping of Shiga toxin-producing E. coli (STEC) strains provides valuable information to evaluate the routes, sources, and prevalence of agents in outbreak investigations and surveillance. Here, we present a complete and practical PCR-based H-typing system, E. coli H-genotyping PCR, consisting of 10 multiplex PCR kits with 51 single PCR primer pairs. Primers were designed based on a detailed comparative analysis of sequences from all H-antigen (flagellin)-encoding genes, fliC and its homologs. The specificity of this system was confirmed by using all H type reference strains. Additionally, 362 serotyped wild strains were also used to evaluate its practicality. All 277 H-type-identified isolates gave PCR products that corresponded to the results of serological H typing. Moreover, 76 nonmotile and nine untypeable strains could be successfully subtyped into any H type by the PCR system. The E. coli H-genotyping PCR developed here allows broader, rapid, and low-cost subtyping of H types and will assist epidemiological studies as well as surveillance of pathogenic E. coli . Copyright © 2018 American Society for Microbiology.

  5. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Science.gov (United States)

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  6. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    Science.gov (United States)

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  7. Assessment of Duplex PCR for the simultaneous diagnose of Mycobacterium spp. and Brucella spp. in cattle

    Directory of Open Access Journals (Sweden)

    Ariel Escobar

    2013-03-01

    Full Text Available Tuberculosis and brucellosis remain important causes of morbidity and mortality in many countries, for the detection of both diseases requires efficient and sensitive tool for effectuate the diagnosis. This study was aimed to evaluate and compare the duplex PCR versus the nested PCR, for detection of Brucella spp. (BR and Mycobacterium spp. (TB. A total of 100 samples of tissues from tracheo-bronchial lymph nodes, bovine lung and bacterial isolate as positive controls were used. Were evaluated ten combinations of primers which were designed to flank the segment of the 16S rRNA sequence (RB and antigen gen MPB70 (TB, the best result for the Duplex PCR was obtained with the primers Bru-2F/Bru-2R for BR and Tub-1F/Tub-N-R for TB. The amplification of the products was 225 and 230-bp respectively. In order to compare the results of the proposed technique, all samples were initially analyzed and compared between PCR and nested PCR (Kappa, k = 0.85 and the concordance between Duplex PCR and nested PCR (k = 0.88 for the two bacteria was very good.

  8. PCR methodology as a valuable tool for identification of endodontic pathogens.

    Science.gov (United States)

    Siqueira, José F; Rôças, Isabela N

    2003-07-01

    This paper reviews the principles of polymerase chain reaction (PCR) methodology, its application in identification of endodontic pathogens and the perspectives regarding the knowledge to be reached with the use of this highly sensitive, specific and accurate methodology as a microbial identification test. Studies published in the medical, dental and biological literature. Evaluation of published epidemiological studies examining the endodontic microbiota through PCR methodology. PCR technology has enabled the detection of bacterial species that are difficult or even impossible to culture as well as cultivable bacterial strains showing a phenotypically divergent or convergent behaviour. Moreover, PCR is more rapid, much more sensitive, and more accurate when compared with culture. Its use in endodontics to investigate the microbiota associated with infected root canals has expanded the knowledge on the bacteria involved in the pathogenesis of periradicular diseases. For instance, Tannerella forsythensis (formerly Bacteroides forsythus), Treponema denticola, other Treponema species, Dialister pneumosintes, and Prevotella tannerae were detected in infected root canals for the first time and in high prevalence when using PCR analysis. The diversity of endodontic microbiota has been demonstrated by studies using PCR amplification, cloning and sequencing of the PCR products. Moreover, other fastidious bacterial species, such as Porphyromonas endodontalis, Porphyromonas gingivalis and some Eubacterium spp., have been reported in endodontic infections at a higher prevalence than those reported by culture procedures.

  9. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

    Science.gov (United States)

    Demeke, Tigst; Jenkins, G Ronald

    2010-03-01

    Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

  10. Principal component reconstruction (PCR) for cine CBCT with motion learning from 2D fluoroscopy.

    Science.gov (United States)

    Gao, Hao; Zhang, Yawei; Ren, Lei; Yin, Fang-Fang

    2018-01-01

    This work aims to generate cine CT images (i.e., 4D images with high-temporal resolution) based on a novel principal component reconstruction (PCR) technique with motion learning from 2D fluoroscopic training images. In the proposed PCR method, the matrix factorization is utilized as an explicit low-rank regularization of 4D images that are represented as a product of spatial principal components and temporal motion coefficients. The key hypothesis of PCR is that temporal coefficients from 4D images can be reasonably approximated by temporal coefficients learned from 2D fluoroscopic training projections. For this purpose, we can acquire fluoroscopic training projections for a few breathing periods at fixed gantry angles that are free from geometric distortion due to gantry rotation, that is, fluoroscopy-based motion learning. Such training projections can provide an effective characterization of the breathing motion. The temporal coefficients can be extracted from these training projections and used as priors for PCR, even though principal components from training projections are certainly not the same for these 4D images to be reconstructed. For this purpose, training data are synchronized with reconstruction data using identical real-time breathing position intervals for projection binning. In terms of image reconstruction, with a priori temporal coefficients, the data fidelity for PCR changes from nonlinear to linear, and consequently, the PCR method is robust and can be solved efficiently. PCR is formulated as a convex optimization problem with the sum of linear data fidelity with respect to spatial principal components and spatiotemporal total variation regularization imposed on 4D image phases. The solution algorithm of PCR is developed based on alternating direction method of multipliers. The implementation is fully parallelized on GPU with NVIDIA CUDA toolbox and each reconstruction takes about a few minutes. The proposed PCR method is validated and

  11. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  12. Detection of Mycobacterium Tuberculosis by using PCR

    International Nuclear Information System (INIS)

    Suhadi, F; Dadang-Sudrajat; Maria-Lina, R.

    1996-01-01

    Polymerase Chain Reaction (PCR) procedure using three primary set derived from repetitive DNA sequence specific to mycobacteria was used to diagnose pathogenic Mycobacterium tuberculosis. The assay was specific for M. tuberculosis and could be used to detect the amount DNA less than 10 -9 g

  13. Real-time PCR gene expression profiling

    Czech Academy of Sciences Publication Activity Database

    Kubista, Mikael; Sjögreen, B.; Forootan, A.; Šindelka, Radek; Jonák, Jiří; Andrade, J.M.

    2007-01-01

    Roč. 1, - (2007), s. 56-60 ISSN 1360-8606 R&D Projects: GA AV ČR KJB500520601 Institutional research plan: CEZ:AV0Z50520514 Keywords : real - time PCR, * expression profiling * statistical analysis Subject RIV: EB - Genetics ; Molecular Biology

  14. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    Directory of Open Access Journals (Sweden)

    Nelly eDatukishvili

    2015-07-01

    Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  15. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    Science.gov (United States)

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  16. Development of PCR method for diagnosing of honey bee American Foulbrood disease

    Directory of Open Access Journals (Sweden)

    Modirrousta, H.

    2012-06-01

    Full Text Available American foulbrood (AFB disease is caused by the sporeforming bacterium Paenibacillus larvae larvae. Traditional diagnosis is based on culture technique is time and laboratory work consuming. In this study with standard strain, PCR was developed by specific primers and PCR products were electrophoresed on 0.8 % agarose gel. The PCR primers were selected on the basis of the 16S rRNA gene and amplify a 700-bp amplicon. Detection limits were determined for suspensions of bacteria and spores and also honey and larvae experimentally contaminated. The lowest number of bacteria and spores that were able to detect were respectively 28, 33, 330 and 243 cfu /ml. This PCR technique can be used to identification of the presence of Paenibacillus larvae larvae spores in honey samples, brood samples or on the colonies that grow on medium.

  17. Multiplex PCR detection of waterborne intestinal protozoa: microsporidia, Cyclospora, and Cryptosporidium.

    Science.gov (United States)

    Lee, Seung-Hyun; Joung, Migyo; Yoon, Sejoung; Choi, Kyoungjin; Park, Woo-Yoon; Yu, Jae-Ran

    2010-12-01

    Recently, emerging waterborne protozoa, such as microsporidia, Cyclospora, and Cryptosporidium, have become a challenge to human health worldwide. Rapid, simple, and economical detection methods for these major waterborne protozoa in environmental and clinical samples are necessary to control infection and improve public health. In the present study, we developed a multiplex PCR test that is able to detect all these 3 major waterborne protozoa at the same time. Detection limits of the multiplex PCR method ranged from 10(1) to 10(2) oocysts or spores. The primers for microsporidia or Cryptosporidium used in this study can detect both Enterocytozoon bieneusi and Encephalitozoon intestinalis, or both Cryptosporidium hominis and Cryptosporidium parvum, respectively. Restriction enzyme digestion of PCR products with BsaBI or BsiEI makes it possible to distinguish the 2 species of microsporidia or Cryptosporidium, respectively. This simple, rapid, and cost-effective multiplex PCR method will be useful for detecting outbreaks or sporadic cases of waterborne protozoa infections.

  18. A survey of tools for the analysis of quantitative PCR (qPCR) data.

    Science.gov (United States)

    Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

    2014-09-01

    Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  19. Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

    Science.gov (United States)

    Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

    2017-01-01

    The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

  20. A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

    Science.gov (United States)

    Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

    2013-03-11

    Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

  1. A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

    Science.gov (United States)

    Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

    2015-07-07

    Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

  2. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  3. Comparison of simultaneous splenic sample PCR with blood sample PCR for diagnosis and treatment of experimental Ehrlichia canis infection.

    Science.gov (United States)

    Harrus, Shimon; Kenny, Martin; Miara, Limor; Aizenberg, Itzhak; Waner, Trevor; Shaw, Susan

    2004-11-01

    This report presents evidence that dogs recover from acute canine monocytic ehrlichiosis (CME) after 16 days of doxycycline treatment (10 mg/kg of body weight every 24 h). Blood PCR was as valuable as splenic aspirate PCR for early diagnosis of acute CME. Splenic aspirate PCR was, however, superior to blood PCR for the evaluation of ehrlichial elimination.

  4. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-01-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  5. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  6. Development of a multiplex PCR for the genetic analysis of paddlefish (Polyodon spathula Walbaum,1792 populations

    Directory of Open Access Journals (Sweden)

    K. Kurta

    2017-12-01

    Full Text Available Purpose. Paddlefish is commercially important species owing to its biological features and consumer characteristics, namely it produces valuable and delicious fish products, such as high quality meat and black caviar. Consequently, its cultivation under Ukrainian fish farm conditions and further realization in domestic and foreign markets are economically efficient. However, the paddlefish broodstock in Ukraine requires the efficient solution of increasing its productivity, identification and assessment of its genetic variation. Thus, the aim of our study was to develop and implement a multiplex PCR-analysis of paddlefish (Polyodon spathula for population-genetic monitoring of its artificial broodstocks in Ukraine. Methodology. A multiplex PCR was used for the study. The multiplex PCR development was performed for four microsatellite DNA markers: Psp12, Psp21, Psp26 and Psp28. Each investigated DNA loci, for which the multiplex PCR was optimized, was selected in such a way that the colored PCR products labeled with fluorescent dye did not overlap the length of the amplified fragments. Evaluation of the multiplex PCR effectiveness and processing of the data were performed by fragment analysis of DNA on the genetic analyzer ABI Prism 3130 (Applied Biosystem, USA. The size of the identified alleles was determined using the "Gene Mapper 3.7" program (Applied Biosystems, USA and LIZ-500 size standard (Applied Biosystems, USA. Results. Based on the results of capillary electrophoresis of multiplex PCR products, it was found that the amplified fragments for each of the four studied loci: Psp12, Psp21, Psp26 and Psp28 in one PCR reaction were within the expected size range. Data analysis on the electrophoregram demonstrated that Psp21 had the highest peak intensity at 611 fluorescent units (FU and the lowest peak intensity at 105 FU was observed for Psp26 locus. In the multiplex PCR after proper interpretation of the data we identified heterozygous

  7. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J J; Carithers, R L; dela Rosa, C; Han, J H; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  8. Genotyping of the Holstein-Friesian crossbred cattle for CD18 gene using PCR-RFLP

    Directory of Open Access Journals (Sweden)

    A. S. Khade

    2014-05-01

    Full Text Available Aim: The present study was undertaken in Holstein-Friesian (HF crossbred cattle with the objective to find out genotype of HF crossbred cattle for Bovine Leucocyte Adhesion Deficiency (BLAD by using PCR-RFLP. Materials and Methods: 50 blood samples were collected from HF crossbred cattle and subjected to PCR. The amplified PCR products were digested using Taq I restriction enzyme at 65 oC overnight. After restriction digestion, the final PCR products were electrophoresed on 2.5 % agarose gel. Results: All the 50 animals under present investigation were found to be normal as the amplified PCR product upon digestion with Taq I restriction enzyme, revealed two bands of 313 bp and 54 bp for normal animals. Conclusions: In the present investigation D128G carrier frequency was found to be 0 %. However, recent reports suggest that the mutant gene has already been observed in the HF crossbred cattle population of India, which makes it necessary to screen the animals to avoid the risk of spreading BLAD in the breeding cattle population.

  9. Improved quantification accuracy for duplex real-time PCR detection of genetically modified soybean and maize in heat processed foods

    Directory of Open Access Journals (Sweden)

    CHENG Fang

    2013-04-01

    Full Text Available Real-time PCR technique has been widely used in quantitative GMO detection in recent years.The accuracy of GMOs quantification based on the real-time PCR methods is still a difficult problem,especially for the quantification of high processed samples.To develop the suitable and accurate real-time PCR system for high processed GM samples,we made ameliorations to several real-time PCR parameters,including re-designed shorter target DNA fragment,similar lengths of amplified endogenous and exogenous gene targets,similar GC contents and melting temperatures of PCR primers and TaqMan probes.Also,one Heat-Treatment Processing Model (HTPM was established using soybean flour samples containing GM soybean GTS 40-3-2 to validate the effectiveness of the improved real-time PCR system.Tested results showed that the quantitative bias of GM content in heat processed samples were lowered using the new PCR system.The improved duplex real-time PCR was further validated using processed foods derived from GM soybean,and more accurate GM content values in these foods was also achieved.These results demonstrated that the improved duplex real-time PCR would be quite suitable in quantitative detection of high processed food products.

  10. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  11. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio

    2002-01-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  12. Identification and genotyping of molluscum contagiosum virus from genital swab samples by real-time PCR and Pyrosequencing.

    Science.gov (United States)

    Trama, Jason P; Adelson, Martin E; Mordechai, Eli

    2007-12-01

    Laboratory diagnosis of molluscum contagiosum virus (MCV) is important as lesions can be confused with those caused by Cryptococcus neoformans, herpes simplex virus, human papillomavirus, and varicella-zoster virus. To develop a rapid method for identifying patients infected with MCV via swab sampling. Two dual-labeled probe real-time PCR assays, one homologous to the p43K gene and one to the MC080R gene, were designed. The p43K PCR was designed to be used in conjunction with Pyrosequencing for confirmation of PCR products and discrimination between MCV1 and MCV2. Both PCR assays were optimized with respect to reaction components, thermocycling parameters, and primer and probe concentrations. The specificities of both PCR assays were confirmed by non-amplification of 38 known human pathogens. Sensitivity assays demonstrated detection of as few as 10 copies per reaction. Testing 703 swabs, concordance between the two real-time PCR assays was 99.9%. Under the developed conditions, Pyrosequencing of the p43K PCR product was capable of providing enough nucleotide sequence to definitively differentiate MCV1 and MCV2. These real-time PCR assays can be used for the rapid, sensitive, and specific detection of MCV and, when combined with Pyrosequencing, can further discriminate between MCV1 and MCV2.

  13. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR.

    Directory of Open Access Journals (Sweden)

    Yogita Maheshwari

    Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.

  14. Clostridium perfringens isolate typing by multiplex PCR

    Directory of Open Access Journals (Sweden)

    MR Ahsani

    2010-01-01

    Full Text Available Clostridium perfringens is an important pathogen that provokes numerous different diseases. This bacterium is classified into five different types, each of which capable of causing a different disease. There are various methods for the bacterial identification, many are labor-intensive, time-consuming, expensive and also present low sensitivity and specificity. The aim of this research was to identify the different types of C. perfringens using PCR molecular method. In this study, 130 sheep-dung samples were randomly collected from areas around the city of Kerman, southeastern Iran. After processing and culturing of samples, the produced colonies were morphologically studied, gram stain test was also carried out and the genera of these bacteria were identified through biochemical tests. DNA extracted from isolated bacteria for genotyping was tested by multiplex PCR with specific primers. Based on length of synthesized fragments by PCR, toxin types and bacterial strains were detected. C. perfringens isolated types were divided as follows: 17.39% type A, 21.74% type B, 34.78% type C and 26.09% type D. It should be emphasized that, up to the present moment, C. perfringens type A has not been reported in Iran.

  15. Directed PCR-free engineering of highly repetitive DNA sequences

    Directory of Open Access Journals (Sweden)

    Preissler Steffen

    2011-09-01

    Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

  16. COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR

    Directory of Open Access Journals (Sweden)

    Masashi Miura

    2013-12-01

    Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.

  17. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    Science.gov (United States)

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. A comparative study of digital PCR and real-time qPCR for the detection and quantification of HPV mRNA in sentinel lymph nodes of cervical cancer patients.

    Science.gov (United States)

    Carow, Katrin; Read, Christina; Häfner, Norman; Runnebaum, Ingo B; Corner, Adam; Dürst, Matthias

    2017-10-30

    Qualitative analyses showed that the presence of HPV mRNA in sentinel lymph nodes of cervical cancer patients with pN0 status is associated with significantly decreased recurrence free survival. To further address the clinical potential of the strategy and to define prognostic threshold levels it is necessary to use a quantitative assay. Here, we compare two methods of quantification: digital PCR and standard quantitative PCR. Serial dilutions of 5 ng-5 pg RNA (≙ 500-0.5 cells) of the cervical cancer cell line SiHa were prepared in 5 µg RNA of the HPV-negative human keratinocyte cell line HaCaT. Clinical samples consisted of 10 sentinel lymph nodes with varying HPV transcript levels. Reverse transcription of total RNA (5 µg RNA each) was performed in 100 µl and cDNA aliquots were analyzed by qPCR and dPCR. Digital PCR was run in the RainDrop ® Digital PCR system (RainDance Technologies) using a probe-based detection of HPV E6/E7 cDNA PCR products with 11 µl template. qPCR was done using a Rotor Gene Q 5plex HRM (Qiagen) amplifying HPV E6/E7 cDNA in a SYBR Green format with 1 µl template. For the analysis of both, clinical samples and serial dilution samples, dPCR and qPCR showed comparable sensitivity. With regard to reproducibility, both methods differed considerably, especially for low template samples. Here, we found with qPCR a mean variation coefficient of 126% whereas dPCR enabled a significantly lower mean variation coefficient of 40% (p = 0.01). Generally, we saw with dPCR a substantial reduction of subsampling errors, which most likely reflects the large cDNA amounts available for analysis. Compared to real-time PCR, dPCR shows higher reliability. Thus, our HPV mRNA dPCR assay holds promise for the clinical evaluation of occult tumor cells in histologically tumor-free lymph nodes in future studies.

  19. Fast real-time PCR for the detection of crustacean allergen in foods.

    Science.gov (United States)

    Herrero, Beatriz; Vieites, Juan M; Espiñeira, Montserrat

    2012-02-29

    Crustaceans are one of the most common allergens causing severe food reaction. These food allergens are a health problem, and they have become very important; there are various regulations that establish that labeling must be present regarding these allergens to warn consumers. In the present work a fast real-time PCR, by a LNA probe, was developed. This allows the detection of crustaceans in all kinds of products, including processed products in which very aggressive treatments of temperature and pressure during the manufacturing process are used. This methodology provides greater sensitivity and specificity and reduces the analysis time of real-time PCR to 40 min. This methodology was further validated by means of simulating products likely to contain this allergen. For this, products present on the market were spiked with crustacean cooking water. The assay is a potential tool in issues related to the labeling of products and food security to protect the allergic consumer.

