Entanglement probabilities of polymers: a white noise functional approach

International Nuclear Information System (INIS)

Bernido, Christopher C; Carpio-Bernido, M Victoria

2003-01-01

The entanglement probabilities for a highly flexible polymer to wind n times around a straight polymer are evaluated using white noise analysis. To introduce the white noise functional approach, the one-dimensional random walk problem is taken as an example. The polymer entanglement scenario, viewed as a random walk on a plane, is then treated and the entanglement probabilities are obtained for a magnetic flux confined along the straight polymer, and a case where an entangled polymer is subjected to the potential V = f-dot(s)θ. In the absence of the magnetic flux and the potential V, the entanglement probabilities reduce to a result obtained by Wiegel

Theoretical analysis of integral neutron transport equation using collision probability method with quadratic flux approach

International Nuclear Information System (INIS)

Shafii, Mohammad Ali; Meidianti, Rahma; Wildian,; Fitriyani, Dian; Tongkukut, Seni H. J.; Arkundato, Artoto

2014-01-01

Theoretical analysis of integral neutron transport equation using collision probability (CP) method with quadratic flux approach has been carried out. In general, the solution of the neutron transport using the CP method is performed with the flat flux approach. In this research, the CP method is implemented in the cylindrical nuclear fuel cell with the spatial of mesh being conducted into non flat flux approach. It means that the neutron flux at any point in the nuclear fuel cell are considered different each other followed the distribution pattern of quadratic flux. The result is presented here in the form of quadratic flux that is better understanding of the real condition in the cell calculation and as a starting point to be applied in computational calculation

Theoretical analysis of integral neutron transport equation using collision probability method with quadratic flux approach

Energy Technology Data Exchange (ETDEWEB)

Shafii, Mohammad Ali, E-mail: mashafii@fmipa.unand.ac.id; Meidianti, Rahma, E-mail: mashafii@fmipa.unand.ac.id; Wildian,, E-mail: mashafii@fmipa.unand.ac.id; Fitriyani, Dian, E-mail: mashafii@fmipa.unand.ac.id [Department of Physics, Andalas University Padang West Sumatera Indonesia (Indonesia); Tongkukut, Seni H. J. [Department of Physics, Sam Ratulangi University Manado North Sulawesi Indonesia (Indonesia); Arkundato, Artoto [Department of Physics, Jember University Jember East Java Indonesia (Indonesia)

2014-09-30

Theoretical analysis of integral neutron transport equation using collision probability (CP) method with quadratic flux approach has been carried out. In general, the solution of the neutron transport using the CP method is performed with the flat flux approach. In this research, the CP method is implemented in the cylindrical nuclear fuel cell with the spatial of mesh being conducted into non flat flux approach. It means that the neutron flux at any point in the nuclear fuel cell are considered different each other followed the distribution pattern of quadratic flux. The result is presented here in the form of quadratic flux that is better understanding of the real condition in the cell calculation and as a starting point to be applied in computational calculation.

Calculating the Probability of Returning a Loan with Binary Probability Models

Directory of Open Access Journals (Sweden)

Julian Vasilev

2014-12-01

Full Text Available The purpose of this article is to give a new approach in calculating the probability of returning a loan. A lot of factors affect the value of the probability. In this article by using statistical and econometric models some influencing factors are proved. The main approach is concerned with applying probit and logit models in loan management institutions. A new aspect of the credit risk analysis is given. Calculating the probability of returning a loan is a difficult task. We assume that specific data fields concerning the contract (month of signing, year of signing, given sum and data fields concerning the borrower of the loan (month of birth, year of birth (age, gender, region, where he/she lives may be independent variables in a binary logistics model with a dependent variable “the probability of returning a loan”. It is proved that the month of signing a contract, the year of signing a contract, the gender and the age of the loan owner do not affect the probability of returning a loan. It is proved that the probability of returning a loan depends on the sum of contract, the remoteness of the loan owner and the month of birth. The probability of returning a loan increases with the increase of the given sum, decreases with the proximity of the customer, increases for people born in the beginning of the year and decreases for people born at the end of the year.

Approaches to Evaluating Probability of Collision Uncertainty

Science.gov (United States)

Hejduk, Matthew D.; Johnson, Lauren C.

2016-01-01

While the two-dimensional probability of collision (Pc) calculation has served as the main input to conjunction analysis risk assessment for over a decade, it has done this mostly as a point estimate, with relatively little effort made to produce confidence intervals on the Pc value based on the uncertainties in the inputs. The present effort seeks to try to carry these uncertainties through the calculation in order to generate a probability density of Pc results rather than a single average value. Methods for assessing uncertainty in the primary and secondary objects' physical sizes and state estimate covariances, as well as a resampling approach to reveal the natural variability in the calculation, are presented; and an initial proposal for operationally-useful display and interpretation of these data for a particular conjunction is given.

A probability tomography approach to the analysis of potential field data in the Campi Flegrei caldera (Italy)

Energy Technology Data Exchange (ETDEWEB)

Iuliano, T.; Patella, D. [Naples Univ. Federico 2., Naples (Italy). Dipartimento di Scienze Fisiche; Mauriello, P. [Consiglio Nazionale delle Ricerche, Istituto per le Tecnologie Applicate ai Beni Culturali, Rome (Italy)

2001-04-01

The results of the application of the 3a probability tomography imaging approach to the study of the Ca mpi Fagarol (Cf) caldera are presented and discussed. The tomography approach has been applied to gravity, magnetic and ground deformation data already available in literature. The analysis of the 3a tomographic images is preceded by a brief qualitative interpretation of the original survey maps and by an outline of the probability tomography approach for each geophysical prospecting method. The results derived from the 3a tomographic images are the high occurrence probabilities of both gravity and ground deformation source centers in the Cf caldera under the town of Palazzo. A Bagger negative anomaly source centre is highlighted in the depth range 1.6-2 km b.s.l., whereas a positive ground deformation point source, responsible for the bradyseismic crisis of 1982-1984, is estimated at a mean depth of 3-4 km b.s.l. These inferences, combined with the results of a previous analysis of magnetotelluric, dipolar geolectrical and self-potential data, corroborate the hypothesis that the bradyseismic events in the CF area may be explained by hot fluids vertical advection and subsequent lateral diffusion within a trapped reservoir overlying a magma chamber.

A probability tomography approach to the analysis of potential field data in the Campi Flegrei caldera (Italy

Directory of Open Access Journals (Sweden)

D. Patella

2001-06-01

Full Text Available The results of the application of the 3D probability tomography imaging approach to the study of the Campi Flegrei (CF caldera are presented and discussed. The tomography approach has been applied to gravity, magnetic and ground deformation data already available in literature. The analysis of the 3D tomographic images is preceded by a brief qualitative interpretation of the original survey maps and by an outline of the probability tomography approach for each geophysical prospecting method. The results derived from the 3D tomographic images are the high occurrence probabilities of both gravity and ground deformation source centres in the CF caldera under the town of Pozzuoli. A Bouguer negative anomaly source centre is highlighted in the depth range 1.6-2 km b.s.l., whereas a positive ground deformation point source, responsible for the bradyseismic crisis of 1982-1984, is estimated at a mean depth of 3-4 km b.s.l. These inferences, combined with the results of a previous analysis of magnetotelluric, dipolar geoelectrical and self-potential data, corroborate the hypothesis that the bradyseismic events in the CF area may be explained by hot fluids vertical advection and subsequent lateral diffusion within a trapped reservoir overlying a magma chamber.

Elements of a function analytic approach to probability.

Energy Technology Data Exchange (ETDEWEB)

Ghanem, Roger Georges (University of Southern California, Los Angeles, CA); Red-Horse, John Robert

2008-02-01

We first provide a detailed motivation for using probability theory as a mathematical context in which to analyze engineering and scientific systems that possess uncertainties. We then present introductory notes on the function analytic approach to probabilistic analysis, emphasizing the connections to various classical deterministic mathematical analysis elements. Lastly, we describe how to use the approach as a means to augment deterministic analysis methods in a particular Hilbert space context, and thus enable a rigorous framework for commingling deterministic and probabilistic analysis tools in an application setting.

Analysis of femtosecond pump-probe photoelectron-photoion coincidence measurements applying Bayesian probability theory

Science.gov (United States)

Rumetshofer, M.; Heim, P.; Thaler, B.; Ernst, W. E.; Koch, M.; von der Linden, W.

2018-06-01

Ultrafast dynamical processes in photoexcited molecules can be observed with pump-probe measurements, in which information about the dynamics is obtained from the transient signal associated with the excited state. Background signals provoked by pump and/or probe pulses alone often obscure these excited-state signals. Simple subtraction of pump-only and/or probe-only measurements from the pump-probe measurement, as commonly applied, results in a degradation of the signal-to-noise ratio and, in the case of coincidence detection, the danger of overrated background subtraction. Coincidence measurements additionally suffer from false coincidences, requiring long data-acquisition times to keep erroneous signals at an acceptable level. Here we present a probabilistic approach based on Bayesian probability theory that overcomes these problems. For a pump-probe experiment with photoelectron-photoion coincidence detection, we reconstruct the interesting excited-state spectrum from pump-probe and pump-only measurements. This approach allows us to treat background and false coincidences consistently and on the same footing. We demonstrate that the Bayesian formalism has the following advantages over simple signal subtraction: (i) the signal-to-noise ratio is significantly increased, (ii) the pump-only contribution is not overestimated, (iii) false coincidences are excluded, (iv) prior knowledge, such as positivity, is consistently incorporated, (v) confidence intervals are provided for the reconstructed spectrum, and (vi) it is applicable to any experimental situation and noise statistics. Most importantly, by accounting for false coincidences, the Bayesian approach allows us to run experiments at higher ionization rates, resulting in a significant reduction of data acquisition times. The probabilistic approach is thoroughly scrutinized by challenging mock data. The application to pump-probe coincidence measurements on acetone molecules enables quantitative interpretations

Failure probability under parameter uncertainty.

Science.gov (United States)

Gerrard, R; Tsanakas, A

2011-05-01

In many problems of risk analysis, failure is equivalent to the event of a random risk factor exceeding a given threshold. Failure probabilities can be controlled if a decisionmaker is able to set the threshold at an appropriate level. This abstract situation applies, for example, to environmental risks with infrastructure controls; to supply chain risks with inventory controls; and to insurance solvency risks with capital controls. However, uncertainty around the distribution of the risk factor implies that parameter error will be present and the measures taken to control failure probabilities may not be effective. We show that parameter uncertainty increases the probability (understood as expected frequency) of failures. For a large class of loss distributions, arising from increasing transformations of location-scale families (including the log-normal, Weibull, and Pareto distributions), the article shows that failure probabilities can be exactly calculated, as they are independent of the true (but unknown) parameters. Hence it is possible to obtain an explicit measure of the effect of parameter uncertainty on failure probability. Failure probability can be controlled in two different ways: (1) by reducing the nominal required failure probability, depending on the size of the available data set, and (2) by modifying of the distribution itself that is used to calculate the risk control. Approach (1) corresponds to a frequentist/regulatory view of probability, while approach (2) is consistent with a Bayesian/personalistic view. We furthermore show that the two approaches are consistent in achieving the required failure probability. Finally, we briefly discuss the effects of data pooling and its systemic risk implications. © 2010 Society for Risk Analysis.

Dropping Probability Reduction in OBS Networks: A Simple Approach

KAUST Repository

Elrasad, Amr

2016-08-01

In this paper, we propose and derive a slotted-time model for analyzing the burst blocking probability in Optical Burst Switched (OBS) networks. We evaluated the immediate and delayed signaling reservation schemes. The proposed model compares the performance of both just-in-time (JIT) and just-enough-time (JET) signaling protocols associated with of void/non-void filling link scheduling schemes. It also considers none and limited range wavelength conversions scenarios. Our model is distinguished by being adaptable to different offset-time and burst length distributions. We observed that applying a limited range of wavelength conversion, burst blocking probability is reduced by several orders of magnitudes and yields a better burst delivery ratio compared with full wavelength conversion.

Improving information extraction using a probability-based approach

DEFF Research Database (Denmark)

Kim, S.; Ahmed, Saeema; Wallace, K.

2007-01-01

Information plays a crucial role during the entire life-cycle of a product. It has been shown that engineers frequently consult colleagues to obtain the information they require to solve problems. However, the industrial world is now more transient and key personnel move to other companies...... or retire. It is becoming essential to retrieve vital information from archived product documents, if it is available. There is, therefore, great interest in ways of extracting relevant and sharable information from documents. A keyword-based search is commonly used, but studies have shown...... the recall, while maintaining the high precision, a learning approach that makes identification decisions based on a probability model, rather than simply looking up the presence of the pre-defined variations, looks promising. This paper presents the results of developing such a probability-based entity...

Scaling Qualitative Probability

OpenAIRE

Burgin, Mark

2017-01-01

There are different approaches to qualitative probability, which includes subjective probability. We developed a representation of qualitative probability based on relational systems, which allows modeling uncertainty by probability structures and is more coherent than existing approaches. This setting makes it possible proving that any comparative probability is induced by some probability structure (Theorem 2.1), that classical probability is a probability structure (Theorem 2.2) and that i...

Quantum probability measures and tomographic probability densities

NARCIS (Netherlands)

Amosov, GG; Man'ko, [No Value

2004-01-01

Using a simple relation of the Dirac delta-function to generalized the theta-function, the relationship between the tomographic probability approach and the quantum probability measure approach with the description of quantum states is discussed. The quantum state tomogram expressed in terms of the

Probability approaching method (PAM) and its application on fuel management optimization

International Nuclear Information System (INIS)

Liu, Z.; Hu, Y.; Shi, G.

2004-01-01

For multi-cycle reloading optimization problem, a new solving scheme is presented. The multi-cycle problem is de-coupled into a number of relatively independent mono-cycle issues, then this non-linear programming problem with complex constraints is solved by an advanced new algorithm -probability approaching method (PAM), which is based on probability theory. The result on simplified core model shows well effect of this new multi-cycle optimization scheme. (authors)

Probable Inference and Quantum Mechanics

International Nuclear Information System (INIS)

Grandy, W. T. Jr.

2009-01-01

In its current very successful interpretation the quantum theory is fundamentally statistical in nature. Although commonly viewed as a probability amplitude whose (complex) square is a probability, the wavefunction or state vector continues to defy consensus as to its exact meaning, primarily because it is not a physical observable. Rather than approach this problem directly, it is suggested that it is first necessary to clarify the precise role of probability theory in quantum mechanics, either as applied to, or as an intrinsic part of the quantum theory. When all is said and done the unsurprising conclusion is that quantum mechanics does not constitute a logic and probability unto itself, but adheres to the long-established rules of classical probability theory while providing a means within itself for calculating the relevant probabilities. In addition, the wavefunction is seen to be a description of the quantum state assigned by an observer based on definite information, such that the same state must be assigned by any other observer based on the same information, in much the same way that probabilities are assigned.

Introduction to probability and stochastic processes with applications

CERN Document Server

Castañ, Blanco; Arunachalam, Viswanathan; Dharmaraja, Selvamuthu

2012-01-01

An easily accessible, real-world approach to probability and stochastic processes Introduction to Probability and Stochastic Processes with Applications presents a clear, easy-to-understand treatment of probability and stochastic processes, providing readers with a solid foundation they can build upon throughout their careers. With an emphasis on applications in engineering, applied sciences, business and finance, statistics, mathematics, and operations research, the book features numerous real-world examples that illustrate how random phenomena occur in nature and how to use probabilistic t

Long-Term Fatigue and Its Probability of Failure Applied to Dental Implants

Directory of Open Access Journals (Sweden)

María Prados-Privado

2016-01-01

Full Text Available It is well known that dental implants have a high success rate but even so, there are a lot of factors that can cause dental implants failure. Fatigue is very sensitive to many variables involved in this phenomenon. This paper takes a close look at fatigue analysis and explains a new method to study fatigue from a probabilistic point of view, based on a cumulative damage model and probabilistic finite elements, with the goal of obtaining the expected life and the probability of failure. Two different dental implants were analysed. The model simulated a load of 178 N applied with an angle of 0°, 15°, and 20° and a force of 489 N with the same angles. Von Mises stress distribution was evaluated and once the methodology proposed here was used, the statistic of the fatigue life and the probability cumulative function were obtained. This function allows us to relate each cycle life with its probability of failure. Cylindrical implant has a worst behaviour under the same loading force compared to the conical implant analysed here. Methodology employed in the present study provides very accuracy results because all possible uncertainties have been taken in mind from the beginning.

Stochastic Analysis and Applied Probability(3.3.1): Topics in the Theory and Applications of Stochastic Analysis

Science.gov (United States)

2015-08-13

Critical Catalyst Reactant Branching Processes with Controlled Immigration , Annals of Applied Probability (03 2012) Amarjit Budhiraja, Rami Atar ...Markus Fischer. Large Deviation Properties of Weakly Interacting Processes via Weak Convergence Methods, Annals of Probability (10 2010) Rami Atar ...Dimensional Forward-Backward Stochastic Differen- tial Equations and the KPZ Equation Electron. J. Probab., 19 (2014), no. 40, 121. [2] R. Atar and A

An extended risk assessment approach for chemical plants applied to a study related to pipe ruptures

International Nuclear Information System (INIS)

Milazzo, Maria Francesca; Aven, Terje

2012-01-01

Risk assessments and Quantitative Risk Assessment (QRA) in particular have been used in the chemical industry for many years to support decision-making on the choice of arrangements and measures associated with chemical processes, transportation and storage of dangerous substances. The assessments have been founded on a risk perspective seeing risk as a function of frequency of events (probability) and associated consequences. In this paper we point to the need for extending this approach to place a stronger emphasis on uncertainties. A recently developed risk framework designed to better reflect such uncertainties is presented and applied to a chemical plant and specifically the analysis of accidental events related to the rupture of pipes. Two different ways of implementing the framework are presented, one based on the introduction of probability models and one without. The differences between the standard approach and the extended approaches are discussed from a theoretical point of view as well as from a practical risk analyst perspective.

Non-Archimedean Probability

NARCIS (Netherlands)

Benci, Vieri; Horsten, Leon; Wenmackers, Sylvia

We propose an alternative approach to probability theory closely related to the framework of numerosity theory: non-Archimedean probability (NAP). In our approach, unlike in classical probability theory, all subsets of an infinite sample space are measurable and only the empty set gets assigned

Collective fluctuations in magnetized plasma: Transition probability approach

International Nuclear Information System (INIS)

Sosenko, P.P.

1997-01-01

Statistical plasma electrodynamics is elaborated with special emphasis on the transition probability approach and quasi-particles, and on modern applications to magnetized plasmas. Fluctuation spectra in the magnetized plasma are calculated in the range of low frequencies (with respect to the cyclotron one), and the conditions for the transition from incoherent to collective fluctuations are established. The role of finite-Larmor-radius effects and particle polarization drift in such a transition is explained. The ion collective features in fluctuation spectra are studied. 63 refs., 30 figs

COVAL, Compound Probability Distribution for Function of Probability Distribution

International Nuclear Information System (INIS)

Astolfi, M.; Elbaz, J.

1979-01-01

1 - Nature of the physical problem solved: Computation of the probability distribution of a function of variables, given the probability distribution of the variables themselves. 'COVAL' has been applied to reliability analysis of a structure subject to random loads. 2 - Method of solution: Numerical transformation of probability distributions

Re-assessment of road accident data-analysis policy : applying theory from involuntary, high-consequence, low-probability events like nuclear power plant meltdowns to voluntary, low-consequence, high-probability events like traffic accidents

Science.gov (United States)

2002-02-01

This report examines the literature on involuntary, high-consequence, low-probability (IHL) events like nuclear power plant meltdowns to determine what can be applied to the problem of voluntary, low-consequence high-probability (VLH) events like tra...

Triangulation based inclusion probabilities: a design-unbiased sampling approach

OpenAIRE

Fehrmann, Lutz; Gregoire, Timothy; Kleinn, Christoph

2011-01-01

A probabilistic sampling approach for design-unbiased estimation of area-related quantitative characteristics of spatially dispersed population units is proposed. The developed field protocol includes a fixed number of 3 units per sampling location and is based on partial triangulations over their natural neighbors to derive the individual inclusion probabilities. The performance of the proposed design is tested in comparison to fixed area sample plots in a simulation with two forest stands. ...

On the Possibility of Assigning Probabilities to Singular Cases, or: Probability Is Subjective Too!

Directory of Open Access Journals (Sweden)

Mark R. Crovelli

2009-06-01

Full Text Available Both Ludwig von Mises and Richard von Mises claimed that numerical probability could not be legitimately applied to singular cases. This paper challenges this aspect of the von Mises brothers’ theory of probability. It is argued that their denial that numerical probability could be applied to singular cases was based solely upon Richard von Mises’ exceptionally restrictive definition of probability. This paper challenges Richard von Mises’ definition of probability by arguing that the definition of probability necessarily depends upon whether the world is governed by time-invariant causal laws. It is argued that if the world is governed by time-invariant causal laws, a subjective definition of probability must be adopted. It is further argued that both the nature of human action and the relative frequency method for calculating numerical probabilities both presuppose that the world is indeed governed by time-invariant causal laws. It is finally argued that the subjective definition of probability undercuts the von Mises claim that numerical probability cannot legitimately be applied to singular, non-replicable cases.

A hydroclimatological approach to predicting regional landslide probability using Landlab

Directory of Open Access Journals (Sweden)

R. Strauch

2018-02-01

Full Text Available We develop a hydroclimatological approach to the modeling of regional shallow landslide initiation that integrates spatial and temporal dimensions of parameter uncertainty to estimate an annual probability of landslide initiation based on Monte Carlo simulations. The physically based model couples the infinite-slope stability model with a steady-state subsurface flow representation and operates in a digital elevation model. Spatially distributed gridded data for soil properties and vegetation classification are used for parameter estimation of probability distributions that characterize model input uncertainty. Hydrologic forcing to the model is through annual maximum daily recharge to subsurface flow obtained from a macroscale hydrologic model. We demonstrate the model in a steep mountainous region in northern Washington, USA, over 2700 km2. The influence of soil depth on the probability of landslide initiation is investigated through comparisons among model output produced using three different soil depth scenarios reflecting the uncertainty of soil depth and its potential long-term variability. We found elevation-dependent patterns in probability of landslide initiation that showed the stabilizing effects of forests at low elevations, an increased landslide probability with forest decline at mid-elevations (1400 to 2400 m, and soil limitation and steep topographic controls at high alpine elevations and in post-glacial landscapes. These dominant controls manifest themselves in a bimodal distribution of spatial annual landslide probability. Model testing with limited observations revealed similarly moderate model confidence for the three hazard maps, suggesting suitable use as relative hazard products. The model is available as a component in Landlab, an open-source, Python-based landscape earth systems modeling environment, and is designed to be easily reproduced utilizing HydroShare cyberinfrastructure.

A hydroclimatological approach to predicting regional landslide probability using Landlab

Science.gov (United States)

Strauch, Ronda; Istanbulluoglu, Erkan; Nudurupati, Sai Siddhartha; Bandaragoda, Christina; Gasparini, Nicole M.; Tucker, Gregory E.

2018-02-01

We develop a hydroclimatological approach to the modeling of regional shallow landslide initiation that integrates spatial and temporal dimensions of parameter uncertainty to estimate an annual probability of landslide initiation based on Monte Carlo simulations. The physically based model couples the infinite-slope stability model with a steady-state subsurface flow representation and operates in a digital elevation model. Spatially distributed gridded data for soil properties and vegetation classification are used for parameter estimation of probability distributions that characterize model input uncertainty. Hydrologic forcing to the model is through annual maximum daily recharge to subsurface flow obtained from a macroscale hydrologic model. We demonstrate the model in a steep mountainous region in northern Washington, USA, over 2700 km2. The influence of soil depth on the probability of landslide initiation is investigated through comparisons among model output produced using three different soil depth scenarios reflecting the uncertainty of soil depth and its potential long-term variability. We found elevation-dependent patterns in probability of landslide initiation that showed the stabilizing effects of forests at low elevations, an increased landslide probability with forest decline at mid-elevations (1400 to 2400 m), and soil limitation and steep topographic controls at high alpine elevations and in post-glacial landscapes. These dominant controls manifest themselves in a bimodal distribution of spatial annual landslide probability. Model testing with limited observations revealed similarly moderate model confidence for the three hazard maps, suggesting suitable use as relative hazard products. The model is available as a component in Landlab, an open-source, Python-based landscape earth systems modeling environment, and is designed to be easily reproduced utilizing HydroShare cyberinfrastructure.

An operational-oriented approach to the assessment of low probability seismic ground motions for critical infrastructures

Science.gov (United States)

Garcia-Fernandez, Mariano; Assatourians, Karen; Jimenez, Maria-Jose

2018-01-01

Extreme natural hazard events have the potential to cause significant disruption to critical infrastructure (CI) networks. Among them, earthquakes represent a major threat as sudden-onset events with limited, if any, capability of forecast, and high damage potential. In recent years, the increased exposure of interdependent systems has heightened concern, motivating the need for a framework for the management of these increased hazards. The seismic performance level and resilience of existing non-nuclear CIs can be analyzed by identifying the ground motion input values leading to failure of selected key elements. Main interest focuses on the ground motions exceeding the original design values, which should correspond to low probability occurrence. A seismic hazard methodology has been specifically developed to consider low-probability ground motions affecting elongated CI networks. The approach is based on Monte Carlo simulation, which allows for building long-duration synthetic earthquake catalogs to derive low-probability amplitudes. This approach does not affect the mean hazard values and allows obtaining a representation of maximum amplitudes that follow a general extreme-value distribution. This facilitates the analysis of the occurrence of extremes, i.e., very low probability of exceedance from unlikely combinations, for the development of, e.g., stress tests, among other applications. Following this methodology, extreme ground-motion scenarios have been developed for selected combinations of modeling inputs including seismic activity models (source model and magnitude-recurrence relationship), ground motion prediction equations (GMPE), hazard levels, and fractiles of extreme ground motion. The different results provide an overview of the effects of different hazard modeling inputs on the generated extreme motion hazard scenarios. This approach to seismic hazard is at the core of the risk analysis procedure developed and applied to European CI transport

Maximization of regional probabilities using Optimal Surface Graphs

DEFF Research Database (Denmark)

Arias Lorza, Andres M.; Van Engelen, Arna; Petersen, Jens

2018-01-01

Purpose: We present a segmentation method that maximizes regional probabilities enclosed by coupled surfaces using an Optimal Surface Graph (OSG) cut approach. This OSG cut determines the globally optimal solution given a graph constructed around an initial surface. While most methods for vessel...... wall segmentation only use edge information, we show that maximizing regional probabilities using an OSG improves the segmentation results. We applied this to automatically segment the vessel wall of the carotid artery in magnetic resonance images. Methods: First, voxel-wise regional probability maps...... were obtained using a Support Vector Machine classifier trained on local image features. Then, the OSG segments the regions which maximizes the regional probabilities considering smoothness and topological constraints. Results: The method was evaluated on 49 carotid arteries from 30 subjects...

Identifying functional reorganization of spelling networks: an individual peak probability comparison approach

Science.gov (United States)

Purcell, Jeremy J.; Rapp, Brenda

2013-01-01

Previous research has shown that damage to the neural substrates of orthographic processing can lead to functional reorganization during reading (Tsapkini et al., 2011); in this research we ask if the same is true for spelling. To examine the functional reorganization of spelling networks we present a novel three-stage Individual Peak Probability Comparison (IPPC) analysis approach for comparing the activation patterns obtained during fMRI of spelling in a single brain-damaged individual with dysgraphia to those obtained in a set of non-impaired control participants. The first analysis stage characterizes the convergence in activations across non-impaired control participants by applying a technique typically used for characterizing activations across studies: Activation Likelihood Estimate (ALE) (Turkeltaub et al., 2002). This method was used to identify locations that have a high likelihood of yielding activation peaks in the non-impaired participants. The second stage provides a characterization of the degree to which the brain-damaged individual's activations correspond to the group pattern identified in Stage 1. This involves performing a Mahalanobis distance statistics analysis (Tsapkini et al., 2011) that compares each of a control group's peak activation locations to the nearest peak generated by the brain-damaged individual. The third stage evaluates the extent to which the brain-damaged individual's peaks are atypical relative to the range of individual variation among the control participants. This IPPC analysis allows for a quantifiable, statistically sound method for comparing an individual's activation pattern to the patterns observed in a control group and, thus, provides a valuable tool for identifying functional reorganization in a brain-damaged individual with impaired spelling. Furthermore, this approach can be applied more generally to compare any individual's activation pattern with that of a set of other individuals. PMID:24399981

Critical Applied Linguistics: An Evaluative Interdisciplinary Approach in Criticism and Evaluation of Applied Linguistics’ Disciplines

Directory of Open Access Journals (Sweden)

H. Davari

2015-11-01

Full Text Available The emergence of some significant critical approaches and directions in the field of applied linguistics from the mid-1980s onwards has met with various positive and opposite reactions. On the basis of their strength and significance, such approaches and directions have challenged some of the mainstream approaches’ claims, principles and assumptions. Among them, critical applied linguistics can be highlighted as a new approach, developed by the Australian applied linguist, Alastair Pennycook. The aspects, domains and concerns of this new approach were introduced in his book in 2001. Due to the undeniable importance of this approach, as well as partial negligence regarding it in Iranian academic setting, this paper first intends to introduce this approach, as an approach that evaluates various disciplines of applied linguistics through its own specific principles and interests. Then, in order to show its step-by-step application in the evaluation of different disciplines of applied linguistics, with a glance at its significance and appropriateness in Iranian society, two domains, namely English language education and language policy and planning, are introduced and evaluated in order to provide readers with a visible and practical picture of its interdisciplinary nature and evaluative functions. The findings indicate the efficacy of applying this interdisciplinary framework in any language-in-education policy and planning in accordance with the political, social and cultural context of the target society.

Modeling Stochastic Complexity in Complex Adaptive Systems: Non-Kolmogorov Probability and the Process Algebra Approach.

Science.gov (United States)

Sulis, William H

2017-10-01

Walter Freeman III pioneered the application of nonlinear dynamical systems theories and methodologies in his work on mesoscopic brain dynamics.Sadly, mainstream psychology and psychiatry still cling to linear correlation based data analysis techniques, which threaten to subvert the process of experimentation and theory building. In order to progress, it is necessary to develop tools capable of managing the stochastic complexity of complex biopsychosocial systems, which includes multilevel feedback relationships, nonlinear interactions, chaotic dynamics and adaptability. In addition, however, these systems exhibit intrinsic randomness, non-Gaussian probability distributions, non-stationarity, contextuality, and non-Kolmogorov probabilities, as well as the absence of mean and/or variance and conditional probabilities. These properties and their implications for statistical analysis are discussed. An alternative approach, the Process Algebra approach, is described. It is a generative model, capable of generating non-Kolmogorov probabilities. It has proven useful in addressing fundamental problems in quantum mechanics and in the modeling of developing psychosocial systems.

Critical Applied Linguistics: An Evaluative Interdisciplinary Approach in Criticism and Evaluation of Applied Linguistics’ Disciplines

OpenAIRE

H. Davari

2015-01-01

The emergence of some significant critical approaches and directions in the field of applied linguistics from the mid-1980s onwards has met with various positive and opposite reactions. On the basis of their strength and significance, such approaches and directions have challenged some of the mainstream approaches’ claims, principles and assumptions. Among them, critical applied linguistics can be highlighted as a new approach, developed by the Australian applied linguist, Alastair Pennycook....

Use of an influence diagram and fuzzy probability for evaluating accident management in a BWR

International Nuclear Information System (INIS)

Yu, Donghan; Okrent, D.; Kastenberg, W.E.

1993-01-01

This paper develops a new approach for evaluating severe accident management strategies. At first, this approach considers accident management as a decision problem (i.e., ''applying a strategy'' vs. ''do nothing'') and uses influence diagrams. This approach introduces the concept of a ''fuzzy probability'' in the evaluation of an influence diagram. When fuzzy logic is applied, fuzzy probabilities in an influence diagram can be easily propagated to obtain results. In addition, the results obtained provide not only information similar to the classical approach using point-estimate values, but also additional information regarding the impact from imprecise input data. The proposed methodology is applied to the evaluation of the drywell flooding strategy for a long-term station blackout sequence in the Peach Bottom nuclear power plant. The results show that the drywell flooding strategy seems to be beneficial for preventing reactor vessel breach. It is also effective for reducing the probability of the containment failure for both liner melt-through and late overpressurization. Even though there exists uncertainty in the results, ''flooding'' is preferred to ''do nothing'' when evaluated in terms of expected consequences, i.e., early and late fatalities

Incorporation of various uncertainties in dependent failure-probability estimation

International Nuclear Information System (INIS)

Samanta, P.K.; Mitra, S.P.

1982-01-01

This paper describes an approach that allows the incorporation of various types of uncertainties in the estimation of dependent failure (common mode failure) probability. The types of uncertainties considered are attributable to data, modeling and coupling. The method developed is applied to a class of dependent failures, i.e., multiple human failures during testing, maintenance and calibration. Estimation of these failures is critical as they have been shown to be significant contributors to core melt probability in pressurized water reactors

Probability Machines: Consistent Probability Estimation Using Nonparametric Learning Machines

Science.gov (United States)

Malley, J. D.; Kruppa, J.; Dasgupta, A.; Malley, K. G.; Ziegler, A.

2011-01-01

Summary Background Most machine learning approaches only provide a classification for binary responses. However, probabilities are required for risk estimation using individual patient characteristics. It has been shown recently that every statistical learning machine known to be consistent for a nonparametric regression problem is a probability machine that is provably consistent for this estimation problem. Objectives The aim of this paper is to show how random forests and nearest neighbors can be used for consistent estimation of individual probabilities. Methods Two random forest algorithms and two nearest neighbor algorithms are described in detail for estimation of individual probabilities. We discuss the consistency of random forests, nearest neighbors and other learning machines in detail. We conduct a simulation study to illustrate the validity of the methods. We exemplify the algorithms by analyzing two well-known data sets on the diagnosis of appendicitis and the diagnosis of diabetes in Pima Indians. Results Simulations demonstrate the validity of the method. With the real data application, we show the accuracy and practicality of this approach. We provide sample code from R packages in which the probability estimation is already available. This means that all calculations can be performed using existing software. Conclusions Random forest algorithms as well as nearest neighbor approaches are valid machine learning methods for estimating individual probabilities for binary responses. Freely available implementations are available in R and may be used for applications. PMID:21915433

Estimating Probability of Default on Peer to Peer Market – Survival Analysis Approach

Directory of Open Access Journals (Sweden)

Đurović Andrija

2017-05-01

Full Text Available Arguably a cornerstone of credit risk modelling is the probability of default. This article aims is to search for the evidence of relationship between loan characteristics and probability of default on peer-to-peer (P2P market. In line with that, two loan characteristics are analysed: 1 loan term length and 2 loan purpose. The analysis is conducted using survival analysis approach within the vintage framework. Firstly, 12 months probability of default through the cycle is used to compare riskiness of analysed loan characteristics. Secondly, log-rank test is employed in order to compare complete survival period of cohorts. Findings of the paper suggest that there is clear evidence of relationship between analysed loan characteristics and probability of default. Longer term loans are more risky than the shorter term ones and the least risky loans are those used for credit card payoff.