  20. Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.

    Science.gov (United States)

    Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing

    2018-02-01

    The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.

  1. Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

    Science.gov (United States)

    Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

    2017-08-15

    Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Lina, M.; Dadang, S.; Suhadi, F.

    2002-01-01

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  3. Advantages and Limitations of Ribosomal RNA PCR and DNA Sequencing for Identification of Bacteria in Cardiac Valves of Danish Patients

    DEFF Research Database (Denmark)

    Kemp, Michael; Bangsborg, Jette; Kjerulf, Anne

    2013-01-01

    of direct molecular identification should also address weaknesses, their relevance in the given setting, and possible improvements. In this study cardiac valves from 56 Danish patients referred for surgery for infective endocarditis were analysed by microscopy and culture as well as by PCR targeting part...... of the bacterial 16S rRNA gene followed by DNA sequencing of the PCR product. PCR and DNA sequencing identified significant bacteria in 49 samples from 43 patients, including five out of 13 culture-negative cases. No rare, exotic, or intracellular bacteria were identified. There was a general agreement between...... bacterial identity obtained by ribosomal PCR and DNA sequencing from the valves and bacterial isolates from blood culture. However, DNA sequencing of the 16S rRNA gene did not discriminate well among non-haemolytic streptococci, especially within the Streptococcus mitis group. Ribosomal PCR with subsequent...

  4. Screening for human papillomavirus in basaloid squamous carcinoma: utility of p16(INK4a), CISH, and PCR.

    Science.gov (United States)

    Winters, Ryan; Trotman, Winifred; Adamson, Christine S C; Rajendran, Vanitha; Tang, Alice; Elhosseiny, Abdelmonem; Evans, Mark F

    2011-06-01

    This study compares p16( INK4a) immunohistochemistry (IHC), HPV chromogenic in situ hybridization (ISH), and HPV polymerase chain reaction (PCR) genotyping for detection of HPV infection in basaloid squamous carcinoma (BSCC). A retrospective histopathological analysis of 40 BSCC from a single institution was carried out. p16 IHC, HPV DNA extraction and ISH, and HPV PCR genotyping were performed, and there was excellent agreement between all 3 methods of HPV detection. Analysis of variance yielded no significant differences between the results of the 3 tests ( P = .354) and Pearson product-moment correlation coefficients calculated for each pair of tests demonstrated direct correlation (r = .61 for PCR and IHC, r = .61 for PCR and ISH, and r = 1.00 for ISH and IHC). This supports the use of p16(INK4a) IHC as an initial screening tool for HPV infection in BSCC, while definitive evidence of HPV DNA can be sought subsequently with PCR or CISH.

  5. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Species-specific detection and quantification of common barnacle larvae from the Japanese coast using quantitative real-time PCR.

    Science.gov (United States)

    Endo, Noriyuki; Sato, Kana; Matsumura, Kiyotaka; Yoshimura, Erina; Odaka, Yukiko; Nogata, Yasuyuki

    2010-11-01

    Species-specific detection and quantification methods for barnacle larvae using quantitative real-time polymerase chain reaction (qPCR) were developed. Species-specific primers for qPCR were designed for 13 barnacle species in the mitochondrial 12S ribosomal RNA gene region. Primer specificity was examined by PCR using template DNA extracted from each of the 13 barnacle species, other unidentified barnacle species, and field collected zooplankton samples. The resulting PCR products comprised single bands following agarose gel electrophoresis when the templates corresponded to primers. The amplifications were highly species-specific even for the field plankton samples. The field plankton samples were subjected to qPCR assay. The calculated DNA contents for each barnacle species were closely correlated with the number of larvae measured by microscopic examination. The method could be applied to quantify barnacle larvae in natural plankton samples.

  7. Is qPCR a Reliable Indicator of Cyanotoxin Risk in Freshwater?

    Science.gov (United States)

    Pacheco, Ana Beatriz F.; Guedes, Iame A.; Azevedo, Sandra M.F.O.

    2016-01-01

    The wide distribution of cyanobacteria in aquatic environments leads to the risk of water contamination by cyanotoxins, which generate environmental and public health issues. Measurements of cell densities or pigment contents allow both the early detection of cellular growth and bloom monitoring, but these methods are not sufficiently accurate to predict actual cyanobacterial risk. To quantify cyanotoxins, analytical methods are considered the gold standards, but they are laborious, expensive, time-consuming and available in a limited number of laboratories. In cyanobacterial species with toxic potential, cyanotoxin production is restricted to some strains, and blooms can contain varying proportions of both toxic and non-toxic cells, which are morphologically indistinguishable. The sequencing of cyanobacterial genomes led to the description of gene clusters responsible for cyanotoxin production, which paved the way for the use of these genes as targets for PCR and then quantitative PCR (qPCR). Thus, the quantification of cyanotoxin genes appeared as a new method for estimating the potential toxicity of blooms. This raises a question concerning whether qPCR-based methods would be a reliable indicator of toxin concentration in the environment. Here, we review studies that report the parallel detection of microcystin genes and microcystin concentrations in natural populations and also a smaller number of studies dedicated to cylindrospermopsin and saxitoxin. We discuss the possible issues associated with the contradictory findings reported to date, present methodological limitations and consider the use of qPCR as an indicator of cyanotoxin risk. PMID:27338471

  8. Is qPCR a Reliable Indicator of Cyanotoxin Risk in Freshwater?

    Directory of Open Access Journals (Sweden)

    Ana Beatriz F. Pacheco

    2016-06-01

    Full Text Available The wide distribution of cyanobacteria in aquatic environments leads to the risk of water contamination by cyanotoxins, which generate environmental and public health issues. Measurements of cell densities or pigment contents allow both the early detection of cellular growth and bloom monitoring, but these methods are not sufficiently accurate to predict actual cyanobacterial risk. To quantify cyanotoxins, analytical methods are considered the gold standards, but they are laborious, expensive, time-consuming and available in a limited number of laboratories. In cyanobacterial species with toxic potential, cyanotoxin production is restricted to some strains, and blooms can contain varying proportions of both toxic and non-toxic cells, which are morphologically indistinguishable. The sequencing of cyanobacterial genomes led to the description of gene clusters responsible for cyanotoxin production, which paved the way for the use of these genes as targets for PCR and then quantitative PCR (qPCR. Thus, the quantification of cyanotoxin genes appeared as a new method for estimating the potential toxicity of blooms. This raises a question concerning whether qPCR-based methods would be a reliable indicator of toxin concentration in the environment. Here, we review studies that report the parallel detection of microcystin genes and microcystin concentrations in natural populations and also a smaller number of studies dedicated to cylindrospermopsin and saxitoxin. We discuss the possible issues associated with the contradictory findings reported to date, present methodological limitations and consider the use of qPCR as an indicator of cyanotoxin risk.

  9. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  10. Mung bean nuclease treatment increases capture specificity of microdroplet-PCR based targeted DNA enrichment.

    Directory of Open Access Journals (Sweden)

    Zhenming Yu

    Full Text Available Targeted DNA enrichment coupled with next generation sequencing has been increasingly used for interrogation of select sub-genomic regions at high depth of coverage in a cost effective manner. Specificity measured by on-target efficiency is a key performance metric for target enrichment. Non-specific capture leads to off-target reads, resulting in waste of sequencing throughput on irrelevant regions. Microdroplet-PCR allows simultaneous amplification of up to thousands of regions in the genome and is among the most commonly used strategies for target enrichment. Here we show that carryover of single-stranded template genomic DNA from microdroplet-PCR constitutes a major contributing factor for off-target reads in the resultant libraries. Moreover, treatment of microdroplet-PCR enrichment products with a nuclease specific to single-stranded DNA alleviates off-target load and improves enrichment specificity. We propose that nuclease treatment of enrichment products should be incorporated in the workflow of targeted sequencing using microdroplet-PCR for target capture. These findings may have a broad impact on other PCR based applications for which removal of template DNA is beneficial.

  11. Improvement of the sensitivity and resolution of PCR-SSCP analysis ...

    Indian Academy of Sciences (India)

    enced by many parameters, including size and GC content of the PCR product (Li et ... of the gene for vitamin D (1,25-dihydroxyvitamin D3) re- ceptor (VDR) to .... phism (FokI) and bone mineral density in premenopausal Ameri- can black and ...

  12. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    Science.gov (United States)

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  13. Competitive PCR for quantification of minimal residual disease in acute lymphoblastic leukaemia

    DEFF Research Database (Denmark)

    Nyvold, C; Madsen, H O; Ryder, L P

    2000-01-01

    under identical conditions. After restriction enzyme cleavage, the PCR products originating from the competitor and the malignant clone can be distinguished by size in a gel electrophoresis step and the amount of residual disease can be determined. The method is very sensitive with a detection limit...

  14. Analysis of extracellular RNA by digital PCR

    Directory of Open Access Journals (Sweden)

    Kenji eTakahashi

    2014-06-01

    Full Text Available The transfer of extracellular RNA is emerging as an important mechanism for intracellular communication. The ability for the transfer of functionally active RNA molecules from one cell to another within vesicles such as exosomes enables a cell to modulate cellular signaling and biological processes within recipient cells. The study of extracellular RNA requires sensitive methods for the detection of these molecules. In this methods article, we will describe protocols for the detection of such extracellular RNA using sensitive detection technologies such as digital PCR. These protocols should be valuable to researchers interested in the role and contribution of extracellular RNA to tumor cell biology.

  15. Determining Fungi rRNA Copy Number by PCR

    Science.gov (United States)

    The goal of this project is to improve the quantification of indoor fungal pollutants via the specific application of quantitative PCR (qPCR). Improvement will be made in the controls used in current qPCR applications. This work focuses on the use of two separate controls within ...

  16. Real-Time PCR for Universal Phytoplasma Detection and Quantification

    DEFF Research Database (Denmark)

    Christensen, Nynne Meyn; Nyskjold, Henriette; Nicolaisen, Mogens

    2013-01-01

    Currently, the most efficient detection and precise quantification of phytoplasmas is by real-time PCR. Compared to nested PCR, this method is less sensitive to contamination and is less work intensive. Therefore, a universal real-time PCR method will be valuable in screening programs and in other...

  17. Comparison of a Commercially Available Repetitive-Element PCR System (DiversiLab) with PCR Ribotyping for Typing of Clostridium difficile Strains ▿

    OpenAIRE

    Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.

    2011-01-01

    This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.

  18. Automated PCR setup for forensic casework samples using the Normalization Wizard and PCR Setup robotic methods.

    Science.gov (United States)

    Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C

    2006-12-20

    Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the

  19. Development of expression vectors for Escherichia coli based on the pCR2 replicon

    Directory of Open Access Journals (Sweden)

    Deb J K

    2007-05-01

    Full Text Available Abstract Background Recent developments in metabolic engineering and the need for expanded compatibility required for co-expression studies, underscore the importance of developing new plasmid vectors with properties such as stability and compatibility. Results We utilized the pCR2 replicon of Corynebacterium renale, which harbours multiple plasmids, for constructing a range of expression vectors. Different antibiotic-resistance markers were introduced and the vectors were found to be 100% stable over a large number of generations in the absence of selection pressure. Compatibility of this plasmid was studied with different Escherichia coli plasmid replicons viz. pMB1 and p15A. It was observed that pCR2 was able to coexist with these E.coli plasmids for 60 generations in the absence of selection pressure. Soluble intracellular production was checked by expressing GFP under the lac promoter in an expression plasmid pCR2GFP. Also high level production of human IFNγ was obtained by cloning the h-IFNγ under a T7 promoter in the expression plasmid pCR2-IFNγ and using a dual plasmid heat shock system for expression. Repeated sub-culturing in the absence of selection pressure for six days did not lead to any fall in the production levels post induction, for both GFP and h-IFNγ, demonstrating that pCR2 is a useful plasmid in terms of stability and compatibility. Conclusion We have constructed a series of expression vectors based on the pCR2 replicon and demonstrated its high stability and sustained expression capacity, in the absence of selection pressure which will make it an efficient tool for metabolic engineering and co-expression studies, as well as for scale up of expression.

  20. Detection of polyoma virus in brain tissue of patients with progressive multifocal leukoencephalopathy by real-time PCR and pyrosequencing.

    Science.gov (United States)

    Beck, Rose C; Kohn, Debra J; Tuohy, Marion J; Prayson, Richard A; Yen-Lieberman, Belinda; Procop, Gary W

    2004-03-01

    We evaluated 2 methods, a LightCycler PCR assay and pyrosequencing for the detection of the JC polyoma virus (JCV) in fixed brain tissue of 10 patients with and 3 control patients without progressive multifocal leukoencephalopathy (PML). Nucleic acid extraction was performed after deparaffinization and proteinase K digestion. The LightCycler assay differentiates the BK virus (BKV), JCV, and SV40 using melt curve analysis. Conventional PCR was used with the same primers to generate products for pyrosequencing. Two sequencing primers were used that differentiate the polyoma viruses. Seven of 11 biopsies (1 patient had 2 biopsies) with PML were positive for JCV by real-time PCR and/or PCR/pyrosequencing. Three of 4 remaining biopsies were positive by real-time PCR but had melting points between JCV and SV40. The 4 specimens that were negative or atypical by LightCycler PCR were positive by traditional PCR, but 1 had an amplicon of lower molecular weight by gel electrophoresis. These were shown to represent JCV by at least 1 of the 2 pyrosequencing primers. The biopsies from patients without PML were PCR negative. Both the LightCycler and pyrosequencing assays are useful for confirming JCV in brain biopsies from patients with PML, but variant JCVs may require supplementary methods to confirm JCV infection.

  1. Optimization of PCR Condition: The First Study of High Resolution Melting Technique for Screening of APOA1 Variance.

    Science.gov (United States)

    Wahyuningsih, Hesty; K Cayami, Ferdy; Bahrudin, Udin; A Sobirin, Mochamad; Ep Mundhofir, Farmaditya; Mh Faradz, Sultana; Hisatome, Ichiro

    2017-03-01

    High resolution melting (HRM) is a post-PCR technique for variant screening and genotyping based on the different melting points of DNA fragments. The advantages of this technique are that it is fast, simple, and efficient and has a high output, particularly for screening of a large number of samples. APOA1 encodes apolipoprotein A1 (apoA1) which is a major component of high density lipoprotein cholesterol (HDL-C). This study aimed to obtain an optimal quantitative polymerase chain reaction (qPCR)-HRM condition for screening of APOA1 variance. Genomic DNA was isolated from a peripheral blood sample using the salting out method. APOA1 was amplified using the RotorGeneQ 5Plex HRM. The PCR product was visualized with the HRM amplification curve and confirmed using gel electrophoresis. The melting profile was confirmed by looking at the melting curve. Five sets of primers covering the translated region of APOA1 exons were designed with expected PCR product size of 100-400 bps. The amplified segments of DNA were amplicons 2, 3, 4A, 4B, and 4C. Amplicons 2, 3 and 4B were optimized at an annealing temperature of 60 °C at 40 PCR cycles. Amplicon 4A was optimized at an annealing temperature of 62 °C at 45 PCR cycles. Amplicon 4C was optimized at an annealing temperature of 63 °C at 50 PCR cycles. In addition to the suitable procedures of DNA isolation and quantification, primer design and an estimated PCR product size, the data of this study showed that appropriate annealing temperature and PCR cycles were important factors in optimization of HRM technique for variant screening in APOA1 .

  2. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Routine clinical application of the FRAXA Pfu PCR assay: limits and utility.

    Science.gov (United States)

    Condorelli, D F; Milana, G; Dell'Albani, P; Roccazzello, A M; Insirello, E; Pavone, L; Mollica, F

    1996-11-01

    Fragile X genotype is characterized by the excessive amplification of an unstable region of DNA: a trinucleotide repeat CGG of variable copy number present in the FRAXA locus. Methods based on polymerase chain reaction (PCR) amplification of the CGG repeat region could facilitate the development of a rapid screening assay. Unfortunately, amplification across CGG repeats can be inefficient and unreliable due to their 100% G + C base composition. The utility of the exonuclease-deficient Pfu polymerase for amplification and detection of the CGG repeats at the FRAXA locus has been reported. In the present study we analysed the utility of a Pfu PCR assay as a rapid initial screening method to rule out a diagnosis of fragile X syndrome in males with mental retardation. Affected males did not show any amplification products or a smear of amplification products between 350 and 550 bp. Only 10% of affected male samples did not show any amplification products, while the vast majority showed the amplification smear. The amplification smears represent a serious drawback of the method, since they cannot be distinguished from the amplification products of normal samples after separation in 1% agarose gel. Several modifications of the PCR conditions were attempted to eliminate this problem, but none was appropriate for clinical applications. However, the problem was easily solved by using a higher resolution electrophoretic system that allows a clear distinction of normal bands from pathological smears. We tested the specificity of the Pfu PCR assay, followed by an improved MetaPhor gel electrophoretic separation of PCR products, on 50 samples from normal males and 24 samples form affected males. The results showed that this method is a rapid, sensitive and specific assay for the exclusion of fragile X syndrome diagnosis in mentally retarded males.

  4. Identification of periodontopathogen microorganisms by PCR technique

    Directory of Open Access Journals (Sweden)

    Milićević Radovan

    2008-01-01

    Full Text Available INTRODUCTION Periodontitis is an inflammatory disease of the supporting tissues of teeth and is a major cause of tooth loss in adults. The onset and progression of periodontal disease is attributed to the presence of elevated levels of a consortium of pathogenic bacteria. Gram negative bacteria, mainly strict anaerobes, play the major role. OBJECTIVE The present study aimed to assess the presence of the main types of microorganisms involved in the aetiopathogenesis of periodontal disease: Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Eikenella corrodens, Treponema denticola, Tanerella forsythia and Prevotella intermedia in different samples collected from the oral cavity of 90 patients diagnosed with periodontitis. METHOD Bacterial DNA detection was performed in diverse biological materials, namely in dental plaque, gingival tissue and saliva, by means of multiplex PCR, a technique that allows simultaneous identification of two different bacterial genomes. RESULTS In the dental plaque of the periodontitis patients, Treponema denticola dominated. In the gingival tissue, Tannerella forsythia and Treponema denticola were the microbiota most frequently detected, whilst in saliva Treponema denticola and Eikenella corrodens were found with the highest percentage. CONCLUSION The identification of microorganisms by multiplex PCR is specific and sensitive. Rapid and precise assessment of different types of periodontopathogens is extremely important for early detection of the infection and consequently for the prevention and treatment of periodontal disease. In everyday clinical practice, for routine bacterial evaluation in patients with periodontal disease, the dental plaque is the most suitable biological material, because it is the richest in periodontal bacteria.

  5. Denoising PCR-amplified metagenome data

    Directory of Open Access Journals (Sweden)

    Rosen Michael J

    2012-10-01

    Full Text Available Abstract Background PCR amplification and high-throughput sequencing theoretically enable the characterization of the finest-scale diversity in natural microbial and viral populations, but each of these methods introduces random errors that are difficult to distinguish from genuine biological diversity. Several approaches have been proposed to denoise these data but lack either speed or accuracy. Results We introduce a new denoising algorithm that we call DADA (Divisive Amplicon Denoising Algorithm. Without training data, DADA infers both the sample genotypes and error parameters that produced a metagenome data set. We demonstrate performance on control data sequenced on Roche’s 454 platform, and compare the results to the most accurate denoising software currently available, AmpliconNoise. Conclusions DADA is more accurate and over an order of magnitude faster than AmpliconNoise. It eliminates the need for training data to establish error parameters, fully utilizes sequence-abundance information, and enables inclusion of context-dependent PCR error rates. It should be readily extensible to other sequencing platforms such as Illumina.