Toward a generalized probability theory: conditional probabilities

International Nuclear Information System (INIS)

Cassinelli, G.

1979-01-01

The main mathematical object of interest in the quantum logic approach to the foundations of quantum mechanics is the orthomodular lattice and a set of probability measures, or states, defined by the lattice. This mathematical structure is studied per se, independently from the intuitive or physical motivation of its definition, as a generalized probability theory. It is thought that the building-up of such a probability theory could eventually throw light on the mathematical structure of Hilbert-space quantum mechanics as a particular concrete model of the generalized theory. (Auth.)

Pipe failure probability - the Thomas paper revisited

International Nuclear Information System (INIS)

Lydell, B.O.Y.

2000-01-01

Almost twenty years ago, in Volume 2 of Reliability Engineering (the predecessor of Reliability Engineering and System Safety), a paper by H. M. Thomas of Rolls Royce and Associates Ltd. presented a generalized approach to the estimation of piping and vessel failure probability. The 'Thomas-approach' used insights from actual failure statistics to calculate the probability of leakage and conditional probability of rupture given leakage. It was intended for practitioners without access to data on the service experience with piping and piping system components. This article revisits the Thomas paper by drawing on insights from development of a new database on piping failures in commercial nuclear power plants worldwide (SKI-PIPE). Partially sponsored by the Swedish Nuclear Power Inspectorate (SKI), the R and D leading up to this note was performed during 1994-1999. Motivated by data requirements of reliability analysis and probabilistic safety assessment (PSA), the new database supports statistical analysis of piping failure data. Against the background of this database development program, the article reviews the applicability of the 'Thomas approach' in applied risk and reliability analysis. It addresses the question whether a new and expanded database on the service experience with piping systems would alter the original piping reliability correlation as suggested by H. M. Thomas

Promoting Active Learning When Teaching Introductory Statistics and Probability Using a Portfolio Curriculum Approach

Science.gov (United States)

Adair, Desmond; Jaeger, Martin; Price, Owen M.

2018-01-01

The use of a portfolio curriculum approach, when teaching a university introductory statistics and probability course to engineering students, is developed and evaluated. The portfolio curriculum approach, so called, as the students need to keep extensive records both as hard copies and digitally of reading materials, interactions with faculty,…

Quantum Probabilities as Behavioral Probabilities

Directory of Open Access Journals (Sweden)

Vyacheslav I. Yukalov

2017-03-01

Full Text Available We demonstrate that behavioral probabilities of human decision makers share many common features with quantum probabilities. This does not imply that humans are some quantum objects, but just shows that the mathematics of quantum theory is applicable to the description of human decision making. The applicability of quantum rules for describing decision making is connected with the nontrivial process of making decisions in the case of composite prospects under uncertainty. Such a process involves deliberations of a decision maker when making a choice. In addition to the evaluation of the utilities of considered prospects, real decision makers also appreciate their respective attractiveness. Therefore, human choice is not based solely on the utility of prospects, but includes the necessity of resolving the utility-attraction duality. In order to justify that human consciousness really functions similarly to the rules of quantum theory, we develop an approach defining human behavioral probabilities as the probabilities determined by quantum rules. We show that quantum behavioral probabilities of humans do not merely explain qualitatively how human decisions are made, but they predict quantitative values of the behavioral probabilities. Analyzing a large set of empirical data, we find good quantitative agreement between theoretical predictions and observed experimental data.

An analytic approach to probability tables for the unresolved resonance region

Science.gov (United States)

Brown, David; Kawano, Toshihiko

2017-09-01

The Unresolved Resonance Region (URR) connects the fast neutron region with the Resolved Resonance Region (RRR). The URR is problematic since resonances are not resolvable experimentally yet the fluctuations in the neutron cross sections play a discernible and technologically important role: the URR in a typical nucleus is in the 100 keV - 2 MeV window where the typical fission spectrum peaks. The URR also represents the transition between R-matrix theory used to described isolated resonances and Hauser-Feshbach theory which accurately describes the average cross sections. In practice, only average or systematic features of the resonances in the URR are known and are tabulated in evaluations in a nuclear data library such as ENDF/B-VII.1. Codes such as AMPX and NJOY can compute the probability distribution of the cross section in the URR under some assumptions using Monte Carlo realizations of sets of resonances. These probability distributions are stored in the so-called PURR tables. In our work, we begin to develop a scheme for computing the covariance of the cross section probability distribution analytically. Our approach offers the possibility of defining the limits of applicability of Hauser-Feshbach theory and suggests a way to calculate PURR tables directly from systematics for nuclei whose RRR is unknown, provided one makes appropriate assumptions about the shape of the cross section probability distribution.

Continuation of probability density functions using a generalized Lyapunov approach

Energy Technology Data Exchange (ETDEWEB)

Baars, S., E-mail: s.baars@rug.nl [Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen, P.O. Box 407, 9700 AK Groningen (Netherlands); Viebahn, J.P., E-mail: viebahn@cwi.nl [Centrum Wiskunde & Informatica (CWI), P.O. Box 94079, 1090 GB, Amsterdam (Netherlands); Mulder, T.E., E-mail: t.e.mulder@uu.nl [Institute for Marine and Atmospheric research Utrecht, Department of Physics and Astronomy, Utrecht University, Princetonplein 5, 3584 CC Utrecht (Netherlands); Kuehn, C., E-mail: ckuehn@ma.tum.de [Technical University of Munich, Faculty of Mathematics, Boltzmannstr. 3, 85748 Garching bei München (Germany); Wubs, F.W., E-mail: f.w.wubs@rug.nl [Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen, P.O. Box 407, 9700 AK Groningen (Netherlands); Dijkstra, H.A., E-mail: h.a.dijkstra@uu.nl [Institute for Marine and Atmospheric research Utrecht, Department of Physics and Astronomy, Utrecht University, Princetonplein 5, 3584 CC Utrecht (Netherlands); School of Chemical and Biomolecular Engineering, Cornell University, Ithaca, NY (United States)

2017-05-01

Techniques from numerical bifurcation theory are very useful to study transitions between steady fluid flow patterns and the instabilities involved. Here, we provide computational methodology to use parameter continuation in determining probability density functions of systems of stochastic partial differential equations near fixed points, under a small noise approximation. Key innovation is the efficient solution of a generalized Lyapunov equation using an iterative method involving low-rank approximations. We apply and illustrate the capabilities of the method using a problem in physical oceanography, i.e. the occurrence of multiple steady states of the Atlantic Ocean circulation.

Forecasting the Stock Market with Linguistic Rules Generated from the Minimize Entropy Principle and the Cumulative Probability Distribution Approaches

Directory of Open Access Journals (Sweden)

Chung-Ho Su

2010-12-01

Full Text Available To forecast a complex and non-linear system, such as a stock market, advanced artificial intelligence algorithms, like neural networks (NNs and genetic algorithms (GAs have been proposed as new approaches. However, for the average stock investor, two major disadvantages are argued against these advanced algorithms: (1 the rules generated by NNs and GAs are difficult to apply in investment decisions; and (2 the time complexity of the algorithms to produce forecasting outcomes is very high. Therefore, to provide understandable rules for investors and to reduce the time complexity of forecasting algorithms, this paper proposes a novel model for the forecasting process, which combines two granulating methods (the minimize entropy principle approach and the cumulative probability distribution approach and a rough set algorithm. The model verification demonstrates that the proposed model surpasses the three listed conventional fuzzy time-series models and a multiple regression model (MLR in forecast accuracy.

Sensitivity analysis approaches applied to systems biology models.

Science.gov (United States)

Zi, Z

2011-11-01

With the rising application of systems biology, sensitivity analysis methods have been widely applied to study the biological systems, including metabolic networks, signalling pathways and genetic circuits. Sensitivity analysis can provide valuable insights about how robust the biological responses are with respect to the changes of biological parameters and which model inputs are the key factors that affect the model outputs. In addition, sensitivity analysis is valuable for guiding experimental analysis, model reduction and parameter estimation. Local and global sensitivity analysis approaches are the two types of sensitivity analysis that are commonly applied in systems biology. Local sensitivity analysis is a classic method that studies the impact of small perturbations on the model outputs. On the other hand, global sensitivity analysis approaches have been applied to understand how the model outputs are affected by large variations of the model input parameters. In this review, the author introduces the basic concepts of sensitivity analysis approaches applied to systems biology models. Moreover, the author discusses the advantages and disadvantages of different sensitivity analysis methods, how to choose a proper sensitivity analysis approach, the available sensitivity analysis tools for systems biology models and the caveats in the interpretation of sensitivity analysis results.

Teaching Probability to Pre-Service Teachers with Argumentation Based Science Learning Approach

Science.gov (United States)

Can, Ömer Sinan; Isleyen, Tevfik

2016-01-01

The aim of this study is to explore the effects of the argumentation based science learning (ABSL) approach on the teaching probability to pre-service teachers. The sample of the study included 41 students studying at the Department of Elementary School Mathematics Education in a public university during the 2014-2015 academic years. The study is…

An analytic approach to probability tables for the unresolved resonance region

Directory of Open Access Journals (Sweden)

Brown David

2017-01-01

Full Text Available The Unresolved Resonance Region (URR connects the fast neutron region with the Resolved Resonance Region (RRR. The URR is problematic since resonances are not resolvable experimentally yet the fluctuations in the neutron cross sections play a discernible and technologically important role: the URR in a typical nucleus is in the 100 keV – 2 MeV window where the typical fission spectrum peaks. The URR also represents the transition between R-matrix theory used to described isolated resonances and Hauser-Feshbach theory which accurately describes the average cross sections. In practice, only average or systematic features of the resonances in the URR are known and are tabulated in evaluations in a nuclear data library such as ENDF/B-VII.1. Codes such as AMPX and NJOY can compute the probability distribution of the cross section in the URR under some assumptions using Monte Carlo realizations of sets of resonances. These probability distributions are stored in the so-called PURR tables. In our work, we begin to develop a scheme for computing the covariance of the cross section probability distribution analytically. Our approach offers the possibility of defining the limits of applicability of Hauser-Feshbach theory and suggests a way to calculate PURR tables directly from systematics for nuclei whose RRR is unknown, provided one makes appropriate assumptions about the shape of the cross section probability distribution.

Evaluation of nuclear power plant component failure probability and core damage probability using simplified PSA model

International Nuclear Information System (INIS)

Shimada, Yoshio

2000-01-01

It is anticipated that the change of frequency of surveillance tests, preventive maintenance or parts replacement of safety related components may cause the change of component failure probability and result in the change of core damage probability. It is also anticipated that the change is different depending on the initiating event frequency or the component types. This study assessed the change of core damage probability using simplified PSA model capable of calculating core damage probability in a short time period, which is developed by the US NRC to process accident sequence precursors, when various component's failure probability is changed between 0 and 1, or Japanese or American initiating event frequency data are used. As a result of the analysis, (1) It was clarified that frequency of surveillance test, preventive maintenance or parts replacement of motor driven pumps (high pressure injection pumps, residual heat removal pumps, auxiliary feedwater pumps) should be carefully changed, since the core damage probability's change is large, when the base failure probability changes toward increasing direction. (2) Core damage probability change is insensitive to surveillance test frequency change, since the core damage probability change is small, when motor operated valves and turbine driven auxiliary feed water pump failure probability changes around one figure. (3) Core damage probability change is small, when Japanese failure probability data are applied to emergency diesel generator, even if failure probability changes one figure from the base value. On the other hand, when American failure probability data is applied, core damage probability increase is large, even if failure probability changes toward increasing direction. Therefore, when Japanese failure probability data is applied, core damage probability change is insensitive to surveillance tests frequency change etc. (author)

Improved Membership Probability for Moving Groups: Bayesian and Machine Learning Approaches

Science.gov (United States)

Lee, Jinhee; Song, Inseok

2018-01-01

Gravitationally unbound loose stellar associations (i.e., young nearby moving groups: moving groups hereafter) have been intensively explored because they are important in planet and disk formation studies, exoplanet imaging, and age calibration. Among the many efforts devoted to the search for moving group members, a Bayesian approach (e.g.,using the code BANYAN) has become popular recently because of the many advantages it offers. However, the resultant membership probability needs to be carefully adopted because of its sensitive dependence on input models. In this study, we have developed an improved membership calculation tool focusing on the beta-Pic moving group. We made three improvements for building models used in BANYAN II: (1) updating a list of accepted members by re-assessing memberships in terms of position, motion, and age, (2) investigating member distribution functions in XYZ, and (3) exploring field star distribution functions in XYZUVW. Our improved tool can change membership probability up to 70%. Membership probability is critical and must be better defined. For example, our code identifies only one third of the candidate members in SIMBAD that are believed to be kinematically associated with beta-Pic moving group.Additionally, we performed cluster analysis of young nearby stars using an unsupervised machine learning approach. As more moving groups and their members are identified, the complexity and ambiguity in moving group configuration has been increased. To clarify this issue, we analyzed ~4,000 X-ray bright young stellar candidates. Here, we present the preliminary results. By re-identifying moving groups with the least human intervention, we expect to understand the composition of the solar neighborhood. Moreover better defined moving group membership will help us understand star formation and evolution in relatively low density environments; especially for the low-mass stars which will be identified in the coming Gaia release.

Ruin probabilities

DEFF Research Database (Denmark)

Asmussen, Søren; Albrecher, Hansjörg

The book gives a comprehensive treatment of the classical and modern ruin probability theory. Some of the topics are Lundberg's inequality, the Cramér-Lundberg approximation, exact solutions, other approximations (e.g., for heavy-tailed claim size distributions), finite horizon ruin probabilities......, extensions of the classical compound Poisson model to allow for reserve-dependent premiums, Markov-modulation, periodicity, change of measure techniques, phase-type distributions as a computational vehicle and the connection to other applied probability areas, like queueing theory. In this substantially...... updated and extended second version, new topics include stochastic control, fluctuation theory for Levy processes, Gerber–Shiu functions and dependence....

Estimating the Probability of Traditional Copying, Conditional on Answer-Copying Statistics.

Science.gov (United States)

Allen, Jeff; Ghattas, Andrew

2016-06-01

Statistics for detecting copying on multiple-choice tests produce p values measuring the probability of a value at least as large as that observed, under the null hypothesis of no copying. The posterior probability of copying is arguably more relevant than the p value, but cannot be derived from Bayes' theorem unless the population probability of copying and probability distribution of the answer-copying statistic under copying are known. In this article, the authors develop an estimator for the posterior probability of copying that is based on estimable quantities and can be used with any answer-copying statistic. The performance of the estimator is evaluated via simulation, and the authors demonstrate how to apply the formula using actual data. Potential uses, generalizability to other types of cheating, and limitations of the approach are discussed.

Probability of causation approach

International Nuclear Information System (INIS)

Jose, D.E.

1988-01-01

Probability of causation (PC) is sometimes viewed as a great improvement by those persons who are not happy with the present rulings of courts in radiation cases. The author does not share that hope and expects that PC will not play a significant role in these issues for at least the next decade. If it is ever adopted in a legislative compensation scheme, it will be used in a way that is unlikely to please most scientists. Consequently, PC is a false hope for radiation scientists, and its best contribution may well lie in some of the spin-off effects, such as an influence on medical practice

Probability of extreme interference levels computed from reliability approaches: application to transmission lines with uncertain parameters

International Nuclear Information System (INIS)

Larbi, M.; Besnier, P.; Pecqueux, B.

2014-01-01

This paper deals with the risk analysis of an EMC default using a statistical approach. It is based on reliability methods from probabilistic engineering mechanics. A computation of probability of failure (i.e. probability of exceeding a threshold) of an induced current by crosstalk is established by taking into account uncertainties on input parameters influencing levels of interference in the context of transmission lines. The study has allowed us to evaluate the probability of failure of the induced current by using reliability methods having a relative low computational cost compared to Monte Carlo simulation. (authors)

Crash probability estimation via quantifying driver hazard perception.

Science.gov (United States)

Li, Yang; Zheng, Yang; Wang, Jianqiang; Kodaka, Kenji; Li, Keqiang

2018-07-01

Crash probability estimation is an important method to predict the potential reduction of crash probability contributed by forward collision avoidance technologies (FCATs). In this study, we propose a practical approach to estimate crash probability, which combines a field operational test and numerical simulations of a typical rear-end crash model. To consider driver hazard perception characteristics, we define a novel hazard perception measure, called as driver risk response time, by considering both time-to-collision (TTC) and driver braking response to impending collision risk in a near-crash scenario. Also, we establish a driving database under mixed Chinese traffic conditions based on a CMBS (Collision Mitigation Braking Systems)-equipped vehicle. Applying the crash probability estimation in this database, we estimate the potential decrease in crash probability owing to use of CMBS. A comparison of the results with CMBS on and off shows a 13.7% reduction of crash probability in a typical rear-end near-crash scenario with a one-second delay of driver's braking response. These results indicate that CMBS is positive in collision prevention, especially in the case of inattentive drivers or ole drivers. The proposed crash probability estimation offers a practical way for evaluating the safety benefits in the design and testing of FCATs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Risk Profile Indicators and Spanish Banks’ Probability of Default from a Regulatory Approach

Directory of Open Access Journals (Sweden)

Pilar Gómez-Fernández-Aguado

2018-04-01

Full Text Available This paper analyses the relationships between the traditional bank risk profile indicators and a new measure of banks’ probability of default that considers the Basel regulatory framework. First, based on the SYstemic Model of Bank Originated Losses (SYMBOL, we calculated the individual probabilities of default (PD of a representative sample of Spanish credit institutions during the period of 2008–2016. Then, panel data regressions were estimated to explore the influence of the risk indicators on the PD. Our findings on the Spanish banking system could be important to regulatory and supervisory authorities. First, the PD based on the SYMBOL model could be used to analyse bank risk from a regulatory approach. Second, the results might be useful for designing new regulations focused on the key factors that affect the banks’ probability of default. Third, our findings reveal that the emphasis on regulation and supervision should differ by type of entity.

Optimal selection for BRCA1 and BRCA2 mutation testing using a combination of ' easy to apply ' probability models

NARCIS (Netherlands)

Bodmer, D.; Ligtenberg, M. J. L.; van der Hout, A. H.; Gloudemans, S.; Ansink, K.; Oosterwijk, J. C.; Hoogerbrugge, N.

2006-01-01

To establish an efficient, reliable and easy to apply risk assessment tool to select families with breast and/or ovarian cancer patients for BRCA mutation testing, using available probability models. In a retrospective study of 263 families with breast and/or ovarian cancer patients, the utility of

Use of an influence diagram and fuzzy probability for evaluating accident management in a boiling water reactor

International Nuclear Information System (INIS)

Yu, D.; Kastenberg, W.E.; Okrent, D.

1994-01-01

A new approach is presented for evaluating the uncertainties inherent in severe accident management strategies. At first, this analysis considers accident management as a decision problem (i.e., applying a strategy compared with do nothing) and uses an influence diagram. To evaluate imprecise node probabilities in the influence diagram, the analysis introduces the concept of a fuzzy probability. When fuzzy logic is applied, fuzzy probabilities are easily propagated to obtain results. In addition, the results obtained provide not only information similar to the classical approach, which uses point-estimate values, but also additional information regarding the impact of using imprecise input data. As an illustrative example, the proposed methodology is applied to the evaluation of the drywell flooding strategy for a long-term station blackout sequence at the Peach Bottom nuclear power plant. The results show that the drywell flooding strategy is beneficial for preventing reactor vessel breach. It is also effective for reducing the probability of containment failure for both liner melt-through and late overpressurization. Even though uncertainty exists in the results, flooding is preferred to do nothing when evaluated in terms of two risk measures: early and late fatalities

Calculation of the tunneling time using the extended probability of the quantum histories approach

International Nuclear Information System (INIS)

Rewrujirek, Jiravatt; Hutem, Artit; Boonchui, Sutee

2014-01-01

The dwell time of quantum tunneling has been derived by Steinberg (1995) [7] as a function of the relation between transmission and reflection times τ t and τ r , weighted by the transmissivity and the reflectivity. In this paper, we reexamine the dwell time using the extended probability approach. The dwell time is calculated as the weighted average of three mutually exclusive events. We consider also the scattering process due to a resonance potential in the long-time limit. The results show that the dwell time can be expressed as the weighted sum of transmission, reflection and internal probabilities.

Probability concepts in quality risk management.

Science.gov (United States)

Claycamp, H Gregg

2012-01-01

Essentially any concept of risk is built on fundamental concepts of chance, likelihood, or probability. Although risk is generally a probability of loss of something of value, given that a risk-generating event will occur or has occurred, it is ironic that the quality risk management literature and guidelines on quality risk management tools are relatively silent on the meaning and uses of "probability." The probability concept is typically applied by risk managers as a combination of frequency-based calculation and a "degree of belief" meaning of probability. Probability as a concept that is crucial for understanding and managing risk is discussed through examples from the most general, scenario-defining and ranking tools that use probability implicitly to more specific probabilistic tools in risk management. A rich history of probability in risk management applied to other fields suggests that high-quality risk management decisions benefit from the implementation of more thoughtful probability concepts in both risk modeling and risk management. Essentially any concept of risk is built on fundamental concepts of chance, likelihood, or probability. Although "risk" generally describes a probability of loss of something of value, given that a risk-generating event will occur or has occurred, it is ironic that the quality risk management literature and guidelines on quality risk management methodologies and respective tools focus on managing severity but are relatively silent on the in-depth meaning and uses of "probability." Pharmaceutical manufacturers are expanding their use of quality risk management to identify and manage risks to the patient that might occur in phases of the pharmaceutical life cycle from drug development to manufacture, marketing to product discontinuation. A probability concept is typically applied by risk managers as a combination of data-based measures of probability and a subjective "degree of belief" meaning of probability. Probability as

More efficient integrated safeguards by applying a reasonable detection probability for maintaining low presence probability of undetected nuclear proliferating activities

International Nuclear Information System (INIS)

Otsuka, Naoto

2013-01-01

Highlights: • A theoretical foundation is presented for more efficient Integrated Safeguards (IS). • Probability of undetected nuclear proliferation activities should be maintained low. • For nations under IS, the probability to start proliferation activities is very low. • The fact can decrease the detection probability of IS by dozens of percentage points. • The cost of IS per nation can be cut down by reducing inspection frequencies etc. - Abstract: A theoretical foundation is presented for implementing more efficiently the present International Atomic Energy Agency (IAEA) integrated safeguards (ISs) on the basis of fuzzy evaluation of the probability that the evaluated nation will continue peaceful activities. It is shown that by determining the presence probability of undetected nuclear proliferating activities, nations under IS can be maintained at acceptably low proliferation risk levels even if the detection probability of current IS is decreased by dozens of percentage from the present value. This makes it possible to reduce inspection frequency and the number of collected samples, allowing the IAEA to cut costs per nation. This will contribute to further promotion and application of IS to more nations by the IAEA, and more efficient utilization of IAEA resources from the viewpoint of whole IS framework

Risk Probabilities

DEFF Research Database (Denmark)

Rojas-Nandayapa, Leonardo

Tail probabilities of sums of heavy-tailed random variables are of a major importance in various branches of Applied Probability, such as Risk Theory, Queueing Theory, Financial Management, and are subject to intense research nowadays. To understand their relevance one just needs to think...... analytic expression for the distribution function of a sum of random variables. The presence of heavy-tailed random variables complicates the problem even more. The objective of this dissertation is to provide better approximations by means of sharp asymptotic expressions and Monte Carlo estimators...

Subspace Learning via Local Probability Distribution for Hyperspectral Image Classification

Directory of Open Access Journals (Sweden)

Huiwu Luo

2015-01-01

Full Text Available The computational procedure of hyperspectral image (HSI is extremely complex, not only due to the high dimensional information, but also due to the highly correlated data structure. The need of effective processing and analyzing of HSI has met many difficulties. It has been evidenced that dimensionality reduction has been found to be a powerful tool for high dimensional data analysis. Local Fisher’s liner discriminant analysis (LFDA is an effective method to treat HSI processing. In this paper, a novel approach, called PD-LFDA, is proposed to overcome the weakness of LFDA. PD-LFDA emphasizes the probability distribution (PD in LFDA, where the maximum distance is replaced with local variance for the construction of weight matrix and the class prior probability is applied to compute the affinity matrix. The proposed approach increases the discriminant ability of the transformed features in low dimensional space. Experimental results on Indian Pines 1992 data indicate that the proposed approach significantly outperforms the traditional alternatives.

Probability via expectation

CERN Document Server

Whittle, Peter

1992-01-01

This book is a complete revision of the earlier work Probability which ap­ peared in 1970. While revised so radically and incorporating so much new material as to amount to a new text, it preserves both the aim and the approach of the original. That aim was stated as the provision of a 'first text in probability, de­ manding a reasonable but not extensive knowledge of mathematics, and taking the reader to what one might describe as a good intermediate level'. In doing so it attempted to break away from stereotyped applications, and consider applications of a more novel and significant character. The particular novelty of the approach was that expectation was taken as the prime concept, and the concept of expectation axiomatized rather than that of a probability measure. In the preface to the original text of 1970 (reproduced below, together with that to the Russian edition of 1982) I listed what I saw as the advantages of the approach in as unlaboured a fashion as I could. I also took the view that the text...

Joint probability distributions and fluctuation theorems

International Nuclear Information System (INIS)

García-García, Reinaldo; Kolton, Alejandro B; Domínguez, Daniel; Lecomte, Vivien

2012-01-01

We derive various exact results for Markovian systems that spontaneously relax to a non-equilibrium steady state by using joint probability distribution symmetries of different entropy production decompositions. The analytical approach is applied to diverse problems such as the description of the fluctuations induced by experimental errors, for unveiling symmetries of correlation functions appearing in fluctuation–dissipation relations recently generalized to non-equilibrium steady states, and also for mapping averages between different trajectory-based dynamical ensembles. Many known fluctuation theorems arise as special instances of our approach for particular twofold decompositions of the total entropy production. As a complement, we also briefly review and synthesize the variety of fluctuation theorems applying to stochastic dynamics of both continuous systems described by a Langevin dynamics and discrete systems obeying a Markov dynamics, emphasizing how these results emerge from distinct symmetries of the dynamical entropy of the trajectory followed by the system. For Langevin dynamics, we embed the 'dual dynamics' with a physical meaning, and for Markov systems we show how the fluctuation theorems translate into symmetries of modified evolution operators

Probabilistic Design Analysis (PDA) Approach to Determine the Probability of Cross-System Failures for a Space Launch Vehicle

Science.gov (United States)

Shih, Ann T.; Lo, Yunnhon; Ward, Natalie C.

2010-01-01

Quantifying the probability of significant launch vehicle failure scenarios for a given design, while still in the design process, is critical to mission success and to the safety of the astronauts. Probabilistic risk assessment (PRA) is chosen from many system safety and reliability tools to verify the loss of mission (LOM) and loss of crew (LOC) requirements set by the NASA Program Office. To support the integrated vehicle PRA, probabilistic design analysis (PDA) models are developed by using vehicle design and operation data to better quantify failure probabilities and to better understand the characteristics of a failure and its outcome. This PDA approach uses a physics-based model to describe the system behavior and response for a given failure scenario. Each driving parameter in the model is treated as a random variable with a distribution function. Monte Carlo simulation is used to perform probabilistic calculations to statistically obtain the failure probability. Sensitivity analyses are performed to show how input parameters affect the predicted failure probability, providing insight for potential design improvements to mitigate the risk. The paper discusses the application of the PDA approach in determining the probability of failure for two scenarios from the NASA Ares I project

Defining Probability in Sex Offender Risk Assessment.

Science.gov (United States)

Elwood, Richard W

2016-12-01

There is ongoing debate and confusion over using actuarial scales to predict individuals' risk of sexual recidivism. Much of the debate comes from not distinguishing Frequentist from Bayesian definitions of probability. Much of the confusion comes from applying Frequentist probability to individuals' risk. By definition, only Bayesian probability can be applied to the single case. The Bayesian concept of probability resolves most of the confusion and much of the debate in sex offender risk assessment. Although Bayesian probability is well accepted in risk assessment generally, it has not been widely used to assess the risk of sex offenders. I review the two concepts of probability and show how the Bayesian view alone provides a coherent scheme to conceptualize individuals' risk of sexual recidivism.

Probability, Statistics, and Stochastic Processes

CERN Document Server

Olofsson, Peter

2011-01-01

A mathematical and intuitive approach to probability, statistics, and stochastic processes This textbook provides a unique, balanced approach to probability, statistics, and stochastic processes. Readers gain a solid foundation in all three fields that serves as a stepping stone to more advanced investigations into each area. This text combines a rigorous, calculus-based development of theory with a more intuitive approach that appeals to readers' sense of reason and logic, an approach developed through the author's many years of classroom experience. The text begins with three chapters that d

A Balanced Approach to Adaptive Probability Density Estimation

Directory of Open Access Journals (Sweden)

Julio A. Kovacs

2017-04-01

Full Text Available Our development of a Fast (Mutual Information Matching (FIM of molecular dynamics time series data led us to the general problem of how to accurately estimate the probability density function of a random variable, especially in cases of very uneven samples. Here, we propose a novel Balanced Adaptive Density Estimation (BADE method that effectively optimizes the amount of smoothing at each point. To do this, BADE relies on an efficient nearest-neighbor search which results in good scaling for large data sizes. Our tests on simulated data show that BADE exhibits equal or better accuracy than existing methods, and visual tests on univariate and bivariate experimental data show that the results are also aesthetically pleasing. This is due in part to the use of a visual criterion for setting the smoothing level of the density estimate. Our results suggest that BADE offers an attractive new take on the fundamental density estimation problem in statistics. We have applied it on molecular dynamics simulations of membrane pore formation. We also expect BADE to be generally useful for low-dimensional applications in other statistical application domains such as bioinformatics, signal processing and econometrics.

A brief introduction to probability.

Science.gov (United States)

Di Paola, Gioacchino; Bertani, Alessandro; De Monte, Lavinia; Tuzzolino, Fabio

2018-02-01

The theory of probability has been debated for centuries: back in 1600, French mathematics used the rules of probability to place and win bets. Subsequently, the knowledge of probability has significantly evolved and is now an essential tool for statistics. In this paper, the basic theoretical principles of probability will be reviewed, with the aim of facilitating the comprehension of statistical inference. After a brief general introduction on probability, we will review the concept of the "probability distribution" that is a function providing the probabilities of occurrence of different possible outcomes of a categorical or continuous variable. Specific attention will be focused on normal distribution that is the most relevant distribution applied to statistical analysis.

Janus-faced probability

CERN Document Server

Rocchi, Paolo

2014-01-01

The problem of probability interpretation was long overlooked before exploding in the 20th century, when the frequentist and subjectivist schools formalized two conflicting conceptions of probability. Beyond the radical followers of the two schools, a circle of pluralist thinkers tends to reconcile the opposing concepts. The author uses two theorems in order to prove that the various interpretations of probability do not come into opposition and can be used in different contexts. The goal here is to clarify the multifold nature of probability by means of a purely mathematical approach and to show how philosophical arguments can only serve to deepen actual intellectual contrasts. The book can be considered as one of the most important contributions in the analysis of probability interpretation in the last 10-15 years.

Impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach.

Science.gov (United States)

Chandrasekar, A; Rakkiyappan, R; Cao, Jinde

2015-10-01

This paper studies the impulsive synchronization of Markovian jumping randomly coupled neural networks with partly unknown transition probabilities via multiple integral approach. The array of neural networks are coupled in a random fashion which is governed by Bernoulli random variable. The aim of this paper is to obtain the synchronization criteria, which is suitable for both exactly known and partly unknown transition probabilities such that the coupled neural network is synchronized with mixed time-delay. The considered impulsive effects can be synchronized at partly unknown transition probabilities. Besides, a multiple integral approach is also proposed to strengthen the Markovian jumping randomly coupled neural networks with partly unknown transition probabilities. By making use of Kronecker product and some useful integral inequalities, a novel Lyapunov-Krasovskii functional was designed for handling the coupled neural network with mixed delay and then impulsive synchronization criteria are solvable in a set of linear matrix inequalities. Finally, numerical examples are presented to illustrate the effectiveness and advantages of the theoretical results. Copyright © 2015 Elsevier Ltd. All rights reserved.

Integrated failure probability estimation based on structural integrity analysis and failure data: Natural gas pipeline case

International Nuclear Information System (INIS)

Dundulis, Gintautas; Žutautaitė, Inga; Janulionis, Remigijus; Ušpuras, Eugenijus; Rimkevičius, Sigitas; Eid, Mohamed

2016-01-01

In this paper, the authors present an approach as an overall framework for the estimation of the failure probability of pipelines based on: the results of the deterministic-probabilistic structural integrity analysis (taking into account loads, material properties, geometry, boundary conditions, crack size, and defected zone thickness), the corrosion rate, the number of defects and failure data (involved into the model via application of Bayesian method). The proposed approach is applied to estimate the failure probability of a selected part of the Lithuanian natural gas transmission network. The presented approach for the estimation of integrated failure probability is a combination of several different analyses allowing us to obtain: the critical crack's length and depth, the failure probability of the defected zone thickness, dependency of the failure probability on the age of the natural gas transmission pipeline. A model's uncertainty analysis and uncertainty propagation analysis are performed, as well. - Highlights: • Degradation mechanisms of natural gas transmission pipelines. • Fracture mechanic analysis of the pipe with crack. • Stress evaluation of the pipe with critical crack. • Deterministic-probabilistic structural integrity analysis of gas pipeline. • Integrated estimation of pipeline failure probability by Bayesian method.