  6. A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria.

    Science.gov (United States)

    Sasaki, Mizuki; Omobowale, Olutayo; Ohta, Kaisaku; Tozuka, Morito; Matsuu, Aya; Hirata, Haruyuki; Nottidge, Helen Oyebukola; Ikadai, Hiromi; Oyamada, Takashi

    2008-07-01

    The prevalence of Hepatozoon canis infections in dogs in Nigeria was surveyed using molecular methods. DNA was extracted from blood samples obtained from 400 dogs. A primer set that amplified the Babesia canis 18S rRNA gene, which has high similarity to the H. canis 18S rRNA gene, was used for the PCR. As a result, samples from 81 dogs (20.3%) produced 757 bp bands, which differed from the 698 bp band that corresponded to B. canis infection. The sequence of the PCR products of 10 samples were determined, all of which corresponded with the H. canis sequence.

  7. Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

    Science.gov (United States)

    Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

    2018-02-28

    A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

  8. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food.

    Directory of Open Access Journals (Sweden)

    Junan Ren

    Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.

  9. One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, B. R.

    2004-04-16

    nucleotides on polymerase and unmasking mechanisms. This approach takes advantage of differences in reactivity of the normal and modified nucleotidic linkages to generate PCR sequencing fragments that terminate at the site of incorporation of the modified nucleotide. In principle, the position of the modified nucleotide in each PCR product can be revealed in two ways, either by enzymatic unmasking (as previously described) or by chemical unmasking. We identified reagent sets for enzymatic or chemical conversion of boronated PCR products into mono- and bidirectional sequencing fragments. (a) We developed a new modified cytidine boranophosphate analogue that is (i) compatible with PCR, but more resistant to exonuclease III read-through than unmodified cytidine and (ii) permits better base calling; (b) We developed chemical methods for DNA and RNA cleavage at boronated nucleotide sites; and (c) We developed methods to quantify and detect stealth boranophosphate groups in DNA and RNA. Key advantages of boranophosphates as sequence delimiters in PCR are that they (1) delineate the DNA sequence yet (2) do not obstruct exponential amplification, and they (3) permit direct PCR sequencing, cycle sequencing, or RNA sequencing. They are also compatible with most sequencing platforms.

  10. Accurate quantification of supercoiled DNA by digital PCR

    Science.gov (United States)

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  11. A Highly Sensitive Telomerase Activity Assay that Eliminates False-Negative Results Caused by PCR Inhibitors

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2013-09-01

    Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.

  12. Use of alternative alkali chlorides in RT and PCR of polynucleotides containing G quadruplex structures.

    Science.gov (United States)

    Ramos-Alemán, Fabiola; González-Jasso, Eva; Pless, Reynaldo C

    2018-02-15

    Several alkali chlorides were compared for their use in reverse transcription (RT) and PCR of different types of nucleic acid templates. On a test region of biological DNA incapable of forming G quadruplex (G4) structures, Taq DNA polymerase showed similar PCR performance with 50 mM KCl, CsCl, LiCl, and NaCl. In contrast, on a synthetic model polydeoxyribonucleotide prone to G4 formation, good PCR amplification was obtained with 50 mM CsCl, but little or none with LiCl or KCl. Similarly, in RT of a G4-prone model polyribonucleotide, MMLV reverse transcriptase produced a good yield with 50 mM CsCl, mediocre yields with LiCl or without added alkali chloride, and a poor yield with 50 mM KCl. The full RT-PCR assay starting from the G4-prone polyribonucleotide, showed good results with CsCl in both stages, poor results with LiCl, and no product formation with KCl. The model polynucleotides showed fast G quadruplex formation under PCR or RT conditions with 50 mM KCl, but not with CsCl or LiCl. The results argue for the use of CsCl instead of KCl for RT and PCR of G4-prone sequences. No advantage was observed when using the 7-deaza type nucleotide analog c 7 dGTP in PCR amplification of the G4-prone polydeoxyribonucleotide. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    Science.gov (United States)

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  14. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. A reliable and feasible qPCR strategy for titrating AAV vectors.

    Science.gov (United States)

    Wang, Feng; Cui, Xiuling; Wang, Mingxi; Xiao, Weidong; Xu, Ruian

    2013-07-05

    Previous studies have revealed that traditional real-time quantitative PCR (qPCR) underestimates adeno-associated virus (AAV) titer. Because the inverted terminal repeat (ITR) exists in all AAV vectors, the only remaining element from the wild genome could form special configurations to interfere with qPCR titration. To solve this problem, a modified and universal qPCR method was tested and established. In this work, there was a great variation in titration of ssAAV2-EGFP (Enhanced Green Fluorescence Protein) and scAAV2-EGFP genome by traditional qPCR. For ssAAV2-EGFP, the highest titer was found by using the targeting EGFP primers and the lowest titer was measured by those targeting bovine growth hormone polyA element (pBGH) primers. Experimental data were reverse for ssAAV2-EGFP and scAAV2-EGFP. Here we report an improved and universal SmaI qPCR method, based on cleaving all ITRs in AAV2 genome by SmaI with several advantages: (1) impact of all ITRs in ssAAV2 and scAAV2 was dismissed; (2) titers increased remarkably, up to 7-fold, especially for scAAV2; (3) the variation of titers was reduced when different primers were applied. A similar phenomenon was also observed in other ssAAV2 and scAAV2 products when the range of titration was at 3×107 to 7×109 V.G/µl in this study. This modified qPCR strategy can increase rAAV' titer and reduce titration variance, possibly become a universal method for titrating AAV vectors.

  16. An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Directory of Open Access Journals (Sweden)

    Davis Thomas M

    2010-03-01

    Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

  17. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  18. Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

    International Nuclear Information System (INIS)

    Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

    2013-01-01

    The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a

  19. A survey of tools for the analysis of quantitative PCR (qPCR data

    Directory of Open Access Journals (Sweden)

    Stephan Pabinger

    2014-09-01

    Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  20. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  1. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  2. Detection and quantification of Roundup Ready soybean residues in sausage samples by conventional and real-time PCR.

    OpenAIRE

    MARCELINO-GUIMARÃES, F. C.; GUIMARÃES, M. F. M.; DE-BARROS, E. G.

    2009-01-01

    The increasing presence of products derived from genetically modified (GM) plants in human and animal diets has led to the development of detection methods to distinguish biotechnology-derived foods from conventional ones. The conventional and real-time PCR have been used, respectively, to detect and quantify GM residues in highly processed foods. DNA extraction is a critical step during the analysis process. Some factors such as DNA degradation, matrix effects, and the presence of PCR inhibi...

  3. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

    OpenAIRE

    ÖZKUL, Aykut

    2002-01-01

    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  4. Comparison of high and low virulence serotypes of Actinobacillus pleuropneumoniae by quantitative real-time PCR

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Angen, Øystein; Boye, Mette

    PCR data. Preliminary results showed that in both serotype 2 and serotype 6, the toxin producing gene apxIV was the most highly expressed of the investigated genes. The major difference observed between the two serotypes was that apfA, involved in type IV vili production, was significantly upregulated...... of high virulence while serotype 6 strains are normally found to be less pathogenic. To gain an understanding of the differential virulence of serotype 2 and 6, the expression of a panel of Ap genes during infection of porcine epithelial lung cells (SJPL) were examined by quantitative real-time PCR (q...... to be important for early establishment of the bacteria in the host were examined by qPCR. The genes examined were apfA, coding for a subunit of Type IV pili, kdsB coding for a gene involved in lippopolysacceride biosynthesis, and pgaB which is involved in biofilm formation, all three believed to be important...

  5. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    Science.gov (United States)

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  6. Identification of some Fusarium species from selected crop seeds using traditional method and BIO-PCR

    Directory of Open Access Journals (Sweden)

    Tomasz Kulik

    2012-12-01

    Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.

  7. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  8. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  9. Molecular quantification of environmental DNA using microfluidics and digital PCR.

    Science.gov (United States)

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2012-09-01

    Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Detection and Differentiation of Leishmania spp. in Clinical Specimens by Use of a SYBR Green-Based Real-Time PCR Assay.

    Science.gov (United States)

    de Almeida, Marcos E; Koru, Ozgur; Steurer, Francis; Herwaldt, Barbara L; da Silva, Alexandre J

    2017-01-01

    Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (T m ) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the T m values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L (L) tropica; and the species L (L) mexicana, L (L) amazonensis, L (L) major, and L (L) aethiopica in aggregate. Copyright © 2016 American Society for Microbiology.

  12. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  13. A Real-Time PCR Detection of Genus Salmonella in Meat and Milk Samples

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-05-01

    Full Text Available The aim of this study was follow the contamination of ready to eat milk and meat products with Salmonella spp. by using the Step One real-time PCR. Classical microbiological methods for detection of food-borne bacteria involve the use of pre-enrichment and/or specific enrichment, followed by the isolation of the bacteria in solid media and a final confirmation by biochemical and/or serological tests. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In the investigated samples without incubation we could detect strain of Salmonella sp. in five out of twenty three samples (swabs. This Step One real-time PCR assay is extremely useful for any laboratory in possession of a real-time PCR. It is a fast, reproducible, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future. Our results indicated that the Step One real-time PCR assay developed in this study could sensitively detect Salmonella spp. in ready to eat food.

  14. Rapid identification of dairy lactic acid bacteria by M13-generated, RAPD-PCR fingerprint databases.

    Science.gov (United States)

    Rossetti, Lia; Giraffa, Giorgio

    2005-11-01

    About a thousand lactic acid bacteria (LAB) isolated from dairy products, especially cheeses, were identified and typed by species-specific PCR and RAPD-PCR, respectively. RAPD-PCR profiles, which were obtained by using the M13 sequence as a primer, allowed us to implement a large database of different fingerprints, which were analysed by BioNumerics software. Cluster analysis of the combined RAPD-PCR fingerprinting profiles enabled us to implement a library, which is a collection of library units, which in turn is a selection of representative database entries. A library unit, in this case, can be considered to be a definable taxon. The strains belonged to 11 main RAPD-PCR fingerprinting library units identified as Lactobacillus casei/paracasei, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus helveticus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus brevis, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus and Lactococcus lactis. The possibility to routinely identify newly typed, bacterial isolates by consulting the library of the software was valued. The proposed method could be suggested to refine previous strain identifications, eliminate redundancy and dispose of a technologically useful LAB strain collection. The same approach could also be applied to identify LAB strains isolated from other food ecosystems.

  15. Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method

    Directory of Open Access Journals (Sweden)

    H Ansari

    2010-02-01

    Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.

  16. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

    Directory of Open Access Journals (Sweden)

    Kwang-Pyo Kim

    2015-09-01

    Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.

  17. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  18. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

    Directory of Open Access Journals (Sweden)

    Perkins James R

    2012-07-01

    Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

  19. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR

  20. Meat species identification and Halal authentication using PCR analysis of raw and cooked traditional Turkish foods.

    Science.gov (United States)

    Ulca, Pelin; Balta, Handan; Çağın, Ilknur; Senyuva, Hamide Z

    2013-07-01

    The method performance characteristics of commercially available PCR kits for animal species identification were established. Comminuted meat products containing different levels of pork were prepared from authentic beef, chicken, and turkey. These meat products were analysed in the raw state and after cooking for 20 min at 200 °C. For both raw and cooked meats, the PCR kit could correctly identify the animal species and could reliably detect the addition of pork at a level below 0.1%. A survey of 42 Turkish processed meat products such as soudjouk, salami, sausage, meatball, cured spiced beef and doner kebap was conducted. Thirty-six samples were negative for the presence of pork (meatball sample labelled as 100% beef was found to contain chicken. Another turkey meatball sample was predominantly chicken. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. An external standard method for quantification of human cytomegalovirus by PCR

    International Nuclear Information System (INIS)

    Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo

    1997-01-01

    An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)

  2. Digital PCR as a tool to measure HIV persistence.

    Science.gov (United States)

    Rutsaert, Sofie; Bosman, Kobus; Trypsteen, Wim; Nijhuis, Monique; Vandekerckhove, Linos

    2018-01-30

    Although antiretroviral therapy is able to suppress HIV replication in infected patients, the virus persists and rebounds when treatment is stopped. In order to find a cure that can eradicate the latent reservoir, one must be able to quantify the persisting virus. Traditionally, HIV persistence studies have used real-time PCR (qPCR) to measure the viral reservoir represented by HIV DNA and RNA. Most recently, digital PCR is gaining popularity as a novel approach to nucleic acid quantification as it allows for absolute target quantification. Various commercial digital PCR platforms are nowadays available that implement the principle of digital PCR, of which Bio-Rad's QX200 ddPCR is currently the most used platform in HIV research. Quantification of HIV by digital PCR is proving to be a valuable improvement over qPCR as it is argued to have a higher robustness to mismatches between the primers-probe set and heterogeneous HIV, and forfeits the need for a standard curve, both of which are known to complicate reliable quantification. However, currently available digital PCR platforms occasionally struggle with unexplained false-positive partitions, and reliable segregation between positive and negative droplets remains disputed. Future developments and advancements of the digital PCR technology are promising to aid in the accurate quantification and characterization of the persistent HIV reservoir.

  3. Absolute determination of single-stranded and self-complementary adeno-associated viral vector genome titers by droplet digital PCR.

    Science.gov (United States)

    Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M

    2014-04-01

    Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution

  4. Development of Quantitative Competitive PCR and Absolute Based Real-Time PCR Assays for Quantification of The Butyrate Producing Bacterium: Butyrivibrio fibrisolvens

    Directory of Open Access Journals (Sweden)

    Mojtaba Tahmoorespur

    2016-04-01

    Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio

  5. Clinical and epidemiological use of nested PCR targeting the repetitive element IS1111 associated with the transposase gene from Coxiella burnetii.

    Science.gov (United States)

    Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S

    Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.

  6. Verification of animal species in ham and salami by dna microarray and real time pcr methods

    Directory of Open Access Journals (Sweden)

    Zuzana Drdolová

    2017-01-01

    Full Text Available Consumer protection and detecting of adulteration is very important and has a wide societal impact in the economic sphere. Detection of animal species in meat products and the use of combining different methods is one of the means to achieve relevant product status. The aim of this study was to reveal whether or not the products label clearly meets the content declared by producer. In our study, 29 samples of meat products such as salami and ham obtained from stores and supermarkets in Slovakia were analyzed to detect the existing animal species according to the product label the use of Chipron LCD Array Analysis System, Meat 5.0. Products in which the presence of non-declared animal species has been detected were subjected to testing by the innuDETECT PCR Real-Time Kit, repeatedly. The results showed that 20 (68.96% samples were improperly labeled. From in total 14 tested ham samples 11 (78.57% products exhibited non-conformity with declared composition. Tested salami samples (15 revealed 9 (60% incorrectly labelled products. The results obtained by DNA Microarray and Real Time PCR methods were identical, and both methods should be extensively promoted for the detection of animal species in the meat and meat products. Normal 0 21 false false false EN-GB X-NONE X-NONE

  7. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  8. Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

    2016-06-01

    Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

  9. Characterization by PCR of Vibrio parahaemolyticus isolates collected during the 1997-1998 Chilean outbreak.

    Science.gov (United States)

    Córdova, José Luis; Astorga, Josefa; Silva, Wally; Riquelme, Carlos

    2002-01-01

    Between November 1997 and April 1998, several human gastroenteritis cases were reported in Antofagasta, a city in the north of Chile. This outbreak was associated with the consumption of shellfish, and the etiologic agent responsible was identified as Vibrio parahaemolyticus. This was the first report of this bacterium causing an epidemic in Chile. V. parahaemolyticus was the only pathogenic bacterium isolated from patient stools and from shellfish samples. These isolates were analyzed by polymerase chain reaction (PCR) amplification of the pR72H gene, a species-specific sequence. Based on the pR72H gene amplification pattern, at least three different isolates of V. parahaemolyticus were found. Two isolates (named amplicons A and C) generated PCR products of approximately 400 bp and 340 bp respectively, while another type of isolate designated B, did not generate a PCR product, regardless of which method of DNA purification was used. Sequence analysis of the amplicons A and C shows that they have an 80 bp and 183 bp conserved region at the 5' end of the gene. However, both isolates have different sequences at their 3' terminus and are also different from the pR72H sequence originally reported. Using this PCR assay we demonstrated that these three isolates were found in clinical samples as well as in shellfish. The warm seawater caused by the climatological phenomena "El Niño" perhaps favored the geographic dispersion of the bacterium (bacterial bloom) occurring in Antofagasta that occurred during that time of year.

  10. Sources of Blood Meals of Sylvatic Triatoma guasayana near Zurima, Bolivia, Assayed with qPCR and 12S Cloning

    Science.gov (United States)

    Lucero, David E.; Ribera, Wilma; Pizarro, Juan Carlos; Plaza, Carlos; Gordon, Levi W.; Peña, Reynaldo; Morrissey, Leslie A.; Rizzo, Donna M.; Stevens, Lori

    2014-01-01

    Background In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps). Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia. Methodology/Principal Findings We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens), five for chicken (Gallus gallus) and unicolored blackbird (Agelasticus cyanopus), and one for opossum (Monodelphis domestica). Using the qPCR assay we detected chicken (13 vectors), and human (14 vectors) blood meals as well as an additional blood meal source, Canis sp. (4 vectors). Conclusions/Significance We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors. PMID:25474154

  11. Detection of MPLW515L/K mutations and determination of allele frequencies with a single-tube PCR assay.

    Science.gov (United States)

    Takei, Hiraku; Morishita, Soji; Araki, Marito; Edahiro, Yoko; Sunami, Yoshitaka; Hironaka, Yumi; Noda, Naohiro; Sekiguchi, Yuji; Tsuneda, Satoshi; Ohsaka, Akimichi; Komatsu, Norio

    2014-01-01

    A gain-of-function mutation in the myeloproliferative leukemia virus (MPL) gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs). The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system)-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5%) of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.

  12. Detection of MPLW515L/K mutations and determination of allele frequencies with a single-tube PCR assay.

    Directory of Open Access Journals (Sweden)

    Hiraku Takei

    Full Text Available A gain-of-function mutation in the myeloproliferative leukemia virus (MPL gene, which encodes the thrombopoietin receptor, has been identified in patients with essential thrombocythemia and primary myelofibrosis, subgroups of classic myeloproliferative neoplasms (MPNs. The presence of MPL gene mutations is a critical diagnostic criterion for these diseases. Here, we developed a rapid, simple, and cost-effective method of detecting two major MPL mutations, MPLW515L/K, in a single PCR assay; we termed this method DARMS (dual amplification refractory mutation system-PCR. DARMS-PCR is designed to produce three different PCR products corresponding to MPLW515L, MPLW515K, and all MPL alleles. The amplicons are later detected and quantified using a capillary sequencer to determine the relative frequencies of the mutant and wild-type alleles. Applying DARMS-PCR to human specimens, we successfully identified MPL mutations in MPN patients, with the exception of patients bearing mutant allele frequencies below the detection limit (5% of this method. The MPL mutant allele frequencies determined using DARMS-PCR correlated strongly with the values determined using deep sequencing. Thus, we demonstrated the potential of DARMS-PCR to detect MPL mutations and determine the allele frequencies in a timely and cost-effective manner.

  13. Sources of blood meals of sylvatic Triatoma guasayana near Zurima, Bolivia, assayed with qPCR and 12S cloning.

    Directory of Open Access Journals (Sweden)

    David E Lucero

    2014-12-01

    Full Text Available In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps. Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia.We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens, five for chicken (Gallus gallus and unicolored blackbird (Agelasticus cyanopus, and one for opossum (Monodelphis domestica. Using the qPCR assay we detected chicken (13 vectors, and human (14 vectors blood meals as well as an additional blood meal source, Canis sp. (4 vectors.We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors.

  14. Blood grouping based on PCR methods and agarose gel electrophoresis.

    Science.gov (United States)

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  15. Selecting PCR for the Diagnosis of Intestinal Parasitosis

    DEFF Research Database (Denmark)

    Hartmeyer, G. N.; Hoegh, S. V.; Skov, M. N.

    2017-01-01

    Microscopy of stool samples is a labour-intensive and inaccurate technique for detection of intestinal parasites causing diarrhoea and replacement by PCR is attractive. Almost all cases of diarrhoea induced by parasites over a nine-year period in our laboratory were due to Giardia lamblia......, Cryptosporidium species, or Entamoeba histolytica detected by microscopy. We evaluated and selected in-house singleplex real-time PCR (RT-PCR) assays for these pathogens in 99 stool samples from patients suspected of having intestinal parasitosis tested by microscopy. The strategy included a genus-specific PCR...... assay for C. parvum and C. hominis, with subsequent identification by a PCR that distinguishes between the two species. G. lamblia was detected in five and C. parvum in one out of 68 microscopy-negative samples. The performance of the in-house RT-PCR assays was compared to three commercially available...

  16. Standardization of diagnostic PCR for the detection of foodborne pathogens

    DEFF Research Database (Denmark)

    Malorny, B.; Tassios, P.T.; Radstrom, P.

    2003-01-01

    In vitro amplification of nucleic acids using the polymerase chain reaction (PCR) has become, since its discovery in the 1980s, a powerful diagnostic tool for the analysis of microbial infections as well as for the analysis of microorganisms in food samples. However, despite its potential, PCR has...... neither gained wide acceptance in routine diagnostics nor been widely incorporated in standardized methods. Lack of validation and standard protocols, as well as variable quality of reagents and equipment, influence the efficient dissemination of PCR methodology from expert research laboratories to end......-user laboratories. Moreover, the food industry understandably requires and expects officially approved standards. Recognizing this, in 1999, the European Commission approved the research project, FOOD-PCR (http://www.PCR.dk), which aims to validate and standardize the use of diagnostic PCR for the detection...

  17. In vitro culture, PCR , and nested PCR for the detection of Theileria equi in horses submitted to exercise Cultivo in vitro, PCR e nested PCR na detecção de Theileria equi em eqüinos submetidos a exercícios

    Directory of Open Access Journals (Sweden)

    C.D. Baldani

    2008-06-01

    Full Text Available This study compared the usefulness of in vitro culture, PCR, and nested PCR for the diagnosis of Theileria equi in horses submitted to stress during exercise. Blood samples from 15 apparently healthy horses, previously conditioned to a high-speed equine treadmill, were taken prior to and after exercise. The animals were divided into two experimental groups: 30-day training schedule (G1 and 90-day training schedule (G2. Statistical analysis was performed using a chi-square test and kappa statistic was used in order to assess agreement. No significant difference was observed between samples collected at resting or after exercise. In G1, merozoites of T. equi were detected in the blood smears of four horses before in vitro culture, whereas 14 samples were positive, confirmed by culture. In G2, five and 11 horses were positive before and after culture, respectively. No PCR amplified product was observed in any of the tested animals although the PCR system based on the 16S rRNA gene of T. equi detected DNA in blood with an equivalent 8x10-5% parasitaemia. The nested PCR based on the T. equi merozoite antigen gene (EMA-1 allowed the visualization of amplified products in all the horses. Therefore, nested PCR should be considered as a means of detection of sub-clinical T. equi infections and in vitro culture could be used as a complement to other methods of diagnosis.Comparou-se a utilização do cultivo in vitro, PCR e nested PCR no diagnóstico de Theileria equi em eqüinos submetidos ao estresse induzido por exercícios. Amostras de sangue foram obtidas de 15 eqüinos submetidos a treinamento em esteira rolante de alto desempenho, sendo as amostras colhidas antes e após os exercícios. Os animais foram divididos em dois grupos experimentais: 30 dias de treinamento (G1 e 90 dias de treinamento (G2. O teste do qui-quadrado foi empregado para as análises estatísticas e o índice kappa utilizado para avaliar a concordância. Não houve diferen

  18. Comparison of multiplex reverse transcription-PCR-enzyme ...

    African Journals Online (AJOL)

    Comparison of multiplex reverse transcription-PCR-enzyme hybridization assay with immunofluorescence techniques for the detection of four viral respiratory pathogens in pediatric community acquired pneumonia.

  19. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  20. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi; PCR associado a hibridizacao com sondas radioativas de DNA para a identificacao de infeccao subclinica causada por Leishmania Chagasi

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN), Belo Horizonte, MG (Brazil); Moreno, Elizabeth Castro [Fundacao Nacional de Saude, Belo Horizonte, MG (Brazil). Coordenacao Regional de Minas Gerais; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Parasitologia; Fernandes, Octavio [Fundacao Inst. Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical

    2002-07-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with {sup 32} P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with {sup 32} P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  1. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann

    2009-01-01

    of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...

  2. Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

    Science.gov (United States)

    Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

    2016-03-01

    The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

  3. Soft fruit traceability in food matrices using real-time PCR.

    Science.gov (United States)

    Palmieri, Luisa; Bozza, Elisa; Giongo, Lara

    2009-02-01

    Food product authentication provides a means of monitoring and identifying products for consumer protection and regulatory compliance. There is a scarcity of analytical methods for confirming the identity of fruit pulp in products containing Soft Fruit. In the present work we have developed a very sensible qualitative and quantitative method to determine the presence of berry DNAs in different food matrices. To our knowledge, this is the first study that shows the applicability, to Soft Fruit traceability, of melting curve analysis and multiplexed fluorescent probes, in a Real-Time PCR platform. This methodology aims to protect the consumer from label misrepresentation.

  4. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  5. Detection of Mycoplasma synoviae infection in broiler breeder farms of Tehran province using PCR and culture methods

    Directory of Open Access Journals (Sweden)

    Elhamnia, F.

    2010-07-01

    Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.

  6. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  7. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  8. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    International Nuclear Information System (INIS)

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  9. Comparison of ELISA, nested PCR and sequencing and a novel qPCR for detection of Giardia isolates from Jordan.

    Science.gov (United States)

    Hijjawi, Nawal; Yang, Rongchang; Hatmal, Ma'mon; Yassin, Yasmeen; Mharib, Taghrid; Mukbel, Rami; Mahmoud, Sameer Alhaj; Al-Shudifat, Abdel-Ellah; Ryan, Una

    2018-02-01

    Little is known about the prevalence of Giardia duodenalis in human patients in Jordan and all previous studies have used direct microscopy, which lacks sensitivity. The present study developed a novel quantitative PCR (qPCR) assay at the β-giardin (bg) locus and evaluated its use as a frontline test for the diagnosis of giardiasis in comparison with a commercially available ELISA using nested PCR and sequencing of the glutamate dehydrogenase (gdh) locus (gdh nPCR) as the gold standard. A total of 96 human faecal samples were collected from 96 patients suffering from diarrhoea from 5 regions of Jordan and were screened using the ELISA and qPCR. The analytical specificity of the bg qPCR assay revealed no cross-reactions with other genera and detected all the Giardia isolates tested. Analytical sensitivity was 1 Giardia cyst per μl of DNA extract. The overall prevalence of Giardia was 64.6%. The clinical sensitivity and specificity of the bg qPCR was 89.9% and 82.9% respectively compared to 76.5 and 68.0% for the ELISA. This study is the first to compare three different methods (ELISA, bg qPCR, nested PCR and sequencing at the gdh locus) to diagnose Jordanian patients suffering from giardiasis and to analyze their demographic data. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. PCR-DGGE analysis of the microbial communities in three different Chinese "Baiyunbian" liquor fermentation starters.

    Science.gov (United States)

    Xiong, Xiaomao; Hu, Yuanliang; Yan, Nanfeng; Huang, Yingna; Peng, Nan; Liang, Yunxiang; Zhao, Shumiao

    2014-08-01

    A systematic investigation was performed on the bacterial, Bacillus, fungal, and yeast communities of the three types of Daqu (mechanically prepared, manually prepared, and mixed prepared) used in Baiyunbian Company by reconditioning PCR-denaturing gradient gel electrophoresis (PCR-DGGE). The DGGE results showed that the microbes in the three types of Daqu were mainly thermotolerant and thermophilic microbes, and the most dominant bacterial species were Bacillus and Virgibacillus, followed by Lactobacillus and Trichococcus. Furthermore, the dominant fungi were found to be molds, such as Rasamsonia, Penicillium, Aspergillus, and Monascus, and the dominant yeasts were Saccharomyces cerevisiae, Saccharomycopsis fibuligera, Pichia anomala, and Debaryomyces hansenii. In general, the three types of Daqu showed slight differences in microbial communities, and the Shannon indexes (H') of the manually prepared and mechanically prepared Daqu were similar. The results suggest that mechanically prepared Daqu can replace manually prepared Daqu in liquor production, and this research provides useful information for liquor production and process improvement.

  11. Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method

    Directory of Open Access Journals (Sweden)

    Alamian, S.

    2015-04-01

    Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.

  12. Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

    DEFF Research Database (Denmark)

    Liu, Yilan; Chen, Jinjin; Thygesen, Anders

    2018-01-01

    Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

  13. Identification of species of leishmania isolated from patients with cutaneous leishmaniasis in Kermanshah; using RAPD-PCR technique

    Directory of Open Access Journals (Sweden)

    Yazdan Hamzavi

    2010-09-01

    Full Text Available Annually many numbers of pationts with Cutaneous Leishmaniasis (CL have been reported in Kermanshah province- IRAN. The study aimed to identify species of Leishmania isolated from patients with CT in Kermanshah. Seven isolates of Leishmania obtained from patients with CL, without any travelling to other provinces, were cultured in NNN medium. After mass production of leptomonads in RPMI 1640 medium DNA was purified and the species were diagnosed using RAPD-PCR technique. The study of electrophoretic fingerprints of the product of RAPD-PCR in seven isolates showed that Leshmania major was the causative agent of CL patients in Kermanshah province. More studies in this field recommended.

  14. Human fecal source identification with real-time quantitative PCR

    Science.gov (United States)

    Waterborne diseases represent a significant public health risk worldwide, and can originate from contact with water contaminated with human fecal material. We describe a real-time quantitative PCR (qPCR) method that targets a Bacteroides dori human-associated genetic marker for...

  15. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    Science.gov (United States)

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  16. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  17. Development of a competitive PCR assay for the quantification of ...

    African Journals Online (AJOL)

    The E. coli malate dehydrogenase Mdh house-keeping gene was modified and used as an internal control and competitor DNA for the c-PCR. E. coli cell concentration equivalents ranging from 20 to 2 x 104 cells ml-1 could be quantified with the c-PCR. Fifty-three water samples from various sources were tested with the ...

  18. Evaluation of PCR for diagnosis of visceral leishmaniasis

    NARCIS (Netherlands)

    Osman, O. F.; Oskam, L.; Zijlstra, E. E.; Kroon, N. C.; Schoone, G. J.; Khalil, E. T.; El-Hassan, A. M.; Kager, P. A.

    1997-01-01

    An evaluation of Leishmania PCR was performed with bone marrow, lymph node, and blood samples from 492 patients, 60 positive controls, and 90 negative controls. Results were compared with microscopy results for Giemsa-stained smears. PCR and microscopy of lymph node and bone marrow aspirates from

  19. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  20. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2013-10-10

    In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

  1. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas; Xiao, Kang; Wu, Jinbo; Yi, Xin; Gong, Xiuqing; Foulds, Ian G.; Wen, Weijia

    2013-01-01

    In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.

  2. Splinkerette PCR for mapping transposable elements in Drosophila.

    Directory of Open Access Journals (Sweden)

    Christopher J Potter

    2010-04-01

    Full Text Available Transposable elements (such as the P-element and piggyBac have been used to introduce thousands of transgenic constructs into the Drosophila genome. These transgenic constructs serve many roles, from assaying gene/cell function, to controlling chromosome arm rearrangement. Knowing the precise genomic insertion site for the transposable element is often desired. This enables identification of genomic enhancer regions trapped by an enhancer trap, identification of the gene mutated by a transposon insertion, or simplifying recombination experiments. The most commonly used transgene mapping method is inverse PCR (iPCR. Although usually effective, limitations with iPCR hinder its ability to isolate flanking genomic DNA in complex genomic loci, such as those that contain natural transposons. Here we report the adaptation of the splinkerette PCR (spPCR method for the isolation of flanking genomic DNA of any P-element or piggyBac. We report a simple and detailed protocol for spPCR. We use spPCR to 1 map a GAL4 enhancer trap located inside a natural transposon, pinpointing a master regulatory region for olfactory neuron expression in the brain; and 2 map all commonly used centromeric FRT insertion sites. The ease, efficiency, and efficacy of spPCR could make it a favored choice for the mapping of transposable element in Drosophila.

  3. Diagnostic PCR: validation and sample preparation are two sides of the same coin

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Wolffs, Petra; Radstrøm, Peter

    2004-01-01

    Increased use of powerful PCR technology for the routine detection of pathogens has focused attention on the need for international validation and preparation of official non-commercial guidelines. Bacteria of epidemiological importance should be the prime focus, although a "validation...... of quantitative reference DNA material and reagents, production of stringent protocols and tools for thermal cycler performance testing, uncomplicated sample preparation techniques, and extensive ring trials for assessment of the efficacy of selected matrix/pathogen detection protocols....

  4. ABO Blood Group Genotyping by Real-time PCR in Kazakh Population

    Directory of Open Access Journals (Sweden)

    Pavel Tarlykov

    2014-12-01

    Full Text Available Introduction. ABO blood group genotyping is a new technology in hematology that helps prevent adverse transfusion reactions in patients. Identification of antigens on the surface of red blood cells is based on serology; however, genotyping employs a different strategy and is aimed directly at genes that determine the surface proteins. ABO blood group genotyping by real-time PCR has several crucial advantages over other PCR-based techniques, such as high rapidity and reliability of analysis. The purpose of this study was to examine nucleotide substitutions differences by blood types using a PCR-based method on Kazakh blood donors.Methods. The study was approved by the Ethics Committee of the National Center for Biotechnology. Venous blood samples from 369 healthy Kazakh blood donors, whose blood types had been determined by serological methods, were collected after obtaining informed consent. The phenotypes of the samples included blood group A (n = 99, B (n = 93, O (n = 132, and AB (n = 45. Genomic DNA was extracted using a salting-out method. PCR products of ABO gene were sequenced on an ABI 3730xl DNA analyzer (Applied Biosystems. The resulting nucleotide sequences were compared and aligned against reference sequence NM_020469.2. Real-time PCR analysis was performed on CFX96 Touch™ Real-Time PCR Detection System (BioRad.Results. Direct sequencing of ABO gene in 369 samples revealed that the vast majority of nucleotide substitutions that change the ABO phenotype were limited to exons 6 and 7 of the ABO gene at positions 261, 467, 657, 796, 803, 930 and 1,060. However, genotyping of only three of them (261, 796 and 803 resulted in identification of major ABO genotypes in the Kazakh population. As a result, TaqMan probe based real-time PCR assay for the specific detection of genotypes 261, 796 and 803 was developed. The assay did not take into account several other mutations that may affect the determination of blood group, because they have a

  5. Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.

    Science.gov (United States)

    Jamjoom, Manal; Sultan, Amal H

    2009-04-01

    The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity

  6. Multiplex PCR identification of Taenia spp. in rodents and carnivores.

    Science.gov (United States)

    Al-Sabi, Mohammad N S; Kapel, Christian M O

    2011-11-01

    The genus Taenia includes several species of veterinary and public health importance, but diagnosis of the etiological agent in definitive and intermediate hosts often relies on labor intensive and few specific morphometric criteria, especially in immature worms and underdeveloped metacestodes. In the present study, a multiplex PCR, based on five primers targeting the 18S rDNA and ITS2 sequences, produced a species-specific banding patterns for a range of Taenia spp. Species typing by the multiplex PCR was compared to morphological identification and sequencing of cox1 and/or 12S rDNA genes. As compared to sequencing, the multiplex PCR identified 31 of 32 Taenia metacestodes from rodents, whereas only 14 cysts were specifically identified by morphology. Likewise, the multiplex PCR identified 108 of 130 adult worms, while only 57 were identified to species by morphology. The tested multiplex PCR system may potentially be used for studies of Taenia spp. transmitted between rodents and carnivores.

  7. The Prevalence of Pneumocystis jiroveci in Bronchoalveolar Lavage Specimens of Lung Transplant Recipients Examined by the Nested PCR.

    Science.gov (United States)

    Izadi, Morteza; Jonaidi Jafari, Nematollah; Sadraei, Javid; Mahmoodzadeh Poornaki, Abbas; Rezavand, Babak; Zarrinfar, Hossein; Abdi, Jahangir; Mohammadi, Younes

    2014-12-01

    The use of immune suppressive drugs for organ transplant recipients predisposes them to opportunistic infections, especially by fungal agents. Pneumocystis jiroveci, as an opportunistic pathogen, endangers the patients' life in those with immune system disorders. Early detection of latent Pneumocystis infection in susceptible patients may help choose the optimal treatment for these patients. The aim of this study was to identify and determine the colonization of latent P. jiroveci infection among lung transplant recipients. This cross-sectional descriptive study was conducted on lung transplant recipients. Bronchoalveolar lavage (BAL) specimens were collected from 32 patients undergoing bronchoscopy. The samples were aseptically homogenized by 10 mM dithiothreitol, and their DNA was extracted. The mtLSUrRNA gene of P. jiroveci was amplified using nested PCR in two stages. Nested PCR was performed using external primers of pAZ-102-E and pAZ102-H followed by using the PCR product of the first stage and internal primers of pAZ-102-E and pAZ102-L2. The genome of P. jiroveci was revealed by a 346 bp PCR product in the initial amplification and a 120 bp product in the nested PCR. The results showed that seven BAL specimens (21.9%) from lung transplant recipients were positive for P. jiroveci. In molecular epidemiology studies, nested PCR has higher sensitivity than PCR. Results of this study support the colonization of P. jiroveci in patients receiving lung transplantation. Patients who are carriers of P. jiroveci are at a higher risk of P. jiroveci pneumonia.

  8. Evaluation of a PCR and comparison with RLB for detection and differentiation of Theileria sp. MK and other Theileria and Babesia species of small ruminants.

    Science.gov (United States)

    Altay, Kursat; Aktas, Munir; Dumanli, Nazir; Aydin, Mehmet Fatih

    2008-07-01

    Theileria sp. MK in sheep and goats were detected first time by polymerase chain reaction (PCR) and detection limit of PCR and reverse line blotting (RLB) were compared. A part of 18S ssu rRNA gene was amplified from blood samples that were taken from sheep and goats naturally infected with Theileria sp. MK by PCR. Detection limit of both PCR and RLB methods was one infected cell in 10(7) sheep erythrocytes. Nine hundred twenty field samples that had been tested previously by RLB were evaluated by the PCR assay. As found by RLB previously, 12 of 920 (1.30%) samples were detected as positive by PCR. Two positive PCR products, one of which was from sheep and the other from goat, were sequenced. These sequences were identical to the reported nucleotide sequence of Theileria sp. MK. It is concluded that the PCR described in this study will be useful for epidemiological studies and for discrimination between Theileria sp. MK and other Theileria species. In addition, PCR has superiority over RLB because of its ease of use and time period required.