CGC/saturation approach for soft interactions at high energy: survival probability of central exclusive production

Energy Technology Data Exchange (ETDEWEB)

Gotsman, E.; Maor, U. [Tel Aviv University, Department of Particle Physics, Raymond and Beverly Sackler Faculty of Exact Science, School of Physics and Astronomy, Tel Aviv (Israel); Levin, E. [Tel Aviv University, Department of Particle Physics, Raymond and Beverly Sackler Faculty of Exact Science, School of Physics and Astronomy, Tel Aviv (Israel); Universidad Tecnica Federico Santa Maria, Departemento de Fisica, Centro Cientifico-Tecnologico de Valparaiso, Valparaiso (Chile)

2016-04-15

We estimate the value of the survival probability for central exclusive production in a model which is based on the CGC/saturation approach. Hard and soft processes are described in the same framework. At LHC energies, we obtain a small value for the survival probability. The source of the small value is the impact parameter dependence of the hard amplitude. Our model has successfully described a large body of soft data: elastic, inelastic and diffractive cross sections, inclusive production and rapidity correlations, as well as the t-dependence of deep inelastic diffractive production of vector mesons. (orig.)

Probabilistic Approach to Conditional Probability of Release of Hazardous Materials from Railroad Tank Cars during Accidents

Science.gov (United States)

2009-10-13

This paper describes a probabilistic approach to estimate the conditional probability of release of hazardous materials from railroad tank cars during train accidents. Monte Carlo methods are used in developing a probabilistic model to simulate head ...

Fuzzy probability based fault tree analysis to propagate and quantify epistemic uncertainty

International Nuclear Information System (INIS)

Purba, Julwan Hendry; Sony Tjahyani, D.T.; Ekariansyah, Andi Sofrany; Tjahjono, Hendro

2015-01-01

Highlights: • Fuzzy probability based fault tree analysis is to evaluate epistemic uncertainty in fuzzy fault tree analysis. • Fuzzy probabilities represent likelihood occurrences of all events in a fault tree. • A fuzzy multiplication rule quantifies epistemic uncertainty of minimal cut sets. • A fuzzy complement rule estimate epistemic uncertainty of the top event. • The proposed FPFTA has successfully evaluated the U.S. Combustion Engineering RPS. - Abstract: A number of fuzzy fault tree analysis approaches, which integrate fuzzy concepts into the quantitative phase of conventional fault tree analysis, have been proposed to study reliabilities of engineering systems. Those new approaches apply expert judgments to overcome the limitation of the conventional fault tree analysis when basic events do not have probability distributions. Since expert judgments might come with epistemic uncertainty, it is important to quantify the overall uncertainties of the fuzzy fault tree analysis. Monte Carlo simulation is commonly used to quantify the overall uncertainties of conventional fault tree analysis. However, since Monte Carlo simulation is based on probability distribution, this technique is not appropriate for fuzzy fault tree analysis, which is based on fuzzy probabilities. The objective of this study is to develop a fuzzy probability based fault tree analysis to overcome the limitation of fuzzy fault tree analysis. To demonstrate the applicability of the proposed approach, a case study is performed and its results are then compared to the results analyzed by a conventional fault tree analysis. The results confirm that the proposed fuzzy probability based fault tree analysis is feasible to propagate and quantify epistemic uncertainties in fault tree analysis

Adapting machine learning techniques to censored time-to-event health record data: A general-purpose approach using inverse probability of censoring weighting.

Science.gov (United States)

Vock, David M; Wolfson, Julian; Bandyopadhyay, Sunayan; Adomavicius, Gediminas; Johnson, Paul E; Vazquez-Benitez, Gabriela; O'Connor, Patrick J

2016-06-01

Models for predicting the probability of experiencing various health outcomes or adverse events over a certain time frame (e.g., having a heart attack in the next 5years) based on individual patient characteristics are important tools for managing patient care. Electronic health data (EHD) are appealing sources of training data because they provide access to large amounts of rich individual-level data from present-day patient populations. However, because EHD are derived by extracting information from administrative and clinical databases, some fraction of subjects will not be under observation for the entire time frame over which one wants to make predictions; this loss to follow-up is often due to disenrollment from the health system. For subjects without complete follow-up, whether or not they experienced the adverse event is unknown, and in statistical terms the event time is said to be right-censored. Most machine learning approaches to the problem have been relatively ad hoc; for example, common approaches for handling observations in which the event status is unknown include (1) discarding those observations, (2) treating them as non-events, (3) splitting those observations into two observations: one where the event occurs and one where the event does not. In this paper, we present a general-purpose approach to account for right-censored outcomes using inverse probability of censoring weighting (IPCW). We illustrate how IPCW can easily be incorporated into a number of existing machine learning algorithms used to mine big health care data including Bayesian networks, k-nearest neighbors, decision trees, and generalized additive models. We then show that our approach leads to better calibrated predictions than the three ad hoc approaches when applied to predicting the 5-year risk of experiencing a cardiovascular adverse event, using EHD from a large U.S. Midwestern healthcare system. Copyright © 2016 Elsevier Inc. All rights reserved.

Compositional cokriging for mapping the probability risk of groundwater contamination by nitrates.

Science.gov (United States)

Pardo-Igúzquiza, Eulogio; Chica-Olmo, Mario; Luque-Espinar, Juan A; Rodríguez-Galiano, Víctor

2015-11-01

Contamination by nitrates is an important cause of groundwater pollution and represents a potential risk to human health. Management decisions must be made using probability maps that assess the nitrate concentration potential of exceeding regulatory thresholds. However these maps are obtained with only a small number of sparse monitoring locations where the nitrate concentrations have been measured. It is therefore of great interest to have an efficient methodology for obtaining those probability maps. In this paper, we make use of the fact that the discrete probability density function is a compositional variable. The spatial discrete probability density function is estimated by compositional cokriging. There are several advantages in using this approach: (i) problems of classical indicator cokriging, like estimates outside the interval (0,1) and order relations, are avoided; (ii) secondary variables (e.g. aquifer parameters) can be included in the estimation of the probability maps; (iii) uncertainty maps of the probability maps can be obtained; (iv) finally there are modelling advantages because the variograms and cross-variograms of real variables that do not have the restrictions of indicator variograms and indicator cross-variograms. The methodology was applied to the Vega de Granada aquifer in Southern Spain and the advantages of the compositional cokriging approach were demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

The hybrid thermography approach applied to architectural structures

Science.gov (United States)

Sfarra, S.; Ambrosini, D.; Paoletti, D.; Nardi, I.; Pasqualoni, G.

2017-07-01

This work contains an overview of infrared thermography (IRT) method and its applications relating to the investigation of architectural structures. In this method, the passive approach is usually used in civil engineering, since it provides a panoramic view of the thermal anomalies to be interpreted also thanks to the use of photographs focused on the region of interest (ROI). The active approach, is more suitable for laboratory or indoor inspections, as well as for objects having a small size. The external stress to be applied is thermal, coming from non-natural apparatus such as lamps or hot / cold air jets. In addition, the latter permits to obtain quantitative information related to defects not detectable to the naked eyes. Very recently, the hybrid thermography (HIRT) approach has been introduced to the attention of the scientific panorama. It can be applied when the radiation coming from the sun, directly arrives (i.e., possibly without the shadow cast effect) on a surface exposed to the air. A large number of thermograms must be collected and a post-processing analysis is subsequently applied via advanced algorithms. Therefore, an appraisal of the defect depth can be obtained passing through the calculation of the combined thermal diffusivity of the materials above the defect. The approach is validated herein by working, in a first stage, on a mosaic sample having known defects while, in a second stage, on a Church built in L'Aquila (Italy) and covered with a particular masonry structure called apparecchio aquilano. The results obtained appear promising.

Enhancing Ignition Probability and Fusion Yield in NIF Indirect Drive Targets with Applied Magnetic Fields

Science.gov (United States)

Perkins, L. John; Logan, B. Grant; Ho, Darwin; Zimmerman, George; Rhodes, Mark; Blackfield, Donald; Hawkins, Steven

2017-10-01

Imposed magnetic fields of tens of Tesla that increase to greater than 10 kT (100 MGauss) under capsule compression may relax conditions for ignition and propagating burn in indirect-drive ICF targets. This may allow attainment of ignition, or at least significant fusion energy yields, in presently-performing ICF targets on the National Ignition Facility that today are sub-marginal for thermonuclear burn through adverse hydrodynamic conditions at stagnation. Results of detailed 2D radiation-hydrodynamic-burn simulations applied to NIF capsule implosions with low-mode shape perturbations and residual kinetic energy loss indicate that such compressed fields may increase the probability for ignition through range reduction of fusion alpha particles, suppression of electron heat conduction and stabilization of higher-mode RT instabilities. Optimum initial applied fields are around 50 T. Off-line testing has been performed of a hohlraum coil and pulsed power supply that could be integrated on NIF; axial fields of 58T were obtained. Given the full plasma structure at capsule stagnation may be governed by 3-D resistive MHD, the formation of closed magnetic field lines might further augment ignition prospects. Experiments are now required to assess the potential of applied magnetic fields to NIF ICF ignition and burn. Work performed under auspices of U.S. DOE by LLNL under Contract DE-AC52-07NA27344.

The Classicist and the Frequentist Approach to Probability within a "TinkerPlots2" Combinatorial Problem

Science.gov (United States)

Prodromou, Theodosia

2012-01-01

This article seeks to address a pedagogical theory of introducing the classicist and the frequentist approach to probability, by investigating important elements in 9th grade students' learning process while working with a "TinkerPlots2" combinatorial problem. Results from this research study indicate that, after the students had seen…

A Comprehensive Probability Project for the Upper Division One-Semester Probability Course Using Yahtzee

Science.gov (United States)

Wilson, Jason; Lawman, Joshua; Murphy, Rachael; Nelson, Marissa

2011-01-01

This article describes a probability project used in an upper division, one-semester probability course with third-semester calculus and linear algebra prerequisites. The student learning outcome focused on developing the skills necessary for approaching project-sized math/stat application problems. These skills include appropriately defining…

Applying a Bayesian Approach to Identification of Orthotropic Elastic Constants from Full Field Displacement Measurements

Directory of Open Access Journals (Sweden)

Le Riche R.

2010-06-01

dimensionality. POD is based on projecting the full field images on a modal basis, constructed from sample simulations, and which can account for the variations of the full field as the elastic constants and other parameters of interest are varied. The fidelity of the decomposition depends on the number of basis vectors used. Typically even complex fields can be accurately represented with no more than a few dozen modes and for our problem we showed that only four or five modes are sufficient [5]. To further reduce the computational cost of the Bayesian approach we use response surface approximations of the POD coefficients of the fields. We show that 3rd degree polynomial response surface approximations provide a satisfying accuracy. The combination of POD decomposition and response surface methodology allows to bring down the computational time of the Bayesian identification to a few days. The proposed approach is applied to Moiré interferometry full field displacement measurements from a traction experiment on a plate with a hole. The laminate with a layup of [45,- 45,0]s is made out of a Toray® T800/3631 graphite/epoxy prepreg. The measured displacement maps are provided in Figure 1. The mean values of the identified properties joint probability density function are in agreement with previous identifications carried out on the same material. Furthermore the probability density function also provides the coefficient of variation with which the properties are identified as well as the correlations between the various properties. We find that while the longitudinal Young’s modulus is identified with good accuracy (low standard deviation, the Poisson’s ration is identified with much higher uncertainty. Several of the properties are also found to be correlated. The identified uncertainty structure of the elastic constants (i.e. variance co-variance matrix has potential benefits to reliability analyses, by allowing a more accurate description of the input uncertainty. An

Applying a Bayesian Approach to Identification of Orthotropic Elastic Constants from Full Field Displacement Measurements

Science.gov (United States)

Gogu, C.; Yin, W.; Haftka, R.; Ifju, P.; Molimard, J.; Le Riche, R.; Vautrin, A.

2010-06-01

based on projecting the full field images on a modal basis, constructed from sample simulations, and which can account for the variations of the full field as the elastic constants and other parameters of interest are varied. The fidelity of the decomposition depends on the number of basis vectors used. Typically even complex fields can be accurately represented with no more than a few dozen modes and for our problem we showed that only four or five modes are sufficient [5]. To further reduce the computational cost of the Bayesian approach we use response surface approximations of the POD coefficients of the fields. We show that 3rd degree polynomial response surface approximations provide a satisfying accuracy. The combination of POD decomposition and response surface methodology allows to bring down the computational time of the Bayesian identification to a few days. The proposed approach is applied to Moiré interferometry full field displacement measurements from a traction experiment on a plate with a hole. The laminate with a layup of [45,- 45,0]s is made out of a Toray® T800/3631 graphite/epoxy prepreg. The measured displacement maps are provided in Figure 1. The mean values of the identified properties joint probability density function are in agreement with previous identifications carried out on the same material. Furthermore the probability density function also provides the coefficient of variation with which the properties are identified as well as the correlations between the various properties. We find that while the longitudinal Young’s modulus is identified with good accuracy (low standard deviation), the Poisson’s ration is identified with much higher uncertainty. Several of the properties are also found to be correlated. The identified uncertainty structure of the elastic constants (i.e. variance co-variance matrix) has potential benefits to reliability analyses, by allowing a more accurate description of the input uncertainty. An additional

Generic Degraded Configuration Probability Analysis for the Codisposal Waste Package

International Nuclear Information System (INIS)

S.F.A. Deng; M. Saglam; L.J. Gratton

2001-01-01

In accordance with the technical work plan, ''Technical Work Plan For: Department of Energy Spent Nuclear Fuel Work Packages'' (CRWMS M and O 2000c), this Analysis/Model Report (AMR) is developed for the purpose of screening out degraded configurations for U.S. Department of Energy (DOE) spent nuclear fuel (SNF) types. It performs the degraded configuration parameter and probability evaluations of the overall methodology specified in the ''Disposal Criticality Analysis Methodology Topical Report'' (YMP 2000, Section 3) to qualifying configurations. Degradation analyses are performed to assess realizable parameter ranges and physical regimes for configurations. Probability calculations are then performed for configurations characterized by k eff in excess of the Critical Limit (CL). The scope of this document is to develop a generic set of screening criteria or models to screen out degraded configurations having potential for exceeding a criticality limit. The developed screening criteria include arguments based on physical/chemical processes and probability calculations and apply to DOE SNF types when codisposed with the high-level waste (HLW) glass inside a waste package. The degradation takes place inside the waste package and is long after repository licensing has expired. The emphasis of this AMR is on degraded configuration screening and the probability analysis is one of the approaches used for screening. The intended use of the model is to apply the developed screening criteria to each DOE SNF type following the completion of the degraded mode criticality analysis internal to the waste package

Estimating Subjective Probabilities

DEFF Research Database (Denmark)

Andersen, Steffen; Fountain, John; Harrison, Glenn W.

2014-01-01

either construct elicitation mechanisms that control for risk aversion, or construct elicitation mechanisms which undertake 'calibrating adjustments' to elicited reports. We illustrate how the joint estimation of risk attitudes and subjective probabilities can provide the calibration adjustments...... that theory calls for. We illustrate this approach using data from a controlled experiment with real monetary consequences to the subjects. This allows the observer to make inferences about the latent subjective probability, under virtually any well-specified model of choice under subjective risk, while still...

Escape and transmission probabilities in cylindrical geometry

International Nuclear Information System (INIS)

Bjerke, M.A.

1980-01-01

An improved technique for the generation of escape and transmission probabilities in cylindrical geometry was applied to the existing resonance cross section processing code ROLAIDS. The algorithm of Hwang and Toppel, [ANL-FRA-TM-118] (with modifications) was employed. The probabilities generated were found to be as accurate as those given by the method previously applied in ROLAIDS, while requiring much less computer core storage and CPU time

Probability estimation with machine learning methods for dichotomous and multicategory outcome: theory.

Science.gov (United States)

Kruppa, Jochen; Liu, Yufeng; Biau, Gérard; Kohler, Michael; König, Inke R; Malley, James D; Ziegler, Andreas

2014-07-01

Probability estimation for binary and multicategory outcome using logistic and multinomial logistic regression has a long-standing tradition in biostatistics. However, biases may occur if the model is misspecified. In contrast, outcome probabilities for individuals can be estimated consistently with machine learning approaches, including k-nearest neighbors (k-NN), bagged nearest neighbors (b-NN), random forests (RF), and support vector machines (SVM). Because machine learning methods are rarely used by applied biostatisticians, the primary goal of this paper is to explain the concept of probability estimation with these methods and to summarize recent theoretical findings. Probability estimation in k-NN, b-NN, and RF can be embedded into the class of nonparametric regression learning machines; therefore, we start with the construction of nonparametric regression estimates and review results on consistency and rates of convergence. In SVMs, outcome probabilities for individuals are estimated consistently by repeatedly solving classification problems. For SVMs we review classification problem and then dichotomous probability estimation. Next we extend the algorithms for estimating probabilities using k-NN, b-NN, and RF to multicategory outcomes and discuss approaches for the multicategory probability estimation problem using SVM. In simulation studies for dichotomous and multicategory dependent variables we demonstrate the general validity of the machine learning methods and compare it with logistic regression. However, each method fails in at least one simulation scenario. We conclude with a discussion of the failures and give recommendations for selecting and tuning the methods. Applications to real data and example code are provided in a companion article (doi:10.1002/bimj.201300077). © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

On finding the C in CBT: the challenges of applying gambling-related cognitive approaches to video-gaming.

Science.gov (United States)

Delfabbro, Paul; King, Daniel

2015-03-01

Many similarities have been drawn between the activities of gambling and video-gaming. Both are repetitive activities with intermittent reinforcement, decision-making opportunities, and elements of risk-taking. As a result, it might be tempting to believe that cognitive strategies that are used to treat problem gambling might also be applied to problematic video gaming. In this paper, we argue that many cognitive approaches to gambling that typically involve a focus on erroneous beliefs about probabilities and randomness are not readily applicable to video gaming. Instead, we encourage a focus on other clusters of cognitions that relate to: (a) the salience and over-valuing of gaming rewards, experiences, and identities, (b) maladaptive and inflexible rules about behaviour, (c) the use of video-gaming to maintain self-esteem, and (d) video-gaming for social status and recognition. This theoretical discussion is advanced as a starting point for the development of more refined cognitive treatment approaches for problematic video gaming.

A philosophical essay on probabilities

CERN Document Server

Laplace, Marquis de

1996-01-01

A classic of science, this famous essay by ""the Newton of France"" introduces lay readers to the concepts and uses of probability theory. It is of especial interest today as an application of mathematical techniques to problems in social and biological sciences.Generally recognized as the founder of the modern phase of probability theory, Laplace here applies the principles and general results of his theory ""to the most important questions of life, which are, in effect, for the most part, problems in probability."" Thus, without the use of higher mathematics, he demonstrates the application

Limited test data: The choice between confidence limits and inverse probability

International Nuclear Information System (INIS)

Nichols, P.

1975-01-01

For a unit which has been successfully designed to a high standard of reliability, any test programme of reasonable size will result in only a small number of failures. In these circumstances the failure rate estimated from the tests will depend on the statistical treatment applied. When a large number of units is to be manufactured, an unexpected high failure rate will certainly result in a large number of failures, so it is necessary to guard against optimistic unrepresentative test results by using a confidence limit approach. If only a small number of production units is involved, failures may not occur even with a higher than expected failure rate, and so one may be able to accept a method which allows for the possibility of either optimistic or pessimistic test results, and in this case an inverse probability approach, based on Bayes' theorem, might be used. The paper first draws attention to an apparently significant difference in the numerical results from the two methods, particularly for the overall probability of several units arranged in redundant logic. It then discusses a possible objection to the inverse method, followed by a demonstration that, for a large population and a very reasonable choice of prior probability, the inverse probability and confidence limit methods give the same numerical result. Finally, it is argued that a confidence limit approach is overpessimistic when a small number of production units is involved, and that both methods give the same answer for a large population. (author)

Modern applied U-statistics

CERN Document Server

Kowalski, Jeanne

2008-01-01

A timely and applied approach to the newly discovered methods and applications of U-statisticsBuilt on years of collaborative research and academic experience, Modern Applied U-Statistics successfully presents a thorough introduction to the theory of U-statistics using in-depth examples and applications that address contemporary areas of study including biomedical and psychosocial research. Utilizing a "learn by example" approach, this book provides an accessible, yet in-depth, treatment of U-statistics, as well as addresses key concepts in asymptotic theory by integrating translational and cross-disciplinary research.The authors begin with an introduction of the essential and theoretical foundations of U-statistics such as the notion of convergence in probability and distribution, basic convergence results, stochastic Os, inference theory, generalized estimating equations, as well as the definition and asymptotic properties of U-statistics. With an emphasis on nonparametric applications when and where applic...

Impact of controlling the sum of error probability in the sequential probability ratio test

Directory of Open Access Journals (Sweden)

Bijoy Kumarr Pradhan

2013-05-01

Full Text Available A generalized modified method is proposed to control the sum of error probabilities in sequential probability ratio test to minimize the weighted average of the two average sample numbers under a simple null hypothesis and a simple alternative hypothesis with the restriction that the sum of error probabilities is a pre-assigned constant to find the optimal sample size and finally a comparison is done with the optimal sample size found from fixed sample size procedure. The results are applied to the cases when the random variate follows a normal law as well as Bernoullian law.

Calculating method on human error probabilities considering influence of management and organization

International Nuclear Information System (INIS)

Gao Jia; Huang Xiangrui; Shen Zupei

1996-01-01

This paper is concerned with how management and organizational influences can be factored into quantifying human error probabilities on risk assessments, using a three-level Influence Diagram (ID) which is originally only as a tool for construction and representation of models of decision-making trees or event trees. An analytical model of human errors causation has been set up with three influence levels, introducing a method for quantification assessments (of the ID), which can be applied into quantifying probabilities) of human errors on risk assessments, especially into the quantification of complex event trees (system) as engineering decision-making analysis. A numerical case study is provided to illustrate the approach

An Inverse Kinematic Approach Using Groebner Basis Theory Applied to Gait Cycle Analysis

Science.gov (United States)

2013-03-01

AN INVERSE KINEMATIC APPROACH USING GROEBNER BASIS THEORY APPLIED TO GAIT CYCLE ANALYSIS THESIS Anum Barki AFIT-ENP-13-M-02 DEPARTMENT OF THE AIR...copyright protection in the United States. AFIT-ENP-13-M-02 AN INVERSE KINEMATIC APPROACH USING GROEBNER BASIS THEORY APPLIED TO GAIT CYCLE ANALYSIS THESIS...APPROACH USING GROEBNER BASIS THEORY APPLIED TO GAIT CYCLE ANALYSIS Anum Barki, BS Approved: Dr. Ronald F. Tuttle (Chairman) Date Dr. Kimberly Kendricks

Collision Probability Analysis

DEFF Research Database (Denmark)

Hansen, Peter Friis; Pedersen, Preben Terndrup

1998-01-01

It is the purpose of this report to apply a rational model for prediction of ship-ship collision probabilities as function of the ship and the crew characteristics and the navigational environment for MS Dextra sailing on a route between Cadiz and the Canary Islands.The most important ship and crew...... characteristics are: ship speed, ship manoeuvrability, the layout of the navigational bridge, the radar system, the number and the training of navigators, the presence of a look out etc. The main parameters affecting the navigational environment are ship traffic density, probability distributions of wind speeds...... probability, i.e. a study of the navigator's role in resolving critical situations, a causation factor is derived as a second step.The report documents the first step in a probabilistic collision damage analysis. Future work will inlcude calculation of energy released for crushing of structures giving...

Top scores are possible, bottom scores are certain (and middle scores are not worth mentioning: A pragmatic view of verbal probabilities

Directory of Open Access Journals (Sweden)

Marie Juanchich

2013-05-01

Full Text Available In most previous studies of verbal probabilities, participants are asked to translate expressions such as possible and not certain into numeric probability values. This probabilistic translation approach can be contrasted with a novel which-outcome (WO approach that focuses on the outcomes that people naturally associate with probability terms. The WO approach has revealed that, when given bell-shaped distributions of quantitative outcomes, people tend to associate certainty with minimum (unlikely outcome magnitudes and possibility with (unlikely maximal ones. The purpose of the present paper is to test the factors that foster these effects and the conditions in which they apply. Experiment 1 showed that the association of probability term and outcome was related to the association of scalar modifiers (i.e., it is certain that the battery will last at least..., it is possible that the battery will last up to.... Further, we tested whether this pattern was dependent on the frequency (e.g., increasing vs. decreasing distribution or the nature of the outcomes presented (i.e., categorical vs. continuous. Results showed that despite being slightly affected by the shape of the distribution, participants continue to prefer to associate possible with maximum outcomes and certain with minimum outcomes. The final experiment provided a boundary condition to the effect, showing that it applies to verbal but not numerical probabilities.

Excluding joint probabilities from quantum theory

Science.gov (United States)

Allahverdyan, Armen E.; Danageozian, Arshag

2018-03-01

Quantum theory does not provide a unique definition for the joint probability of two noncommuting observables, which is the next important question after the Born's probability for a single observable. Instead, various definitions were suggested, e.g., via quasiprobabilities or via hidden-variable theories. After reviewing open issues of the joint probability, we relate it to quantum imprecise probabilities, which are noncontextual and are consistent with all constraints expected from a quantum probability. We study two noncommuting observables in a two-dimensional Hilbert space and show that there is no precise joint probability that applies for any quantum state and is consistent with imprecise probabilities. This contrasts with theorems by Bell and Kochen-Specker that exclude joint probabilities for more than two noncommuting observables, in Hilbert space with dimension larger than two. If measurement contexts are included into the definition, joint probabilities are not excluded anymore, but they are still constrained by imprecise probabilities.

An intelligent system based on fuzzy probabilities for medical diagnosis – a study in aphasia diagnosis

Directory of Open Access Journals (Sweden)

Majid Moshtagh Khorasani

2009-04-01

Full Text Available

• BACKGROUND: Aphasia diagnosis is particularly challenging due to the linguistic uncertainty and vagueness, inconsistencies in the definition of aphasic syndromes, large number of measurements with  mprecision, natural diversity and subjectivity in test objects as well as in opinions of experts who diagnose the disease.
• METHODS: Fuzzy probability is proposed here as the basic framework for handling the uncertainties in medical diagnosis and particularly aphasia diagnosis. To efficiently construct this fuzzy probabilistic mapping, statistical analysis is performed that constructs input membership functions as well as determines an effective set of input features.
• RESULTS: Considering the high sensitivity of performance measures to different distribution of testing/training sets, a statistical t-test of significance is applied to compare fuzzy approach results with NN  esults as well as author’s earlier work using fuzzy logic. The proposed fuzzy probability estimator approach clearly provides better diagnosis for both classes of data sets. Specifically, for the first and second type of fuzzy probability classifiers, i.e. spontaneous speech and comprehensive model, P-values are 2.24E-08 and 0.0059, espectively, strongly rejecting the null hypothesis.
• CONCLUSIONS: The technique is applied and compared on both comprehensive and spontaneous speech test data for diagnosis of four Aphasia types: Anomic, Broca, Global and Wernicke. Statistical analysis confirms that the proposed approach can significantly improve accuracy using fewer Aphasia features.
• KEYWORDS: Aphasia, fuzzy probability, fuzzy logic, medical diagnosis, fuzzy rules.

Assessment of Optical Coherence Tomography Color Probability Codes in Myopic Glaucoma Eyes After Applying a Myopic Normative Database.

Science.gov (United States)

Seol, Bo Ram; Kim, Dong Myung; Park, Ki Ho; Jeoung, Jin Wook

2017-11-01

To evaluate the optical coherence tomography (OCT) color probability codes based on a myopic normative database and to investigate whether the implementation of the myopic normative database can improve the OCT diagnostic ability in myopic glaucoma. Comparative validity study. In this study, 305 eyes (154 myopic healthy eyes and 151 myopic glaucoma eyes) were included. A myopic normative database was obtained based on myopic healthy eyes. We evaluated the agreement between OCT color probability codes after applying the built-in and myopic normative databases, respectively. Another 120 eyes (60 myopic healthy eyes and 60 myopic glaucoma eyes) were included and the diagnostic performance of OCT color codes using a myopic normative database was investigated. The mean weighted kappa (Kw) coefficients for quadrant retinal nerve fiber layer (RNFL) thickness, clock-hour RNFL thickness, and ganglion cell-inner plexiform layer (GCIPL) thickness were 0.636, 0.627, and 0.564, respectively. The myopic normative database showed a higher specificity than did the built-in normative database in quadrant RNFL thickness, clock-hour RNFL thickness, and GCIPL thickness (P database in quadrant RNFL thickness, clock-hour RNFL thickness, and GCIPL thickness (P = .011, P = .004, P database. The implementation of a myopic normative database is needed to allow more precise interpretation of OCT color probability codes when used in myopic eyes. Copyright © 2017 Elsevier Inc. All rights reserved.

Establishment probability in newly founded populations

Directory of Open Access Journals (Sweden)

Gusset Markus

2012-06-01

Full Text Available Abstract Background Establishment success in newly founded populations relies on reaching the established phase, which is defined by characteristic fluctuations of the population’s state variables. Stochastic population models can be used to quantify the establishment probability of newly founded populations; however, so far no simple but robust method for doing so existed. To determine a critical initial number of individuals that need to be released to reach the established phase, we used a novel application of the “Wissel plot”, where –ln(1 – P0(t is plotted against time t. This plot is based on the equation P0t=1–c1e–ω1t, which relates the probability of extinction by time t, P0(t, to two constants: c1 describes the probability of a newly founded population to reach the established phase, whereas ω1 describes the population’s probability of extinction per short time interval once established. Results For illustration, we applied the method to a previously developed stochastic population model of the endangered African wild dog (Lycaon pictus. A newly founded population reaches the established phase if the intercept of the (extrapolated linear parts of the “Wissel plot” with the y-axis, which is –ln(c1, is negative. For wild dogs in our model, this is the case if a critical initial number of four packs, consisting of eight individuals each, are released. Conclusions The method we present to quantify the establishment probability of newly founded populations is generic and inferences thus are transferable to other systems across the field of conservation biology. In contrast to other methods, our approach disaggregates the components of a population’s viability by distinguishing establishment from persistence.

Probability of cavitation for single ultrasound pulses applied to tissues and tissue-mimicking materials.

Science.gov (United States)

Maxwell, Adam D; Cain, Charles A; Hall, Timothy L; Fowlkes, J Brian; Xu, Zhen

2013-03-01

In this study, the negative pressure values at which inertial cavitation consistently occurs in response to a single, two-cycle, focused ultrasound pulse were measured in several media relevant to cavitation-based ultrasound therapy. The pulse was focused into a chamber containing one of the media, which included liquids, tissue-mimicking materials, and ex vivo canine tissue. Focal waveforms were measured by two separate techniques using a fiber-optic hydrophone. Inertial cavitation was identified by high-speed photography in optically transparent media and an acoustic passive cavitation detector. The probability of cavitation (P(cav)) for a single pulse as a function of peak negative pressure (p(-)) followed a sigmoid curve, with the probability approaching one when the pressure amplitude was sufficient. The statistical threshold (defined as P(cav) = 0.5) was between p(-) = 26 and 30 MPa in all samples with high water content but varied between p(-) = 13.7 and >36 MPa in other media. A model for radial cavitation bubble dynamics was employed to evaluate the behavior of cavitation nuclei at these pressure levels. A single bubble nucleus with an inertial cavitation threshold of p(-) = 28.2 megapascals was estimated to have a 2.5 nm radius in distilled water. These data may be valuable for cavitation-based ultrasound therapy to predict the likelihood of cavitation at various pressure levels and dimensions of cavitation-induced lesions in tissue. Copyright © 2013 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Estimation of the nuclear fuel assembly eigenfrequencies in the probability sense

Directory of Open Access Journals (Sweden)

Zeman V.

2014-12-01

Full Text Available The paper deals with upper and lower limits estimation of the nuclear fuel assembly eigenfrequencies, whose design and operation parameters are random variables. Each parameter is defined by its mean value and standard deviation or by a range of values. The gradient and three sigma criterion approach is applied to the calculation of the upper and lower limits of fuel assembly eigenfrequencies in the probability sense. Presented analytical approach used for the calculation of eigenfrequencies sensitivity is based on the modal synthesis method and the fuel assembly decomposition into six identical revolved fuel rod segments, centre tube and load-bearing skeleton linked by spacer grids. The method is applied for the Russian TVSA-T fuel assembly in the WWER1000/320 type reactor core in the Czech nuclear power plant Temelín.

Using inferred probabilities to measure the accuracy of imprecise forecasts

Directory of Open Access Journals (Sweden)

Paul Lehner

2012-11-01

Full Text Available Research on forecasting is effectively limited to forecasts that are expressed with clarity; which is to say that the forecasted event must be sufficiently well-defined so that it can be clearly resolved whether or not the event occurred and forecasts certainties are expressed as quantitative probabilities. When forecasts are expressed with clarity, then quantitative measures (scoring rules, calibration, discrimination, etc. can be used to measure forecast accuracy, which in turn can be used to measure the comparative accuracy of different forecasting methods. Unfortunately most real world forecasts are not expressed clearly. This lack of clarity extends to both the description of the forecast event and to the use of vague language to express forecast certainty. It is thus difficult to assess the accuracy of most real world forecasts, and consequently the accuracy the methods used to generate real world forecasts. This paper addresses this deficiency by presenting an approach to measuring the accuracy of imprecise real world forecasts using the same quantitative metrics routinely used to measure the accuracy of well-defined forecasts. To demonstrate applicability, the Inferred Probability Method is applied to measure the accuracy of forecasts in fourteen documents examining complex political domains. Key words: inferred probability, imputed probability, judgment-based forecasting, forecast accuracy, imprecise forecasts, political forecasting, verbal probability, probability calibration.