  9. Comparison of bacteriological culture and PCR for detection of bacteria in ovine milk--sheep are not small cows.

    Science.gov (United States)

    Zadoks, Ruth N; Tassi, Riccardo; Martin, Elena; Holopainen, Jani; McCallum, Sarah; Gibbons, James; Ballingall, Keith T

    2014-10-01

    Mastitis, inflammation of the mammary gland, is an important cause of disease, mortality, and production losses in dairy and meat sheep. Mastitis is commonly caused by intramammary infection with bacteria, which can be detected by bacterial culture or PCR. PathoProof (Thermo Fisher Scientific Ltd., Vantaa, Finland) is a commercially available real-time PCR system for the detection of bovine mastitis pathogens. Sheep differ from cattle in the bacterial species or bacterial strains that cause mastitis, as well as in the composition of their milk. The aim of this study was to evaluate whether the PathoProof system was suitable for detection of mastitis pathogens in sheep milk. Milk samples were collected aseptically from 219 udder halves of 113 clinically healthy ewes in a single flock. Aliquots were used for bacteriological culture and real-time PCR-based detection of bacteria. For species identified by culture, the diagnosis was confirmed by species-specific conventional PCR or by sequencing of a housekeeping gene. The majority of samples were negative by culture (74.4% of 219 samples) and real-time PCR (82.3% of 192 samples). Agreement was observed for 138 of 192 samples. Thirty-four samples were positive by culture only, mostly due to presence of species that are not covered by primers in the PCR system (e.g., Mannheimia spp.). Two samples were positive for Streptococcus uberis by culture but not by PCR directly from the milk samples. This was not due to inability of the PCR primers to amplify ovine Streptococcus uberis, as diluted DNA extracts from the same samples and DNA extracts from the bacterial isolates were positive by real-time PCR. For samples containing Staphylococcus spp., 11 samples were positive by culture and PCR, 9 by culture only, and 20 by PCR only. Samples that were negative by either method had lower bacterial load than samples that were positive for both methods, whereas no clear relation with species identity was observed. This study provides

  10. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  11. Detection of Replication Competent Lentivirus Using a qPCR Assay for VSV-G

    Directory of Open Access Journals (Sweden)

    Lindsey M. Skrdlant

    2018-03-01

    Full Text Available Lentiviral vectors are a common tool used to introduce new and corrected genes into cell therapy products for treatment of human diseases. Although lentiviral vectors are ideal for delivery and stable integration of genes of interest into the host cell genome, they potentially pose risks to human health, such as integration-mediated transformation and generation of a replication competent lentivirus (RCL capable of infecting non-target cells. In consideration of the latter risk, all cell-based products modified by lentiviral vectors and intended for patient use must be tested for RCL prior to treatment of the patient. Current Food and Drug Administration (FDA guidelines recommend use of cell-based assays to this end, which can take up to 6 weeks for results. However, qPCR-based assays are a quick alternative for rapid assessment of RCL in products intended for fresh infusion. We describe here the development and qualification of a qPCR assay based on detection of envelope gene sequences (vesicular stomatitis virus G glycoprotein [VSV-G] for RCL in accordance with Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE guidelines. Our results demonstrate the sensitivity, linearity, specificity, and reproducibility of detection of VSV-G sequences, with a low false-positive rate. These procedures are currently being used in our phase 1 clinical investigations.

  12. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    Science.gov (United States)

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  13. REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-02-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  14. Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR

    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop

    2013-10-01

    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  15. Characterization of some Brucella species from Zimbabwe by biochemical profiling and AMOS-PCR

    Directory of Open Access Journals (Sweden)

    Skjerve Eystein

    2009-12-01

    Full Text Available Abstract Background Bovine brucellosis caused by Brucella abortus is endemic in most large commercial and smallholder cattle farms of Zimbabwe, while brucellosis in other domestic animals is rare. The diagnosis of brucellosis is mainly accomplished using serological tests. However, some Brucella spp. have been isolated from clinical cases in the field and kept in culture collection but their biochemical profiles were not documented. We report biochemical profiling and AMOS-PCR characterization of some of these field isolates of Brucella originating from both commercial and smallholder cattle farming sectors of Zimbabwe. Findings Fourteen isolates of Brucella from culture collection were typed using biochemical profiles, agglutination by monospecific antisera, susceptibility to Brucella-specific bacteriophages and by AMOS-PCR that amplifies species- specific IS711. The results of the biochemical profiles for B. abortus biovar 1 (11 isolates and biovar 2 (2 isolates were consistent with those of reference strains. A single isolate from a goat originating from a smallholder mixed animal farm was identified as B. melitensis biovar 1. The AMOS-PCR produced DNA products of sizes 498 bp and 731 bp for B. abortus (biovar 1 and 2 and B. melitensis biovar 1, respectively. Conclusion We concluded that the biochemical profiles and AMOS-PCR characterization were consistent with their respective species and biovars. B. abortus biovar 1 is likely to be the predominant cause of brucellosis in both commercial and smallholder cattle farms in Zimbabwe.

  16. [Influence of PCR cycle number on microbial diversity analysis through next generation sequencing].

    Science.gov (United States)

    An, Yunhe; Gao, Lijuan; Li, Junbo; Tian, Yanjie; Wang, Jinlong; Zheng, Xuejuan; Wu, Huijuan

    2016-08-25

    Using of high throughput sequencing technology to study the microbial diversity in complex samples has become one of the hottest issues in the field of microbial diversity research. In this study, the soil and sheep rumen chyme samples were used to extract DNA, respectively. Then the 25 ng total DNA was used to amplify the 16S rRNA V3 region with 20, 25, 30 PCR cycles, and the final sequencing library was constructed by mixing equal amounts of purified PCR products. Finally, the operational taxonomic unit (OUT) amount, rarefaction curve, microbial number and species were compared through data analysis. It was found that at the same amount of DNA template, the proportion of the community composition was not the best with more numbers of PCR cycle, although the species number was much more. In all, when the PCR cycle number is 25, the number of species and proportion of the community composition were the most optimal both in soil or chyme samples.

  17. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

    Science.gov (United States)

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-21

    To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

  18. Post-PCR detection of nucleic acids using metalloporphyrin labels and time-resolved fluorescence

    International Nuclear Information System (INIS)

    O'Shea, Desmond J.; O'Sullivan, Paul J.; Ponomarev, Gelii V.; Papkovsky, Dmitri B.

    2005-01-01

    Phosphorescent platinum(II)-coproporphyrin label (PtCP) was evaluated in post-PCR detection of nucleic acids by time-resolved fluorescence (TR-F) using three common formats. PtCP-labelled oligonucleotide primers and PtCP-dUTP were incorporated in a PCR to produce labelled amplified target -173 or 305 bp DNA. Alternatively, aminoallyl-dUTP was incorporated in a PCR and the product was subsequently labelled with PtCP. The resulting PCR mixtures containing labelled dsDNA were separated on 1.5% agarose gels and then analysed by ethidium bromide staining and by direct detection of PtCP label on a commercial TR-F plate reader Victor 2 (Perkin Elmer Life Sciences) used in scanning mode. In all cases label incorporation and high yields of amplified DNA were observed. Direct TR-F detection of PtCP-labelled DNA from a gel provided high sensitivity and signal to noise ratio, with limits of detection in the range of 9-22 pg for all three formats. The sensitivity achieved with PtCP label was considerably better than that achieved with ethidium bromide staining (∼1 ng of dsDNA) or with conventional fluorescent label FITC. Neither the FITC label nor ethidium bromide staining interfered with PtCP detection, thus allowing multiplexed detection

  19. Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments

    Science.gov (United States)

    Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu

    2017-01-01

    In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249

  20. Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

    Science.gov (United States)

    Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

    2017-10-01

    Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

  1. Comparison of droplet digital PCR and seminested real-time PCR for quantification of cell-associated HIV-1 RNA

    NARCIS (Netherlands)

    Kiselinova, Maja; Pasternak, Alexander O.; de Spiegelaere, Ward; Vogelaers, Dirk; Berkhout, Ben; Vandekerckhove, Linos

    2014-01-01

    Cell-associated (CA) HIV-1 RNA is considered a potential marker for assessment of viral reservoir dynamics and antiretroviral therapy (ART) response in HIV-infected patients. Recent studies employed sensitive seminested real-time quantitative (q)PCR to quantify CA HIV-1 RNA. Digital PCR has been

  2. Transient neonatal diabetes mellitus with macroglossia diagnosed by methylation specific PCR (MS-PCR

    Directory of Open Access Journals (Sweden)

    Hye Young Jin

    2010-03-01

    Full Text Available Transient neonatal diabetes mellitus (TNDM has been associated with paternal uniparental isodisomy of chromosome 6, paternally inherited duplication of 6q24, or a methylation defect at a CpG island of the ZAC or HYMAI gene. We experienced a case of TNDM in which the patient presented with hyperglycemia, macroglossia, and intrauterine growth retardation, caused by a paternally derived HYMAI. An 18-day-old female infant was admitted to the hospital because of macroglossia and recurrent hyperglycemia. In addition to the macroglossia, she also presented with large fontanelles, micrognathia, and prominent eyes. Serum glucose levels were 200&#8211;300 mg/dL and they improved spontaneously 2 days after admission. To identify the presence of a maternal methylated allele, bisulfite-treated genomic DNA from peripheral blood was prepared and digested with BssHII after polymerase chain reaction (PCR amplification with methylation-specific HYMAI primers. PCR and restriction fragment length polymorphism analysis showed that the patient had only the paternal origin of the HYMA1 gene. TNDM is associated with a methylation defect in chromosome 6, suggesting that an imprinted gene on chromosome 6 is responsible for this phenotype.

  3. A new PCR approach for the identification of Fusarium graminearum Um novo protocolo de PCR para a identificação de Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Gleison Ricardo de Biazio

    2008-09-01

    Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as

  4. High sensitive diagnostic technique for virus gene using radioisotope. Development of PCR in situ hybridization and its application

    Energy Technology Data Exchange (ETDEWEB)

    Iwasaki, Takuya; Sada, Tetsutaro; Terai, Masanori; Sato, Yuko; Kurata, Takeshi [National Inst. of Infectious Diseases, Tokyo (Japan); Yamaguchi, Kazuyoshi; Yanagisawa, Akio; Sakai, Yuzo

    1998-02-01

    An animal model, experimentally induced squamous cell carcinoma was produced in hamster mucosa to establish a carcinogenic system inducible by interaction of a virus and chemical(s). Human hydatid mole and cholioepithelioma were chosen as the target subjects. Several tumor cells and host cells were isolated under microscopy and DNA was extracted from these cells to indentify the respective origins (maternal, paternal or host origin). The base sequence of HLADRB region was analyzed by PCR using synthetic primer and the tissue localization was examined by PCR in situ hybridization. A PCR product of 82 bp was found in 15 of 17 samples and there were 2 samples in which the product was not detectable with the constructed primer and 6 samples were negative. While significant differences were not observed by in situ hybridization compared with the negative control. (M.N.)

  5. High sensitive diagnostic technique for virus gene using radioisotope. Development of PCR in situ hybridization and its application

    International Nuclear Information System (INIS)

    Iwasaki, Takuya; Sada, Tetsutaro; Terai, Masanori; Sato, Yuko; Kurata, Takeshi; Yamaguchi, Kazuyoshi; Yanagisawa, Akio; Sakai, Yuzo

    1998-01-01

    An animal model, experimentally induced squamous cell carcinoma was produced in hamster mucosa to establish a carcinogenic system inducible by interaction of a virus and chemical(s). Human hydatid mole and cholioepithelioma were chosen as the target subjects. Several tumor cells and host cells were isolated under microscopy and DNA was extracted from these cells to indentify the respective origins (maternal, paternal or host origin). The base sequence of HLADRB region was analyzed by PCR using synthetic primer and the tissue localization was examined by PCR in situ hybridization. A PCR product of 82 bp was found in 15 of 17 samples and there were 2 samples in which the product was not detectable with the constructed primer and 6 samples were negative. While significant differences were not observed by in situ hybridization compared with the negative control. (M.N.)

  6. RAPD-PCR characterization of lactobacilli isolated from artisanal meat plants and traditional fermented sausages of Veneto region (Italy).

    Science.gov (United States)

    Andrighetto, C; Zampese, L; Lombardi, A

    2001-07-01

    The study was carried out to evaluate the use of randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) as a method for the identification of lactobacilli isolated from meat products. RAPD-PCR with primers M13 and D8635 was applied to the identification and intraspecific differentiation of 53 lactobacilli isolates originating from traditional fermented sausages and artisanal meat plants of the Veneto region (Italy). Most of the isolates were assigned to the species Lactobacillus sakei and Lact. curvatus; differentiation of groups of strains within the species was also possible. RAPD-PCR could be applied to the identification of lactobacilli species most commonly found in meat products. The method, which is easy and rapid to perform, could be useful for the study of the lactobacilli populations present in fermented sausages, and could help in the selection of candidate strains to use as starter cultures in meat fermentation.

  7. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  8. Simultaneous Detection of Mixed Infection of Onion yellow dwarf virus and an Allexivirus in RT-PCR for Ensuring Virus Free Onion Bulbs.

    Science.gov (United States)

    Kumar, Sandeep; Baranwal, V K; Joshi, Subodh; Arya, Meenakshi; Majumder, S

    2010-06-01

    Reduced seed production in onion is associated with Onion yellow dwarf virus (OYDV), a filamentous Potyvirus. Onion is also infected with other filamentous virus particles suspected to be Allexivirus. RT-PCR was used to detect mixed infection of both the viruses in leaves and bulbs. A duplex RT-PCR was developed, which simultaneously detected the presence of these two viruses in winter (Rabi) onion bulb. In summer (Kharif) onion bulbs only Allexivirus was detected. The absence of OYDV in summer crop is discussed. The sequencing of RT-PCR amplified products confirmed the identity of OYDV and Allexivirus, the latter showing closer identity to Garlic virus C (GVC)/Garlic mite-borne mosaic virus. This makes the first detection of an Allexivirus in onion crop in India. The duplex RT-PCR to detect these viruses (OYDV and Allexivirus) would be an improvement for indexing of viruses in onion bulbs for seed production.

  9. Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

    Science.gov (United States)

    Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

    2003-08-01

    Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  10. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  11. Shape based kinetic outlier detection in real-time PCR

    Directory of Open Access Journals (Sweden)

    D'Atri Mario

    2010-04-01

    Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.

  12. Broad-range PCR: past, present, or future of bacteriology?

    Science.gov (United States)

    Renvoisé, A; Brossier, F; Sougakoff, W; Jarlier, V; Aubry, A

    2013-08-01

    PCR targeting the gene encoding 16S ribosomal RNA (commonly named broad-range PCR or 16S PCR) has been used for 20 years as a polyvalent tool to study prokaryotes. Broad-range PCR was first used as a taxonomic tool, then in clinical microbiology. We will describe the use of broad-range PCR in clinical microbiology. The first application was identification of bacterial strains obtained by culture but whose phenotypic or proteomic identification remained difficult or impossible. This changed bacterial taxonomy and allowed discovering many new species. The second application of broad-range PCR in clinical microbiology is the detection of bacterial DNA from clinical samples; we will review the clinical settings in which the technique proved useful (such as endocarditis) and those in which it did not (such as characterization of bacteria in ascites, in cirrhotic patients). This technique allowed identifying the etiological agents for several diseases, such as Whipple disease. This review is a synthesis of data concerning the applications, assets, and drawbacks of broad-range PCR in clinical microbiology. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  13. Ureaplasma parvum prosthetic joint infection detected by PCR.

    Science.gov (United States)

    Farrell, John J; Larson, Joshua A; Akeson, Jeffrey W; Lowery, Kristin S; Rounds, Megan A; Sampath, Rangarajan; Bonomo, Robert A; Patel, Robin

    2014-06-01

    We describe the first reported case of Ureaplasma parvum prosthetic joint infection (PJI) detected by PCR. Ureaplasma species do not possess a cell wall and are usually associated with colonization and infection of mucosal surfaces (not prosthetic material). U. parvum is a relatively new species name for certain serovars of Ureaplasma urealyticum, and PCR is useful for species determination. Our patient presented with late infection of his right total knee arthroplasty. Intraoperative fluid and tissue cultures and pre- and postoperative synovial fluid cultures were all negative. To discern the pathogen, we employed PCR coupled with electrospray ionization mass spectrometry (PCR/ESI-MS). Our patient's failure to respond to empirical antimicrobial treatment and our previous experience with PCR/ESI-MS in culture-negative cases of infection prompted us to use this approach over other diagnostic modalities. PCR/ESI-MS detected U. parvum in all samples. U. parvum-specific PCR testing was performed on all synovial fluid samples to confirm the U. parvum detection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. A Point-of-Need infrared mediated PCR platform with compatible lateral flow strip for HPV detection.

    Science.gov (United States)

    Liu, Wenjia; Zhang, Mingfang; Liu, Xiaoyan; Sharma, Alok; Ding, Xianting

    2017-10-15

    With the increasing need of monitoring the epidemiology of serious infectious diseases, food hygiene, food additives and pesticide residues, it is urgent to develop portable, easy-to-use, inexpensive and rapid molecular diagnostic tools. Herein, we demonstrate a prototype of IR mediated Conducting Oil and CarbOn Nanotube circUlaTing PCR (IR-COCONUT PCR) platform for nucleic acid amplification. The presented platform offers a new solution for miniaturized PCR instruments with non-contact heaters by using conducting oil and carbon nanotube as a medium in IR mediated PCR. This novel platform offers accurate and flexible control of temperature through the integration of PID (proportional-integral-derivative) algorithms to manipulate the duty cycle of the voltage signals of IR LED and a peristaltic pump. The ramping rate of the introduced platform in current study is 1.5°C/s for heating speed and -2.0°C/s for cooling speed. This platform fulfills 30 thermal cycles within 50min which is a match to the conventional bench-top PCR thermo cyclers. For demonstration purpose, human papillomavirus (HPV) patient cervical swab specimens were examined. Downstream lateral flow strip (LFS) was also developed to quantity the PCR products from the IR-COCONUT PCR device within 25min. This PCR platform together with the compatible LFS shows great potential for in-field and Point-of-Need (PoN) testing of genetic or contagious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  16. Simultaneous detection of multiple HPV DNA via bottom-well microfluidic chip within an infra-red PCR platform.

    Science.gov (United States)

    Liu, Wenjia; Warden, Antony; Sun, Jiahui; Shen, Guangxia; Ding, Xianting

    2018-03-01

    Portable Polymerase Chain Reaction (PCR) devices combined with microfluidic chips or lateral flow stripes have shown great potential in the field of point-of-need testing (PoNT) as they only require a small volume of patient sample and are capable of presenting results in a short time. However, the detection for multiple targets in this field leaves much to be desired. Herein, we introduce a novel PCR platform by integrating a bottom-well microfluidic chip with an infra-red (IR) excited temperature control method and fluorescence co-detection of three PCR products. Microfluidic chips are utilized to partition different samples into individual bottom-wells. The oil phase in the main channel contains multi-walled carbon nanotubes which were used as a heat transfer medium that absorbs energy from the IR-light-emitting diode (LED) and transfers heat to the water phase below. Cyclical rapid heating and cooling necessary for PCR are achieved by alternative power switching of the IR-LED and Universal Serial Bus (USB) mini-fan with a pulse width modulation scheme. This design of the IR-LED PCR platform is economic, compact, and fully portable, making it a promising application in the field of PoNT. The bottom-well microfluidic chip and IR-LED PCR platform were combined to fulfill a three-stage thermal cycling PCR for 40 cycles within 90 min for Human Papilloma Virus (HPV) detection. The PCR fluorescent signal was successfully captured at the end of each cycle. The technique introduced here has broad applications in nucleic acid amplification and PoNT devices.