A discussion on the origin of quantum probabilities

International Nuclear Information System (INIS)

Holik, Federico; Sáenz, Manuel; Plastino, Angel

2014-01-01

We study the origin of quantum probabilities as arising from non-Boolean propositional-operational structures. We apply the method developed by Cox to non distributive lattices and develop an alternative formulation of non-Kolmogorovian probability measures for quantum mechanics. By generalizing the method presented in previous works, we outline a general framework for the deduction of probabilities in general propositional structures represented by lattices (including the non-distributive case). -- Highlights: •Several recent works use a derivation similar to that of R.T. Cox to obtain quantum probabilities. •We apply Cox’s method to the lattice of subspaces of the Hilbert space. •We obtain a derivation of quantum probabilities which includes mixed states. •The method presented in this work is susceptible to generalization. •It includes quantum mechanics and classical mechanics as particular cases

Generic Degraded Congiguration Probability Analysis for DOE Codisposal Waste Package

Energy Technology Data Exchange (ETDEWEB)

S.F.A. Deng; M. Saglam; L.J. Gratton

2001-05-23

In accordance with the technical work plan, ''Technical Work Plan For: Department of Energy Spent Nuclear Fuel Work Packages'' (CRWMS M&O 2000c), this Analysis/Model Report (AMR) is developed for the purpose of screening out degraded configurations for U.S. Department of Energy (DOE) spent nuclear fuel (SNF) types. It performs the degraded configuration parameter and probability evaluations of the overall methodology specified in the ''Disposal Criticality Analysis Methodology Topical Report'' (YMP 2000, Section 3) to qualifying configurations. Degradation analyses are performed to assess realizable parameter ranges and physical regimes for configurations. Probability calculations are then performed for configurations characterized by k{sub eff} in excess of the Critical Limit (CL). The scope of this document is to develop a generic set of screening criteria or models to screen out degraded configurations having potential for exceeding a criticality limit. The developed screening criteria include arguments based on physical/chemical processes and probability calculations and apply to DOE SNF types when codisposed with the high-level waste (HLW) glass inside a waste package. The degradation takes place inside the waste package and is long after repository licensing has expired. The emphasis of this AMR is on degraded configuration screening and the probability analysis is one of the approaches used for screening. The intended use of the model is to apply the developed screening criteria to each DOE SNF type following the completion of the degraded mode criticality analysis internal to the waste package.

Applying lessons from the ecohealth approach to make food ...

International Development Research Centre (IDRC) Digital Library (Canada)

Applying lessons from the ecohealth approach to make food systems healthier ... the biennial Ecohealth Congress of the International Association for Ecology and ... intersectoral policies that address the notable increase in obesity, diabetes, ...

Predicting longitudinal trajectories of health probabilities with random-effects multinomial logit regression.

Science.gov (United States)

Liu, Xian; Engel, Charles C

2012-12-20

Researchers often encounter longitudinal health data characterized with three or more ordinal or nominal categories. Random-effects multinomial logit models are generally applied to account for potential lack of independence inherent in such clustered data. When parameter estimates are used to describe longitudinal processes, however, random effects, both between and within individuals, need to be retransformed for correctly predicting outcome probabilities. This study attempts to go beyond existing work by developing a retransformation method that derives longitudinal growth trajectories of unbiased health probabilities. We estimated variances of the predicted probabilities by using the delta method. Additionally, we transformed the covariates' regression coefficients on the multinomial logit function, not substantively meaningful, to the conditional effects on the predicted probabilities. The empirical illustration uses the longitudinal data from the Asset and Health Dynamics among the Oldest Old. Our analysis compared three sets of the predicted probabilities of three health states at six time points, obtained from, respectively, the retransformation method, the best linear unbiased prediction, and the fixed-effects approach. The results demonstrate that neglect of retransforming random errors in the random-effects multinomial logit model results in severely biased longitudinal trajectories of health probabilities as well as overestimated effects of covariates on the probabilities. Copyright © 2012 John Wiley & Sons, Ltd.

Transition probabilities for general birth-death processes with applications in ecology, genetics, and evolution

Science.gov (United States)

Crawford, Forrest W.; Suchard, Marc A.

2011-01-01

A birth-death process is a continuous-time Markov chain that counts the number of particles in a system over time. In the general process with n current particles, a new particle is born with instantaneous rate λn and a particle dies with instantaneous rate μn. Currently no robust and efficient method exists to evaluate the finite-time transition probabilities in a general birth-death process with arbitrary birth and death rates. In this paper, we first revisit the theory of continued fractions to obtain expressions for the Laplace transforms of these transition probabilities and make explicit an important derivation connecting transition probabilities and continued fractions. We then develop an efficient algorithm for computing these probabilities that analyzes the error associated with approximations in the method. We demonstrate that this error-controlled method agrees with known solutions and outperforms previous approaches to computing these probabilities. Finally, we apply our novel method to several important problems in ecology, evolution, and genetics. PMID:21984359

A novel approach to estimate the eruptive potential and probability in open conduit volcanoes.

Science.gov (United States)

De Gregorio, Sofia; Camarda, Marco

2016-07-26

In open conduit volcanoes, volatile-rich magma continuously enters into the feeding system nevertheless the eruptive activity occurs intermittently. From a practical perspective, the continuous steady input of magma in the feeding system is not able to produce eruptive events alone, but rather surplus of magma inputs are required to trigger the eruptive activity. The greater the amount of surplus of magma within the feeding system, the higher is the eruptive probability.Despite this observation, eruptive potential evaluations are commonly based on the regular magma supply, and in eruptive probability evaluations, generally any magma input has the same weight. Conversely, herein we present a novel approach based on the quantification of surplus of magma progressively intruded in the feeding system. To quantify the surplus of magma, we suggest to process temporal series of measurable parameters linked to the magma supply. We successfully performed a practical application on Mt Etna using the soil CO2 flux recorded over ten years.

Introduction to imprecise probabilities

CERN Document Server

Augustin, Thomas; de Cooman, Gert; Troffaes, Matthias C M

2014-01-01

In recent years, the theory has become widely accepted and has been further developed, but a detailed introduction is needed in order to make the material available and accessible to a wide audience. This will be the first book providing such an introduction, covering core theory and recent developments which can be applied to many application areas. All authors of individual chapters are leading researchers on the specific topics, assuring high quality and up-to-date contents. An Introduction to Imprecise Probabilities provides a comprehensive introduction to imprecise probabilities, includin

Model uncertainty: Probabilities for models?

International Nuclear Information System (INIS)

Winkler, R.L.

1994-01-01

Like any other type of uncertainty, model uncertainty should be treated in terms of probabilities. The question is how to do this. The most commonly-used approach has a drawback related to the interpretation of the probabilities assigned to the models. If we step back and look at the big picture, asking what the appropriate focus of the model uncertainty question should be in the context of risk and decision analysis, we see that a different probabilistic approach makes more sense, although it raise some implementation questions. Current work that is underway to address these questions looks very promising

Probability theory

CERN Document Server

Dorogovtsev, A Ya; Skorokhod, A V; Silvestrov, D S; Skorokhod, A V

1997-01-01

This book of problems is intended for students in pure and applied mathematics. There are problems in traditional areas of probability theory and problems in the theory of stochastic processes, which has wide applications in the theory of automatic control, queuing and reliability theories, and in many other modern science and engineering fields. Answers to most of the problems are given, and the book provides hints and solutions for more complicated problems.

A probability space for quantum models

Science.gov (United States)

Lemmens, L. F.

2017-06-01

A probability space contains a set of outcomes, a collection of events formed by subsets of the set of outcomes and probabilities defined for all events. A reformulation in terms of propositions allows to use the maximum entropy method to assign the probabilities taking some constraints into account. The construction of a probability space for quantum models is determined by the choice of propositions, choosing the constraints and making the probability assignment by the maximum entropy method. This approach shows, how typical quantum distributions such as Maxwell-Boltzmann, Fermi-Dirac and Bose-Einstein are partly related with well-known classical distributions. The relation between the conditional probability density, given some averages as constraints and the appropriate ensemble is elucidated.

Random phenomena fundamentals of probability and statistics for engineers

CERN Document Server

Ogunnaike, Babatunde A

2009-01-01

PreludeApproach PhilosophyFour Basic PrinciplesI FoundationsTwo Motivating ExamplesYield Improvement in a Chemical ProcessQuality Assurance in a Glass Sheet Manufacturing ProcessOutline of a Systematic ApproachRandom Phenomena, Variability, and UncertaintyTwo Extreme Idealizations of Natural PhenomenaRandom Mass PhenomenaIntroducing ProbabilityThe Probabilistic FrameworkII ProbabilityFundamentals of Probability TheoryBuilding BlocksOperationsProbabilityConditional ProbabilityIndependenceRandom Variables and DistributionsDistributionsMathematical ExpectationCharacterizing DistributionsSpecial Derived Probability FunctionsMultidimensional Random VariablesDistributions of Several Random VariablesDistributional Characteristics of Jointly Distributed Random VariablesRandom Variable TransformationsSingle Variable TransformationsBivariate TransformationsGeneral Multivariate TransformationsApplication Case Studies I: ProbabilityMendel and HeredityWorld War II Warship Tactical Response Under AttackIII DistributionsIde...

Truth, possibility and probability new logical foundations of probability and statistical inference

CERN Document Server

Chuaqui, R

1991-01-01

Anyone involved in the philosophy of science is naturally drawn into the study of the foundations of probability. Different interpretations of probability, based on competing philosophical ideas, lead to different statistical techniques, and frequently to mutually contradictory consequences. This unique book presents a new interpretation of probability, rooted in the traditional interpretation that was current in the 17th and 18th centuries. Mathematical models are constructed based on this interpretation, and statistical inference and decision theory are applied, including some examples in artificial intelligence, solving the main foundational problems. Nonstandard analysis is extensively developed for the construction of the models and in some of the proofs. Many nonstandard theorems are proved, some of them new, in particular, a representation theorem that asserts that any stochastic process can be approximated by a process defined over a space with equiprobable outcomes.

Failure probability assessment of wall-thinned nuclear pipes using probabilistic fracture mechanics

International Nuclear Information System (INIS)

Lee, Sang-Min; Chang, Yoon-Suk; Choi, Jae-Boong; Kim, Young-Jin

2006-01-01

The integrity of nuclear piping system has to be maintained during operation. In order to maintain the integrity, reliable assessment procedures including fracture mechanics analysis, etc., are required. Up to now, this has been performed using conventional deterministic approaches even though there are many uncertainties to hinder a rational evaluation. In this respect, probabilistic approaches are considered as an appropriate method for piping system evaluation. The objectives of this paper are to estimate the failure probabilities of wall-thinned pipes in nuclear secondary systems and to propose limited operating conditions under different types of loadings. To do this, a probabilistic assessment program using reliability index and simulation techniques was developed and applied to evaluate failure probabilities of wall-thinned pipes subjected to internal pressure, bending moment and combined loading of them. The sensitivity analysis results as well as prototypal integrity assessment results showed a promising applicability of the probabilistic assessment program, necessity of practical evaluation reflecting combined loading condition and operation considering limited condition

A novel multi-model probability battery state of charge estimation approach for electric vehicles using H-infinity algorithm

International Nuclear Information System (INIS)

Lin, Cheng; Mu, Hao; Xiong, Rui; Shen, Weixiang

2016-01-01

Highlights: • A novel multi-model probability battery SOC fusion estimation approach was proposed. • The linear matrix inequality-based H∞ technique is employed to estimate the SOC. • The Bayes theorem has been employed to realize the optimal weight for the fusion. • The robustness of the proposed approach is verified by different batteries. • The results show that the proposed method can promote global estimation accuracy. - Abstract: Due to the strong nonlinearity and complex time-variant property of batteries, the existing state of charge (SOC) estimation approaches based on a single equivalent circuit model (ECM) cannot provide the accurate SOC for the entire discharging period. This paper aims to present a novel SOC estimation approach based on a multiple ECMs fusion method for improving the practical application performance. In the proposed approach, three battery ECMs, namely the Thevenin model, the double polarization model and the 3rd order RC model, are selected to describe the dynamic voltage of lithium-ion batteries and the genetic algorithm is then used to determine the model parameters. The linear matrix inequality-based H-infinity technique is employed to estimate the SOC from the three models and the Bayes theorem-based probability method is employed to determine the optimal weights for synthesizing the SOCs estimated from the three models. Two types of lithium-ion batteries are used to verify the feasibility and robustness of the proposed approach. The results indicate that the proposed approach can improve the accuracy and reliability of the SOC estimation against uncertain battery materials and inaccurate initial states.

A Multidisciplinary Approach for Teaching Statistics and Probability

Science.gov (United States)

Rao, C. Radhakrishna

1971-01-01

The author presents a syllabus for an introductory (first year after high school) course in statistics and probability and some methods of teaching statistical techniques. The description comes basically from the procedures used at the Indian Statistical Institute, Calcutta. (JG)

Invariant probabilities of transition functions

CERN Document Server

Zaharopol, Radu

2014-01-01

The structure of the set of all the invariant probabilities and the structure of various types of individual invariant probabilities of a transition function are two topics of significant interest in the theory of transition functions, and are studied in this book. The results obtained are useful in ergodic theory and the theory of dynamical systems, which, in turn, can be applied in various other areas (like number theory). They are illustrated using transition functions defined by flows, semiflows, and one-parameter convolution semigroups of probability measures. In this book, all results on transition probabilities that have been published by the author between 2004 and 2008 are extended to transition functions. The proofs of the results obtained are new. For transition functions that satisfy very general conditions the book describes an ergodic decomposition that provides relevant information on the structure of the corresponding set of invariant probabilities. Ergodic decomposition means a splitting of t...

Quantum computing and probability.

Science.gov (United States)

Ferry, David K

2009-11-25

Over the past two decades, quantum computing has become a popular and promising approach to trying to solve computationally difficult problems. Missing in many descriptions of quantum computing is just how probability enters into the process. Here, we discuss some simple examples of how uncertainty and probability enter, and how this and the ideas of quantum computing challenge our interpretations of quantum mechanics. It is found that this uncertainty can lead to intrinsic decoherence, and this raises challenges for error correction.

Quantum computing and probability

International Nuclear Information System (INIS)

Ferry, David K

2009-01-01

Over the past two decades, quantum computing has become a popular and promising approach to trying to solve computationally difficult problems. Missing in many descriptions of quantum computing is just how probability enters into the process. Here, we discuss some simple examples of how uncertainty and probability enter, and how this and the ideas of quantum computing challenge our interpretations of quantum mechanics. It is found that this uncertainty can lead to intrinsic decoherence, and this raises challenges for error correction. (viewpoint)

Uncertainty plus prior equals rational bias: an intuitive Bayesian probability weighting function.

Science.gov (United States)

Fennell, John; Baddeley, Roland

2012-10-01

Empirical research has shown that when making choices based on probabilistic options, people behave as if they overestimate small probabilities, underestimate large probabilities, and treat positive and negative outcomes differently. These distortions have been modeled using a nonlinear probability weighting function, which is found in several nonexpected utility theories, including rank-dependent models and prospect theory; here, we propose a Bayesian approach to the probability weighting function and, with it, a psychological rationale. In the real world, uncertainty is ubiquitous and, accordingly, the optimal strategy is to combine probability statements with prior information using Bayes' rule. First, we show that any reasonable prior on probabilities leads to 2 of the observed effects; overweighting of low probabilities and underweighting of high probabilities. We then investigate 2 plausible kinds of priors: informative priors based on previous experience and uninformative priors of ignorance. Individually, these priors potentially lead to large problems of bias and inefficiency, respectively; however, when combined using Bayesian model comparison methods, both forms of prior can be applied adaptively, gaining the efficiency of empirical priors and the robustness of ignorance priors. We illustrate this for the simple case of generic good and bad options, using Internet blogs to estimate the relevant priors of inference. Given this combined ignorant/informative prior, the Bayesian probability weighting function is not only robust and efficient but also matches all of the major characteristics of the distortions found in empirical research. PsycINFO Database Record (c) 2012 APA, all rights reserved.

Alternative probability theories for cognitive psychology.

Science.gov (United States)

Narens, Louis

2014-01-01

Various proposals for generalizing event spaces for probability functions have been put forth in the mathematical, scientific, and philosophic literatures. In cognitive psychology such generalizations are used for explaining puzzling results in decision theory and for modeling the influence of context effects. This commentary discusses proposals for generalizing probability theory to event spaces that are not necessarily boolean algebras. Two prominent examples are quantum probability theory, which is based on the set of closed subspaces of a Hilbert space, and topological probability theory, which is based on the set of open sets of a topology. Both have been applied to a variety of cognitive situations. This commentary focuses on how event space properties can influence probability concepts and impact cognitive modeling. Copyright © 2013 Cognitive Science Society, Inc.

Estimating the Probability of Wind Ramping Events: A Data-driven Approach

OpenAIRE

Wang, Cheng; Wei, Wei; Wang, Jianhui; Qiu, Feng

2016-01-01

This letter proposes a data-driven method for estimating the probability of wind ramping events without exploiting the exact probability distribution function (PDF) of wind power. Actual wind data validates the proposed method.

Propensity, Probability, and Quantum Theory

Science.gov (United States)

Ballentine, Leslie E.

2016-08-01

Quantum mechanics and probability theory share one peculiarity. Both have well established mathematical formalisms, yet both are subject to controversy about the meaning and interpretation of their basic concepts. Since probability plays a fundamental role in QM, the conceptual problems of one theory can affect the other. We first classify the interpretations of probability into three major classes: (a) inferential probability, (b) ensemble probability, and (c) propensity. Class (a) is the basis of inductive logic; (b) deals with the frequencies of events in repeatable experiments; (c) describes a form of causality that is weaker than determinism. An important, but neglected, paper by P. Humphreys demonstrated that propensity must differ mathematically, as well as conceptually, from probability, but he did not develop a theory of propensity. Such a theory is developed in this paper. Propensity theory shares many, but not all, of the axioms of probability theory. As a consequence, propensity supports the Law of Large Numbers from probability theory, but does not support Bayes theorem. Although there are particular problems within QM to which any of the classes of probability may be applied, it is argued that the intrinsic quantum probabilities (calculated from a state vector or density matrix) are most naturally interpreted as quantum propensities. This does not alter the familiar statistical interpretation of QM. But the interpretation of quantum states as representing knowledge is untenable. Examples show that a density matrix fails to represent knowledge.

On the use of mean groundwater age, life expectancy and capture probability for defining aquifer vulnerability and time-of-travel zones for source water protection.

Science.gov (United States)

Molson, J W; Frind, E O

2012-01-01

Protection and sustainability of water supply wells requires the assessment of vulnerability to contamination and the delineation of well capture zones. Capture zones, or more generally, time-of-travel zones corresponding to specific contaminant travel times, are most commonly delineated using advective particle tracking. More recently, the capture probability approach has been used in which a probability of capture of P=1 is assigned to the well and the growth of a probability-of-capture plume is tracked backward in time using an advective-dispersive transport model. This approach accounts for uncertainty due to local-scale heterogeneities through the use of macrodispersion. In this paper, we develop an alternative approach to capture zone delineation by applying the concept of mean life expectancy E (time remaining before being captured by the well), and we show how life expectancy E is related to capture probability P. Either approach can be used to delineate time-of-travel zones corresponding to specific travel times, as well as the ultimate capture zone. The related concept of mean groundwater age A (time since recharge) can also be applied in the context of defining the vulnerability of a pumped aquifer. In the same way as capture probability, mean life expectancy and groundwater age account for local-scale uncertainty or unresolved heterogeneities through macrodispersion, which standard particle tracking neglects. The approach is tested on 2D and 3D idealized systems, as well as on several watershed-scale well fields within the Regional Municipality of Waterloo, Ontario, Canada. Copyright © 2011 Elsevier B.V. All rights reserved.

The effect of coupling hydrologic and hydrodynamic models on probable maximum flood estimation

Science.gov (United States)

Felder, Guido; Zischg, Andreas; Weingartner, Rolf

2017-07-01

Deterministic rainfall-runoff modelling usually assumes stationary hydrological system, as model parameters are calibrated with and therefore dependant on observed data. However, runoff processes are probably not stationary in the case of a probable maximum flood (PMF) where discharge greatly exceeds observed flood peaks. Developing hydrodynamic models and using them to build coupled hydrologic-hydrodynamic models can potentially improve the plausibility of PMF estimations. This study aims to assess the potential benefits and constraints of coupled modelling compared to standard deterministic hydrologic modelling when it comes to PMF estimation. The two modelling approaches are applied using a set of 100 spatio-temporal probable maximum precipitation (PMP) distribution scenarios. The resulting hydrographs, the resulting peak discharges as well as the reliability and the plausibility of the estimates are evaluated. The discussion of the results shows that coupling hydrologic and hydrodynamic models substantially improves the physical plausibility of PMF modelling, although both modelling approaches lead to PMF estimations for the catchment outlet that fall within a similar range. Using a coupled model is particularly suggested in cases where considerable flood-prone areas are situated within a catchment.

Domestic wells have high probability of pumping septic tank leachate

Science.gov (United States)

Bremer, J. E.; Harter, T.

2012-08-01

Onsite wastewater treatment systems are common in rural and semi-rural areas around the world; in the US, about 25-30% of households are served by a septic (onsite) wastewater treatment system, and many property owners also operate their own domestic well nearby. Site-specific conditions and local groundwater flow are often ignored when installing septic systems and wells. In areas with small lots (thus high spatial septic system densities), shallow domestic wells are prone to contamination by septic system leachate. Mass balance approaches have been used to determine a maximum septic system density that would prevent contamination of groundwater resources. In this study, a source area model based on detailed groundwater flow and transport modeling is applied for a stochastic analysis of domestic well contamination by septic leachate. Specifically, we determine the probability that a source area overlaps with a septic system drainfield as a function of aquifer properties, septic system density and drainfield size. We show that high spatial septic system density poses a high probability of pumping septic system leachate. The hydraulic conductivity of the aquifer has a strong influence on the intersection probability. We find that mass balance calculations applied on a regional scale underestimate the contamination risk of individual drinking water wells by septic systems. This is particularly relevant for contaminants released at high concentrations, for substances that experience limited attenuation, and those that are harmful even at low concentrations (e.g., pathogens).

Domestic wells have high probability of pumping septic tank leachate

Directory of Open Access Journals (Sweden)

J. E. Bremer

2012-08-01

Full Text Available Onsite wastewater treatment systems are common in rural and semi-rural areas around the world; in the US, about 25–30% of households are served by a septic (onsite wastewater treatment system, and many property owners also operate their own domestic well nearby. Site-specific conditions and local groundwater flow are often ignored when installing septic systems and wells. In areas with small lots (thus high spatial septic system densities, shallow domestic wells are prone to contamination by septic system leachate. Mass balance approaches have been used to determine a maximum septic system density that would prevent contamination of groundwater resources. In this study, a source area model based on detailed groundwater flow and transport modeling is applied for a stochastic analysis of domestic well contamination by septic leachate. Specifically, we determine the probability that a source area overlaps with a septic system drainfield as a function of aquifer properties, septic system density and drainfield size. We show that high spatial septic system density poses a high probability of pumping septic system leachate. The hydraulic conductivity of the aquifer has a strong influence on the intersection probability. We find that mass balance calculations applied on a regional scale underestimate the contamination risk of individual drinking water wells by septic systems. This is particularly relevant for contaminants released at high concentrations, for substances that experience limited attenuation, and those that are harmful even at low concentrations (e.g., pathogens.

An approach for estimating the breach probabilities of moraine-dammed lakes in the Chinese Himalayas using remote-sensing data

Directory of Open Access Journals (Sweden)

X. Wang

2012-10-01

Full Text Available To make first-order estimates of the probability of moraine-dammed lake outburst flood (MDLOF and prioritize the probabilities of breaching posed by potentially dangerous moraine-dammed lakes (PDMDLs in the Chinese Himalayas, an objective approach is presented. We first select five indicators to identify PDMDLs according to four predesigned criteria. The climatic background was regarded as the climatic precondition of the moraine-dam failure, and under different climatic preconditions, we distinguish the trigger mechanisms of MDLOFs and subdivide them into 17 possible breach modes, with each mode having three or four components; we combined the precondition, modes and components to construct a decision-making tree of moraine-dam failure. Conversion guidelines were established so as to quantify the probabilities of components of a breach mode employing the historic performance method combined with expert knowledge and experience. The region of the Chinese Himalayas was chosen as a study area where there have been frequent MDLOFs in recent decades. The results show that the breaching probabilities (P of 142 PDMDLs range from 0.037 to 0.345, and they can be further categorized as 43 lakes with very high breach probabilities (P ≥ 0.24, 47 lakes with high breach probabilities (0.18 ≤ P < 0.24, 24 lakes with mid-level breach probabilities (0.12 ≤ P < 0.18, 24 lakes with low breach probabilities (0.06 ≤ P < 0.12, and four lakes with very low breach probabilities (p < 0.06.

Fuzzy uncertainty modeling applied to AP1000 nuclear power plant LOCA

International Nuclear Information System (INIS)

Ferreira Guimaraes, Antonio Cesar; Franklin Lapa, Celso Marcelo; Lamego Simoes Filho, Francisco Fernando; Cabral, Denise Cunha

2011-01-01

Research highlights: → This article presents an uncertainty modelling study using a fuzzy approach. → The AP1000 Westinghouse NPP was used and it is provided of passive safety systems. → The use of advanced passive safety systems in NPP has limited operational experience. → Failure rates and basic events probabilities used on the fault tree analysis. → Fuzzy uncertainty approach was employed to reliability of the AP1000 large LOCA. - Abstract: This article presents an uncertainty modeling study using a fuzzy approach applied to the Westinghouse advanced nuclear reactor. The AP1000 Westinghouse Nuclear Power Plant (NPP) is provided of passive safety systems, based on thermo physics phenomenon, that require no operating actions, soon after an incident has been detected. The use of advanced passive safety systems in NPP has limited operational experience. As it occurs in any reliability study, statistically non-significant events report introduces a significant uncertainty level about the failure rates and basic events probabilities used on the fault tree analysis (FTA). In order to model this uncertainty, a fuzzy approach was employed to reliability analysis of the AP1000 large break Loss of Coolant Accident (LOCA). The final results have revealed that the proposed approach may be successfully applied to modeling of uncertainties in safety studies.

First-passage Probability Estimation of an Earthquake Response of Seismically Isolated Containment Buildings

International Nuclear Information System (INIS)

Hahm, Dae-Gi; Park, Kwan-Soon; Koh, Hyun-Moo

2008-01-01

The awareness of a seismic hazard and risk is being increased rapidly according to the frequent occurrences of the huge earthquakes such as the 2008 Sichuan earthquake which caused about 70,000 confirmed casualties and a 20 billion U.S. dollars economic loss. Since an earthquake load contains various uncertainties naturally, the safety of a structural system under an earthquake excitation has been assessed by probabilistic approaches. In many structural applications for a probabilistic safety assessment, it is often regarded that the failure of a system will occur when the response of the structure firstly crosses the limit barrier within a specified interval of time. The determination of such a failure probability is usually called the 'first-passage problem' and has been extensively studied during the last few decades. However, especially for the structures which show a significant nonlinear dynamic behavior, an effective and accurate method for the estimation of such a failure probability is not fully established yet. In this study, we presented a new approach to evaluate the first-passage probability of an earthquake response of seismically isolated structures. The proposed method is applied to the seismic isolation system for the containment buildings of a nuclear power plant. From the numerical example, we verified that the proposed method shows accurate results with more efficient computational efforts compared to the conventional approaches

Views on Montessori Approach by Teachers Serving at Schools Applying the Montessori Approach

Science.gov (United States)

Atli, Sibel; Korkmaz, A. Merve; Tastepe, Taskin; Koksal Akyol, Aysel

2016-01-01

Problem Statement: Further studies on Montessori teachers are required on the grounds that the Montessori approach, which, having been applied throughout the world, holds an important place in the alternative education field. Yet it is novel for Turkey, and there are only a limited number of studies on Montessori teachers in Turkey. Purpose of…

Coasting beam theory applied to bunches

International Nuclear Information System (INIS)

Hereward, H.

1975-01-01

It is plausible to apply coasting beam criteria to bunches if one has short wavelength disturbances of the bunch and short memory wake fields, where short means short compared with a bunch length, for then one can argue that a piece of the bunch near the middle does not even know that the bunch has ends. Some other conditions probably required to validate this approach are discussed. The local Keil-Schnell criterion is derived from the local dispersion integral

Reliability of structures by using probability and fatigue theories

International Nuclear Information System (INIS)

Lee, Ouk Sub; Kim, Dong Hyeok; Park, Yeon Chang

2008-01-01

Methodologies to calculate failure probability and to estimate the reliability of fatigue loaded structures are developed. The applicability of the methodologies is evaluated with the help of the fatigue crack growth models suggested by Paris and Walker. The probability theories such as the FORM (first order reliability method), the SORM (second order reliability method) and the MCS (Monte Carlo simulation) are utilized. It is found that the failure probability decreases with the increase of the design fatigue life and the applied minimum stress, the decrease of the initial edge crack size, the applied maximum stress and the slope of Paris equation. Furthermore, according to the sensitivity analysis of random variables, the slope of Pairs equation affects the failure probability dominantly among other random variables in the Paris and the Walker models

Probability, statistics, and queueing theory

CERN Document Server

Allen, Arnold O

1990-01-01

This is a textbook on applied probability and statistics with computer science applications for students at the upper undergraduate level. It may also be used as a self study book for the practicing computer science professional. The successful first edition of this book proved extremely useful to students who need to use probability, statistics and queueing theory to solve problems in other fields, such as engineering, physics, operations research, and management science. The book has also been successfully used for courses in queueing theory for operations research students. This second edit

Dangerous "spin": the probability myth of evidence-based prescribing - a Merleau-Pontyian approach.

Science.gov (United States)

Morstyn, Ron

2011-08-01

The aim of this study was to examine logical positivist statistical probability statements used to support and justify "evidence-based" prescribing rules in psychiatry when viewed from the major philosophical theories of probability, and to propose "phenomenological probability" based on Maurice Merleau-Ponty's philosophy of "phenomenological positivism" as a better clinical and ethical basis for psychiatric prescribing. The logical positivist statistical probability statements which are currently used to support "evidence-based" prescribing rules in psychiatry have little clinical or ethical justification when subjected to critical analysis from any of the major theories of probability and represent dangerous "spin" because they necessarily exclude the individual , intersubjective and ambiguous meaning of mental illness. A concept of "phenomenological probability" founded on Merleau-Ponty's philosophy of "phenomenological positivism" overcomes the clinically destructive "objectivist" and "subjectivist" consequences of logical positivist statistical probability and allows psychopharmacological treatments to be appropriately integrated into psychiatric treatment.

SLIM-MAUD: an approach to assessing human error probabilities using structured expert judgment. Volume II. Detailed analysis of the technical issues

International Nuclear Information System (INIS)

Embrey, D.E.; Humphreys, P.; Rosa, E.A.; Kirwan, B.; Rea, K.

1984-07-01

This two-volume report presents the procedures and analyses performed in developing an approach for structuring expert judgments to estimate human error probabilities. Volume I presents an overview of work performed in developing the approach: SLIM-MAUD (Success Likelihood Index Methodology, implemented through the use of an interactive computer program called MAUD-Multi-Attribute Utility Decomposition). Volume II provides a more detailed analysis of the technical issues underlying the approach

Probabilities the little numbers that rule our lives

CERN Document Server

Olofsson, Peter

2014-01-01

Praise for the First Edition"If there is anything you want to know, or remind yourself, about probabilities, then look no further than this comprehensive, yet wittily written and enjoyable, compendium of how to apply probability calculations in real-world situations."- Keith Devlin, Stanford University, National Public Radio's "Math Guy" and author of The Math Gene and The Unfinished GameFrom probable improbabilities to regular irregularities, Probabilities: The Little Numbers That Rule Our Lives, Second Edition investigates the often surprising effects of risk and chance in our lives. Featur

Estimating species occurrence, abundance, and detection probability using zero-inflated distributions.

Science.gov (United States)

Wenger, Seth J; Freeman, Mary C

2008-10-01

Researchers have developed methods to account for imperfect detection of species with either occupancy (presence absence) or count data using replicated sampling. We show how these approaches can be combined to simultaneously estimate occurrence, abundance, and detection probability by specifying a zero-inflated distribution for abundance. This approach may be particularly appropriate when patterns of occurrence and abundance arise from distinct processes operating at differing spatial or temporal scales. We apply the model to two data sets: (1) previously published data for a species of duck, Anas platyrhynchos, and (2) data for a stream fish species, Etheostoma scotti. We show that in these cases, an incomplete-detection zero-inflated modeling approach yields a superior fit to the data than other models. We propose that zero-inflated abundance models accounting for incomplete detection be considered when replicate count data are available.

Encounter Probability of Individual Wave Height

DEFF Research Database (Denmark)

Liu, Z.; Burcharth, H. F.

1998-01-01

wave height corresponding to a certain exceedence probability within a structure lifetime (encounter probability), based on the statistical analysis of long-term extreme significant wave height. Then the design individual wave height is calculated as the expected maximum individual wave height...... associated with the design significant wave height, with the assumption that the individual wave heights follow the Rayleigh distribution. However, the exceedence probability of such a design individual wave height within the structure lifetime is unknown. The paper presents a method for the determination...... of the design individual wave height corresponding to an exceedence probability within the structure lifetime, given the long-term extreme significant wave height. The method can also be applied for estimation of the number of relatively large waves for fatigue analysis of constructions....

Probability mapping of contaminants

International Nuclear Information System (INIS)

Rautman, C.A.; Kaplan, P.G.; McGraw, M.A.; Istok, J.D.; Sigda, J.M.

1994-01-01

Exhaustive characterization of a contaminated site is a physical and practical impossibility. Descriptions of the nature, extent, and level of contamination, as well as decisions regarding proposed remediation activities, must be made in a state of uncertainty based upon limited physical sampling. The probability mapping approach illustrated in this paper appears to offer site operators a reasonable, quantitative methodology for many environmental remediation decisions and allows evaluation of the risk associated with those decisions. For example, output from this approach can be used in quantitative, cost-based decision models for evaluating possible site characterization and/or remediation plans, resulting in selection of the risk-adjusted, least-cost alternative. The methodology is completely general, and the techniques are applicable to a wide variety of environmental restoration projects. The probability-mapping approach is illustrated by application to a contaminated site at the former DOE Feed Materials Production Center near Fernald, Ohio. Soil geochemical data, collected as part of the Uranium-in-Soils Integrated Demonstration Project, have been used to construct a number of geostatistical simulations of potential contamination for parcels approximately the size of a selective remediation unit (the 3-m width of a bulldozer blade). Each such simulation accurately reflects the actual measured sample values, and reproduces the univariate statistics and spatial character of the extant data. Post-processing of a large number of these equally likely statistically similar images produces maps directly showing the probability of exceeding specified levels of contamination (potential clean-up or personnel-hazard thresholds)

Probability mapping of contaminants

Energy Technology Data Exchange (ETDEWEB)

Rautman, C.A.; Kaplan, P.G. [Sandia National Labs., Albuquerque, NM (United States); McGraw, M.A. [Univ. of California, Berkeley, CA (United States); Istok, J.D. [Oregon State Univ., Corvallis, OR (United States); Sigda, J.M. [New Mexico Inst. of Mining and Technology, Socorro, NM (United States)

1994-04-01

Exhaustive characterization of a contaminated site is a physical and practical impossibility. Descriptions of the nature, extent, and level of contamination, as well as decisions regarding proposed remediation activities, must be made in a state of uncertainty based upon limited physical sampling. The probability mapping approach illustrated in this paper appears to offer site operators a reasonable, quantitative methodology for many environmental remediation decisions and allows evaluation of the risk associated with those decisions. For example, output from this approach can be used in quantitative, cost-based decision models for evaluating possible site characterization and/or remediation plans, resulting in selection of the risk-adjusted, least-cost alternative. The methodology is completely general, and the techniques are applicable to a wide variety of environmental restoration projects. The probability-mapping approach is illustrated by application to a contaminated site at the former DOE Feed Materials Production Center near Fernald, Ohio. Soil geochemical data, collected as part of the Uranium-in-Soils Integrated Demonstration Project, have been used to construct a number of geostatistical simulations of potential contamination for parcels approximately the size of a selective remediation unit (the 3-m width of a bulldozer blade). Each such simulation accurately reflects the actual measured sample values, and reproduces the univariate statistics and spatial character of the extant data. Post-processing of a large number of these equally likely statistically similar images produces maps directly showing the probability of exceeding specified levels of contamination (potential clean-up or personnel-hazard thresholds).

Probability tales

CERN Document Server

Grinstead, Charles M; Snell, J Laurie

2011-01-01

This book explores four real-world topics through the lens of probability theory. It can be used to supplement a standard text in probability or statistics. Most elementary textbooks present the basic theory and then illustrate the ideas with some neatly packaged examples. Here the authors assume that the reader has seen, or is learning, the basic theory from another book and concentrate in some depth on the following topics: streaks, the stock market, lotteries, and fingerprints. This extended format allows the authors to present multiple approaches to problems and to pursue promising side discussions in ways that would not be possible in a book constrained to cover a fixed set of topics. To keep the main narrative accessible, the authors have placed the more technical mathematical details in appendices. The appendices can be understood by someone who has taken one or two semesters of calculus.

Reliability analysis of reactor systems by applying probability method; Analiza pouzdanosti reaktorskih sistema primenom metoda verovatnoce

Energy Technology Data Exchange (ETDEWEB)

Milivojevic, S [Institute of Nuclear Sciences Boris Kidric, Vinca, Beograd (Serbia and Montenegro)

1974-12-15

Probability method was chosen for analysing the reactor system reliability is considered realistic since it is based on verified experimental data. In fact this is a statistical method. The probability method developed takes into account the probability distribution of permitted levels of relevant parameters and their particular influence on the reliability of the system as a whole. The proposed method is rather general, and was used for problem of thermal safety analysis of reactor system. This analysis enables to analyze basic properties of the system under different operation conditions, expressed in form of probability they show the reliability of the system on the whole as well as reliability of each component.

Effect of velocity variation on secondary-ion-emission probability: Quantum stationary approach

International Nuclear Information System (INIS)

Goldberg, E.C.; Ferron, J.; Passeggi, M.C.G.

1989-01-01

The ion-velocity dependence of the ionization probability for an atom ejected from a surface is examined by using a quantum approach in which the coupled motion between electrons and the outgoing nucleus is followed along the whole trajectory by solving the stationary Schroedinger equation. We choose a very-small-cluster-model system in which the motion of the atom is restricted to one dimension, and with energy potential curves corresponding to the involved channels varying appreciably with the atom position. We found an exponential dependence on the inverse of the asymptotic ion velocity for high emission energies, and a smoother behavior with slight oscillations at low energies. These results are compared with those obtained within a dynamical-trajectory approximation using either a constant velocity equal to the asymptotic ionic value, or expressions for the velocity derived from the eikonal approximation and from the classical limit of the current vector. Both approaches give similar results provided the velocity is allowed to adjust self-consistently to potential energies and transition-amplitude variations. Strong oscillations are observed in the low-emission-energy range either if the transitions are neglected, or a constant velocity along the whole path is assumed for the ejected particle

Improved method for estimating particle scattering probabilities to finite detectors for Monte Carlo simulation

International Nuclear Information System (INIS)

Mickael, M.; Gardner, R.P.; Verghese, K.

1988-01-01

An improved method for calculating the total probability of particle scattering within the solid angle subtended by finite detectors is developed, presented, and tested. The limiting polar and azimuthal angles subtended by the detector are measured from the direction that most simplifies their calculation rather than from the incident particle direction. A transformation of the particle scattering probability distribution function (pdf) is made to match the transformation of the direction from which the limiting angles are measured. The particle scattering probability to the detector is estimated by evaluating the integral of the transformed pdf over the range of the limiting angles measured from the preferred direction. A general formula for transforming the particle scattering pdf is derived from basic principles and applied to four important scattering pdf's; namely, isotropic scattering in the Lab system, isotropic neutron scattering in the center-of-mass system, thermal neutron scattering by the free gas model, and gamma-ray Klein-Nishina scattering. Some approximations have been made to these pdf's to enable analytical evaluations of the final integrals. These approximations are shown to be valid over a wide range of energies and for most elements. The particle scattering probability to spherical, planar circular, and right circular cylindrical detectors has been calculated using the new and previously reported direct approach. Results indicate that the new approach is valid and is computationally faster by orders of magnitude

Imaging multipole gravity anomaly sources by 3D probability tomography

International Nuclear Information System (INIS)

Alaia, Raffaele; Patella, Domenico; Mauriello, Paolo

2009-01-01

We present a generalized theory of the probability tomography applied to the gravity method, assuming that any Bouguer anomaly data set can be caused by a discrete number of monopoles, dipoles, quadrupoles and octopoles. These elementary sources are used to characterize, in an as detailed as possible way and without any a priori assumption, the shape and position of the most probable minimum structure of the gravity sources compatible with the observed data set, by picking out the location of their centres and peculiar points of their boundaries related to faces, edges and vertices. A few synthetic examples using simple geometries are discussed in order to demonstrate the notably enhanced resolution power of the new approach, compared with a previous formulation that used only monopoles and dipoles. A field example related to a gravity survey carried out in the volcanic area of Mount Etna (Sicily, Italy) is presented, aimed at imaging the geometry of the minimum gravity structure down to 8 km of depth bsl

Human errors evaluation for muster in emergency situations applying human error probability index (HEPI, in the oil company warehouse in Hamadan City

Directory of Open Access Journals (Sweden)

2012-12-01

Full Text Available Introduction: Emergency situation is one of the influencing factors on human error. The aim of this research was purpose to evaluate human error in emergency situation of fire and explosion at the oil company warehouse in Hamadan city applying human error probability index (HEPI. . Material and Method: First, the scenario of emergency situation of those situation of fire and explosion at the oil company warehouse was designed and then maneuver against, was performed. The scaled questionnaire of muster for the maneuver was completed in the next stage. Collected data were analyzed to calculate the probability success for the 18 actions required in an emergency situation from starting point of the muster until the latest action to temporary sheltersafe. .Result: The result showed that the highest probability of error occurrence was related to make safe workplace (evaluation phase with 32.4 % and lowest probability of occurrence error in detection alarm (awareness phase with 1.8 %, probability. The highest severity of error was in the evaluation phase and the lowest severity of error was in the awareness and recovery phase. Maximum risk level was related to the evaluating exit routes and selecting one route and choosy another exit route and minimum risk level was related to the four evaluation phases. . Conclusion: To reduce the risk of reaction in the exit phases of an emergency situation, the following actions are recommended, based on the finding in this study: A periodic evaluation of the exit phase and modifying them if necessary, conducting more maneuvers and analyzing this results along with a sufficient feedback to the employees.

Converting dose distributions into tumour control probability

International Nuclear Information System (INIS)

Nahum, A.E.

1996-01-01

The endpoints in radiotherapy that are truly of relevance are not dose distributions but the probability of local control, sometimes known as the Tumour Control Probability (TCP) and the Probability of Normal Tissue Complications (NTCP). A model for the estimation of TCP based on simple radiobiological considerations is described. It is shown that incorporation of inter-patient heterogeneity into the radiosensitivity parameter a through s a can result in a clinically realistic slope for the dose-response curve. The model is applied to inhomogeneous target dose distributions in order to demonstrate the relationship between dose uniformity and s a . The consequences of varying clonogenic density are also explored. Finally the model is applied to the target-volume DVHs for patients in a clinical trial of conformal pelvic radiotherapy; the effect of dose inhomogeneities on distributions of TCP are shown as well as the potential benefits of customizing the target dose according to normal-tissue DVHs. (author). 37 refs, 9 figs

Converting dose distributions into tumour control probability

Energy Technology Data Exchange (ETDEWEB)

Nahum, A E [The Royal Marsden Hospital, London (United Kingdom). Joint Dept. of Physics

1996-08-01

The endpoints in radiotherapy that are truly of relevance are not dose distributions but the probability of local control, sometimes known as the Tumour Control Probability (TCP) and the Probability of Normal Tissue Complications (NTCP). A model for the estimation of TCP based on simple radiobiological considerations is described. It is shown that incorporation of inter-patient heterogeneity into the radiosensitivity parameter a through s{sub a} can result in a clinically realistic slope for the dose-response curve. The model is applied to inhomogeneous target dose distributions in order to demonstrate the relationship between dose uniformity and s{sub a}. The consequences of varying clonogenic density are also explored. Finally the model is applied to the target-volume DVHs for patients in a clinical trial of conformal pelvic radiotherapy; the effect of dose inhomogeneities on distributions of TCP are shown as well as the potential benefits of customizing the target dose according to normal-tissue DVHs. (author). 37 refs, 9 figs.

Application of binomial and multinomial probability statistics to the sampling design process of a global grain tracing and recall system

Science.gov (United States)

Small, coded, pill-sized tracers embedded in grain are proposed as a method for grain traceability. A sampling process for a grain traceability system was designed and investigated by applying probability statistics using a science-based sampling approach to collect an adequate number of tracers fo...

A whole-of-curriculum approach to improving nursing students' applied numeracy skills.

Science.gov (United States)

van de Mortel, Thea F; Whitehair, Leeann P; Irwin, Pauletta M

2014-03-01

Nursing students often perform poorly on numeracy tests. Whilst one-off interventions have been trialled with limited success, a whole-of-curriculum approach may provide a better means of improving applied numeracy skills. The objective of the study is to assess the efficacy of a whole-of-curriculum approach in improving nursing students' applied numeracy skills. Two cycles of assessment, implementation and evaluation of strategies were conducted following a high fail rate in the final applied numeracy examination in a Bachelor of Nursing (BN) programme. Strategies included an early diagnostic assessment followed by referral to remediation, setting the pass mark at 100% for each of six applied numeracy examinations across the programme, and employing a specialist mathematics teacher to provide consistent numeracy teaching. The setting of the study is one Australian university. 1035 second and third year nursing students enrolled in four clinical nursing courses (CNC III, CNC IV, CNC V and CNC VI) were included. Data on the percentage of students who obtained 100% in their applied numeracy examination in up to two attempts were collected from CNCs III, IV, V and VI between 2008 and 2011. A four by two χ(2) contingency table was used to determine if the differences in the proportion of students achieving 100% across two examination attempts in each CNC were significantly different between 2008 and 2011. The percentage of students who obtained 100% correct answers on the applied numeracy examinations was significantly higher in 2011 than in 2008 in CNC III (χ(2)=272, 3; p<0.001), IV (χ(2)=94.7, 3; p<0.001) and VI (χ(2)=76.3, 3; p<0.001). A whole-of-curriculum approach to developing applied numeracy skills in BN students resulted in a substantial improvement in these skills over four years. Copyright © 2013 Elsevier Ltd. All rights reserved.

Probability: A Matter of Life and Death

Science.gov (United States)

Hassani, Mehdi; Kippen, Rebecca; Mills, Terence

2016-01-01

Life tables are mathematical tables that document probabilities of dying and life expectancies at different ages in a society. Thus, the life table contains some essential features of the health of a population. Probability is often regarded as a difficult branch of mathematics. Life tables provide an interesting approach to introducing concepts…

Fitness Probability Distribution of Bit-Flip Mutation.

Science.gov (United States)

Chicano, Francisco; Sutton, Andrew M; Whitley, L Darrell; Alba, Enrique

2015-01-01

Bit-flip mutation is a common mutation operator for evolutionary algorithms applied to optimize functions over binary strings. In this paper, we develop results from the theory of landscapes and Krawtchouk polynomials to exactly compute the probability distribution of fitness values of a binary string undergoing uniform bit-flip mutation. We prove that this probability distribution can be expressed as a polynomial in p, the probability of flipping each bit. We analyze these polynomials and provide closed-form expressions for an easy linear problem (Onemax), and an NP-hard problem, MAX-SAT. We also discuss a connection of the results with runtime analysis.

Probability of crack-initiation and application to NDE

Energy Technology Data Exchange (ETDEWEB)

Prantl, G [Nuclear Safety Inspectorate HSK, (Switzerland)

1988-12-31

Fracture toughness is a property with a certain variability. When a statistical distribution is assumed, the probability of crack initiation may be calculated for a given problem defined by its geometry and the applied stress. Experiments have shown, that cracks which experience a certain small amount of ductile growth can reliably be detected by acoustic emission measurements. The probability of crack detection by AE-techniques may be estimated using this experimental finding and the calculated probability of crack initiation. (author).

Probabilities, causes and propensities in physics

CERN Document Server

Suárez, Mauricio

2010-01-01

This volume defends a novel approach to the philosophy of physics: it is the first book devoted to a comparative study of probability, causality, and propensity, and their various interrelations, within the context of contemporary physics - particularly quantum and statistical physics. The philosophical debates and distinctions are firmly grounded upon examples from actual physics, thus exemplifying a robustly empiricist approach. The essays, by both prominent scholars in the field and promising young researchers, constitute a pioneer effort in bringing out the connections between probabilistic, causal and dispositional aspects of the quantum domain. This book will appeal to specialists in philosophy and foundations of physics, philosophy of science in general, metaphysics, ontology of physics theories, and philosophy of probability.

An empirical probability model of detecting species at low densities.

Science.gov (United States)

Delaney, David G; Leung, Brian

2010-06-01

False negatives, not detecting things that are actually present, are an important but understudied problem. False negatives are the result of our inability to perfectly detect species, especially those at low density such as endangered species or newly arriving introduced species. They reduce our ability to interpret presence-absence survey data and make sound management decisions (e.g., rapid response). To reduce the probability of false negatives, we need to compare the efficacy and sensitivity of different sampling approaches and quantify an unbiased estimate of the probability of detection. We conducted field experiments in the intertidal zone of New England and New York to test the sensitivity of two sampling approaches (quadrat vs. total area search, TAS), given different target characteristics (mobile vs. sessile). Using logistic regression we built detection curves for each sampling approach that related the sampling intensity and the density of targets to the probability of detection. The TAS approach reduced the probability of false negatives and detected targets faster than the quadrat approach. Mobility of targets increased the time to detection but did not affect detection success. Finally, we interpreted two years of presence-absence data on the distribution of the Asian shore crab (Hemigrapsus sanguineus) in New England and New York, using our probability model for false negatives. The type of experimental approach in this paper can help to reduce false negatives and increase our ability to detect species at low densities by refining sampling approaches, which can guide conservation strategies and management decisions in various areas of ecology such as conservation biology and invasion ecology.

Non-parametric adaptive importance sampling for the probability estimation of a launcher impact position

International Nuclear Information System (INIS)

Morio, Jerome

2011-01-01

Importance sampling (IS) is a useful simulation technique to estimate critical probability with a better accuracy than Monte Carlo methods. It consists in generating random weighted samples from an auxiliary distribution rather than the distribution of interest. The crucial part of this algorithm is the choice of an efficient auxiliary PDF that has to be able to simulate more rare random events. The optimisation of this auxiliary distribution is often in practice very difficult. In this article, we propose to approach the IS optimal auxiliary density with non-parametric adaptive importance sampling (NAIS). We apply this technique for the probability estimation of spatial launcher impact position since it has currently become a more and more important issue in the field of aeronautics.

A Bayesian joint probability modeling approach for seasonal forecasting of streamflows at multiple sites

Science.gov (United States)

Wang, Q. J.; Robertson, D. E.; Chiew, F. H. S.

2009-05-01

Seasonal forecasting of streamflows can be highly valuable for water resources management. In this paper, a Bayesian joint probability (BJP) modeling approach for seasonal forecasting of streamflows at multiple sites is presented. A Box-Cox transformed multivariate normal distribution is proposed to model the joint distribution of future streamflows and their predictors such as antecedent streamflows and El Niño-Southern Oscillation indices and other climate indicators. Bayesian inference of model parameters and uncertainties is implemented using Markov chain Monte Carlo sampling, leading to joint probabilistic forecasts of streamflows at multiple sites. The model provides a parametric structure for quantifying relationships between variables, including intersite correlations. The Box-Cox transformed multivariate normal distribution has considerable flexibility for modeling a wide range of predictors and predictands. The Bayesian inference formulated allows the use of data that contain nonconcurrent and missing records. The model flexibility and data-handling ability means that the BJP modeling approach is potentially of wide practical application. The paper also presents a number of statistical measures and graphical methods for verification of probabilistic forecasts of continuous variables. Results for streamflows at three river gauges in the Murrumbidgee River catchment in southeast Australia show that the BJP modeling approach has good forecast quality and that the fitted model is consistent with observed data.

Faster exact Markovian probability functions for motif occurrences: a DFA-only approach.

Science.gov (United States)

Ribeca, Paolo; Raineri, Emanuele

2008-12-15

The computation of the statistical properties of motif occurrences has an obviously relevant application: patterns that are significantly over- or under-represented in genomes or proteins are interesting candidates for biological roles. However, the problem is computationally hard; as a result, virtually all the existing motif finders use fast but approximate scoring functions, in spite of the fact that they have been shown to produce systematically incorrect results. A few interesting exact approaches are known, but they are very slow and hence not practical in the case of realistic sequences. We give an exact solution, solely based on deterministic finite-state automata (DFA), to the problem of finding the whole relevant part of the probability distribution function of a simple-word motif in a homogeneous (biological) sequence. Out of that, the z-value can always be computed, while the P-value can be obtained either when it is not too extreme with respect to the number of floating-point digits available in the implementation, or when the number of pattern occurrences is moderately low. In particular, the time complexity of the algorithms for Markov models of moderate order (0 manage to obtain an algorithm which is both easily interpretable and efficient. This approach can be used for exact statistical studies of very long genomes and protein sequences, as we illustrate with some examples on the scale of the human genome.

Applying Petri nets in modelling the human factor

International Nuclear Information System (INIS)

Bedreaga, Luminita; Constntinescu, Cristina; Guzun, Basarab

2007-01-01

Usually, in the reliability analysis performed for complex systems, we determine the success probability to work with other performance indices, i.e. the likelihood associated with a given state. The possible values assigned to system states can be derived using inductive methods. If one wants to calculate the probability to occur a particular event in the system, then deductive methods should be applied. In the particular case of the human reliability analysis, as part of probabilistic safety analysis, the international regulatory commission have developed specific guides and procedures to perform such assessments. The paper presents the modality to obtain the human reliability quantification using the Petri nets approach. This is an efficient means to assess reliability systems because of their specific features. The examples showed in the paper are from human reliability documentation without a detailed human factor analysis (qualitative). We present human action modelling using event trees and Petri nets approach. The obtained results by these two kinds of methods are in good concordance. (authors)

Challenges and Limitations of Applying an Emotion-driven Design Approach on Elderly Users

DEFF Research Database (Denmark)

Andersen, Casper L.; Gudmundsson, Hjalte P.; Achiche, Sofiane

2011-01-01

a competitive advantage for companies. In this paper, challenges of applying an emotion-driven design approach applied on elderly people, in order to identify their user needs towards walking frames, are discussed. The discussion will be based on the experiences and results obtained from the case study...... related to the participants’ age and cognitive abilities. The challenges encountered are discussed and guidelines on what should be taken into account to facilitate an emotion-driven design approach for elderly people are proposed....

Probabilistic Approach to Provide Scenarios of Earthquake-Induced Slope Failures (PARSIFAL Applied to the Alcoy Basin (South Spain

Directory of Open Access Journals (Sweden)

Salvatore Martino

2018-02-01

Full Text Available The PARSIFAL (Probabilistic Approach to pRovide Scenarios of earthquake-Induced slope FAiLures approach was applied in the basin of Alcoy (Alicante, South Spain, to provide a comprehensive scenario of earthquake-induced landslides. The basin of Alcoy is well known for several historical landslides, mainly represented by earth-slides, that involve urban settlement as well as infrastructures (i.e., roads, bridges. The PARSIFAL overcomes several limits existing in other approaches, allowing the concomitant analyses of: (i first-time landslides (due to both rock-slope failures and shallow earth-slides and reactivations of existing landslides; (ii slope stability analyses of different failure mechanisms; (iii comprehensive mapping of earthquake-induced landslide scenarios in terms of exceedance probability of critical threshold values of co-seismic displacements. Geotechnical data were used to constrain the slope stability analysis, while specific field surveys were carried out to measure jointing and strength conditions of rock masses and to inventory already existing landslides. GIS-based susceptibility analyses were performed to assess the proneness to shallow earth-slides as well as to verify kinematic compatibility to planar or wedge rock-slides and to topples. The experienced application of PARSIFAL to the Alcoy basin: (i confirms the suitability of the approach at a municipality scale, (ii outputs the main role of saturation in conditioning slope instabilities in this case study, (iii demonstrates the reliability of the obtained results respect to the historical data.

Quantitative non-monotonic modeling of economic uncertainty by probability and possibility distributions

DEFF Research Database (Denmark)

Schjær-Jacobsen, Hans

2012-01-01

uncertainty can be calculated. The possibility approach is particular well suited for representation of uncertainty of a non-statistical nature due to lack of knowledge and requires less information than the probability approach. Based on the kind of uncertainty and knowledge present, these aspects...... to the understanding of similarities and differences of the two approaches as well as practical applications. The probability approach offers a good framework for representation of randomness and variability. Once the probability distributions of uncertain parameters and their correlations are known the resulting...... are thoroughly discussed in the case of rectangular representation of uncertainty by the uniform probability distribution and the interval, respectively. Also triangular representations are dealt with and compared. Calculation of monotonic as well as non-monotonic functions of variables represented...

A Generic Simulation Approach for the Fast and Accurate Estimation of the Outage Probability of Single Hop and Multihop FSO Links Subject to Generalized Pointing Errors

KAUST Repository

Ben Issaid, Chaouki; Park, Kihong; Alouini, Mohamed-Slim

2017-01-01

When assessing the performance of the free space optical (FSO) communication systems, the outage probability encountered is generally very small, and thereby the use of nave Monte Carlo simulations becomes prohibitively expensive. To estimate these rare event probabilities, we propose in this work an importance sampling approach which is based on the exponential twisting technique to offer fast and accurate results. In fact, we consider a variety of turbulence regimes, and we investigate the outage probability of FSO communication systems, under a generalized pointing error model based on the Beckmann distribution, for both single and multihop scenarios. Selected numerical simulations are presented to show the accuracy and the efficiency of our approach compared to naive Monte Carlo.

A Generic Simulation Approach for the Fast and Accurate Estimation of the Outage Probability of Single Hop and Multihop FSO Links Subject to Generalized Pointing Errors

KAUST Repository

Ben Issaid, Chaouki

2017-07-28

When assessing the performance of the free space optical (FSO) communication systems, the outage probability encountered is generally very small, and thereby the use of nave Monte Carlo simulations becomes prohibitively expensive. To estimate these rare event probabilities, we propose in this work an importance sampling approach which is based on the exponential twisting technique to offer fast and accurate results. In fact, we consider a variety of turbulence regimes, and we investigate the outage probability of FSO communication systems, under a generalized pointing error model based on the Beckmann distribution, for both single and multihop scenarios. Selected numerical simulations are presented to show the accuracy and the efficiency of our approach compared to naive Monte Carlo.

Risk Probability Estimating Based on Clustering

DEFF Research Database (Denmark)

Chen, Yong; Jensen, Christian D.; Gray, Elizabeth

2003-01-01

of prior experiences, recommendations from a trusted entity or the reputation of the other entity. In this paper we propose a dynamic mechanism for estimating the risk probability of a certain interaction in a given environment using hybrid neural networks. We argue that traditional risk assessment models...... from the insurance industry do not directly apply to ubiquitous computing environments. Instead, we propose a dynamic mechanism for risk assessment, which is based on pattern matching, classification and prediction procedures. This mechanism uses an estimator of risk probability, which is based...

Duelling idiots and other probability puzzlers

CERN Document Server

Nahin, Paul J

2002-01-01

What are your chances of dying on your next flight, being called for jury duty, or winning the lottery? We all encounter probability problems in our everyday lives. In this collection of twenty-one puzzles, Paul Nahin challenges us to think creatively about the laws of probability as they apply in playful, sometimes deceptive, ways to a fascinating array of speculative situations. Games of Russian roulette, problems involving the accumulation of insects on flypaper, and strategies for determining the odds of the underdog winning the World Series all reveal intriguing dimensions to the worki

Problems involved in calculating the probability of rare occurrences

International Nuclear Information System (INIS)

Tittes, E.

1986-01-01

Also with regard to the characteristics such as occurrence probability or occurrence rate, there are limits which have to be observed, or else probability data and thus the concept of determinable risk itself will lose its practical value. The mathematical models applied for probability assessment are based on data supplied by the insurance companies, reliability experts in the automobile industry, or by planning experts in the field of traffic or information supply. (DG) [de

Towards a Categorical Account of Conditional Probability

Directory of Open Access Journals (Sweden)

Robert Furber

2015-11-01

Full Text Available This paper presents a categorical account of conditional probability, covering both the classical and the quantum case. Classical conditional probabilities are expressed as a certain "triangle-fill-in" condition, connecting marginal and joint probabilities, in the Kleisli category of the distribution monad. The conditional probabilities are induced by a map together with a predicate (the condition. The latter is a predicate in the logic of effect modules on this Kleisli category. This same approach can be transferred to the category of C*-algebras (with positive unital maps, whose predicate logic is also expressed in terms of effect modules. Conditional probabilities can again be expressed via a triangle-fill-in property. In the literature, there are several proposals for what quantum conditional probability should be, and also there are extra difficulties not present in the classical case. At this stage, we only describe quantum systems with classical parametrization.

Failure probability analysis of optical grid

Science.gov (United States)

Zhong, Yaoquan; Guo, Wei; Sun, Weiqiang; Jin, Yaohui; Hu, Weisheng

2008-11-01

Optical grid, the integrated computing environment based on optical network, is expected to be an efficient infrastructure to support advanced data-intensive grid applications. In optical grid, the faults of both computational and network resources are inevitable due to the large scale and high complexity of the system. With the optical network based distributed computing systems extensive applied in the processing of data, the requirement of the application failure probability have been an important indicator of the quality of application and an important aspect the operators consider. This paper will present a task-based analysis method of the application failure probability in optical grid. Then the failure probability of the entire application can be quantified, and the performance of reducing application failure probability in different backup strategies can be compared, so that the different requirements of different clients can be satisfied according to the application failure probability respectively. In optical grid, when the application based DAG (directed acyclic graph) is executed in different backup strategies, the application failure probability and the application complete time is different. This paper will propose new multi-objective differentiated services algorithm (MDSA). New application scheduling algorithm can guarantee the requirement of the failure probability and improve the network resource utilization, realize a compromise between the network operator and the application submission. Then differentiated services can be achieved in optical grid.

Uncertainty the soul of modeling, probability & statistics

CERN Document Server

Briggs, William

2016-01-01

This book presents a philosophical approach to probability and probabilistic thinking, considering the underpinnings of probabilistic reasoning and modeling, which effectively underlie everything in data science. The ultimate goal is to call into question many standard tenets and lay the philosophical and probabilistic groundwork and infrastructure for statistical modeling. It is the first book devoted to the philosophy of data aimed at working scientists and calls for a new consideration in the practice of probability and statistics to eliminate what has been referred to as the "Cult of Statistical Significance". The book explains the philosophy of these ideas and not the mathematics, though there are a handful of mathematical examples. The topics are logically laid out, starting with basic philosophy as related to probability, statistics, and science, and stepping through the key probabilistic ideas and concepts, and ending with statistical models. Its jargon-free approach asserts that standard methods, suc...

Generalized Probability-Probability Plots

NARCIS (Netherlands)

Mushkudiani, N.A.; Einmahl, J.H.J.

2004-01-01

We introduce generalized Probability-Probability (P-P) plots in order to study the one-sample goodness-of-fit problem and the two-sample problem, for real valued data.These plots, that are constructed by indexing with the class of closed intervals, globally preserve the properties of classical P-P

Thermal disadvantage factor calculation by the multiregion collision probability method

International Nuclear Information System (INIS)

Ozgener, B.; Ozgener, H.A.

2004-01-01

A multi-region collision probability formulation that is capable of applying white boundary condition directly is presented and applied to thermal neutron transport problems. The disadvantage factors computed are compared with their counterparts calculated by S N methods with both direct and indirect application of white boundary condition. The results of the ABH and collision probability method with indirect application of white boundary condition are also considered and comparisons with benchmark Monte Carlo results are carried out. The studies show that the proposed formulation is capable of calculating thermal disadvantage factor with sufficient accuracy without resorting to the fictitious scattering outer shell approximation associated with the indirect application of the white boundary condition in collision probability solutions

Imprecise Probability Methods for Weapons UQ

Energy Technology Data Exchange (ETDEWEB)

Picard, Richard Roy [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Vander Wiel, Scott Alan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2016-05-13

Building on recent work in uncertainty quanti cation, we examine the use of imprecise probability methods to better characterize expert knowledge and to improve on misleading aspects of Bayesian analysis with informative prior distributions. Quantitative approaches to incorporate uncertainties in weapons certi cation are subject to rigorous external peer review, and in this regard, certain imprecise probability methods are well established in the literature and attractive. These methods are illustrated using experimental data from LANL detonator impact testing.

Probability Aggregates in Probability Answer Set Programming

OpenAIRE

Saad, Emad

2013-01-01

Probability answer set programming is a declarative programming that has been shown effective for representing and reasoning about a variety of probability reasoning tasks. However, the lack of probability aggregates, e.g. {\\em expected values}, in the language of disjunctive hybrid probability logic programs (DHPP) disallows the natural and concise representation of many interesting problems. In this paper, we extend DHPP to allow arbitrary probability aggregates. We introduce two types of p...

Scoring Rules for Subjective Probability Distributions

DEFF Research Database (Denmark)

Harrison, Glenn W.; Martínez-Correa, Jimmy; Swarthout, J. Todd

The theoretical literature has a rich characterization of scoring rules for eliciting the subjective beliefs that an individual has for continuous events, but under the restrictive assumption of risk neutrality. It is well known that risk aversion can dramatically affect the incentives to correctly...... report the true subjective probability of a binary event, even under Subjective Expected Utility. To address this one can “calibrate” inferences about true subjective probabilities from elicited subjective probabilities over binary events, recognizing the incentives that risk averse agents have...... to distort reports. We characterize the comparable implications of the general case of a risk averse agent when facing a popular scoring rule over continuous events, and find that these concerns do not apply with anything like the same force. For empirically plausible levels of risk aversion, one can...

Some simple applications of probability models to birth intervals

International Nuclear Information System (INIS)

Shrestha, G.

1987-07-01

An attempt has been made in this paper to apply some simple probability models to birth intervals under the assumption of constant fecundability and varying fecundability among women. The parameters of the probability models are estimated by using the method of moments and the method of maximum likelihood. (author). 9 refs, 2 tabs

Optimum Inductive Methods. A study in Inductive Probability, Bayesian Statistics, and Verisimilitude.

NARCIS (Netherlands)

Festa, Roberto

1992-01-01

According to the Bayesian view, scientific hypotheses must be appraised in terms of their posterior probabilities relative to the available experimental data. Such posterior probabilities are derived from the prior probabilities of the hypotheses by applying Bayes'theorem. One of the most important

Calculation of the uncertainty in complication probability for various dose-response models, applied to the parotid gland

International Nuclear Information System (INIS)

Schilstra, C.; Meertens, H.

2001-01-01

Purpose: Usually, models that predict normal tissue complication probability (NTCP) are fitted to clinical data with the maximum likelihood (ML) method. This method inevitably causes a loss of information contained in the data. In this study, an alternative method is investigated that calculates the parameter probability distribution (PD), and, thus, conserves all information. The PD method also allows the calculation of the uncertainty in the NTCP, which is an (often-neglected) prerequisite for the intercomparison of both treatment plans and NTCP models. The PD and ML methods are applied to parotid gland data, and the results are compared. Methods and Materials: The drop in salivary flow due to radiotherapy was measured in 25 parotid glands of 15 patients. Together with the parotid gland dose-volume histograms (DVH), this enabled the calculation of the parameter PDs for three different NTCP models (Lyman, relative seriality, and critical volume). From these PDs, the NTCP and its uncertainty could be calculated for arbitrary parotid gland DVHs. ML parameters and resulting NTCP values were calculated also. Results: All models fitted equally well. The parameter PDs turned out to have nonnormal shapes and long tails. The NTCP predictions of the ML and PD method usually differed considerably, depending on the NTCP model and the nature of irradiation. NTCP curves and ML parameters suggested a highly parallel organization of the parotid gland. Conclusions: Considering the substantial differences between the NTCP predictions of the ML and PD method, the use of the PD method is preferred, because this is the only method that takes all information contained in the clinical data into account. Furthermore, PD method gives a true measure of the uncertainty in the NTCP

Using Fuzzy Probability Weights in Cumulative Prospect Theory

Directory of Open Access Journals (Sweden)

Užga-Rebrovs Oļegs

2016-12-01

Full Text Available During the past years, a rapid growth has been seen in the descriptive approaches to decision choice. As opposed to normative expected utility theory, these approaches are based on the subjective perception of probabilities by the individuals, which takes place in real situations of risky choice. The modelling of this kind of perceptions is made on the basis of probability weighting functions. In cumulative prospect theory, which is the focus of this paper, decision prospect outcome weights are calculated using the obtained probability weights. If the value functions are constructed in the sets of positive and negative outcomes, then, based on the outcome value evaluations and outcome decision weights, generalised evaluations of prospect value are calculated, which are the basis for choosing an optimal prospect.