  17. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

    Science.gov (United States)

    Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

    2017-05-01

    Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. A multiplex PCR for detection of six viruses in ducks.

    Science.gov (United States)

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  19. Typing some of lactic acid bacteria in Syria using PCR and FT-IR techniques

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Sharabi, N. D.

    2008-11-01

    Lactic Acid Bacteria (LAB) are considered to be the most useful microorganisms. They are beneficial in flavoring foods, inhibiting pathogenic as well as spoilage bacteria in food products. The isolates of LAB were obtained from traditional Syrian dairy products (white cheese and curdled yogurt) obtained from different regions in Syria. The isolates were subjected to phenotypic characterization analyses. The PCR technique of bacterial DNA was evaluated as an advanced tool for the identification of LAB. It was found that strains: E. faecium, E. faecalis and S. thermophilus dominate in white cheese and in yogurt. Our results demonstrated that we could identify LAB using Fourier transform infrared spectroscopy (FT-IR) patterns. (Authors)

  20. Typing some of lactic acid bacteria in Syria using PCR and FT-IR techniques

    Energy Technology Data Exchange (ETDEWEB)

    Al-Mariri, A; Sharabi, N D [Atomic Energy Commission, Damascus (Syrian Arab Republic), Dept. of Molecular Biology and Biotechnology

    2008-11-15

    Lactic Acid Bacteria (LAB) are considered to be the most useful microorganisms. They are beneficial in flavoring foods, inhibiting pathogenic as well as spoilage bacteria in food products. The isolates of LAB were obtained from traditional Syrian dairy products (white cheese and curdled yogurt) obtained from different regions in Syria. The isolates were subjected to phenotypic characterization analyses. The PCR technique of bacterial DNA was evaluated as an advanced tool for the identification of LAB. It was found that strains: E. faecium, E. faecalis and S. thermophilus dominate in white cheese and in yogurt. Our results demonstrated that we could identify LAB using Fourier transform infrared spectroscopy (FT-IR) patterns. (Authors)

  1. Typing some of lactic acid bacteria in Syria using PCR and FT-IR techniques

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Sharabi, N. D.

    2010-01-01

    Lactic Acid Bacteria (LAB) are considered to be the most useful microorganisms. They are beneficial in flavoring foods, inhibiting pathogenic as well as spoilage bacteria in food products. The isolates of LAB were obtained from traditional Syrian dairy products (white cheese and curdled yogurt) obtained from different regions in Syria. The isolates were subjected to phenotypic characterization analyses. The PCR technique of bacterial DNA was evaluated as an advanced tool for the identification of LAB. It was found that strains: E. faecium, E. faecalis and S. thermophilus dominate in white cheese and in yogurt. Our results demonstrated that we could identify LAB using Fourier transform infrared spectroscopy (FT-IR) patterns. (author)

  2. PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY

    Directory of Open Access Journals (Sweden)

    E. M. Polyakova

    2014-01-01

    Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.

  3. Comparison of noninvasive sample collection procedures for canine leishmaniasis diagnosis by PCR-hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br

    2007-07-01

    The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)

  4. [Detection of Cryptospordium spp. in environmental water samples by FTA-PCR].

    Science.gov (United States)

    Zhang, Xiao-Ping; Zhu, Qian; He, Yan-Yan; Jiang, Li; Jiang, Shou-Fu

    2011-02-01

    To establish a FTA-polymeras chain reaction (FTA-PCR) method in detection of Cryptospordium spp. in different sources of water. The semi automated immunomagnetic separation (IMS) of Cryptospordium oocysts in environmental water samples was performed firstly, and then genomic DNA of Cryptospordium oocysts was extracted by FTA filters disk. Oligonucleotide primers were designed based on the DNA fragment of the 18 S rRNA gene from C. parvum. Plate DNA was amplified with primers in PCR. The control DNA samples from Toxoplasma gondii,Sarcocystis suihominis, Echinococcus granulosus, and Clonorchis sinensis were amplified simultaneously. All PCR products were detected by agar electrophoresis dyed with ethidium bromide. The 446 bp fragment of DNA was detected in all samples of C. parvum, C. andersoni, and C. baileyi, while it was not detected in control groups in laboratory. No positive samples were found from 10 samples collected from tape water in 5 districts of Shanghai City by FTA-PCR. Nine positive samples were detected totally from 70 different environmental water samples, there were 0 out of 15 samples from the source of tape water, 2 out of 25 from the Huangpu River, 5 out of 15 from rivers around the animal farmers, 1 out of 9 from output water of contaminating water treatment factory, 1 out of 6 from the out gate of living contaminating water. The 446 bp fragment was detected from all the amplified positive water samples. FTA-PCR is an efficient method for gene detection of Cryptospordium oocysts, which could be used in detection of environmental water samples. The contamination degree of Cryptospordium oocysts in the river water around animal farms is high.

  5. 16S pan-bacterial PCR can accurately identify patients with ventilator-associated pneumonia.

    Science.gov (United States)

    Conway Morris, Andrew; Gadsby, Naomi; McKenna, James P; Hellyer, Thomas P; Dark, Paul; Singh, Suveer; Walsh, Timothy S; McAuley, Danny F; Templeton, Kate; Simpson, A John; McMullan, Ronan

    2017-11-01

    Ventilator-associated pneumonia (VAP) remains a challenge to intensive care units, with secure diagnosis relying on microbiological cultures that take up to 72 hours to provide a result. We sought to derive and validate a novel, real-time 16S rRNA gene PCR for rapid exclusion of VAP. Bronchoalveolar lavage (BAL) was obtained from two independent cohorts of patients with suspected VAP. Patients were recruited in a 2-centre derivation cohort and a 12-centre confirmation cohort. Confirmed VAP was defined as growth of >10 4 colony forming units/ml on semiquantitative culture and compared with a 16S PCR assay. Samples were tested from 67 patients in the derivation cohort, 10 (15%) of whom had confirmed VAP. Using cycles to cross threshold (C t ) values as the result of the 16S PCR test, the area under the receiver operating characteristic (ROC) curve (AUROC) was 0.94 (95% CI 0.86 to 1.0, p<0.0001). Samples from 92 patients were available from the confirmation cohort, 26 (28%) of whom had confirmed VAP. The AUROC for C t in this cohort was 0.89 (95% CI 0.83 to 0.95, p<0.0001). This study has derived and assessed the diagnostic accuracy of a novel application for 16S PCR. This suggests that 16S PCR in BAL could be used as a rapid test in suspected VAP and may allow better stewardship of antibiotics. VAPRAPID trial ref NCT01972425. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  6. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Science.gov (United States)

    Tu, Thomas; Jilbert, Allison R

    2017-01-01

    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  7. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  8. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  9. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  10. Sensitive simultaneous detection of seven sexually transmitted agents in semen by multiplex-PCR and of HPV by single PCR.

    Directory of Open Access Journals (Sweden)

    Fabrícia Gimenes

    Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.

  11. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Science.gov (United States)

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

    Science.gov (United States)

    Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

    2017-04-01

    Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

  13. DIFFERENTIATION BETWEEN Staphylococcus aureus, S. intermedius AND S. hyicus USING PHENOTYPICAL TESTS AND PCR

    Directory of Open Access Journals (Sweden)

    E. A. GANDRA

    2009-01-01

    Full Text Available

    The aim of this work was to compare the use of two phenotypical tests (beta-galactosidase and acriflavine sensitivity and PCR for the coa and nuc gene sequences, for the identification of three species of coagulase positive staphylococcus (CPS: S. aureus, S. intermedius and S. hyicus. Sixty five staphylococcus isolates, previously characterized as CPS through the coagulase, thermonuclease and catalase production tests and Gram staining, were identified at species level using the beta-galactosidase production tests and sensitivity to acriflavine (7 g.mL-1. At the same time, the DNA of these isolates was extracted and amplified by PCR, using primers for the coa gene, specific for S. aureus, and for the nuc gene, specific for S. intermedius and for S. hyicus. It was possible to differentiate the three species of Staphylococcus through phenotypical tests as well as through the molecular technique. There was no difference in discriminatory power between the two techniques used, but the reproducibility and reliability of the technique based on PCR make this technique more precise.

  14. [Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].

    Science.gov (United States)

    Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan

    2017-07-01

    Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.

  15. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Science.gov (United States)

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

    2003-03-01

    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  16. Characterization of spoilage bacteria in pork sausage by PCR-DGGE analysis

    Directory of Open Access Journals (Sweden)

    Francesca Silva Dias

    2013-09-01

    Full Text Available To investigate microbial diversity and identify spoilage bacteria in fresh pork sausages during storage, twelve industrial pork sausages of different trademarks were stored at 4 ºC for 0, 14, 28 and 42 days, 80% relative humidity and packaged in sterile plastic bags. Microbiological analysis was performed. The pH and water activity (a w were measured. The culture-independent method performed was the Polymerase Chain Reaction - Denaturing Gradient Gel Electrophoresis (PCR-DGGE. The culture-dependent method showed that the populations of mesophilic bacteria and Lactic Acid Bacteria (LAB increased linearly over storage time. At the end of the storage time, the average population of microorganisms was detected, in general, at the level of 5 log cfu g-1. A significant (P < 0.005 increase was observed in pH and a w values at the end of the storage time. The PCR-DGGE allowed a rapid identification of dominant communities present in sausages. PCR-DGGE discriminated 15 species and seven genera of bacteria that frequently constitute the microbiota in sausage products. The most frequent spoilage bacteria identified in the sausages were Lactobacillus sakei and Brochothrix thermosphacta. The identification of dominant communities present in fresh pork sausages can help in the choice of the most effective preservation method for extending the product shelf-life.

  17. PCR-RFLP Method to Identify Salmonid Species of Economic Importance

    Directory of Open Access Journals (Sweden)

    Andreea Dudu

    2011-05-01

    Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.

  18. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

  19. Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

    Science.gov (United States)

    Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian

    2017-01-01

    The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a

  20. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  1. Some factors determining the PCr recovery overshoot in skeletal muscle.

    Science.gov (United States)

    Korzeniewski, Bernard; Zoladz, Jerzy A

    2005-07-01

    It has been proposed recently that the phosphocreatine (PCr) overshoot (increase above the resting level) during muscle recovery after exercise is caused by a slow decay during this recovery of the direct activation of oxidative phosphorylation taking place during muscle work. In the present article the factors determining the appearance and size of the PCr overshoot are studied using the computer model of oxidative phosphorylation in intact skeletal muscle developed previously. It is demonstrated that the appearance and duration of this overshoot is positively correlated with the value of the characteristic decay time of the direct activation of oxidative phosphorylation. It is also shown that the size of PCr overshoot is increased by low resting PCr/Cr ratio (what is confirmed by our unpublished experimental data), by high intensity of the direct activation of oxidative phosphorylation, by high muscle work intensity and by low rate of the return of cytosolic pH to the resting value during muscle recovery.

  2. polymerase chain reaction (pcr) provides a superior tool

    African Journals Online (AJOL)

    boaz

    Keywords: Streptococcus pneumoniae, meningitis, rt-PCR, standard bacteriological methods ... qualification de techniciens et les matériels pour son application constituent des ... Streptococcus pneumonia (pneumococcus) is a common.

  3. Multiplex polymerase chain reaction (PCR) and fluorescence-based ...

    African Journals Online (AJOL)

    reading 7

    2011-12-28

    Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.

  4. Comparison of PCR-ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples

    DEFF Research Database (Denmark)

    Perelle, Sylvie; Dilasser, Françoise; Malorny, Burkhard

    2004-01-01

    , minced beef and raw milk, and 92 naturally-contaminated milk and meat samples. When using either PCR-ELISA or LC-PCR assays, only Salmonella strains were detected. PCR-ELISA and LC-PCR assays gave with pure Salmonella cultures the same detection limit level of 10(3) CFU/ml, which corresponds respectively...

  5. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  6. PCR-Based Seamless Genome Editing with High Efficiency and Fidelity in Escherichia coli

    DEFF Research Database (Denmark)

    Liu, Yilan; Yang, Maohua; Yan, Daojiang

    2016-01-01

    Efficiency and fidelity are the key obstacles for genome editing toolboxes. In the present study, a PCR-based tandem repeat assisted genome editing (TRAGE) method with high efficiency and fidelity was developed. The design of TRAGE is based on the mechanism of repair of spontaneous double...... for seamlessly deleting, substituting and inserting targeted genes using PCR products. The effects of different manipulations including sucrose addition time, subculture times in LB with sucrose and stages of inoculation on the efficiency were investigated. With our recommended procedure, seamless excision...... of cat-sacB cassette can be realized in 48 h efficiently. We believe that the developed method has great potential for seamless genome editing in E. coli....

  7. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  8. Discrimination between E. granulosus sensu stricto, E. multilocularis and E. shiquicus Using a Multiplex PCR Assay

    Science.gov (United States)

    Li, Li; Yan, Hong-Bin; Blair, David; Lei, Meng-Tong; Cai, Jin-Zhong; Fan, Yan-Lei; Li, Jian-Qiu; Fu, Bao-Quan; Yang, Yu-Rong; McManus, Donald P.; Jia, Wan-Zhong

    2015-01-01

    Background Infections of Echinococcus granulosus sensu stricto (s.s), E. multilocularis and E. shiquicus are commonly found co-endemic on the Qinghai-Tibet plateau, China, and an efficient tool is needed to facilitate the detection of infected hosts and for species identification. Methodology/Principal Findings A single-tube multiplex PCR assay was established to differentiate the Echinococcus species responsible for infections in intermediate and definitive hosts. Primers specific for E. granulosus, E. multilocularis and E. shiquicus were designed based on sequences of the mitochondrial NADH dehydrogenase subunit 1 (nad1), NADH dehydrogenase subunit 5 (nad5) and cytochrome c oxidase subunit 1 (cox1) genes, respectively. This multiplex PCR accurately detected Echinococcus DNA without generating nonspecific reaction products. PCR products were of the expected sizes of 219 (nad1), 584 (nad5) and 471 (cox1) bp. Furthermore, the multiplex PCR enabled diagnosis of multiple infections using DNA of protoscoleces and copro-DNA extracted from fecal samples of canine hosts. Specificity of the multiplex PCR was 100% when evaluated using DNA isolated from other cestodes. Sensitivity thresholds were determined for DNA from protoscoleces and from worm eggs, and were calculated as 20 pg of DNA for E. granulosus and E. shiquicus, 10 pg of DNA for E. multilocularis, 2 eggs for E. granulosus, and 1 egg for E. multilocularis. Positive results with copro-DNA could be obtained at day 17 and day 26 after experimental infection of dogs with larval E. multilocularis and E. granulosus, respectively. Conclusions/Significance The multiplex PCR developed in this study is an efficient tool for discriminating E. granulosus, E. multilocularis and E. shiquicus from each other and from other taeniid cestodes. It can be used for the detection of canids infected with E. granulosus s.s. and E. multilocularis using feces collected from these definitive hosts. It can also be used for the identification

  9. Culture independent PCR: an alternative enzyme discovery strategy

    DEFF Research Database (Denmark)

    Jacobsen, Jonas; Lydolph, Magnus; Lange, Lene

    2005-01-01

    Degenerate primers were designed for use in a culture-independent PCR screening of DNA from composite fungal communities, inhabiting residues of corn stovers and leaves. According to similarity searches and alignments amplified clone sequences affiliated with glycosyl hydrolase family 7 and glyco...... the value of culture-independent PCR in microbial diversity studies and could add to development of a new enzyme screening technology....

  10. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  11. Template preparation for rapid PCR in Colletotrichum lindemuthianum

    Directory of Open Access Journals (Sweden)

    Roca M. Gabriela

    2003-01-01

    Full Text Available Isolation of DNA for PCR is time-consuming and involves many reagents. The aim of this work was to optimise a rapid and easy PCR methodology without previous DNA isolation. Different strains of the phytopathogenic fungus Colletotrichum lindemuthianum were used. Protoplasts were generated using lytic enzymes under high incubation temperatures using different methodologies to obtain the template. A rapid (10 minute methodology was successful for smaller amplicons (<750 bp.

  12. DNA microarray-based PCR ribotyping of Clostridium difficile.

    Science.gov (United States)

    Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian

    2015-02-01

    This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Diagnosis of aerobic vaginitis by quantitative real-time PCR

    OpenAIRE

    Rumyantseva, T. A.; Bellen, G.; Savochkina, Y. A.; Guschin, A. E.; Donders, G.G.G.

    2016-01-01

    Abstract: Purpose To evaluate a real-time PCR-based technique to quantify bacteria associated with aerobic vaginitis (AV) as a potential test. Methods Vaginal samples from 100 women were tested by wet-mount microscopy, gram stain and quantitative real-time PCR targeting Enterobacteriacea, Staphylococcus spp., Streptococcus spp., Enterococcus spp., Escherichia coli, Streptococcus agalactiae, S. aureus; Lactobacillus spp. AV diagnosis obtained by wet-mount microscopy was used as reference. Resu...

  14. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Science.gov (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  15. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  16. Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella

    International Nuclear Information System (INIS)

    Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar

    2013-01-01

    We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)

  17. Characterization by PCR of Vibrio parahaemolyticus isolates collected during the 1997-1998 Chilean outbreak

    Directory of Open Access Journals (Sweden)

    JOSÉ LUIS CÓRDOVA

    2002-01-01

    Full Text Available Between November 1997 and April 1998, several human gastroenteritis cases were reported in Antofagasta, a city in the north of Chile. This outbreak was associated with the consumption of shellfish, and the etiologic agent responsible was identified as Vibrio parahaemolyticus. This was the first report of this bacterium causing an epidemic in Chile. V. parahaemolyticus was the only pathogenic bacterium isolated from patient stools and from shellfish samples. These isolates were analyzed by polymerase chain reaction (PCR amplification of the pR72H gene, a species-specific sequence. Based on the pR72H gene amplification pattern, at least three different isolates of V. parahaemolyticus were found. Two isolates (named amplicons A and C generated PCR products of approximately 400 bp and 340 bp respectively, while another type of isolate designated B, did not generate a PCR product, regardless of which method of DNA purification was used. Sequence analysis of the amplicons A and C shows that they have an 80 bp and 183 bp conserved region at the 5'end of the gene. However, both isolates have different sequences at their 3' terminus and are also different from the pR72H sequence originally reported. Using this PCR assay we demonstrated that these three isolates were found in clinical samples as well as in shellfish. The warm seawater caused by the climatological phenomena "El Niño" perhaps favored the geographic dispersion of the bacterium (bacterial bloom occurring in Antofagasta that occurred during that time of year

  18. Standardization of the PCR technique for the detection of delta toxin in Staphylococcus spp.

    Directory of Open Access Journals (Sweden)

    C. Marconi

    2005-06-01

    Full Text Available Coagulase-negative staphylococci (CNS, components of the normal flora of neonates, have emerged as important opportunistic pathogens of nosocomial infections that occur in neonatal intensive care units. Some authors have reported the ability of some CNS strains, particularly Staphylococcus epidermidis, to produce a toxin similar to S. aureus delta toxin. This toxin is an exoprotein that has a detergent action on the membranes of various cell types resulting in rapid cell lysis. The objectives of the present study were to standardize the Polymerase Chain Reaction (PCR technique for the detection of the gene responsible for the production of delta toxin (hld gene in staphylococcal species isolated from catheters and blood cultures obtained from neonates, and to compare the results to those obtained with the phenotypic synergistic hemolysis method. Detection of delta toxin by the phenotypic and genotypic method yielded similar results for the S. aureus isolates. However, in S. epidermidis, a higher positivity was observed for PCR (97.4% compared to the synergistic hemolysis method (86.8%. Among CNS, S. epidermidis was the most frequent isolate and was a delta toxin producer. Staphylococcus simulans and S. warneri tested positive by the phenotypic method, but their positivity was not confirmed by PCR for the hld gene detection. These results indicate that different genes might be responsible for the production of this toxin in different CNS species, requiring highly specific primers for their detection. PCR was found to be a rapid and reliable method for the detection of the hld gene in S. aureus and S. epidermidis.