Maximum Entropy and Probability Kinematics Constrained by Conditionals

Directory of Open Access Journals (Sweden)

Stefan Lukits

2015-03-01

Full Text Available Two open questions of inductive reasoning are solved: (1 does the principle of maximum entropy (PME give a solution to the obverse Majerník problem; and (2 isWagner correct when he claims that Jeffrey’s updating principle (JUP contradicts PME? Majerník shows that PME provides unique and plausible marginal probabilities, given conditional probabilities. The obverse problem posed here is whether PME also provides such conditional probabilities, given certain marginal probabilities. The theorem developed to solve the obverse Majerník problem demonstrates that in the special case introduced by Wagner PME does not contradict JUP, but elegantly generalizes it and offers a more integrated approach to probability updating.

Universal critical wrapping probabilities in the canonical ensemble

Directory of Open Access Journals (Sweden)

Hao Hu

2015-09-01

Full Text Available Universal dimensionless quantities, such as Binder ratios and wrapping probabilities, play an important role in the study of critical phenomena. We study the finite-size scaling behavior of the wrapping probability for the Potts model in the random-cluster representation, under the constraint that the total number of occupied bonds is fixed, so that the canonical ensemble applies. We derive that, in the limit L→∞, the critical values of the wrapping probability are different from those of the unconstrained model, i.e. the model in the grand-canonical ensemble, but still universal, for systems with 2yt−d>0 where yt=1/ν is the thermal renormalization exponent and d is the spatial dimension. Similar modifications apply to other dimensionless quantities, such as Binder ratios. For systems with 2yt−d≤0, these quantities share same critical universal values in the two ensembles. It is also derived that new finite-size corrections are induced. These findings apply more generally to systems in the canonical ensemble, e.g. the dilute Potts model with a fixed total number of vacancies. Finally, we formulate an efficient cluster-type algorithm for the canonical ensemble, and confirm these predictions by extensive simulations.

Comparing linear probability model coefficients across groups

DEFF Research Database (Denmark)

Holm, Anders; Ejrnæs, Mette; Karlson, Kristian Bernt

2015-01-01

of the following three components: outcome truncation, scale parameters and distributional shape of the predictor variable. These results point to limitations in using linear probability model coefficients for group comparisons. We also provide Monte Carlo simulations and real examples to illustrate......This article offers a formal identification analysis of the problem in comparing coefficients from linear probability models between groups. We show that differences in coefficients from these models can result not only from genuine differences in effects, but also from differences in one or more...... these limitations, and we suggest a restricted approach to using linear probability model coefficients in group comparisons....

Constructing inverse probability weights for continuous exposures: a comparison of methods.

Science.gov (United States)

Naimi, Ashley I; Moodie, Erica E M; Auger, Nathalie; Kaufman, Jay S

2014-03-01

Inverse probability-weighted marginal structural models with binary exposures are common in epidemiology. Constructing inverse probability weights for a continuous exposure can be complicated by the presence of outliers, and the need to identify a parametric form for the exposure and account for nonconstant exposure variance. We explored the performance of various methods to construct inverse probability weights for continuous exposures using Monte Carlo simulation. We generated two continuous exposures and binary outcomes using data sampled from a large empirical cohort. The first exposure followed a normal distribution with homoscedastic variance. The second exposure followed a contaminated Poisson distribution, with heteroscedastic variance equal to the conditional mean. We assessed six methods to construct inverse probability weights using: a normal distribution, a normal distribution with heteroscedastic variance, a truncated normal distribution with heteroscedastic variance, a gamma distribution, a t distribution (1, 3, and 5 degrees of freedom), and a quantile binning approach (based on 10, 15, and 20 exposure categories). We estimated the marginal odds ratio for a single-unit increase in each simulated exposure in a regression model weighted by the inverse probability weights constructed using each approach, and then computed the bias and mean squared error for each method. For the homoscedastic exposure, the standard normal, gamma, and quantile binning approaches performed best. For the heteroscedastic exposure, the quantile binning, gamma, and heteroscedastic normal approaches performed best. Our results suggest that the quantile binning approach is a simple and versatile way to construct inverse probability weights for continuous exposures.

The probability of a tornado missile hitting a target

International Nuclear Information System (INIS)

Goodman, J.; Koch, J.E.

1983-01-01

It is shown that tornado missile transportation is a diffusion Markovian process. Therefore, the Green's function method is applied for the estimation of the probability of hitting a unit target area. This propability is expressed through a joint density of tornado intensity and path area, a probability of tornado missile injection and a tornado missile height distribution. (orig.)

Blended Risk Approach in Applying PSA Models to Risk-Based Regulations

International Nuclear Information System (INIS)

Dimitrijevic, V. B.; Chapman, J. R.

1996-01-01

In this paper, the authors will discuss a modern approach in applying PSA models in risk-based regulation. The Blended Risk Approach is a combination of traditional and probabilistic processes. It is receiving increased attention in different industries in the U. S. and abroad. The use of the deterministic regulations and standards provides a proven and well understood basis on which to assess and communicate the impact of change to plant design and operation. Incorporation of traditional values into risk evaluation is working very well in the blended approach. This approach is very application specific. It includes multiple risk attributes, qualitative risk analysis, and basic deterministic principles. In blending deterministic and probabilistic principles, this approach ensures that the objectives of the traditional defense-in-depth concept are not compromised and the design basis of the plant is explicitly considered. (author)

Representing Uncertainty by Probability and Possibility

DEFF Research Database (Denmark)

of uncertain parameters. Monte Carlo simulation is readily used for practical calculations. However, an alternative approach is offered by possibility theory making use of possibility distributions such as intervals and fuzzy intervals. This approach is well suited to represent lack of knowledge or imprecision......Uncertain parameters in modeling are usually represented by probability distributions reflecting either the objective uncertainty of the parameters or the subjective belief held by the model builder. This approach is particularly suited for representing the statistical nature or variance...

Hydra-Ring: a computational framework to combine failure probabilities

Science.gov (United States)

Diermanse, Ferdinand; Roscoe, Kathryn; IJmker, Janneke; Mens, Marjolein; Bouwer, Laurens

2013-04-01

This presentation discusses the development of a new computational framework for the safety assessment of flood defence systems: Hydra-Ring. Hydra-Ring computes the failure probability of a flood defence system, which is composed of a number of elements (e.g., dike segments, dune segments or hydraulic structures), taking all relevant uncertainties explicitly into account. This is a major step forward in comparison with the current Dutch practice in which the safety assessment is done separately per individual flood defence section. The main advantage of the new approach is that it will result in a more balanced prioratization of required mitigating measures ('more value for money'). Failure of the flood defence system occurs if any element within the system fails. Hydra-Ring thus computes and combines failure probabilities of the following elements: - Failure mechanisms: A flood defence system can fail due to different failure mechanisms. - Time periods: failure probabilities are first computed for relatively small time scales (assessment of flood defense systems, Hydra-Ring can also be used to derive fragility curves, to asses the efficiency of flood mitigating measures, and to quantify the impact of climate change and land subsidence on flood risk. Hydra-Ring is being developed in the context of the Dutch situation. However, the computational concept is generic and the model is set up in such a way that it can be applied to other areas as well. The presentation will focus on the model concept and probabilistic computation techniques.

Continuation of probability density functions using a generalized Lyapunov approach

NARCIS (Netherlands)

Baars, S.; Viebahn, J. P.; Mulder, T. E.; Kuehn, C.; Wubs, F. W.; Dijkstra, H. A.

2017-01-01

Techniques from numerical bifurcation theory are very useful to study transitions between steady fluid flow patterns and the instabilities involved. Here, we provide computational methodology to use parameter continuation in determining probability density functions of systems of stochastic partial

Probability Theory Plus Noise: Descriptive Estimation and Inferential Judgment.

Science.gov (United States)

Costello, Fintan; Watts, Paul

2018-01-01

We describe a computational model of two central aspects of people's probabilistic reasoning: descriptive probability estimation and inferential probability judgment. This model assumes that people's reasoning follows standard frequentist probability theory, but it is subject to random noise. This random noise has a regressive effect in descriptive probability estimation, moving probability estimates away from normative probabilities and toward the center of the probability scale. This random noise has an anti-regressive effect in inferential judgement, however. These regressive and anti-regressive effects explain various reliable and systematic biases seen in people's descriptive probability estimation and inferential probability judgment. This model predicts that these contrary effects will tend to cancel out in tasks that involve both descriptive estimation and inferential judgement, leading to unbiased responses in those tasks. We test this model by applying it to one such task, described by Gallistel et al. ). Participants' median responses in this task were unbiased, agreeing with normative probability theory over the full range of responses. Our model captures the pattern of unbiased responses in this task, while simultaneously explaining systematic biases away from normatively correct probabilities seen in other tasks. Copyright © 2018 Cognitive Science Society, Inc.

Negative probability in the framework of combined probability

OpenAIRE

Burgin, Mark

2013-01-01

Negative probability has found diverse applications in theoretical physics. Thus, construction of sound and rigorous mathematical foundations for negative probability is important for physics. There are different axiomatizations of conventional probability. So, it is natural that negative probability also has different axiomatic frameworks. In the previous publications (Burgin, 2009; 2010), negative probability was mathematically formalized and rigorously interpreted in the context of extende...

Introduction to probability and statistics for engineers and scientists

CERN Document Server

Ross, Sheldon M

2009-01-01

This updated text provides a superior introduction to applied probability and statistics for engineering or science majors. Ross emphasizes the manner in which probability yields insight into statistical problems; ultimately resulting in an intuitive understanding of the statistical procedures most often used by practicing engineers and scientists. Real data sets are incorporated in a wide variety of exercises and examples throughout the book, and this emphasis on data motivates the probability coverage.As with the previous editions, Ross' text has remendously clear exposition, plus real-data

Path probabilities of continuous time random walks

International Nuclear Information System (INIS)

Eule, Stephan; Friedrich, Rudolf

2014-01-01

Employing the path integral formulation of a broad class of anomalous diffusion processes, we derive the exact relations for the path probability densities of these processes. In particular, we obtain a closed analytical solution for the path probability distribution of a Continuous Time Random Walk (CTRW) process. This solution is given in terms of its waiting time distribution and short time propagator of the corresponding random walk as a solution of a Dyson equation. Applying our analytical solution we derive generalized Feynman–Kac formulae. (paper)

Predicting binary choices from probability phrase meanings.

Science.gov (United States)

Wallsten, Thomas S; Jang, Yoonhee

2008-08-01

The issues of how individuals decide which of two events is more likely and of how they understand probability phrases both involve judging relative likelihoods. In this study, we investigated whether derived scales representing probability phrase meanings could be used within a choice model to predict independently observed binary choices. If they can, this simultaneously provides support for our model and suggests that the phrase meanings are measured meaningfully. The model assumes that, when deciding which of two events is more likely, judges take a single sample from memory regarding each event and respond accordingly. The model predicts choice probabilities by using the scaled meanings of individually selected probability phrases as proxies for confidence distributions associated with sampling from memory. Predictions are sustained for 34 of 41 participants but, nevertheless, are biased slightly low. Sequential sampling models improve the fit. The results have both theoretical and applied implications.

Method to Calculate Accurate Top Event Probability in a Seismic PSA

Energy Technology Data Exchange (ETDEWEB)

Jung, Woo Sik [Sejong Univ., Seoul (Korea, Republic of)

2014-05-15

ACUBE(Advanced Cutset Upper Bound Estimator) calculates the top event probability and importance measures from cutsets by dividing cutsets into major and minor groups depending on the cutset probability, where the cutsets that have higher cutset probability are included in the major group and the others in minor cutsets, converting major cutsets into a Binary Decision Diagram (BDD). By applying the ACUBE algorithm to the seismic PSA cutsets, the accuracy of a top event probability and importance measures can be significantly improved. ACUBE works by dividing the cutsets into two groups (higher and lower cutset probability groups), calculating the top event probability and importance measures in each group, and combining the two results from the two groups. Here, ACUBE calculates the top event probability and importance measures of the higher cutset probability group exactly. On the other hand, ACUBE calculates these measures of the lower cutset probability group with an approximation such as MCUB. The ACUBE algorithm is useful for decreasing the conservatism that is caused by approximating the top event probability and importance measure calculations with given cutsets. By applying the ACUBE algorithm to the seismic PSA cutsets, the accuracy of a top event probability and importance measures can be significantly improved. This study shows that careful attention should be paid and an appropriate method be provided in order to avoid the significant overestimation of the top event probability calculation. Due to the strength of ACUBE that is explained in this study, the ACUBE became a vital tool for calculating more accurate CDF of the seismic PSA cutsets than the conventional probability calculation method.

Bayesian estimation applied to multiple species

International Nuclear Information System (INIS)

Kunz, Martin; Bassett, Bruce A.; Hlozek, Renee A.

2007-01-01

Observed data are often contaminated by undiscovered interlopers, leading to biased parameter estimation. Here we present BEAMS (Bayesian estimation applied to multiple species) which significantly improves on the standard maximum likelihood approach in the case where the probability for each data point being ''pure'' is known. We discuss the application of BEAMS to future type-Ia supernovae (SNIa) surveys, such as LSST, which are projected to deliver over a million supernovae light curves without spectra. The multiband light curves for each candidate will provide a probability of being Ia (pure) but the full sample will be significantly contaminated with other types of supernovae and transients. Given a sample of N supernovae with mean probability, , of being Ia, BEAMS delivers parameter constraints equal to N spectroscopically confirmed SNIa. In addition BEAMS can be simultaneously used to tease apart different families of data and to recover properties of the underlying distributions of those families (e.g. the type-Ibc and II distributions). Hence BEAMS provides a unified classification and parameter estimation methodology which may be useful in a diverse range of problems such as photometric redshift estimation or, indeed, any parameter estimation problem where contamination is an issue

Study on probability distribution of fire scenarios in risk assessment to emergency evacuation

International Nuclear Information System (INIS)

Chu Guanquan; Wang Jinhui

2012-01-01

Event tree analysis (ETA) is a frequently-used technique to analyze the probability of probable fire scenario. The event probability is usually characterized by definite value. It is not appropriate to use definite value as these estimates may be the result of poor quality statistics and limited knowledge. Without addressing uncertainties, ETA will give imprecise results. The credibility of risk assessment will be undermined. This paper presents an approach to address event probability uncertainties and analyze probability distribution of probable fire scenario. ETA is performed to construct probable fire scenarios. The activation time of every event is characterized as stochastic variable by considering uncertainties of fire growth rate and other input variables. To obtain probability distribution of probable fire scenario, Markov Chain is proposed to combine with ETA. To demonstrate the approach, a case study is presented.

Fixation Probability in a Haploid-Diploid Population.

Science.gov (United States)

Bessho, Kazuhiro; Otto, Sarah P

2017-01-01

Classical population genetic theory generally assumes either a fully haploid or fully diploid life cycle. However, many organisms exhibit more complex life cycles, with both free-living haploid and diploid stages. Here we ask what the probability of fixation is for selected alleles in organisms with haploid-diploid life cycles. We develop a genetic model that considers the population dynamics using both the Moran model and Wright-Fisher model. Applying a branching process approximation, we obtain an accurate fixation probability assuming that the population is large and the net effect of the mutation is beneficial. We also find the diffusion approximation for the fixation probability, which is accurate even in small populations and for deleterious alleles, as long as selection is weak. These fixation probabilities from branching process and diffusion approximations are similar when selection is weak for beneficial mutations that are not fully recessive. In many cases, particularly when one phase predominates, the fixation probability differs substantially for haploid-diploid organisms compared to either fully haploid or diploid species. Copyright © 2017 by the Genetics Society of America.

Knowledge typology for imprecise probabilities.

Energy Technology Data Exchange (ETDEWEB)

Wilson, G. D. (Gregory D.); Zucker, L. J. (Lauren J.)

2002-01-01

When characterizing the reliability of a complex system there are often gaps in the data available for specific subsystems or other factors influencing total system reliability. At Los Alamos National Laboratory we employ ethnographic methods to elicit expert knowledge when traditional data is scarce. Typically, we elicit expert knowledge in probabilistic terms. This paper will explore how we might approach elicitation if methods other than probability (i.e., Dempster-Shafer, or fuzzy sets) prove more useful for quantifying certain types of expert knowledge. Specifically, we will consider if experts have different types of knowledge that may be better characterized in ways other than standard probability theory.

Addressing dependability by applying an approach for model-based risk assessment

International Nuclear Information System (INIS)

Gran, Bjorn Axel; Fredriksen, Rune; Thunem, Atoosa P.-J.

2007-01-01

This paper describes how an approach for model-based risk assessment (MBRA) can be applied for addressing different dependability factors in a critical application. Dependability factors, such as availability, reliability, safety and security, are important when assessing the dependability degree of total systems involving digital instrumentation and control (I and C) sub-systems. In order to identify risk sources their roles with regard to intentional system aspects such as system functions, component behaviours and intercommunications must be clarified. Traditional risk assessment is based on fault or risk models of the system. In contrast to this, MBRA utilizes success-oriented models describing all intended system aspects, including functional, operational and organizational aspects of the target. The EU-funded CORAS project developed a tool-supported methodology for the application of MBRA in security-critical systems. The methodology has been tried out within the telemedicine and e-commerce areas, and provided through a series of seven trials a sound basis for risk assessments. In this paper the results from the CORAS project are presented, and it is discussed how the approach for applying MBRA meets the needs of a risk-informed Man-Technology-Organization (MTO) model, and how methodology can be applied as a part of a trust case development

Addressing dependability by applying an approach for model-based risk assessment

Energy Technology Data Exchange (ETDEWEB)

Gran, Bjorn Axel [Institutt for energiteknikk, OECD Halden Reactor Project, NO-1751 Halden (Norway)]. E-mail: bjorn.axel.gran@hrp.no; Fredriksen, Rune [Institutt for energiteknikk, OECD Halden Reactor Project, NO-1751 Halden (Norway)]. E-mail: rune.fredriksen@hrp.no; Thunem, Atoosa P.-J. [Institutt for energiteknikk, OECD Halden Reactor Project, NO-1751 Halden (Norway)]. E-mail: atoosa.p-j.thunem@hrp.no

2007-11-15

This paper describes how an approach for model-based risk assessment (MBRA) can be applied for addressing different dependability factors in a critical application. Dependability factors, such as availability, reliability, safety and security, are important when assessing the dependability degree of total systems involving digital instrumentation and control (I and C) sub-systems. In order to identify risk sources their roles with regard to intentional system aspects such as system functions, component behaviours and intercommunications must be clarified. Traditional risk assessment is based on fault or risk models of the system. In contrast to this, MBRA utilizes success-oriented models describing all intended system aspects, including functional, operational and organizational aspects of the target. The EU-funded CORAS project developed a tool-supported methodology for the application of MBRA in security-critical systems. The methodology has been tried out within the telemedicine and e-commerce areas, and provided through a series of seven trials a sound basis for risk assessments. In this paper the results from the CORAS project are presented, and it is discussed how the approach for applying MBRA meets the needs of a risk-informed Man-Technology-Organization (MTO) model, and how methodology can be applied as a part of a trust case development.

Next-Generation Mitogenomics: A Comparison of Approaches Applied to Caecilian Amphibian Phylogeny

OpenAIRE

Maddock, Simon T.; Briscoe, Andrew G.; Wilkinson, Mark; Waeschenbach, Andrea; San Mauro, Diego; Day, Julia J.; Littlewood, D. Tim J.; Foster, Peter G.; Nussbaum, Ronald A.; Gower, David J.

2016-01-01

Mitochondrial genome (mitogenome) sequences are being generated with increasing speed due to the advances of next-generation sequencing (NGS) technology and associated analytical tools. However, detailed comparisons to explore the utility of alternative NGS approaches applied to the same taxa have not been undertaken. We compared a ‘traditional’ Sanger sequencing method with two NGS approaches (shotgun sequencing and non-indexed, multiplex amplicon sequencing) on four different sequencing pla...

Bayesian optimization for computationally extensive probability distributions.

Science.gov (United States)

Tamura, Ryo; Hukushima, Koji

2018-01-01

An efficient method for finding a better maximizer of computationally extensive probability distributions is proposed on the basis of a Bayesian optimization technique. A key idea of the proposed method is to use extreme values of acquisition functions by Gaussian processes for the next training phase, which should be located near a local maximum or a global maximum of the probability distribution. Our Bayesian optimization technique is applied to the posterior distribution in the effective physical model estimation, which is a computationally extensive probability distribution. Even when the number of sampling points on the posterior distributions is fixed to be small, the Bayesian optimization provides a better maximizer of the posterior distributions in comparison to those by the random search method, the steepest descent method, or the Monte Carlo method. Furthermore, the Bayesian optimization improves the results efficiently by combining the steepest descent method and thus it is a powerful tool to search for a better maximizer of computationally extensive probability distributions.

Joint survival probability via truncated invariant copula

International Nuclear Information System (INIS)

Kim, Jeong-Hoon; Ma, Yong-Ki; Park, Chan Yeol

2016-01-01

Highlights: • We have studied an issue of dependence structure between default intensities. • We use a multivariate shot noise intensity process, where jumps occur simultaneously and their sizes are correlated. • We obtain the joint survival probability of the integrated intensities by using a copula. • We apply our theoretical result to pricing basket default swap spread. - Abstract: Given an intensity-based credit risk model, this paper studies dependence structure between default intensities. To model this structure, we use a multivariate shot noise intensity process, where jumps occur simultaneously and their sizes are correlated. Through very lengthy algebra, we obtain explicitly the joint survival probability of the integrated intensities by using the truncated invariant Farlie–Gumbel–Morgenstern copula with exponential marginal distributions. We also apply our theoretical result to pricing basket default swap spreads. This result can provide a useful guide for credit risk management.

Snell Envelope with Small Probability Criteria

Energy Technology Data Exchange (ETDEWEB)

Del Moral, Pierre, E-mail: Pierre.Del-Moral@inria.fr; Hu, Peng, E-mail: Peng.Hu@inria.fr [Universite de Bordeaux I, Centre INRIA Bordeaux et Sud-Ouest and Institut de Mathematiques de Bordeaux (France); Oudjane, Nadia, E-mail: Nadia.Oudjane@edf.fr [EDF R and D Clamart (France)

2012-12-15

We present a new algorithm to compute the Snell envelope in the specific case where the criteria to optimize is associated with a small probability or a rare event. This new approach combines the Stochastic Mesh approach of Broadie and Glasserman with a particle approximation scheme based on a specific change of measure designed to concentrate the computational effort in regions pointed out by the criteria. The theoretical analysis of this new algorithm provides non asymptotic convergence estimates. Finally, the numerical tests confirm the practical interest of this approach.

Generalizing human error rates: A taxonomic approach

International Nuclear Information System (INIS)

Buffardi, L.; Fleishman, E.; Allen, J.

1989-01-01

It is well established that human error plays a major role in malfunctioning of complex, technological systems and in accidents associated with their operation. Estimates of the rate of human error in the nuclear industry range from 20-65% of all system failures. In response to this, the Nuclear Regulatory Commission has developed a variety of techniques for estimating human error probabilities for nuclear power plant personnel. Most of these techniques require the specification of the range of human error probabilities for various tasks. Unfortunately, very little objective performance data on error probabilities exist for nuclear environments. Thus, when human reliability estimates are required, for example in computer simulation modeling of system reliability, only subjective estimates (usually based on experts' best guesses) can be provided. The objective of the current research is to provide guidelines for the selection of human error probabilities based on actual performance data taken in other complex environments and applying them to nuclear settings. A key feature of this research is the application of a comprehensive taxonomic approach to nuclear and non-nuclear tasks to evaluate their similarities and differences, thus providing a basis for generalizing human error estimates across tasks. In recent years significant developments have occurred in classifying and describing tasks. Initial goals of the current research are to: (1) identify alternative taxonomic schemes that can be applied to tasks, and (2) describe nuclear tasks in terms of these schemes. Three standardized taxonomic schemes (Ability Requirements Approach, Generalized Information-Processing Approach, Task Characteristics Approach) are identified, modified, and evaluated for their suitability in comparing nuclear and non-nuclear power plant tasks. An agenda for future research and its relevance to nuclear power plant safety is also discussed

Location Prediction Based on Transition Probability Matrices Constructing from Sequential Rules for Spatial-Temporal K-Anonymity Dataset

Science.gov (United States)

Liu, Zhao; Zhu, Yunhong; Wu, Chenxue

2016-01-01

Spatial-temporal k-anonymity has become a mainstream approach among techniques for protection of users’ privacy in location-based services (LBS) applications, and has been applied to several variants such as LBS snapshot queries and continuous queries. Analyzing large-scale spatial-temporal anonymity sets may benefit several LBS applications. In this paper, we propose two location prediction methods based on transition probability matrices constructing from sequential rules for spatial-temporal k-anonymity dataset. First, we define single-step sequential rules mined from sequential spatial-temporal k-anonymity datasets generated from continuous LBS queries for multiple users. We then construct transition probability matrices from mined single-step sequential rules, and normalize the transition probabilities in the transition matrices. Next, we regard a mobility model for an LBS requester as a stationary stochastic process and compute the n-step transition probability matrices by raising the normalized transition probability matrices to the power n. Furthermore, we propose two location prediction methods: rough prediction and accurate prediction. The former achieves the probabilities of arriving at target locations along simple paths those include only current locations, target locations and transition steps. By iteratively combining the probabilities for simple paths with n steps and the probabilities for detailed paths with n-1 steps, the latter method calculates transition probabilities for detailed paths with n steps from current locations to target locations. Finally, we conduct extensive experiments, and correctness and flexibility of our proposed algorithm have been verified. PMID:27508502

Precipitation intensity probability distribution modelling for hydrological and construction design purposes

International Nuclear Information System (INIS)

Koshinchanov, Georgy; Dimitrov, Dobri

2008-01-01

The characteristics of rainfall intensity are important for many purposes, including design of sewage and drainage systems, tuning flood warning procedures, etc. Those estimates are usually statistical estimates of the intensity of precipitation realized for certain period of time (e.g. 5, 10 min., etc) with different return period (e.g. 20, 100 years, etc). The traditional approach in evaluating the mentioned precipitation intensities is to process the pluviometer's records and fit probability distribution to samples of intensities valid for certain locations ore regions. Those estimates further become part of the state regulations to be used for various economic activities. Two problems occur using the mentioned approach: 1. Due to various factors the climate conditions are changed and the precipitation intensity estimates need regular update; 2. As far as the extremes of the probability distribution are of particular importance for the practice, the methodology of the distribution fitting needs specific attention to those parts of the distribution. The aim of this paper is to make review of the existing methodologies for processing the intensive rainfalls and to refresh some of the statistical estimates for the studied areas. The methodologies used in Bulgaria for analyzing the intensive rainfalls and produce relevant statistical estimates: - The method of the maximum intensity, used in the National Institute of Meteorology and Hydrology to process and decode the pluviometer's records, followed by distribution fitting for each precipitation duration period; - As the above, but with separate modeling of probability distribution for the middle and high probability quantiles. - Method is similar to the first one, but with a threshold of 0,36 mm/min of intensity; - Another method proposed by the Russian hydrologist G. A. Aleksiev for regionalization of estimates over some territory, improved and adapted by S. Gerasimov for Bulgaria; - Next method is considering only

Probability of misclassifying biological elements in surface waters.

Science.gov (United States)

Loga, Małgorzata; Wierzchołowska-Dziedzic, Anna

2017-11-24

Measurement uncertainties are inherent to assessment of biological indices of water bodies. The effect of these uncertainties on the probability of misclassification of ecological status is the subject of this paper. Four Monte-Carlo (M-C) models were applied to simulate the occurrence of random errors in the measurements of metrics corresponding to four biological elements of surface waters: macrophytes, phytoplankton, phytobenthos, and benthic macroinvertebrates. Long series of error-prone measurement values of these metrics, generated by M-C models, were used to identify cases in which values of any of the four biological indices lay outside of the "true" water body class, i.e., outside the class assigned from the actual physical measurements. Fraction of such cases in the M-C generated series was used to estimate the probability of misclassification. The method is particularly useful for estimating the probability of misclassification of the ecological status of surface water bodies in the case of short sequences of measurements of biological indices. The results of the Monte-Carlo simulations show a relatively high sensitivity of this probability to measurement errors of the river macrophyte index (MIR) and high robustness to measurement errors of the benthic macroinvertebrate index (MMI). The proposed method of using Monte-Carlo models to estimate the probability of misclassification has significant potential for assessing the uncertainty of water body status reported to the EC by the EU member countries according to WFD. The method can be readily applied also in risk assessment of water management decisions before adopting the status dependent corrective actions.

Box-particle probability hypothesis density filtering

OpenAIRE

Schikora, M.; Gning, A.; Mihaylova, L.; Cremers, D.; Koch, W.

2014-01-01

This paper develops a novel approach for multitarget tracking, called box-particle probability hypothesis density filter (box-PHD filter). The approach is able to track multiple targets and estimates the unknown number of targets. Furthermore, it is capable of dealing with three sources of uncertainty: stochastic, set-theoretic, and data association uncertainty. The box-PHD filter reduces the number of particles significantly, which improves the runtime considerably. The small number of box-p...

Concurrency meets probability: theory and practice (abstract)

NARCIS (Netherlands)

Katoen, Joost P.

Treating random phenomena in concurrency theory has a long tradition. Petri nets [18, 10] and process algebras [14] have been extended with probabilities. The same applies to behavioural semantics such as strong and weak (bi)simulation [1], and testing pre-orders [5]. Beautiful connections between

Initialization and Restart in Stochastic Local Search: Computing a Most Probable Explanation in Bayesian Networks

Science.gov (United States)

Mengshoel, Ole J.; Wilkins, David C.; Roth, Dan

2010-01-01

For hard computational problems, stochastic local search has proven to be a competitive approach to finding optimal or approximately optimal problem solutions. Two key research questions for stochastic local search algorithms are: Which algorithms are effective for initialization? When should the search process be restarted? In the present work we investigate these research questions in the context of approximate computation of most probable explanations (MPEs) in Bayesian networks (BNs). We introduce a novel approach, based on the Viterbi algorithm, to explanation initialization in BNs. While the Viterbi algorithm works on sequences and trees, our approach works on BNs with arbitrary topologies. We also give a novel formalization of stochastic local search, with focus on initialization and restart, using probability theory and mixture models. Experimentally, we apply our methods to the problem of MPE computation, using a stochastic local search algorithm known as Stochastic Greedy Search. By carefully optimizing both initialization and restart, we reduce the MPE search time for application BNs by several orders of magnitude compared to using uniform at random initialization without restart. On several BNs from applications, the performance of Stochastic Greedy Search is competitive with clique tree clustering, a state-of-the-art exact algorithm used for MPE computation in BNs.

Acceptance Probability (P a) Analysis for Process Validation Lifecycle Stages.

Science.gov (United States)

Alsmeyer, Daniel; Pazhayattil, Ajay; Chen, Shu; Munaretto, Francesco; Hye, Maksuda; Sanghvi, Pradeep

2016-04-01

This paper introduces an innovative statistical approach towards understanding how variation impacts the acceptance criteria of quality attributes. Because of more complex stage-wise acceptance criteria, traditional process capability measures are inadequate for general application in the pharmaceutical industry. The probability of acceptance concept provides a clear measure, derived from specific acceptance criteria for each quality attribute. In line with the 2011 FDA Guidance, this approach systematically evaluates data and scientifically establishes evidence that a process is capable of consistently delivering quality product. The probability of acceptance provides a direct and readily understandable indication of product risk. As with traditional capability indices, the acceptance probability approach assumes that underlying data distributions are normal. The computational solutions for dosage uniformity and dissolution acceptance criteria are readily applicable. For dosage uniformity, the expected AV range may be determined using the s lo and s hi values along with the worst case estimates of the mean. This approach permits a risk-based assessment of future batch performance of the critical quality attributes. The concept is also readily applicable to sterile/non sterile liquid dose products. Quality attributes such as deliverable volume and assay per spray have stage-wise acceptance that can be converted into an acceptance probability. Accepted statistical guidelines indicate processes with C pk > 1.33 as performing well within statistical control and those with C pk  1.33 is associated with a centered process that will statistically produce less than 63 defective units per million. This is equivalent to an acceptance probability of >99.99%.

Computing elastic‐rebound‐motivated rarthquake probabilities in unsegmented fault models: a new methodology supported by physics‐based simulators

Science.gov (United States)

Field, Edward H.

2015-01-01

A methodology is presented for computing elastic‐rebound‐based probabilities in an unsegmented fault or fault system, which involves computing along‐fault averages of renewal‐model parameters. The approach is less biased and more self‐consistent than a logical extension of that applied most recently for multisegment ruptures in California. It also enables the application of magnitude‐dependent aperiodicity values, which the previous approach does not. Monte Carlo simulations are used to analyze long‐term system behavior, which is generally found to be consistent with that of physics‐based earthquake simulators. Results cast doubt that recurrence‐interval distributions at points on faults look anything like traditionally applied renewal models, a fact that should be considered when interpreting paleoseismic data. We avoid such assumptions by changing the "probability of what" question (from offset at a point to the occurrence of a rupture, assuming it is the next event to occur). The new methodology is simple, although not perfect in terms of recovering long‐term rates in Monte Carlo simulations. It represents a reasonable, improved way to represent first‐order elastic‐rebound predictability, assuming it is there in the first place, and for a system that clearly exhibits other unmodeled complexities, such as aftershock triggering.

Escape probabilities for fluorescent x-rays

International Nuclear Information System (INIS)

Dance, D.R.; Day, G.J.

1985-01-01

Computation of the energy absorption efficiency of an x-ray photon detector involves consideration of the histories of the secondary particles produced in any initial or secondary interaction which may occur within the detector. In particular, the K or higher shell fluorescent x-rays which may be emitted following a photoelectric interaction can carry away a large fraction of the energy of the incident photon, especially if this energy is just above an absorption edge. The effects of such photons cannot be ignored and a correction term, depending upon the probability that the fluorescent x-rays will escape from the detector, must be applied to the energy absorption efficiency. For detectors such as x-ray intensifying screens, it has been usual to calculate this probability by numerical integration. In this note analytic expressions are derived for the escape probability of fluorescent photons from planar detectors in terms of exponential integral functions. Rational approximations for these functions are readily available and these analytic expressions therefore facilitate the computation of photon absorption efficiencies. A table is presented which should obviate the need for calculating the escape probability for most cases of interest. (author)

Probability Density Components Analysis: A New Approach to Treatment and Classification of SAR Images

Directory of Open Access Journals (Sweden)

Osmar Abílio de Carvalho Júnior

2014-04-01

Full Text Available Speckle noise (salt and pepper is inherent to synthetic aperture radar (SAR, which causes a usual noise-like granular aspect and complicates the image classification. In SAR image analysis, the spatial information might be a particular benefit for denoising and mapping classes characterized by a statistical distribution of the pixel intensities from a complex and heterogeneous spectral response. This paper proposes the Probability Density Components Analysis (PDCA, a new alternative that combines filtering and frequency histogram to improve the classification procedure for the single-channel synthetic aperture radar (SAR images. This method was tested on L-band SAR data from the Advanced Land Observation System (ALOS Phased-Array Synthetic-Aperture Radar (PALSAR sensor. The study area is localized in the Brazilian Amazon rainforest, northern Rondônia State (municipality of Candeias do Jamari, containing forest and land use patterns. The proposed algorithm uses a moving window over the image, estimating the probability density curve in different image components. Therefore, a single input image generates an output with multi-components. Initially the multi-components should be treated by noise-reduction methods, such as maximum noise fraction (MNF or noise-adjusted principal components (NAPCs. Both methods enable reducing noise as well as the ordering of multi-component data in terms of the image quality. In this paper, the NAPC applied to multi-components provided large reductions in the noise levels, and the color composites considering the first NAPC enhance the classification of different surface features. In the spectral classification, the Spectral Correlation Mapper and Minimum Distance were used. The results obtained presented as similar to the visual interpretation of optical images from TM-Landsat and Google Maps.

The philosophical basis for the use of probabilities in safety assessments

International Nuclear Information System (INIS)

Abramson, L.R.

1988-01-01

The axiomatic theory of probability is analogous to the theory of moving objects based on relations such as Newton's second law, F = ma. Each theory purports to describe the behavior of physical objects, and each has been validated by countless observations and experiments. In this sense, the probability of coming up heads is just as intrinsic a property of a real coin as is its mass. In contrast to the established validity of the axiomatic approach, the major weakness of the subjectivistic (Bayesian) approach to probability is the questionable connection between its conclusions and the real world. (author)

Probability

CERN Document Server

Shiryaev, A N

1996-01-01

This book contains a systematic treatment of probability from the ground up, starting with intuitive ideas and gradually developing more sophisticated subjects, such as random walks, martingales, Markov chains, ergodic theory, weak convergence of probability measures, stationary stochastic processes, and the Kalman-Bucy filter Many examples are discussed in detail, and there are a large number of exercises The book is accessible to advanced undergraduates and can be used as a text for self-study This new edition contains substantial revisions and updated references The reader will find a deeper study of topics such as the distance between probability measures, metrization of weak convergence, and contiguity of probability measures Proofs for a number of some important results which were merely stated in the first edition have been added The author included new material on the probability of large deviations, and on the central limit theorem for sums of dependent random variables

Trial type probability modulates the cost of antisaccades

Science.gov (United States)

Chiau, Hui-Yan; Tseng, Philip; Su, Jia-Han; Tzeng, Ovid J. L.; Hung, Daisy L.; Muggleton, Neil G.

2011-01-01

The antisaccade task, where eye movements are made away from a target, has been used to investigate the flexibility of cognitive control of behavior. Antisaccades usually have longer saccade latencies than prosaccades, the so-called antisaccade cost. Recent studies have shown that this antisaccade cost can be modulated by event probability. This may mean that the antisaccade cost can be reduced, or even reversed, if the probability of surrounding events favors the execution of antisaccades. The probabilities of prosaccades and antisaccades were systematically manipulated by changing the proportion of a certain type of trial in an interleaved pro/antisaccades task. We aimed to disentangle the intertwined relationship between trial type probabilities and the antisaccade cost with the ultimate goal of elucidating how probabilities of trial types modulate human flexible behaviors, as well as the characteristics of such modulation effects. To this end, we examined whether implicit trial type probability can influence saccade latencies and also manipulated the difficulty of cue discriminability to see how effects of trial type probability would change when the demand on visual perceptual analysis was high or low. A mixed-effects model was applied to the analysis to dissect the factors contributing to the modulation effects of trial type probabilities. Our results suggest that the trial type probability is one robust determinant of antisaccade cost. These findings highlight the importance of implicit probability in the flexibility of cognitive control of behavior. PMID:21543748

Tropical Cyclone Wind Probability Forecasting (WINDP).

Science.gov (United States)

1981-04-01

llq. h. ,c ilrac (t’ small probabilities (below 107c) is limited II(t’h, numb(r o!, significant digits given: therefore 1t( huld lU r~ruidvd as being...APPLIED SCI. CORP. ENGLAMD ;7MOS. SCIENCES OEPT., LIBRARY ATTN: LIBARY , SUITE 500 400 WASHINGTON AVE. 6811 KENILWORTH AVE. EUROPEAN CENTRE FOR MEDIUM

High-resolution urban flood modelling - a joint probability approach

Science.gov (United States)

Hartnett, Michael; Olbert, Agnieszka; Nash, Stephen

2017-04-01

The hydrodynamic modelling of rapid flood events due to extreme climatic events in urban environment is both a complex and challenging task. The horizontal resolution necessary to resolve complexity of urban flood dynamics is a critical issue; the presence of obstacles of varying shapes and length scales, gaps between buildings and the complex geometry of the city such as slopes affect flow paths and flood levels magnitudes. These small scale processes require a high resolution grid to be modelled accurately (2m or less, Olbert et al., 2015; Hunter et al., 2008; Brown et al., 2007) and, therefore, altimetry data of at least the same resolution. Along with availability of high-resolution LiDAR data and computational capabilities, as well as state of the art nested modelling approaches, these problems can now be overcome. Flooding and drying, domain definition, frictional resistance and boundary descriptions are all important issues to be addressed when modelling urban flooding. In recent years, the number of urban flood models dramatically increased giving a good insight into various modelling problems and solutions (Mark et al., 2004; Mason et al., 2007; Fewtrell et al., 2008; Shubert et al., 2008). Despite extensive modelling work conducted for fluvial (e.g. Mignot et al., 2006; Hunter et al., 2008; Yu and Lane, 2006) and coastal mechanisms of flooding (e.g. Gallien et al., 2011; Yang et al., 2012), the amount of investigations into combined coastal-fluvial flooding is still very limited (e.g. Orton et al., 2012; Lian et al., 2013). This is surprising giving the extent of flood consequences when both mechanisms occur simultaneously, which usually happens when they are driven by one process such as a storm. The reason for that could be the fact that the likelihood of joint event is much smaller than those of any of the two contributors occurring individually, because for fast moving storms the rainfall-driven fluvial flood arrives usually later than the storm surge

Joint Probability-Based Neuronal Spike Train Classification

Directory of Open Access Journals (Sweden)

Yan Chen

2009-01-01

Full Text Available Neuronal spike trains are used by the nervous system to encode and transmit information. Euclidean distance-based methods (EDBMs have been applied to quantify the similarity between temporally-discretized spike trains and model responses. In this study, using the same discretization procedure, we developed and applied a joint probability-based method (JPBM to classify individual spike trains of slowly adapting pulmonary stretch receptors (SARs. The activity of individual SARs was recorded in anaesthetized, paralysed adult male rabbits, which were artificially-ventilated at constant rate and one of three different volumes. Two-thirds of the responses to the 600 stimuli presented at each volume were used to construct three response models (one for each stimulus volume consisting of a series of time bins, each with spike probabilities. The remaining one-third of the responses where used as test responses to be classified into one of the three model responses. This was done by computing the joint probability of observing the same series of events (spikes or no spikes, dictated by the test response in a given model and determining which probability of the three was highest. The JPBM generally produced better classification accuracy than the EDBM, and both performed well above chance. Both methods were similarly affected by variations in discretization parameters, response epoch duration, and two different response alignment strategies. Increasing bin widths increased classification accuracy, which also improved with increased observation time, but primarily during periods of increasing lung inflation. Thus, the JPBM is a simple and effective method performing spike train classification.

Application of escape probability to line transfer in laser-produced plasmas

International Nuclear Information System (INIS)

Lee, Y.T.; London, R.A.; Zimmerman, G.B.; Haglestein, P.L.

1989-01-01

In this paper the authors apply the escape probability method to treat transfer of optically thick lines in laser-produced plasmas in plan-parallel geometry. They investigate the effect of self-absorption on the ionization balance and ion level populations. In addition, they calculate such effect on the laser gains in an exploding foil target heated by an optical laser. Due to the large ion streaming motion in laser-produced plasmas, absorption of an emitted photon occurs only over the length in which the Doppler shift is equal to the line width. They find that the escape probability calculated with the Doppler shift is larger compared to the escape probability for a static plasma. Therefore, the ion streaming motion contributes significantly to the line transfer process in laser-produced plasmas. As examples, they have applied escape probability to calculate transfer of optically thick lines in both ablating slab and exploding foil targets under irradiation of a high-power optical laser

Independent events in elementary probability theory

Science.gov (United States)

Csenki, Attila

2011-07-01

In Probability and Statistics taught to mathematicians as a first introduction or to a non-mathematical audience, joint independence of events is introduced by requiring that the multiplication rule is satisfied. The following statement is usually tacitly assumed to hold (and, at best, intuitively motivated): quote specific-use="indent"> If the n events E 1, E 2, … , E n are jointly independent then any two events A and B built in finitely many steps from two disjoint subsets of E 1, E 2, … , E n are also independent. The operations 'union', 'intersection' and 'complementation' are permitted only when forming the events A and B. quote>Here we examine this statement from the point of view of elementary probability theory. The approach described here is accessible also to users of probability theory and is believed to be novel.

Multimodal Approach for Automatic Emotion Recognition Applied to the Tension Levels Study in TV Newscasts

Directory of Open Access Journals (Sweden)

Moisés Henrique Ramos Pereira

2015-12-01

Full Text Available This article addresses a multimodal approach to automatic emotion recognition in participants of TV newscasts (presenters, reporters, commentators and others able to assist the tension levels study in narratives of events in this television genre. The methodology applies state-of-the-art computational methods to process and analyze facial expressions, as well as speech signals. The proposed approach contributes to semiodiscoursive study of TV newscasts and their enunciative praxis, assisting, for example, the identification of the communication strategy of these programs. To evaluate the effectiveness of the proposed approach was applied it in a video related to a report displayed on a Brazilian TV newscast great popularity in the state of Minas Gerais. The experimental results are promising on the recognition of emotions on the facial expressions of tele journalists and are in accordance with the distribution of audiovisual indicators extracted over a TV newscast, demonstrating the potential of the approach to support the TV journalistic discourse analysis.This article addresses a multimodal approach to automatic emotion recognition in participants of TV newscasts (presenters, reporters, commentators and others able to assist the tension levels study in narratives of events in this television genre. The methodology applies state-of-the-art computational methods to process and analyze facial expressions, as well as speech signals. The proposed approach contributes to semiodiscoursive study of TV newscasts and their enunciative praxis, assisting, for example, the identification of the communication strategy of these programs. To evaluate the effectiveness of the proposed approach was applied it in a video related to a report displayed on a Brazilian TV newscast great popularity in the state of Minas Gerais. The experimental results are promising on the recognition of emotions on the facial expressions of tele journalists and are in accordance

A combined evidence Bayesian method for human ancestry inference applied to Afro-Colombians.

Science.gov (United States)

Rishishwar, Lavanya; Conley, Andrew B; Vidakovic, Brani; Jordan, I King

2015-12-15

Uniparental genetic markers, mitochondrial DNA (mtDNA) and Y chromosomal DNA, are widely used for the inference of human ancestry. However, the resolution of ancestral origins based on mtDNA haplotypes is limited by the fact that such haplotypes are often found to be distributed across wide geographical regions. We have addressed this issue here by combining two sources of ancestry information that have typically been considered separately: historical records regarding population origins and genetic information on mtDNA haplotypes. To combine these distinct data sources, we applied a Bayesian approach that considers historical records, in the form of prior probabilities, together with data on the geographical distribution of mtDNA haplotypes, formulated as likelihoods, to yield ancestry assignments from posterior probabilities. This combined evidence Bayesian approach to ancestry assignment was evaluated for its ability to accurately assign sub-continental African ancestral origins to Afro-Colombians based on their mtDNA haplotypes. We demonstrate that the incorporation of historical prior probabilities via this analytical framework can provide for substantially increased resolution in sub-continental African ancestry assignment for members of this population. In addition, a personalized approach to ancestry assignment that involves the tuning of priors to individual mtDNA haplotypes yields even greater resolution for individual ancestry assignment. Despite the fact that Colombia has a large population of Afro-descendants, the ancestry of this community has been understudied relative to populations with primarily European and Native American ancestry. Thus, the application of the kind of combined evidence approach developed here to the study of ancestry in the Afro-Colombian population has the potential to be impactful. The formal Bayesian analytical framework we propose for combining historical and genetic information also has the potential to be widely applied

Risk factors of delay proportional probability in diphtheria-tetanus-pertussis vaccination of Iranian children; Life table approach analysis

Directory of Open Access Journals (Sweden)

Mohsen Mokhtari

2015-01-01

Full Text Available Despite success in expanded program immunization for an increase in vaccination coverage in the children of world, timeliness and schedule of vaccination remains as one of the challenges in public health. This study purposed to demonstrate the related factors of delayed diphtheria-tetanus-pertussis (DTP vaccination using life table approach. A historical cohort study conducted in the poor areas of five large Iran cities. Totally, 3610 children with 24-47 months old age who had documented vaccination card were enrolled. Time of vaccination for the third dose of DTP vaccine was calculated. Life table survival was used to calculate the proportional probability of vaccination in each time. Wilcoxon test was used for the comparison proportional probability of delayed vaccination based on studies factors. The overall median delayed time for DTP3 was 38.52 days. The Wilcoxon test showed that city, nationality, education level of parents, birth order and being in rural areas are related to the high probability of delay time for DTP3 vaccination (P 0.05. Being away from the capital, a high concentration of immigrants in the city borders with a low socioeconomic class leads to prolonged delay in DTP vaccination time. Special attention to these areas is needed to increase the levels of parental knowledge and to facilitate access to the health services care.

Classification by a neural network approach applied to non destructive testing

International Nuclear Information System (INIS)

Lefevre, M.; Preteux, F.; Lavayssiere, B.

1995-01-01

Radiography is used by EDF for pipe inspection in nuclear power plants in order to detect defects. The radiographs obtained are then digitized in a well-defined protocol. The aim of EDF consists of developing a non destructive testing system for recognizing defects. In this paper, we describe the recognition procedure of areas with defects. We first present the digitization protocol, specifies the poor quality of images under study and propose a procedure to enhance defects. We then examine the problem raised by the choice of good features for classification. After having proved that statistical or standard textural features such as homogeneity, entropy or contrast are not relevant, we develop a geometrical-statistical approach based on the cooperation between signal correlations study and regional extrema analysis. The principle consists of analysing and comparing for areas with defects and without any defect, the evolution of conditional probabilities matrices for increasing neighborhood sizes, the shape of variograms and the location of regional minima. We demonstrate that anisotropy and surface of series of 'comet tails' associated with probability matrices, variograms slope and statistical indices, regional extrema location, are features able to discriminate areas with defects from areas without any. The classification is then realized by a neural network, which structure, properties and learning mechanisms are detailed. Finally we discuss the results. (authors). 21 refs., 5 figs

Ignition probabilities for Compact Ignition Tokamak designs

International Nuclear Information System (INIS)

Stotler, D.P.; Goldston, R.J.

1989-09-01

A global power balance code employing Monte Carlo techniques had been developed to study the ''probability of ignition'' and has been applied to several different configurations of the Compact Ignition Tokamak (CIT). Probability distributions for the critical physics parameters in the code were estimated using existing experimental data. This included a statistical evaluation of the uncertainty in extrapolating the energy confinement time. A substantial probability of ignition is predicted for CIT if peaked density profiles can be achieved or if one of the two higher plasma current configurations is employed. In other cases, values of the energy multiplication factor Q of order 10 are generally obtained. The Ignitor-U and ARIES designs are also examined briefly. Comparisons of our empirically based confinement assumptions with two theory-based transport models yield conflicting results. 41 refs., 11 figs

Python for probability, statistics, and machine learning

CERN Document Server

Unpingco, José

2016-01-01

This book covers the key ideas that link probability, statistics, and machine learning illustrated using Python modules in these areas. The entire text, including all the figures and numerical results, is reproducible using the Python codes and their associated Jupyter/IPython notebooks, which are provided as supplementary downloads. The author develops key intuitions in machine learning by working meaningful examples using multiple analytical methods and Python codes, thereby connecting theoretical concepts to concrete implementations. Modern Python modules like Pandas, Sympy, and Scikit-learn are applied to simulate and visualize important machine learning concepts like the bias/variance trade-off, cross-validation, and regularization. Many abstract mathematical ideas, such as convergence in probability theory, are developed and illustrated with numerical examples. This book is suitable for anyone with an undergraduate-level exposure to probability, statistics, or machine learning and with rudimentary knowl...

Conserving relativistic many-body approach: Equation of state, spectral function, and occupation probabilities of nuclear matter

International Nuclear Information System (INIS)

de Jong, F.; Malfliet, R.

1991-01-01

Starting from a relativistic Lagrangian we derive a ''conserving'' approximation for the description of nuclear matter. We show this to be a nontrivial extension over the relativistic Dirac-Brueckner scheme. The saturation point of the equation of state calculated agrees very well with the empirical saturation point. The conserving character of the approach is tested by means of the Hugenholtz--van Hove theorem. We find the theorem fulfilled very well around saturation. A new value for compression modulus is derived, K=310 MeV. Also we calculate the occupation probabilities at normal nuclear matter densities by means of the spectral function. The average depletion κ of the Fermi sea is found to be κ∼0.11

Detection probabilities for time-domain velocity estimation

DEFF Research Database (Denmark)

Jensen, Jørgen Arendt

1991-01-01

programs, it is demonstrated that the probability of correct estimation depends on the signal-to-noise ratio, transducer bandwidth, number of A-lines and number of samples used in the correlation estimate. The influence of applying a stationary echo-canceler is explained. The echo canceling can be modeled...

Probability and information theory, with applications to radar

CERN Document Server

Woodward, P M; Higinbotham, W

1964-01-01

Electronics and Instrumentation, Second Edition, Volume 3: Probability and Information Theory with Applications to Radar provides information pertinent to the development on research carried out in electronics and applied physics. This book presents the established mathematical techniques that provide the code in which so much of the mathematical theory of electronics and radar is expressed.Organized into eight chapters, this edition begins with an overview of the geometry of probability distributions in which moments play a significant role. This text then examines the mathematical methods in

On the Determinants of the Conjunction Fallacy: Probability versus Inductive Confirmation

Science.gov (United States)

Tentori, Katya; Crupi, Vincenzo; Russo, Selena

2013-01-01

Major recent interpretations of the conjunction fallacy postulate that people assess the probability of a conjunction according to (non-normative) averaging rules as applied to the constituents' probabilities or represent the conjunction fallacy as an effect of random error in the judgment process. In the present contribution, we contrast such…

Bounding probabilistic safety assessment probabilities by reality

International Nuclear Information System (INIS)

Fragola, J.R.; Shooman, M.L.

1991-01-01

The investigation of the failure in systems where failure is a rare event makes the continual comparisons between the developed probabilities and empirical evidence difficult. The comparison of the predictions of rare event risk assessments with historical reality is essential to prevent probabilistic safety assessment (PSA) predictions from drifting into fantasy. One approach to performing such comparisons is to search out and assign probabilities to natural events which, while extremely rare, have a basis in the history of natural phenomena or human activities. For example the Segovian aqueduct and some of the Roman fortresses in Spain have existed for several millennia and in many cases show no physical signs of earthquake damage. This evidence could be used to bound the probability of earthquakes above a certain magnitude to less than 10 -3 per year. On the other hand, there is evidence that some repetitive actions can be performed with extremely low historical probabilities when operators are properly trained and motivated, and sufficient warning indicators are provided. The point is not that low probability estimates are impossible, but continual reassessment of the analysis assumptions, and a bounding of the analysis predictions by historical reality. This paper reviews the probabilistic predictions of PSA in this light, attempts to develop, in a general way, the limits which can be historically established and the consequent bounds that these limits place upon the predictions, and illustrates the methodology used in computing such limits. Further, the paper discusses the use of empirical evidence and the requirement for disciplined systematic approaches within the bounds of reality and the associated impact on PSA probabilistic estimates

Single Trial Probability Applications: Can Subjectivity Evade Frequency Limitations?

Directory of Open Access Journals (Sweden)

David Howden

2009-10-01

Full Text Available Frequency probability theorists define an event’s probability distribution as the limit of a repeated set of trials belonging to a homogeneous collective. The subsets of this collective are events which we have deficient knowledge about on an individual level, although for the larger collective we have knowledge its aggregate behavior. Hence, probabilities can only be achieved through repeated trials of these subsets arriving at the established frequencies that define the probabilities. Crovelli (2009 argues that this is a mistaken approach, and that a subjective assessment of individual trials should be used instead. Bifurcating between the two concepts of risk and uncertainty, Crovelli first asserts that probability is the tool used to manage uncertain situations, and then attempts to rebuild a definition of probability theory with this in mind. We show that such an attempt has little to gain, and results in an indeterminate application of entrepreneurial forecasting to uncertain decisions—a process far-removed from any application of probability theory.

VOLCANIC RISK ASSESSMENT - PROBABILITY AND CONSEQUENCES

International Nuclear Information System (INIS)

G.A. Valentine; F.V. Perry; S. Dartevelle

2005-01-01

framework is an important way to focus research in the most critical areas as well as providing an integrated approach to a range of complex processes. Uncertainty in both event probability and consequences can formally be accounted for within a decision framework and therefore is explicitly communicated to decision makers. Such an approach also tends to open new questions about volcanic systems and their interactions with humans and infrastructure, thereby driving new basic research

Probability of ignition - a better approach than ignition margin

International Nuclear Information System (INIS)

Ho, S.K.; Perkins, L.J.

1989-01-01

The use of a figure of merit - the probability of ignition - is proposed for the characterization of the ignition performance of projected ignition tokamaks. Monte Carlo and analytic models have been developed to compute the uncertainty distribution function for ignition of a given tokamak design, in terms of the uncertainties inherent in the tokamak physics database. A sample analysis with this method indicates that the risks of not achieving ignition may be unacceptably high unless the accepted margins for ignition are increased. (author). Letter-to-the-editor. 12 refs, 2 figs, 2 tabs

Greek paideia and terms of probability

Directory of Open Access Journals (Sweden)

Fernando Leon Parada

2016-06-01

Full Text Available This paper addresses three aspects of the conceptual framework for a doctoral dissertation research in process in the field of Mathematics Education, in particular, in the subfield of teaching and learning basic concepts of Probability Theory at the College level. It intends to contrast, sustain and elucidate the central statement that the meanings of some of these basic terms used in Probability Theory were not formally defined by any specific theory but relate to primordial ideas developed in Western culture from Ancient Greek myths. The first aspect deals with the notion of uncertainty, with that Greek thinkers described several archaic gods and goddesses of Destiny, like Parcas and Moiras, often personified in the goddess Tyche—Fortuna for the Romans—, as regarded in Werner Jaeger’s “Paideia”. The second aspect treats the idea of hazard from two different approaches: the first approach deals with hazard, denoted by Plato with the already demythologized term ‘tyche’ from the viewpoint of innate knowledge, as Jaeger points out. The second approach deals with hazard from a perspective that could be called “phenomenological”, from which Aristotle attempted to articulate uncertainty with a discourse based on the hypothesis of causality. The term ‘causal’ was opposed both to ‘casual’ and to ‘spontaneous’ (as used in the expression “spontaneous generation”, attributing uncertainty to ignorance of the future, thus respecting causal flow. The third aspect treated in the paper refers to some definitions and etymologies of some other modern words that have become technical terms in current Probability Theory, confirming the above-mentioned main proposition of this paper.

Probability-based collaborative filtering model for predicting gene-disease associations.

Science.gov (United States)

Zeng, Xiangxiang; Ding, Ningxiang; Rodríguez-Patón, Alfonso; Zou, Quan

2017-12-28

Accurately predicting pathogenic human genes has been challenging in recent research. Considering extensive gene-disease data verified by biological experiments, we can apply computational methods to perform accurate predictions with reduced time and expenses. We propose a probability-based collaborative filtering model (PCFM) to predict pathogenic human genes. Several kinds of data sets, containing data of humans and data of other nonhuman species, are integrated in our model. Firstly, on the basis of a typical latent factorization model, we propose model I with an average heterogeneous regularization. Secondly, we develop modified model II with personal heterogeneous regularization to enhance the accuracy of aforementioned models. In this model, vector space similarity or Pearson correlation coefficient metrics and data on related species are also used. We compared the results of PCFM with the results of four state-of-arts approaches. The results show that PCFM performs better than other advanced approaches. PCFM model can be leveraged for predictions of disease genes, especially for new human genes or diseases with no known relationships.

Probability Distributome: A Web Computational Infrastructure for Exploring the Properties, Interrelations, and Applications of Probability Distributions.

Science.gov (United States)

Dinov, Ivo D; Siegrist, Kyle; Pearl, Dennis K; Kalinin, Alexandr; Christou, Nicolas

2016-06-01

Probability distributions are useful for modeling, simulation, analysis, and inference on varieties of natural processes and physical phenomena. There are uncountably many probability distributions. However, a few dozen families of distributions are commonly defined and are frequently used in practice for problem solving, experimental applications, and theoretical studies. In this paper, we present a new computational and graphical infrastructure, the Distributome , which facilitates the discovery, exploration and application of diverse spectra of probability distributions. The extensible Distributome infrastructure provides interfaces for (human and machine) traversal, search, and navigation of all common probability distributions. It also enables distribution modeling, applications, investigation of inter-distribution relations, as well as their analytical representations and computational utilization. The entire Distributome framework is designed and implemented as an open-source, community-built, and Internet-accessible infrastructure. It is portable, extensible and compatible with HTML5 and Web2.0 standards (http://Distributome.org). We demonstrate two types of applications of the probability Distributome resources: computational research and science education. The Distributome tools may be employed to address five complementary computational modeling applications (simulation, data-analysis and inference, model-fitting, examination of the analytical, mathematical and computational properties of specific probability distributions, and exploration of the inter-distributional relations). Many high school and college science, technology, engineering and mathematics (STEM) courses may be enriched by the use of modern pedagogical approaches and technology-enhanced methods. The Distributome resources provide enhancements for blended STEM education by improving student motivation, augmenting the classical curriculum with interactive webapps, and overhauling the

Applying a Problem Based Learning Approach to Land Management Education

DEFF Research Database (Denmark)

Enemark, Stig

Land management covers a wide range activities associated with the management of land and natural resources that are required to fulfil political objectives and achieve sustainable development. This paper presents an overall understanding of the land management paradigm and the benefits of good...... land governance to society. A land administration system provides a country with the infrastructure to implement land-related policies and land management strategies. By applying this land management profile to surveying education, this paper suggests that there is a need to move away from an exclusive...... engineering focus toward adopting an interdisciplinary and problem-based approach to ensure that academic programmes can cope with the wide range of land administration functions and challenges. An interdisciplinary approach to surveying education calls for the need to address issues and problems in a real...

Setting research priorities by applying the combined approach matrix.

Science.gov (United States)

Ghaffar, Abdul

2009-04-01

Priority setting in health research is a dynamic process. Different organizations and institutes have been working in the field of research priority setting for many years. In 1999 the Global Forum for Health Research presented a research priority setting tool called the Combined Approach Matrix or CAM. Since its development, the CAM has been successfully applied to set research priorities for diseases, conditions and programmes at global, regional and national levels. This paper briefly explains the CAM methodology and how it could be applied in different settings, giving examples and describing challenges encountered in the process of setting research priorities and providing recommendations for further work in this field. The construct and design of the CAM is explained along with different steps needed, including planning and organization of a priority-setting exercise and how it could be applied in different settings. The application of the CAM are described by using three examples. The first concerns setting research priorities for a global programme, the second describes application at the country level and the third setting research priorities for diseases. Effective application of the CAM in different and diverse environments proves its utility as a tool for setting research priorities. Potential challenges encountered in the process of research priority setting are discussed and some recommendations for further work in this field are provided.

Statistics with JMP graphs, descriptive statistics and probability

CERN Document Server

Goos, Peter

2015-01-01

Peter Goos, Department of Statistics, University ofLeuven, Faculty of Bio-Science Engineering and University ofAntwerp, Faculty of Applied Economics, BelgiumDavid Meintrup, Department of Mathematics and Statistics,University of Applied Sciences Ingolstadt, Faculty of MechanicalEngineering, GermanyThorough presentation of introductory statistics and probabilitytheory, with numerous examples and applications using JMPDescriptive Statistics and Probability provides anaccessible and thorough overview of the most important descriptivestatistics for nominal, ordinal and quantitative data withpartic

Assigning probability gain for precursors of four large Chinese earthquakes

Energy Technology Data Exchange (ETDEWEB)

Cao, T.; Aki, K.

1983-03-10

We extend the concept of probability gain associated with a precursor (Aki, 1981) to a set of precursors which may be mutually dependent. Making use of a new formula, we derive a criterion for selecting precursors from a given data set in order to calculate the probability gain. The probabilities per unit time immediately before four large Chinese earthquakes are calculated. They are approximately 0.09, 0.09, 0.07 and 0.08 per day for 1975 Haicheng (M = 7.3), 1976 Tangshan (M = 7.8), 1976 Longling (M = 7.6), and Songpan (M = 7.2) earthquakes, respectively. These results are encouraging because they suggest that the investigated precursory phenomena may have included the complete information for earthquake prediction, at least for the above earthquakes. With this method, the step-by-step approach to prediction used in China may be quantified in terms of the probability of earthquake occurrence. The ln P versus t curve (where P is the probability of earthquake occurrence at time t) shows that ln P does not increase with t linearly but more rapidly as the time of earthquake approaches.

Some applications of the fractional Poisson probability distribution

International Nuclear Information System (INIS)

Laskin, Nick

2009-01-01

Physical and mathematical applications of the recently invented fractional Poisson probability distribution have been presented. As a physical application, a new family of quantum coherent states has been introduced and studied. As mathematical applications, we have developed the fractional generalization of Bell polynomials, Bell numbers, and Stirling numbers of the second kind. The appearance of fractional Bell polynomials is natural if one evaluates the diagonal matrix element of the evolution operator in the basis of newly introduced quantum coherent states. Fractional Stirling numbers of the second kind have been introduced and applied to evaluate the skewness and kurtosis of the fractional Poisson probability distribution function. A representation of the Bernoulli numbers in terms of fractional Stirling numbers of the second kind has been found. In the limit case when the fractional Poisson probability distribution becomes the Poisson probability distribution, all of the above listed developments and implementations turn into the well-known results of the quantum optics and the theory of combinatorial numbers.

Constructing probability boxes and Dempster-Shafer structures

Energy Technology Data Exchange (ETDEWEB)

Ferson, Scott [Applied Biomathematics, Setauket, NY (United States); Kreinovich, Vladik [Applied Biomathematics, Setauket, NY (United States); Grinzburg, Lev [Applied Biomathematics, Setauket, NY (United States); Myers, Davis [Applied Biomathematics, Setauket, NY (United States); Sentz, Kari [Binghamton Univ., NY (United States). Thomas J. Watson School of Engineering and Applied Science, Systems Science and Industrial Engineering Dept.

2015-05-01

This report summarizes a variety of the most useful and commonly applied methods for obtaining Dempster-Shafer structures, and their mathematical kin probability boxes, from empirical information or theoretical knowledge. The report includes a review of the aggregation methods for handling agreement and conflict when multiple such objects are obtained from different sources.

Finding upper bounds for software failure probabilities - experiments and results

International Nuclear Information System (INIS)

Kristiansen, Monica; Winther, Rune

2005-09-01

This report looks into some aspects of using Bayesian hypothesis testing to find upper bounds for software failure probabilities. In the first part, the report evaluates the Bayesian hypothesis testing approach for finding upper bounds for failure probabilities of single software components. The report shows how different choices of prior probability distributions for a software component's failure probability influence the number of tests required to obtain adequate confidence in a software component. In the evaluation, both the effect of the shape of the prior distribution as well as one's prior confidence in the software component were investigated. In addition, different choices of prior probability distributions are discussed based on their relevance in a software context. In the second part, ideas on how the Bayesian hypothesis testing approach can be extended to assess systems consisting of multiple software components are given. One of the main challenges when assessing systems consisting of multiple software components is to include dependency aspects in the software reliability models. However, different types of failure dependencies between software components must be modelled differently. Identifying different types of failure dependencies are therefore an important condition for choosing a prior probability distribution, which correctly reflects one's prior belief in the probability for software components failing dependently. In this report, software components include both general in-house software components, as well as pre-developed software components (e.g. COTS, SOUP, etc). (Author)

Overview of the structured assessment approach and documentation of algorithms to compute the probability of adversary detection

International Nuclear Information System (INIS)

Rice, T.R.; Derby, S.L.

1978-01-01

The Structured Assessment Approach was applied to material control and accounting systems at facilities that process Special Nuclear Material. Four groups of analytical techniques were developed for four general adversory types. Probabilistic algorithms were developed and compared with existing algorithms. 20 figures

A generalised chemical precipitation modelling approach in wastewater treatment applied to calcite

DEFF Research Database (Denmark)

Mbamba, Christian Kazadi; Batstone, Damien J.; Flores Alsina, Xavier

2015-01-01

, the present study aims to identify a broadly applicable precipitation modelling approach. The study uses two experimental platforms applied to calcite precipitating from synthetic aqueous solutions to identify and validate the model approach. Firstly, dynamic pH titration tests are performed to define...... an Arrhenius-style correction of kcryst. The influence of magnesium (a common and representative added impurity) on kcryst was found to be significant but was considered an optional correction because of a lesser influence as compared to that of temperature. Other variables such as ionic strength and pH were...

Responses of mink to auditory stimuli: Prerequisites for applying the ‘cognitive bias’ approach

DEFF Research Database (Denmark)

Svendsen, Pernille Maj; Malmkvist, Jens; Halekoh, Ulrich

2012-01-01

The aim of the study was to determine and validate prerequisites for applying a cognitive (judgement) bias approach to assessing welfare in farmed mink (Neovison vison). We investigated discrimination ability and associative learning ability using auditory cues. The mink (n = 15 females) were...... farmed mink in a judgement bias approach would thus appear to be feasible. However several specific issues are to be considered in order to successfully adapt a cognitive bias approach to mink, and these are discussed....

Modelling detection probabilities to evaluate management and control tools for an invasive species

Science.gov (United States)

Christy, M.T.; Yackel Adams, A.A.; Rodda, G.H.; Savidge, J.A.; Tyrrell, C.L.