  19. A nested PCR approach for unambiguous typing of pestiviruses infecting cattle.

    Science.gov (United States)

    Decaro, Nicola; Sciarretta, Rossana; Lucente, Maria Stella; Mari, Viviana; Amorisco, Francesca; Colaianni, Maria Loredana; Cordioli, Paolo; Parisi, Antonio; Lelli, Rossella; Buonavoglia, Canio

    2012-02-01

    An atypical pestivirus ('Hobi'-like pestivirus, putative bovine viral diarrhoea 3, BVDV-3) was identified firstly in contaminated foetal calf serum batches and isolated subsequently from an outbreak of respiratory disease in a cattle herd in Italy. The isolation of the novel pestivirus from animals affected clinically posed concerns about the validity of BVDV eradication programs, considering that 'Hobi'-like pestivirus (BVDV-3) is undetected or mistyped by the molecular diagnostic tools currently employed. In this paper, the development of a nested PCR (nPCR) assay for unambiguous typing of all bovine pestiviruses is reported. The assay consisted of a first-round amplification using an oligonucleotide pair which binds to conserved sequences located in the 5' untranslated region and capsid gene, followed by a heminested PCR using virus-specific forward primers. The assay performances were evaluated analytically, showing good sensitivity and specificity. By analysis of 100 BVDV-positive samples typed using a nPCR assay discriminating ruminant pestiviruses, five samples recognised previously as BVDV-2 were not typed when submitted to the new assay (n=2) or reacted as 'Hobi'-like pestivirus BVDV-3 (n=3). Sequence analysis of the first-round amplification products showed that the untyped strains were border disease viruses, whereas the other three strains were true 'Hobi'-like viruses. The development of a molecular assay able to identify simultaneously all bovine pestiviruses known currently will help warrant biosafety of live vaccines and other biological products and assess the molecular epidemiology of 'Hobi'-like pestivirus, thus leading to the improvement of the eradication programs through unambiguous typing of pestiviruses infecting cattle. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Takao Ito

    Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

  1. Characterisation of prototype Nurmi cultures using culture-based microbiological techniques and PCR-DGGE.

    Science.gov (United States)

    Waters, Sinéad M; Murphy, Richard A; Power, Ronan F G

    2006-08-01

    , Serratia, Citrobacter, Enterobacter, Pectobacterium and Pantoea spp. in addition to unculturable bacteria were identified as constituents of the NTCs using universal PCR-DGGE analysis. A number of the sequences detected by LAB-specific PCR-DGGE were homologous to those of a number of Lactobacillus spp., including L. fermentum, L. pontis, L. crispatus, L. salivarius, L. casei, L. suntoryeus, L. vaginalis, L. gasseri, L. aviaries, L. johnsonii, L. acidophilus, and L. mucosae in addition to a range of unculturable lactobacilli. While NTCs are successful due to their complexity, the presence of members of Lactobacillus spp. amongst other probiotic genera, in these samples possibly lends to the success of the NTC cultures as probiotics or competitive exclusion products in poultry over the decades. PCR-DGGE proved to be an effective tool in detecting non-culturable organisms present in these complex undefined cultures. In conclusion, while the culture-dependent identification methods or PCR-DGGE alone cannot comprehensively elucidate the bacterial species present in such complex cultures, their complementarity provides useful information on the identity of the constituents of NTCs and will aid in future development of defined probiotics. Moreover, for the purpose of analysing prototype NTCs during their development, PCR-DGGE overcomes the limitations associated with conventional culturing methods including their low sensitivities, inability to detect unculturable bacteria and unknown species, very slow turnabout time and poor reproducibility. This study demonstrated that PCR-DGGE is indeed more valuable in detecting predominant microbial populations between various NTCs than as an identification methodology, being more applicable as a quality control method used to analyse for batch-to-batch variation during NTC production.

  2. PCR Based Microbial Monitor for Analysis of Recycled Water Aboard the ISSA: Issues and Prospects

    Science.gov (United States)

    Cassell, Gail H.; Lefkowitz, Elliot J.; Glass, John I.

    1995-01-01

    added to a PCR assay; There are not likely to be contaminants in ISSA recycled water that would inhibit PCR resulting in false-negative results; The TaqMan PCR product detection system is the most promising method for developing a rapid, highly automated gene-based microbial monitoring system. The method is inherently quantitative. NASA and other government agencies have invested in other technologies that, although potentially could lead to revolutionary advances, are not likely to mature in the next 5 years into working systems; PCR-based methods cannot distinguish between DNA or RNA of a viable microorganism and that of a non-viable organism. This may or may not be an important issue with reclaimed water on the ISSA. The recycling system probably damages the capacity of the genetic material of any bacteria or viruses killed during processing to serve as a template in a PCR desinged to amplify a large segment of DNA (less than 650 base pairs). If necessary, vital dye staining could be used in addition to PCR, to enumerate the viable cells in a water sample; The quality control methods have been developed to insure that PCR's are working properly, and that reactions are not contaminated with PCR carryover products which could lead to the generation of false-positive results; and The sequences of the small rRNA subunit gene for a large number of microorganisms are known, and they consititue the best database for rational development of the oligonucleotide reagents that give PCR its great specificity. From those gene sequences, sets of oligonucleotide primers for PCR and Taqman detection that could be used in a NASA microbial monitor were constructed using computer based methods. In addition to space utilization, a microbial monitior will have tremendous terrestrial applications. Analysis of patient samples for microbial pathogens, testing industrial effluent for biofouling bacteria, and detection biological warfare agents on the battlefield are but a few of the diverse

  3. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Science.gov (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  4. Analysis of ELA-DQB exon 2 polymorphism in Argentine Creole horses by PCR-RFLP and PCR-SSCP.

    Science.gov (United States)

    Villegas-Castagnasso, E E; Díaz, S; Giovambattista, G; Dulout, F N; Peral-García, P

    2003-08-01

    The second exon of equine leucocyte antigen (ELA)-DQB genes was amplified from genomic DNA of 32 Argentine Creole horses by PCR. Amplified DNA was analysed by PCR-restriction fragment length polymorphism (RFLP) and PCR-single-strand conformation polymorphism (SSCP). The PCR-RFLP analysis revealed two HaeIII patterns, four RsaI patterns, five MspI patterns and two HinfI patterns. EcoRI showed no variation in the analysed sample. Additional patterns that did not account for known exon 2 DNA sequences were observed, suggesting the existence of novel ELA-DQB alleles. PCR-SSCP analysis exhibited seven different band patterns, and the number of bands per animal ranged from four to nine. Both methods indicated that at least two DQB genes are present. The presence of more than two alleles in each animal showed that the primers employed in this work are not specific for a unique DQB locus. The improvement of this PCR-RFLP method should provide a simple and rapid technique for an accurate definition of ELA-DQB typing in horses.

  5. Inhibitory effect of common microfluidic materials on PCR outcome

    KAUST Repository

    Kodzius, Rimantas

    2012-02-20

    Microfluidic chips have a variety of applications in the biological sciences and medicine. In contrast with traditional experimental approaches, microfluidics entails lower sample and reagent consumption, allows faster reactions and enables efficient separation. Additionally microfluidics offers other advantages accruing from the fluids’ various distinct behaviors, such as energy dissipation, fluidic resistance, laminar flow, and surface tension. Biological molecules suspended in fluid and transported through microfluidics channels interact with the channel-wall material. This interaction is even stronger in high surface-area-to-volume ratio (SAVR) microfluidic channels. Adsorption and inhibition of biomolecules occur when these materials come in contact with biomolecular reaction components. Polymerase chain reaction (PCR) is a thermal cycling procedure for amplifying target DNA. The PCR compatibility of silicon, silicon dioxide (SiO2) and other surfaces have been studied; however the results are inconclusive. Usually for protein-surface interaction measurements, bulky and expensive equipment is used, such as Atomic Force Microscopy (AFM), Scanning or Transmission Electron Microscopy (SEM, TEM), spectrophotometric protein concentration measurement, Fourier transform infrared spectroscopy (FTIR) or X-Ray photoelectron spectroscopy (XPS). \\tThe PCR reaction components include the DNA template, primers, DNA polymerase (the main component), dNTPs, a buffer, divalent ions (MgCl2), and KCl. \\tWe designed a simple, relatively quick measurement that only requires a PCR cycler; thus it mimics actual conditions in PCR cycling. In our study, we evaluated the inhibitory affect of different materials on PCR, which is one of the most frequently used enzymatic reactions in microfluidics. PCR reaction optimization through choice of surface materials is of the upmost importance, as it enables and improves enzymatic reaction in microfluidics. Our assessment of the PCR

  6. Development of a GeXP-multiplex PCR assay for the simultaneous detection and differentiation of six cattle viruses.

    Directory of Open Access Journals (Sweden)

    Qing Fan

    Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis

  7. Development of real-time PCR tests for the detection of Tenebrio molitor in food and feed.

    Science.gov (United States)

    Debode, Frédéric; Marien, Aline; Gérard, Amaury; Francis, Frédéric; Fumière, Olivier; Berben, Gilbert

    2017-08-01

    Insects are rich in proteins and could be an alternative source of proteins to feed animals and humans. Numerous companies have started the production of insects for feed purposes. In Europe, these processed animal proteins are not yet authorised by legislation as many questions still need to be answered concerning this 'novel food'. Authorisations will be possible when methods of authentication of the products are available. In this study we propose real-time PCR methods for the specific detection of the mealworm (Tenebriomolitor), one of the most widely used insects for food and feed production. Two PCR assays are proposed: the first based on the wingless gene and the second based on the cadherin gene. The PCR tests amplify fragments of 87 bp. These qualitative methods were tested according to several performance criteria. The specificity was tested on 34 insect species' DNA, but also on non-insect species including crustacean, mammals, birds and plants. The limit of detection was determined and was below 20 copies for the two PCR tests. The applicability of the tests was demonstrated by the analysis of real-life processed samples containing T. molitor.

  8. Simultaneous detection of Fusarium culmorum and F. graminearum in plant material by duplex PCR with melting curve analysis.

    Science.gov (United States)

    Brandfass, Christoph; Karlovsky, Petr

    2006-01-23

    Fusarium head blight (FHB) is a disease of cereal crops, which has a severe impact on wheat and barley production worldwide. Apart from reducing the yield and impairing grain quality, FHB leads to contamination of grain with toxic secondary metabolites (mycotoxins), which pose a health risk to humans and livestock. The Fusarium species primarily involved in FHB are F. graminearum and F. culmorum. A key prerequisite for a reduction in the incidence of FHB is an understanding of its epidemiology. We describe a duplex-PCR-based method for the simultaneous detection of F. culmorum and F. graminearum in plant material. Species-specific PCR products are identified by melting curve analysis performed in a real-time thermocycler in the presence of the fluorescent dye SYBR Green I. In contrast to multiplex real-time PCR assays, the method does not use doubly labeled hybridization probes. PCR with product differentiation by melting curve analysis offers a cost-effective means of qualitative analysis for the presence of F. culmorum and F. graminearum in plant material. This method is particularly suitable for epidemiological studies involving a large number of samples.

  9. A molecular-beacon-based asymmetric PCR assay for easy visualization of amplicons in the diagnosis of trichomoniasis.

    Science.gov (United States)

    Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman

    2016-12-15

    The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

    Science.gov (United States)

    Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

    2017-04-01

    Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

  11. Simultaneous detection of Fusarium culmorum and F. graminearum in plant material by duplex PCR with melting curve analysis

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-01-01

    Full Text Available Abstract Background Fusarium head blight (FHB is a disease of cereal crops, which has a severe impact on wheat and barley production worldwide. Apart from reducing the yield and impairing grain quality, FHB leads to contamination of grain with toxic secondary metabolites (mycotoxins, which pose a health risk to humans and livestock. The Fusarium species primarily involved in FHB are F. graminearum and F. culmorum. A key prerequisite for a reduction in the incidence of FHB is an understanding of its epidemiology. Results We describe a duplex-PCR-based method for the simultaneous detection of F. culmorum and F. graminearum in plant material. Species-specific PCR products are identified by melting curve analysis performed in a real-time thermocycler in the presence of the fluorescent dye SYBR Green I. In contrast to multiplex real-time PCR assays, the method does not use doubly labeled hybridization probes. Conclusion PCR with product differentiation by melting curve analysis offers a cost-effective means of qualitative analysis for the presence of F. culmorum and F. graminearum in plant material. This method is particularly suitable for epidemiological studies involving a large number of samples.

  12. Development of a multiplex real time PCR to detect thermophilic lactic acid bacteria in natural whey starters.

    Science.gov (United States)

    Bottari, Benedetta; Agrimonti, Caterina; Gatti, Monica; Neviani, Erasmo; Marmiroli, Nelson

    2013-01-01

    A multiplex real time PCR (mRealT-PCR) useful to rapidly screen microbial composition of thermophilic starter cultures for hard cooked cheeses and to compare samples with potentially different technological properties was developed. Novel primers directed toward pheS gene were designed and optimized for multiple detection of Lactobacillus helveticus, Lactobacillus delbrueckii, Streptococcus thermophilus and Lactobacillus fermentum. The assay was based on SYBR Green chemistry followed by melting curves analysis. The method was then evaluated for applications in the specific detection of the 4 lactic acid bacteria (LAB) in 29 different natural whey starters for Parmigiano Reggiano cheese production. The results obtained by mRealT-PCR were also compared with those obtained on the same samples by Fluorescence in Situ Hybridization (FISH) and Length-Heterogeneity PCR (LH-PCR). The mRealT-PCR developed in this study, was found to be effective for analyzing species present in the samples with an average sensitivity down to less than 600 copies of DNA and therefore sensitive enough to detect even minor LAB community members of thermophilic starter cultures. The assay was able to describe the microbial population of all the different natural whey starter samples analyzed, despite their natural variability. A higher number of whey starter samples with S. thermophilus and L. fermentum present in their microbial community were revealed, suggesting that these species could be more frequent in Parmigiano Reggiano natural whey starter samples than previously shown. The method was more effective than LH-PCR and FISH and, considering that these two techniques have to be used in combination to detect the less abundant species, the mRealT-PCR was also faster. Providing a single step sensitive detection of L. helveticus, L. delbrueckii, S. thermophilus and L. fermentum, the developed mRealT-PCR could be used for screening thermophilic starter cultures and to follow the presence of

  13. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.

    Science.gov (United States)

    Tessitore, Marion Vaglio; Sottini, Alessandra; Roccaro, Aldo M; Ghidini, Claudia; Bernardi, Simona; Martellosio, Giovanni; Serana, Federico; Imberti, Luisa

    2017-04-05

    A normal number of T-cell receptor excision circles (TRECs) and K-deleting recombination excision circles (KRECs) is considered a biomarker for adequate new T- and B-cell production. In newborns, detection of TRECs and KRECs by real time PCR from dried blood spotted on filter paper is used for the screening of severe immunodeficiency. In adults, elderly and during diseases, where the number of TRECs is lower than in newborns and children, a large amount of DNA and a sensitive method of amplification are necessary to identify newly produced lymphocytes. DNA was prepared from blood of 203 healthy adults (range: 18-91 years old) absorbed for 10 s on flocked swabs and let to dry, or from peripheral blood mononuclear cells. DNA was subjected to digital PCR and to well established conventional real time PCR-based method using TREC- and KREC-specific primers and probes. The number of TRECs and KRECs was expressed per mL of blood. Statistical analysis was performed by nested ANOVA, Pearson coefficient of determination, and by linear regression tests. The novel method for the storage of dried blood on nylon flocked swabs and the use of digital PCR allow quantification of TRECs and KRECs with high degree of sensitivity, specificity, accuracy, and precision. TRECs and KRECs were amplified by digital PCR in all tested blood samples, including those obtained from elderly individuals (>70 years old) and that were negative by real time PCR. Furthermore, values of TRECs and KRECs obtained by digital PCR were in the range of those acquired by real time PCR. Our findings demonstrate that DNA isolation from dried blood on flocked swabs followed by digital PCR-based analysis represents a useful tool for studying new lymphocyte production in adults and elderly individuals. This suggests the potential use of the methodology when monitoring of clinical variables is limited by the number of molecules that can be amplified and detected, such as in patients with immunodeficiency or under

  14. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Enhanced capillary electrophoretic screening of Alzheimer based on direct apolipoprotein E genotyping and one-step multiplex PCR.

    Science.gov (United States)

    Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho

    2018-01-01

    Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Preclinical detection of porcine circovirus type 2 infection using an ultrasensitive nanoparticle DNA probe-based PCR assay.

    Directory of Open Access Journals (Sweden)

    Yong Huang

    Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.

  17. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Directory of Open Access Journals (Sweden)

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  18. Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR.

    Directory of Open Access Journals (Sweden)

    Janina Demeler

    Full Text Available Diagnosis of gastrointestinal nematodes relies predominantly on coproscopic methods such as flotation, Kato-Katz, McMaster or FLOTAC. Although FLOTAC allows accurate quantification, many nematode eggs can only be differentiated to genus or family level. Several molecular diagnostic tools discriminating closely related species suffer from high costs for DNA isolation from feces and limited sensitivity since most kits use only small amounts of feces (<1 g. A direct PCR from crude egg preparations was designed for full compatibility with FLOTAC to accurately quantify eggs per gram feces (epg and determine species composition. Eggs were recovered from the flotation solution and concentrated by sieving. Lysis was achieved by repeated boiling and freezing cycles - only Trichuris eggs required additional mechanic disruption. Egg lysates were directly used as template for PCR with Phusion DNA polymerase which is particularly resistant to PCR inhibitors. Qualitative results were obtained with feces of goats, cattle, horses, swine, cats, dogs and mice. The finally established protocol was also compatible with quantitative real-time PCR in the presence of EvaGreen and no PCR inhibition was detectable when extracts were diluted at least fourfold. Sensitivity was comparable to DNA isolation protocols and spiked samples with five epg were reliably detected. For Toxocara cati a detection limit below one epg was demonstrated. It was possible to distinguish T. cati and Toxocara canis using high resolution melt (HRM analysis, a rapid tool for species identification. In human samples, restriction fragment length polymorphism (RFLP and HRM analysis were used to discriminate Necator americanus and Ancylostoma duodenale. The method is able to significantly improve molecular diagnosis of gastrointestinal nematodes by increasing speed and sensitivity while decreasing overall costs. For identification of species or resistance alleles, analysis of PCR products with many

  19. PCR-free detection of genetically modified organisms using magnetic capture technology and fluorescence cross-correlation spectroscopy.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhou

    2009-11-01

    Full Text Available The safety of genetically modified organisms (GMOs has attracted much attention recently. Polymerase chain reaction (PCR amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS. The cauliflower mosaic virus 35S (CaMV35S promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 microg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids.

  20. Discrimination of gastrointestinal nematode eggs from crude fecal egg preparations by inhibitor-resistant conventional and real-time PCR.

    Science.gov (United States)

    Demeler, Janina; Ramünke, Sabrina; Wolken, Sonja; Ianiello, Davide; Rinaldi, Laura; Gahutu, Jean Bosco; Cringoli, Giuseppe; von Samson-Himmelstjerna, Georg; Krücken, Jürgen

    2013-01-01

    Diagnosis of gastrointestinal nematodes relies predominantly on coproscopic methods such as flotation, Kato-Katz, McMaster or FLOTAC. Although FLOTAC allows accurate quantification, many nematode eggs can only be differentiated to genus or family level. Several molecular diagnostic tools discriminating closely related species suffer from high costs for DNA isolation from feces and limited sensitivity since most kits use only small amounts of feces (PCR from crude egg preparations was designed for full compatibility with FLOTAC to accurately quantify eggs per gram feces (epg) and determine species composition. Eggs were recovered from the flotation solution and concentrated by sieving. Lysis was achieved by repeated boiling and freezing cycles - only Trichuris eggs required additional mechanic disruption. Egg lysates were directly used as template for PCR with Phusion DNA polymerase which is particularly resistant to PCR inhibitors. Qualitative results were obtained with feces of goats, cattle, horses, swine, cats, dogs and mice. The finally established protocol was also compatible with quantitative real-time PCR in the presence of EvaGreen and no PCR inhibition was detectable when extracts were diluted at least fourfold. Sensitivity was comparable to DNA isolation protocols and spiked samples with five epg were reliably detected. For Toxocara cati a detection limit below one epg was demonstrated. It was possible to distinguish T. cati and Toxocara canis using high resolution melt (HRM) analysis, a rapid tool for species identification. In human samples, restriction fragment length polymorphism (RFLP) and HRM analysis were used to discriminate Necator americanus and Ancylostoma duodenale. The method is able to significantly improve molecular diagnosis of gastrointestinal nematodes by increasing speed and sensitivity while decreasing overall costs. For identification of species or resistance alleles, analysis of PCR products with many different post PCR methods can

  1. Species identification of Cannabis sativa using real-time quantitative PCR (qPCR).

    Science.gov (United States)

    Johnson, Christopher E; Premasuthan, Amritha; Satkoski Trask, Jessica; Kanthaswamy, Sree

    2013-03-01

    Most narcotics-related cases in the United States involve Cannabis sativa. Material is typically identified based on the cystolithic hairs on the leaves and with chemical tests to identify of the presence of cannabinoids. Suspect seeds are germinated into a viable plant so that morphological and chemical tests can be conducted. Seed germination, however, causes undue analytical delays. DNA analyses that involve the chloroplast and nuclear genomes have been developed for identification of C. sativa materials, but they require several nanograms of template DNA. Using the trnL 3' exon-trnF intragenic spacer regions within the C. sativa chloroplast, we have developed a real-time quantitative PCR assay that is capable of identifying picogram amounts of chloroplast DNA for species determination of suspected C. sativa material. This assay provides forensic science laboratories with a quick and reliable method to identify an unknown sample as C. sativa. © 2013 American Academy of Forensic Sciences.

  2. PCR-based methods for identification of potentially zoonotic ascaridoid parasites of the dog, fox and cat.

    Science.gov (United States)

    Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B

    1997-11-01

    Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.

  3. Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua

    2016-10-11

    The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.

  4. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  5. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    Science.gov (United States)

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  6. Development of the Multiple Gene Knockout System with One-Step PCR in Thermoacidophilic Crenarchaeon Sulfolobus acidocaldarius

    Directory of Open Access Journals (Sweden)

    Shoji Suzuki

    2017-01-01

    Full Text Available Multiple gene knockout systems developed in the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius are powerful genetic tools. However, plasmid construction typically requires several steps. Alternatively, PCR tailing for high-throughput gene disruption was also developed in S. acidocaldarius, but repeated gene knockout based on PCR tailing has been limited due to lack of a genetic marker system. In this study, we demonstrated efficient homologous recombination frequency (2.8 × 104 ± 6.9 × 103 colonies/μg DNA by optimizing the transformation conditions. This optimized protocol allowed to develop reliable gene knockout via double crossover using short homologous arms and to establish the multiple gene knockout system with one-step PCR (MONSTER. In the MONSTER, a multiple gene knockout cassette was simply and rapidly constructed by one-step PCR without plasmid construction, and the PCR product can be immediately used for target gene deletion. As an example of the applications of this strategy, we successfully made a DNA photolyase- (phr- and arginine decarboxylase- (argD- deficient strain of S. acidocaldarius. In addition, an agmatine selection system consisting of an agmatine-auxotrophic strain and argD marker was also established. The MONSTER provides an alternative strategy that enables the very simple construction of multiple gene knockout cassettes for genetic studies in S. acidocaldarius.

  7. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR

    Directory of Open Access Journals (Sweden)

    Susan D'Costa

    2016-01-01

    Full Text Available Clinical trials using recombinant adeno-associated virus (rAAV vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR is now the most common method to titer vector genomes (vg; however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new “Free-ITR” qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.

  9. Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR.

    Science.gov (United States)

    D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard

    2016-01-01

    Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.

  10. Design and optimization of reverse-transcription quantitative PCR experiments.

    Science.gov (United States)

    Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

    2009-10-01

    Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

  11. Droplet digital PCR technology promises new applications and research areas.

    Science.gov (United States)

    Manoj, P

    2016-01-01

    Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.

  12. Result Variation and Efficiency Kinetics in Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Reza Shahsiah

    2010-10-01

    Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.

  13. Decoding DNA labels by melting curve analysis using real-time PCR.

    Science.gov (United States)

    Balog, József A; Fehér, Liliána Z; Puskás, László G

    2017-12-01

    Synthetic DNA has been used as an authentication code for a diverse number of applications. However, existing decoding approaches are based on either DNA sequencing or the determination of DNA length variations. Here, we present a simple alternative protocol for labeling different objects using a small number of short DNA sequences that differ in their melting points. Code amplification and decoding can be done in two steps using quantitative PCR (qPCR). To obtain a DNA barcode with high complexity, we defined 8 template groups, each having 4 different DNA templates, yielding 158 (>2.5 billion) combinations of different individual melting temperature (Tm) values and corresponding ID codes. The reproducibility and specificity of the decoding was confirmed by using the most complex template mixture, which had 32 different products in 8 groups with different Tm values. The industrial applicability of our protocol was also demonstrated by labeling a drone with an oil-based paint containing a predefined DNA code, which was then successfully decoded. The method presented here consists of a simple code system based on a small number of synthetic DNA sequences and a cost-effective, rapid decoding protocol using a few qPCR reactions, enabling a wide range of authentication applications.

  14. Evaluation of PCR and high-resolution melt curve analysis for differentiation of Salmonella isolates.

    Science.gov (United States)

    Saeidabadi, Mohammad Sadegh; Nili, Hassan; Dadras, Habibollah; Sharifiyazdi, Hassan; Connolly, Joanne; Valcanis, Mary; Raidal, Shane; Ghorashi, Seyed Ali

    2017-06-01

    Consumption of poultry products contaminated with Salmonella is one of the major causes of foodborne diseases worldwide and therefore detection and differentiation of Salmonella spp. in poultry is important. In this study, oligonucleotide primers were designed from hemD gene and a PCR followed by high-resolution melt (HRM) curve analysis was developed for rapid differentiation of Salmonella isolates. Amplicons of 228 bp were generated from 16 different Salmonella reference strains and from 65 clinical field isolates mainly from poultry farms. HRM curve analysis of the amplicons differentiated Salmonella isolates and analysis of the nucleotide sequence of the amplicons from selected isolates revealed that each melting curve profile was related to a unique DNA sequence. The relationship between reference strains and tested specimens was also evaluated using a mathematical model without visual interpretation of HRM curves. In addition, the potential of the PCR-HRM curve analysis was evaluated for genotyping of additional Salmonella isolates from different avian species. The findings indicate that PCR followed by HRM curve analysis provides a rapid and robust technique for genotyping of Salmonella isolates to determine the serovar/serotype.

  15. Development of quantitative real-time PCR for detection and enumeration of Enterobacteriaceae.

    Science.gov (United States)

    Takahashi, Hajime; Saito, Rumi; Miya, Satoko; Tanaka, Yuichiro; Miyamura, Natsumi; Kuda, Takashi; Kimura, Bon

    2017-04-04

    The family Enterobacteriaceae, members of which are widely distributed in the environment, includes many important human pathogens. In this study, a rapid real-time PCR method targeting rplP, coding for L16 protein, a component of the ribosome large subunit, was developed for enumerating Enterobacteriaceae strains, and its efficiency was evaluated using naturally contaminated food products. The rplP-targeted real-time PCR amplified Enterobacteriaceae species with Ct values of 14.0-22.8, whereas the Ct values for non-Enterobacteriaceae species were >30, indicating the specificity of this method for the Enterobacteriaceae. Using a calibration curve of Ct=-3.025 (log CFU/g)+37.35, which was calculated from individual plots of the cell numbers in different concentrations of 5 Enterobacteriaceae species, the rplP-targeted real-time PCR was applied to 51 food samples. A Enterobacteriaceae species in foods rapidly and accurately, and therefore, it can be used for the microbiological risk analysis of foods. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    Mahnaz Mahmoudi Rad

    2012-01-01

    Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.

  17. Exploring viral reservoir: The combining approach of cell sorting and droplet digital PCR.

    Science.gov (United States)

    Gibellini, Lara; Pecorini, Simone; De Biasi, Sara; Pinti, Marcello; Bianchini, Elena; De Gaetano, Anna; Digaetano, Margherita; Pullano, Rosalberta; Lo Tartaro, Domenico; Iannone, Anna; Mussini, Cristina; Cossarizza, Andrea; Nasi, Milena

    2018-02-01

    Combined antiretroviral therapy (cART) blocks different steps of HIV replication and maintains plasma viral RNA at undetectable levels. The virus can remain in long-living cells and create a reservoir where HIV can restart replicating after cART discontinuation. A persistent viral production triggers and maintains a persistent immune activation, which is a well-known feature of chronic HIV infection, and contributes either to precocious aging, or to the increased incidence of morbidity and mortality of HIV positive patients. The new frontier of the treatment of HIV infection is nowadays eradication of the virus from all host cells and tissues. For this reason, it is crucial to have a clear and precise idea of where the virus hides, and which are the cells that keep it silent. Important efforts have been made to improve the detection of viral reservoirs, and new techniques are now giving the opportunity to characterize viral reservoirs. Among these techniques, a strategic approach based upon cell sorting and droplet digital PCR (ddPCR) is opening new horizons and opportunities of research. This review provides an overview of the methods that combine cell sorting and ddPCR for the quantification of HIV DNA in different cell types, and for the detection of its maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Molecular typing of the actin gene of Trichomonas vaginalis isolates by PCR-RFLP in Iran.

    Science.gov (United States)

    Momeni, Zohreh; Sadraei, Javid; Kazemi, Bahram; Dalimi, Abdolhossein

    2015-12-01

    Trichomonas vaginalis is a human urogenital pathogen that causes trichomoniasis, the most common nonviral, parasitic sexually transmitted infection in the world. At present, little is known regarding the degree of strain variability of T. vaginalis. A classification method for T. vaginalis strains would be a useful tool in the study of the epidemiology, drug resistance, pathogenesis and transmission of T. vaginalis. Eight different types of actin genes have been identified by PCR-RFLP in T. vaginalis; the purpose of this study is to determine the genotypes of this parasite in Karaj city, Iran. Forty-five clinical T. vaginalis isolates from vaginal secretions and urine sediment were collected from Karaj city from 2012 through 2014. DNA was extracted and the actin gene was amplified by nested-PCR; all samples were positive. To determine the genetic differences, sequencing on seven samples was conducted. Then, all PCR products were digested with HindII, MseI, and RsaI restriction enzymes. Of 45 isolates, 23 samples (51.1%) were of actin genotype G, 11 samples (24.4%) of genotype E, six samples (13.3%) of genotype H, three samples (6.6%) of genotype I, and two samples (4.4%) were mixed genotypes of G and E. Genetic diversity of T. vaginalis isolates is notable. The actin genotype G may be the dominant genotype in Karaj city, Iran. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. The Prevalence of Human Papilloma Virus(HPV in Malignant Cervical Lesion, Using Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M. R. Keyhkhaee

    2006-07-01

    Full Text Available Background: Cervical cancer is the second leading cause of cancer death among women. In this cancer, the effects of prevention, early diagnosis and treatment more than other cancers decrease the mortality rate. In 1970 human papilloma virus (HPV was introduction as major etiologic factor of cervical cancer. Different studies throughout the world revealed strong correlation between HPV and cancerous & precancerous changes in epithelial cells. Since cell culture and serological methods can not recognize the virus and its subtypes, the importance of the molecular methods including polymerase chain reaction (PCR in early and definite diagnosis of virus is obvious. Methods: In this study, after patient selection using the related protocol and completion of the questionnaires, 100 samples from cancer lesions of cervix selected. Then DNA extraction from paraffin blocks performed using standard method. Multiplex PCR with two pairs of primer (one as internal control performed and the PCR product run on 8% polyacrylamid gel. Results: The results showed that 73% of the tissues were infected by HPV. Conclusion: This finding confirm the previous results based of correlation between HPV,and cervical cancer.

  20. Design and Validation of Real-Time PCR: Quantitative Diagnosis of Common Leishmania Species in Iran.

    Science.gov (United States)

    Fekri Soofi Abadi, Maryam; Dabiri, Shahriar; Fotouhi Ardakani, Reza; Fani Malaki, Lina; Amirpoor Rostami, Sahar; Ziasistani, Mahsa; Dabiri, Donya

    2016-07-01

    Design and validation of Real-time PCR on the protected gene region ITS2 to quantify the parasite load in common leishmania (L) species. Probe and primer were designed from the ITS2 region between the rRNA genes with minimum gene variation in three common leishmania species followed by a Real-time PCR using the Taq man probe method in the form of absolute quantification. A series of different concentrations of leishmania were analyzed. After the purified PCR product was successfully placed in a PTG19-T plasmid vector, specialized ITS2 region was cloned in this plasmid. In the last phase, the cloned gene was transferred to the Ecoli.Top10F bacteria. The standard plasmid was provided in 10(7) to 10(1) copies/rxn concentrations. The specification and clinical sensitivity of the data was analyzed using inter and intra scales. The probe and primer were designed using three species, including L. infantum, L. major, and L.tropica. Seven concentrations of purified parasite in culture media showed that the selected region for quantifying the parasite is suitable. Clinical and analytical specificity and sensitivity were both 100%, respectively. The Taq man method for the ITS2 region in leishmania is one the most sensitive diagnostic test for identifying the parasite load and is suggested as a tool for fast identification and quantification of species.

  1. Optimisation of Forensic Genetics Procedures Used in Disputed Paternity Testing: Adjustment of the PCR Reaction Volume

    Directory of Open Access Journals (Sweden)

    Damir Marjanović

    2006-05-01

    Full Text Available Standard molecular techniques, with only a slight modification, are very useful in obtaining and interpreting the final results in the field of forensic genetic. Data obtained through such analysis are highly reliable and can be used as a very powerful tool that produces valuable results. However, success and swiftness of DNA typing of biological evidence either that found at a crime scene or used in disputed paternity testing, depends on the optimization of numerous factors. One of the most important and critical phases that ensures reliability of the whole procedure is the choice of the most suitable volume for the amplification protocol. Buccal swabs were collected from volunteers. DNA was extracted by Qiagen Dnaeasy Tissue Kit. PowerPlex 16 kit was used to simultaneously amplify 15 STR loci by PCR. Amplification was carried out as described previously. The tested total working reaction volumes were 5, 10 and 25 microl. The PCR amplification was carried out in PE Gene Amp PCR System Thermal Cycler (ABI, Foster City, CA. Amplification products were analyzed on an ABI PRISM 377 instrument (ABI, Foster City, CA in 5% bis-acrilamide gel. Amplification was generally successful for all the tested reaction volumes. Lower partial to complete DNA profiles ratio, the quality of obtained STR profiles, significantly reduced amount of reaction's components give advantage to 5 microl reaction volume over other two tested volumes in this case.

  2. Quantification of viable bacteria in wastewater treatment plants by using propidium monoazide combined with quantitative PCR (PMA-qPCR).

    Science.gov (United States)

    Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao

    2014-02-01

    The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.

  3. PCR detection and identification of histamine-forming bacteria in filleted tuna fish samples.

    Science.gov (United States)

    Ferrario, Chiara; Pegollo, Chiara; Ricci, Giovanni; Borgo, Francesca; Fortina, M Grazia

    2012-02-01

    Total of 14 filleted yellowfin tuna fish (Thunnus albacares) sold in wholesale fish market and supermarkets in Milan, Italy, were purchased and tested to determine microbial count, histamine level, histamine-forming bacteria, and their ability to produce histamine in culture broth. Although histamine level was less than 10 ppm, many samples showed high total viable bacterial and enterobacterial counts that reached dangerous levels after temperature abuse for short periods of time. A PCR assay targeting a 709-bp fragment of the histidine decarboxylase gene (hdc) revealed that 30.5% of the 141 enteric bacteria isolated from samples were positive and potentially able to produce histamine. The hdc positive strains were mainly isolated from fish bought at wholesale fish market, where we observed several possible risk factors, such as handling in poor and non-refrigerated conditions during fillet preparation. These positive strains were identified as Citrobacter koseri/Enterobacter spp. and Morganella morganii, by 16S/23S rRNA internal transcribed spacer amplification and 16S rRNA sequence analysis. The strains showed a variable ability of histamine production, with Morganella morganii being the most active histamine-producing species. A direct DNA extraction from fish and a PCR targeting the hdc gene showed a high degree of concordance with the results obtained through microbiological and chemical analyses, and could aid in the prompt detection of potentially contaminated fish products, before histamine accumulates. The use of methods for the early and rapid detection of bacteria producing biogenic amines is important for preventing accumulation of these toxic substances in food products. In this study, we used a molecular approach for the detection of histamine-forming bacteria in fish. PCR-based methods require expensive equipment and a high degree of training for the user, but are fast (marketing and can be used in the investigation of risk reduction strategies.

  4. Direct PCR amplification of the HVSI region in mitochondrial DNA from buccal cell swabs

    Directory of Open Access Journals (Sweden)

    Kovačević-Grujičić Nataša

    2012-01-01

    Full Text Available Amplification of human mitochondrial DNA (mtDNA has been widely used in population genetics, human evolutionary and molecular anthropology studies. mtDNA hypervariable segments I and II (HVSI and HVSII were shown to be a suitable tool in genetic analyses due to the unique properties of mtDNA, such as the lack of recombination, maternal mode of inheritance, rapid evolutionary rate and high population-specific polymorphisms. Here we present a rapid and low-cost method for direct PCR amplification of a 330 bp fragment of HVSI from buccal cell samples. Avoiding the DNA isolation step makes this method appropriate for the analysis of a large number of samples in a short period of time. Since the transportation of samples and fieldwork conditions can affect the quality of samples and subsequent DNA analysis, we tested the effects of long-term storage of buccal cell swabs on the suitability of such samples for direct PCR amplification. We efficiently amplified a 330 bp fragment of HVSI even after the long-term storage of buccal cells at room temperature, +4°C or at -20°C, for up to eight months. All examined PCR products were successfully sequenced, regardless of sample storage time and conditions. Our results suggest that the direct PCR amplification of the HVSI region from buccal cells is a method well suited for large-scale mtDNA population studies.[Acknowledgments. This work was supported by the Ministry of Education and Science of the Republic of Serbia (Grant no. III 47025.

  5. PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

    1993-01-01

    From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  6. PCR-RFLP Analysis of a fliC Gene Fragment in Avian Salmonella Isolates

    Directory of Open Access Journals (Sweden)

    Zohreh Ebrahimvandi

    2014-07-01

    Full Text Available Background: Salmonella are a genus of zoonotic bacteria of worldwide economic and health importance. Members of Salmonella enterica subspecies enterica are mainly associated with warm-blooded vertebrates and are usually transmitted by ingestion of food or watercontaminated by infected feces. Objectives: The aim of this study was to apply a PCR-RFLP method based on the fliC gene to identify the serotypes of Salmonella isolates from Karaj, Iran. Materials and Methods: A