2010-01-01

emphasizing and modelling detection probabilities, we now know: (i) that eradication of this species by searching is possible, (ii) how much searching effort would be required, (iii) under what environmental conditions searching would be most efficient, and (iv) several factors that are likely to modulate this quantification when searching is applied to new areas. The same approach can be use for evaluation of any control technology or population monitoring programme. ?? 2009 The Authors. Journal compilation ?? 2009 British Ecological Society.

Probability Measures on Groups IX

CERN Document Server

1989-01-01

The latest in this series of Oberwolfach conferences focussed on the interplay between structural probability theory and various other areas of pure and applied mathematics such as Tauberian theory, infinite-dimensional rotation groups, central limit theorems, harmonizable processes, and spherical data. Thus it was attended by mathematicians whose research interests range from number theory to quantum physics in conjunction with structural properties of probabilistic phenomena. This volume contains 5 survey articles submitted on special invitation and 25 original research papers.

Quantifying Detection Probabilities for Proliferation Activities in Undeclared Facilities

International Nuclear Information System (INIS)

Listner, C.; Canty, M.; Niemeyer, I.; Rezniczek, A.; Stein, G.

2015-01-01

International Safeguards is currently in an evolutionary process to increase effectiveness and efficiency of the verification system. This is an obvious consequence of the inability to detect the Iraq's clandestine nuclear weapons programme in the early 90s. By the adoption of the Programme 93+2, this has led to the development of Integrated Safeguards and the State-level concept. Moreover, the IAEA's focus was extended onto proliferation activities outside the State's declared facilities. The effectiveness of safeguards activities within declared facilities can and have been quantified with respect to costs and detection probabilities. In contrast, when verifying the absence of undeclared facilities this quantification has been avoided in the past because it has been considered to be impossible. However, when balancing the allocation of budget between the declared and the undeclared field, explicit reasoning is needed why safeguards effort is distributed in a given way. Such reasoning can be given by a holistic, information and risk-driven approach to Acquisition Path Analysis comprising declared and undeclared facilities. Regarding the input, this approach relies on the quantification of several factors, i.e., costs of attractiveness values for specific proliferation activities, potential safeguards measures and detection probabilities for these measures also for the undeclared field. In order to overcome the lack of quantification for detection probabilities in undeclared facilities, the authors of this paper propose a general verification error model. Based on this model, four different approaches are explained and assessed with respect to their advantages and disadvantages: the analogy approach, the Bayes approach, the frequentist approach and the process approach. The paper concludes with a summary and an outlook on potential future research activities. (author)

On the quantification and efficient propagation of imprecise probabilities resulting from small datasets

Science.gov (United States)

Zhang, Jiaxin; Shields, Michael D.

2018-01-01

This paper addresses the problem of uncertainty quantification and propagation when data for characterizing probability distributions are scarce. We propose a methodology wherein the full uncertainty associated with probability model form and parameter estimation are retained and efficiently propagated. This is achieved by applying the information-theoretic multimodel inference method to identify plausible candidate probability densities and associated probabilities that each method is the best model in the Kullback-Leibler sense. The joint parameter densities for each plausible model are then estimated using Bayes' rule. We then propagate this full set of probability models by estimating an optimal importance sampling density that is representative of all plausible models, propagating this density, and reweighting the samples according to each of the candidate probability models. This is in contrast with conventional methods that try to identify a single probability model that encapsulates the full uncertainty caused by lack of data and consequently underestimate uncertainty. The result is a complete probabilistic description of both aleatory and epistemic uncertainty achieved with several orders of magnitude reduction in computational cost. It is shown how the model can be updated to adaptively accommodate added data and added candidate probability models. The method is applied for uncertainty analysis of plate buckling strength where it is demonstrated how dataset size affects the confidence (or lack thereof) we can place in statistical estimates of response when data are lacking.

A multicriteria decision making approach applied to improving maintenance policies in healthcare organizations.

Science.gov (United States)

Carnero, María Carmen; Gómez, Andrés

2016-04-23

Healthcare organizations have far greater maintenance needs for their medical equipment than other organization, as many are used directly with patients. However, the literature on asset management in healthcare organizations is very limited. The aim of this research is to provide more rational application of maintenance policies, leading to an increase in quality of care. This article describes a multicriteria decision-making approach which integrates Markov chains with the multicriteria Measuring Attractiveness by a Categorical Based Evaluation Technique (MACBETH), to facilitate the best choice of combination of maintenance policies by using the judgements of a multi-disciplinary decision group. The proposed approach takes into account the level of acceptance that a given alternative would have among professionals. It also takes into account criteria related to cost, quality of care and impact of care cover. This multicriteria approach is applied to four dialysis subsystems: patients infected with hepatitis C, infected with hepatitis B, acute and chronic; in all cases, the maintenance strategy obtained consists of applying corrective and preventive maintenance plus two reserve machines. The added value in decision-making practices from this research comes from: (i) integrating the use of Markov chains to obtain the alternatives to be assessed by a multicriteria methodology; (ii) proposing the use of MACBETH to make rational decisions on asset management in healthcare organizations; (iii) applying the multicriteria approach to select a set or combination of maintenance policies in four dialysis subsystems of a health care organization. In the multicriteria decision making approach proposed, economic criteria have been used, related to the quality of care which is desired for patients (availability), and the acceptance that each alternative would have considering the maintenance and healthcare resources which exist in the organization, with the inclusion of a

Constructing quantum games from symmetric non-factorizable joint probabilities

International Nuclear Information System (INIS)

Chappell, James M.; Iqbal, Azhar; Abbott, Derek

2010-01-01

We construct quantum games from a table of non-factorizable joint probabilities, coupled with a symmetry constraint, requiring symmetrical payoffs between the players. We give the general result for a Nash equilibrium and payoff relations for a game based on non-factorizable joint probabilities, which embeds the classical game. We study a quantum version of Prisoners' Dilemma, Stag Hunt, and the Chicken game constructed from a given table of non-factorizable joint probabilities to find new outcomes in these games. We show that this approach provides a general framework for both classical and quantum games without recourse to the formalism of quantum mechanics.

Applying a Modified Triad Approach to Investigate Wastewater lines

International Nuclear Information System (INIS)

Pawlowicz, R.; Urizar, L.; Blanchard, S.; Jacobsen, K.; Scholfield, J.

2006-01-01

Approximately 20 miles of wastewater lines are below grade at an active military Base. This piping network feeds or fed domestic or industrial wastewater treatment plants on the Base. Past wastewater line investigations indicated potential contaminant releases to soil and groundwater. Further environmental assessment was recommended to characterize the lines because of possible releases. A Remedial Investigation (RI) using random sampling or use of sampling points spaced at predetermined distances along the entire length of the wastewater lines, however, would be inefficient and cost prohibitive. To accomplish RI goals efficiently and within budget, a modified Triad approach was used to design a defensible sampling and analysis plan and perform the investigation. The RI task was successfully executed and resulted in a reduced fieldwork schedule, and sampling and analytical costs. Results indicated that no major releases occurred at the biased sampling points. It was reasonably extrapolated that since releases did not occur at the most likely locations, then the entire length of a particular wastewater line segment was unlikely to have contaminated soil or groundwater and was recommended for no further action. A determination of no further action was recommended for the majority of the waste lines after completing the investigation. The modified Triad approach was successful and a similar approach could be applied to investigate wastewater lines on other United States Department of Defense or Department of Energy facilities. (authors)

A suggested approach toward measuring sorption and applying sorption data to repository performance assessment

International Nuclear Information System (INIS)

Rundberg, R.S.

1992-01-01

The prediction of radionuclide migration for the purpose of assessing the safety of a nuclear waste repository will be based on a collective knowledge of hydrologic and geochemical properties of the surrounding rock and groundwater. This knowledge along with assumption about the interactions of radionuclides with groundwater and minerals form the scientific basis for a model capable of accurately predicting the repository's performance. Because the interaction of radionuclides in geochemical systems is known to be complicated, several fundamental and empirical approaches to measuring the interaction between radionuclides and the geologic barrier have been developed. The approaches applied to the measurement of sorption involve the use of pure minerals, intact, or crushed rock in dynamic and static experiments. Each approach has its advantages and disadvantages. There is no single best method for providing sorption data for performance assessment models which can be applied without invoking information derived from multiple experiments. 53 refs., 12 figs

Consistent probabilities in loop quantum cosmology

International Nuclear Information System (INIS)

Craig, David A; Singh, Parampreet

2013-01-01

A fundamental issue for any quantum cosmological theory is to specify how probabilities can be assigned to various quantum events or sequences of events such as the occurrence of singularities or bounces. In previous work, we have demonstrated how this issue can be successfully addressed within the consistent histories approach to quantum theory for Wheeler–DeWitt-quantized cosmological models. In this work, we generalize that analysis to the exactly solvable loop quantization of a spatially flat, homogeneous and isotropic cosmology sourced with a massless, minimally coupled scalar field known as sLQC. We provide an explicit, rigorous and complete decoherent-histories formulation for this model and compute the probabilities for the occurrence of a quantum bounce versus a singularity. Using the scalar field as an emergent internal time, we show for generic states that the probability for a singularity to occur in this model is zero, and that of a bounce is unity, complementing earlier studies of the expectation values of the volume and matter density in this theory. We also show from the consistent histories point of view that all states in this model, whether quantum or classical, achieve arbitrarily large volume in the limit of infinite ‘past’ or ‘future’ scalar ‘time’, in the sense that the wave function evaluated at any arbitrary fixed value of the volume vanishes in that limit. Finally, we briefly discuss certain misconceptions concerning the utility of the consistent histories approach in these models. (paper)

Bayesian probability theory and inverse problems

International Nuclear Information System (INIS)

Kopec, S.

1994-01-01

Bayesian probability theory is applied to approximate solving of the inverse problems. In order to solve the moment problem with the noisy data, the entropic prior is used. The expressions for the solution and its error bounds are presented. When the noise level tends to zero, the Bayesian solution tends to the classic maximum entropy solution in the L 2 norm. The way of using spline prior is also shown. (author)

Computing exact bundle compliance control charts via probability generating functions.

Science.gov (United States)

Chen, Binchao; Matis, Timothy; Benneyan, James

2016-06-01

Compliance to evidenced-base practices, individually and in 'bundles', remains an important focus of healthcare quality improvement for many clinical conditions. The exact probability distribution of composite bundle compliance measures used to develop corresponding control charts and other statistical tests is based on a fairly large convolution whose direct calculation can be computationally prohibitive. Various series expansions and other approximation approaches have been proposed, each with computational and accuracy tradeoffs, especially in the tails. This same probability distribution also arises in other important healthcare applications, such as for risk-adjusted outcomes and bed demand prediction, with the same computational difficulties. As an alternative, we use probability generating functions to rapidly obtain exact results and illustrate the improved accuracy and detection over other methods. Numerical testing across a wide range of applications demonstrates the computational efficiency and accuracy of this approach.

The Problem of Probability: An Examination and Refutation of Hjørland’s Relevance Equation

DEFF Research Database (Denmark)

Nicolaisen, Jeppe

2017-01-01

Introduction. The paper presents a critical examination of Professor Birger Hjørland’s relevance equation: Something (A) is relevant to a task (T) if it increases the likelihood of accomplishing the goal (G), which is implied by T. Method. Two theories of probability logic (the logical theory...... and the intersubjective theory) are briefly reviewed and then applied to Hjørland’s equation. Analysis. Focusing on how these theories warrant the probability assumption makes it possible to detect deficiencies in Hjørland’s equation, based as it is on probability logic. Results. Regardless of the kind of logic applied...... to warrant the probability assumption of Hjørland’s equation, the outcome of using it to determine the relevance of any A to any T is found to have quite bizarre consequences: Either nothing is relevant or everything is relevant. Conclusion. Contrary to Hjørland’s claim that his relevance equation applies...

Influence of the Probability Level on the Framing Effect

OpenAIRE

Kaja Damnjanovic; Vasilije Gvozdenovic

2016-01-01

Research of the framing effect of risky choice mostly applies to the tasks where the effect of only one probability or risk level on the choice of non-risky or risky options was examined. The conducted research was aimed to examine the framing effect in the function of probability level in the outcome of a risk option in three decision-making domains: health, money and human lives. It has been confirmed that the decision-making domain moderates the framing effect. In the monetary domain, the ...

Propagating Mixed Uncertainties in Cyber Attacker Payoffs: Exploration of Two-Phase Monte Carlo Sampling and Probability Bounds Analysis

Energy Technology Data Exchange (ETDEWEB)

Chatterjee, Samrat; Tipireddy, Ramakrishna; Oster, Matthew R.; Halappanavar, Mahantesh

2016-09-16

Securing cyber-systems on a continual basis against a multitude of adverse events is a challenging undertaking. Game-theoretic approaches, that model actions of strategic decision-makers, are increasingly being applied to address cybersecurity resource allocation challenges. Such game-based models account for multiple player actions and represent cyber attacker payoffs mostly as point utility estimates. Since a cyber-attacker’s payoff generation mechanism is largely unknown, appropriate representation and propagation of uncertainty is a critical task. In this paper we expand on prior work and focus on operationalizing the probabilistic uncertainty quantification framework, for a notional cyber system, through: 1) representation of uncertain attacker and system-related modeling variables as probability distributions and mathematical intervals, and 2) exploration of uncertainty propagation techniques including two-phase Monte Carlo sampling and probability bounds analysis.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Uncharted territory: A complex systems approach as an emerging paradigm in applied linguistics

Directory of Open Access Journals (Sweden)

Weideman, Albert J

2009-12-01

Full Text Available Developing a theory of applied linguistics is a top priority for the discipline today. The emergence of a new paradigm - a complex systems approach - in applied linguistics presents us with a unique opportunity to give prominence to the development of a foundational framework for this design discipline. Far from being a mere philosophical exercise, such a framework will find application in the training and induction of new entrants into the discipline within the developing context of South Africa, as well as internationally.

Fractal supersymmetric QM, Geometric Probability and the Riemann Hypothesis

CERN Document Server

Castro, C

2004-01-01

The Riemann's hypothesis (RH) states that the nontrivial zeros of the Riemann zeta-function are of the form $ s_n =1/2+i\\lambda_n $. Earlier work on the RH based on supersymmetric QM, whose potential was related to the Gauss-Jacobi theta series, allows to provide the proper framework to construct the well defined algorithm to compute the probability to find a zero (an infinity of zeros) in the critical line. Geometric probability theory furnishes the answer to the very difficult question whether the probability that the RH is true is indeed equal to unity or not. To test the validity of this geometric probabilistic framework to compute the probability if the RH is true, we apply it directly to the the hyperbolic sine function $ \\sinh (s) $ case which obeys a trivial analog of the RH (the HSRH). Its zeros are equally spaced in the imaginary axis $ s_n = 0 + i n \\pi $. The geometric probability to find a zero (and an infinity of zeros) in the imaginary axis is exactly unity. We proceed with a fractal supersymme...

Empirical investigation on using wind speed volatility to estimate the operation probability and power output of wind turbines

International Nuclear Information System (INIS)

Liu, Heping; Shi, Jing; Qu, Xiuli

2013-01-01

Highlights: ► Ten-minute wind speed and power generation data of an offshore wind turbine are used. ► An ARMA–GARCH-M model is built to simultaneously forecast wind speed mean and volatility. ► The operation probability and expected power output of the wind turbine are predicted. ► The integrated approach produces more accurate wind power forecasting than other conventional methods. - Abstract: In this paper, we introduce a quantitative methodology that performs the interval estimation of wind speed, calculates the operation probability of wind turbine, and forecasts the wind power output. The technological advantage of this methodology stems from the empowered capability of mean and volatility forecasting of wind speed. Based on the real wind speed and corresponding wind power output data from an offshore wind turbine, this methodology is applied to build an ARMA–GARCH-M model for wind speed forecasting, and then to compute the operation probability and the expected power output of the wind turbine. The results show that the developed methodology is effective, the obtained interval estimation of wind speed is reliable, and the forecasted operation probability and expected wind power output of the wind turbine are accurate

On Probability Leakage

OpenAIRE

Briggs, William M.

2012-01-01

The probability leakage of model M with respect to evidence E is defined. Probability leakage is a kind of model error. It occurs when M implies that events $y$, which are impossible given E, have positive probability. Leakage does not imply model falsification. Models with probability leakage cannot be calibrated empirically. Regression models, which are ubiquitous in statistical practice, often evince probability leakage.

Applying discursive approaches to health psychology.

Science.gov (United States)

Seymour-Smith, Sarah

2015-04-01

The aim of this paper is to outline the contribution of two strands of discursive research, glossed as 'macro' and 'micro,' to the field of health psychology. A further goal is to highlight some contemporary debates in methodology associated with the use of interview data versus more naturalistic data in qualitative health research. Discursive approaches provide a way of analyzing talk as a social practice that considers how descriptions are put together and what actions they achieve. A selection of recent examples of discursive research from one applied area of health psychology, studies of diet and obesity, are drawn upon in order to illustrate the specifics of both strands. 'Macro' discourse work in psychology incorporates a Foucauldian focus on the way that discourses regulate subjectivities, whereas the concept of interpretative repertoires affords more agency to the individual: both are useful for identifying the cultural context of talk. Both 'macro' and 'micro' strands focus on accountability to varying degrees. 'Micro' Discursive Psychology, however, pays closer attention to the sequential organization of constructions and focuses on naturalistic settings that allow for the inclusion of an analysis of the health professional. Diets are typically depicted as an individual responsibility in mainstream health psychology, but discursive research highlights how discourses are collectively produced and bound up with social practices. (c) 2015 APA, all rights reserved).

Constructing quantum games from symmetric non-factorizable joint probabilities

Energy Technology Data Exchange (ETDEWEB)

Chappell, James M., E-mail: james.m.chappell@adelaide.edu.a [School of Chemistry and Physics, University of Adelaide, South Australia 5005 (Australia); School of Electrical and Electronic Engineering, University of Adelaide, South Australia 5005 (Australia); Iqbal, Azhar [School of Electrical and Electronic Engineering, University of Adelaide, South Australia 5005 (Australia); Centre for Advanced Mathematics and Physics, National University of Sciences and Technology, Peshawar Road, Rawalpindi (Pakistan); Abbott, Derek [School of Electrical and Electronic Engineering, University of Adelaide, South Australia 5005 (Australia)

2010-09-06

We construct quantum games from a table of non-factorizable joint probabilities, coupled with a symmetry constraint, requiring symmetrical payoffs between the players. We give the general result for a Nash equilibrium and payoff relations for a game based on non-factorizable joint probabilities, which embeds the classical game. We study a quantum version of Prisoners' Dilemma, Stag Hunt, and the Chicken game constructed from a given table of non-factorizable joint probabilities to find new outcomes in these games. We show that this approach provides a general framework for both classical and quantum games without recourse to the formalism of quantum mechanics.

Assigning probability distributions to input parameters of performance assessment models

Energy Technology Data Exchange (ETDEWEB)

Mishra, Srikanta [INTERA Inc., Austin, TX (United States)

2002-02-01

This study presents an overview of various approaches for assigning probability distributions to input parameters and/or future states of performance assessment models. Specifically,three broad approaches are discussed for developing input distributions: (a) fitting continuous distributions to data, (b) subjective assessment of probabilities, and (c) Bayesian updating of prior knowledge based on new information. The report begins with a summary of the nature of data and distributions, followed by a discussion of several common theoretical parametric models for characterizing distributions. Next, various techniques are presented for fitting continuous distributions to data. These include probability plotting, method of moments, maximum likelihood estimation and nonlinear least squares analysis. The techniques are demonstrated using data from a recent performance assessment study for the Yucca Mountain project. Goodness of fit techniques are also discussed, followed by an overview of how distribution fitting is accomplished in commercial software packages. The issue of subjective assessment of probabilities is dealt with in terms of the maximum entropy distribution selection approach, as well as some common rules for codifying informal expert judgment. Formal expert elicitation protocols are discussed next, and are based primarily on the guidance provided by the US NRC. The Bayesian framework for updating prior distributions (beliefs) when new information becomes available is discussed. A simple numerical approach is presented for facilitating practical applications of the Bayes theorem. Finally, a systematic framework for assigning distributions is presented: (a) for the situation where enough data are available to define an empirical CDF or fit a parametric model to the data, and (b) to deal with the situation where only a limited amount of information is available.

Assigning probability distributions to input parameters of performance assessment models

International Nuclear Information System (INIS)

Mishra, Srikanta

2002-02-01

This study presents an overview of various approaches for assigning probability distributions to input parameters and/or future states of performance assessment models. Specifically,three broad approaches are discussed for developing input distributions: (a) fitting continuous distributions to data, (b) subjective assessment of probabilities, and (c) Bayesian updating of prior knowledge based on new information. The report begins with a summary of the nature of data and distributions, followed by a discussion of several common theoretical parametric models for characterizing distributions. Next, various techniques are presented for fitting continuous distributions to data. These include probability plotting, method of moments, maximum likelihood estimation and nonlinear least squares analysis. The techniques are demonstrated using data from a recent performance assessment study for the Yucca Mountain project. Goodness of fit techniques are also discussed, followed by an overview of how distribution fitting is accomplished in commercial software packages. The issue of subjective assessment of probabilities is dealt with in terms of the maximum entropy distribution selection approach, as well as some common rules for codifying informal expert judgment. Formal expert elicitation protocols are discussed next, and are based primarily on the guidance provided by the US NRC. The Bayesian framework for updating prior distributions (beliefs) when new information becomes available is discussed. A simple numerical approach is presented for facilitating practical applications of the Bayes theorem. Finally, a systematic framework for assigning distributions is presented: (a) for the situation where enough data are available to define an empirical CDF or fit a parametric model to the data, and (b) to deal with the situation where only a limited amount of information is available

Unification of field theory and maximum entropy methods for learning probability densities

OpenAIRE

Kinney, Justin B.

2014-01-01

The need to estimate smooth probability distributions (a.k.a. probability densities) from finite sampled data is ubiquitous in science. Many approaches to this problem have been described, but none is yet regarded as providing a definitive solution. Maximum entropy estimation and Bayesian field theory are two such approaches. Both have origins in statistical physics, but the relationship between them has remained unclear. Here I unify these two methods by showing that every maximum entropy de...

Statistical validation of normal tissue complication probability models

NARCIS (Netherlands)

Xu, Cheng-Jian; van der Schaaf, Arjen; van t Veld, Aart; Langendijk, Johannes A.; Schilstra, Cornelis

2012-01-01

PURPOSE: To investigate the applicability and value of double cross-validation and permutation tests as established statistical approaches in the validation of normal tissue complication probability (NTCP) models. METHODS AND MATERIALS: A penalized regression method, LASSO (least absolute shrinkage

Comparative analysis on the probability of being a good payer

Science.gov (United States)

Mihova, V.; Pavlov, V.

2017-10-01

Credit risk assessment is crucial for the bank industry. The current practice uses various approaches for the calculation of credit risk. The core of these approaches is the use of multiple regression models, applied in order to assess the risk associated with the approval of people applying for certain products (loans, credit cards, etc.). Based on data from the past, these models try to predict what will happen in the future. Different data requires different type of models. This work studies the causal link between the conduct of an applicant upon payment of the loan and the data that he completed at the time of application. A database of 100 borrowers from a commercial bank is used for the purposes of the study. The available data includes information from the time of application and credit history while paying off the loan. Customers are divided into two groups, based on the credit history: Good and Bad payers. Linear and logistic regression are applied in parallel to the data in order to estimate the probability of being good for new borrowers. A variable, which contains value of 1 for Good borrowers and value of 0 for Bad candidates, is modeled as a dependent variable. To decide which of the variables listed in the database should be used in the modelling process (as independent variables), a correlation analysis is made. Due to the results of it, several combinations of independent variables are tested as initial models - both with linear and logistic regression. The best linear and logistic models are obtained after initial transformation of the data and following a set of standard and robust statistical criteria. A comparative analysis between the two final models is made and scorecards are obtained from both models to assess new customers at the time of application. A cut-off level of points, bellow which to reject the applications and above it - to accept them, has been suggested for both the models, applying the strategy to keep the same Accept Rate as

Rank-Ordered Multifractal Analysis (ROMA of probability distributions in fluid turbulence

Directory of Open Access Journals (Sweden)

C. C. Wu

2011-04-01

Full Text Available Rank-Ordered Multifractal Analysis (ROMA was introduced by Chang and Wu (2008 to describe the multifractal characteristic of intermittent events. The procedure provides a natural connection between the rank-ordered spectrum and the idea of one-parameter scaling for monofractals. This technique has successfully been applied to MHD turbulence simulations and turbulence data observed in various space plasmas. In this paper, the technique is applied to the probability distributions in the inertial range of the turbulent fluid flow, as given in the vast Johns Hopkins University (JHU turbulence database. In addition, a new way of finding the continuous ROMA spectrum and the scaled probability distribution function (PDF simultaneously is introduced.

Large deviations and idempotent probability

CERN Document Server

Puhalskii, Anatolii

2001-01-01

In the view of many probabilists, author Anatolii Puhalskii''s research results stand among the most significant achievements in the modern theory of large deviations. In fact, his work marked a turning point in the depth of our understanding of the connections between the large deviation principle (LDP) and well-known methods for establishing weak convergence results.Large Deviations and Idempotent Probability expounds upon the recent methodology of building large deviation theory along the lines of weak convergence theory. The author develops an idempotent (or maxitive) probability theory, introduces idempotent analogues of martingales (maxingales), Wiener and Poisson processes, and Ito differential equations, and studies their properties. The large deviation principle for stochastic processes is formulated as a certain type of convergence of stochastic processes to idempotent processes. The author calls this large deviation convergence.The approach to establishing large deviation convergence uses novel com...

Influence of the Probability Level on the Framing Effect

Directory of Open Access Journals (Sweden)

Kaja Damnjanovic

2016-11-01

Full Text Available Research of the framing effect of risky choice mostly applies to the tasks where the effect of only one probability or risk level on the choice of non-risky or risky options was examined. The conducted research was aimed to examine the framing effect in the function of probability level in the outcome of a risk option in three decision-making domains: health, money and human lives. It has been confirmed that the decision-making domain moderates the framing effect. In the monetary domain, the general risk aversion has been confirmed as registered in earlier research. At high probability levels, the framing effect is registered in both frames, while no framing effect is registered at lower probability levels. In the domain of decision-making about human lives, the framing effect is registered at medium high and medium low probability levels. In the domain of decision-making about health, the framing effect is registered almost in the entire probability range while this domain differs from the former two. The results show that the attitude to risk is not identical at different probability levels, that the dynamics of the attitude to risk influences the framing effect, and that the framing effect pattern is different in different decision-making domains. In other words, linguistic manipulation representing the frame in the tasks affects the change in the preference order only when the possibility of gain (expressed in probability is estimated as sufficiently high.

Space Object Collision Probability via Monte Carlo on the Graphics Processing Unit

Science.gov (United States)

Vittaldev, Vivek; Russell, Ryan P.

2017-09-01

Fast and accurate collision probability computations are essential for protecting space assets. Monte Carlo (MC) simulation is the most accurate but computationally intensive method. A Graphics Processing Unit (GPU) is used to parallelize the computation and reduce the overall runtime. Using MC techniques to compute the collision probability is common in literature as the benchmark. An optimized implementation on the GPU, however, is a challenging problem and is the main focus of the current work. The MC simulation takes samples from the uncertainty distributions of the Resident Space Objects (RSOs) at any time during a time window of interest and outputs the separations at closest approach. Therefore, any uncertainty propagation method may be used and the collision probability is automatically computed as a function of RSO collision radii. Integration using a fixed time step and a quartic interpolation after every Runge Kutta step ensures that no close approaches are missed. Two orders of magnitude speedups over a serial CPU implementation are shown, and speedups improve moderately with higher fidelity dynamics. The tool makes the MC approach tractable on a single workstation, and can be used as a final product, or for verifying surrogate and analytical collision probability methods.

Maximum likelihood approach for several stochastic volatility models

International Nuclear Information System (INIS)

Camprodon, Jordi; Perelló, Josep

2012-01-01

Volatility measures the amplitude of price fluctuations. Despite it being one of the most important quantities in finance, volatility is not directly observable. Here we apply a maximum likelihood method which assumes that price and volatility follow a two-dimensional diffusion process where volatility is the stochastic diffusion coefficient of the log-price dynamics. We apply this method to the simplest versions of the expOU, the OU and the Heston stochastic volatility models and we study their performance in terms of the log-price probability, the volatility probability, and its Mean First-Passage Time. The approach has some predictive power on the future returns amplitude by only knowing the current volatility. The assumed models do not consider long-range volatility autocorrelation and the asymmetric return-volatility cross-correlation but the method still yields very naturally these two important stylized facts. We apply the method to different market indices and with a good performance in all cases. (paper)

Proximity approach to study fusion probabilities in heavy-ion collisions

International Nuclear Information System (INIS)

Raj Kumari

2013-01-01

The fusion cross-sections at the sub-barrier energies are found to be enhanced compared to the predictions of the barrier penetration model. The aim is to test Bass 80, Aage Winther (AW) 95, Denisov DP, Proximity 2010 and Skyrme Energy Density Formalism (SEDF) at energies above as well as below barrier height. For the present systematic study, the fusion probabilities for the reactions of 28 Si+ 24,26 Mg 30 Si+ 24 Mg and 28,30 Si+ 58,62 Ni have been calculated

Quantum probabilities as Dempster-Shafer probabilities in the lattice of subspaces

International Nuclear Information System (INIS)

Vourdas, A.

2014-01-01

The orthocomplemented modular lattice of subspaces L[H(d)], of a quantum system with d-dimensional Hilbert space H(d), is considered. A generalized additivity relation which holds for Kolmogorov probabilities is violated by quantum probabilities in the full lattice L[H(d)] (it is only valid within the Boolean subalgebras of L[H(d)]). This suggests the use of more general (than Kolmogorov) probability theories, and here the Dempster-Shafer probability theory is adopted. An operator D(H 1 ,H 2 ), which quantifies deviations from Kolmogorov probability theory is introduced, and it is shown to be intimately related to the commutator of the projectors P(H 1 ),P(H 2 ), to the subspaces H 1 , H 2 . As an application, it is shown that the proof of the inequalities of Clauser, Horne, Shimony, and Holt for a system of two spin 1/2 particles is valid for Kolmogorov probabilities, but it is not valid for Dempster-Shafer probabilities. The violation of these inequalities in experiments supports the interpretation of quantum probabilities as Dempster-Shafer probabilities

Measures, Probability and Holography in Cosmology

Science.gov (United States)

Phillips, Daniel

comment on the general implications of this view, and specifically question the application of classical probability theory to cosmology in cases where key questions are known to have no quantum answer. We argue that the ideas developed here may offer a way out of the notorious measure problems of eternal inflation. The fourth project looks at finite universes as alternatives to multiverse theories of cosmology. We compare two holographic arguments that impose especially strong bounds on the amount of inflation. One comes from the de Sitter Equilibrium cosmology and the other from the work of Banks and Fischler. We find that simple versions of these two approaches yield the same bound on the number of e-foldings. A careful examination reveals that while these pictures are similar in spirit, they are not necessarily identical prescriptions. We apply the two pictures to specific cosmologies which expose potentially important differences and which also demonstrate ways these seemingly simple proposals can be tricky to implement in practice.

Probability evolution method for exit location distribution

Science.gov (United States)

Zhu, Jinjie; Chen, Zhen; Liu, Xianbin

2018-03-01

The exit problem in the framework of the large deviation theory has been a hot topic in the past few decades. The most probable escape path in the weak-noise limit has been clarified by the Freidlin-Wentzell action functional. However, noise in real physical systems cannot be arbitrarily small while noise with finite strength may induce nontrivial phenomena, such as noise-induced shift and noise-induced saddle-point avoidance. Traditional Monte Carlo simulation of noise-induced escape will take exponentially large time as noise approaches zero. The majority of the time is wasted on the uninteresting wandering around the attractors. In this paper, a new method is proposed to decrease the escape simulation time by an exponentially large factor by introducing a series of interfaces and by applying the reinjection on them. This method can be used to calculate the exit location distribution. It is verified by examining two classical examples and is compared with theoretical predictions. The results show that the method performs well for weak noise while may induce certain deviations for large noise. Finally, some possible ways to improve our method are discussed.

A Mathematical Modelling Approach to One-Day Cricket Batting Orders

Science.gov (United States)

Bukiet, Bruce; Ovens, Matthews

2006-01-01

While scoring strategies and player performance in cricket have been studied, there has been little published work about the influence of batting order with respect to One-Day cricket. We apply a mathematical modelling approach to compute efficiently the expected performance (runs distribution) of a cricket batting order in an innings. Among other applications, our method enables one to solve for the probability of one team beating another or to find the optimal batting order for a set of 11 players. The influence of defence and bowling ability can be taken into account in a straightforward manner. In this presentation, we outline how we develop our Markov Chain approach to studying the progress of runs for a batting order of non- identical players along the lines of work in baseball modelling by Bukiet et al., 1997. We describe the issues that arise in applying such methods to cricket, discuss ideas for addressing these difficulties and note limitations on modelling batting order for One-Day cricket. By performing our analysis on a selected subset of the possible batting orders, we apply the model to quantify the influence of batting order in a game of One Day cricket using available real-world data for current players. Key Points Batting order does effect the expected runs distribution in one-day cricket. One-day cricket has fewer data points than baseball, thus extreme values have greater effect on estimated probabilities. Dismissals rare and probabilities very small by comparison to baseball. Probability distribution for lower order batsmen is potentially skewed due to increased risk taking. Full enumeration of all possible line-ups is impractical using a single average computer. PMID:24357943

Conditional probability of the tornado missile impact given a tornado occurrence

International Nuclear Information System (INIS)

Goodman, J.; Koch, J.E.

1982-01-01

Using an approach based on statistical mechanics, an expression for the probability of the first missile strike is developed. The expression depends on two generic parameters (injection probability eta(F) and height distribution psi(Z,F)), which are developed in this study, and one plant specific parameter (number of potential missiles N/sub p/). The expression for the joint probability of simultaneous impact of muitiple targets is also developed. This espression is applicable to calculation of the probability of common cause failure due to tornado missiles. It is shown that the probability of the first missile strike can be determined using a uniform missile distribution model. It is also shown that the conditional probability of the second strike, given the first, is underestimated by the uniform model. The probability of the second strike is greatly increased if the missiles are in clusters large enough to cover both targets

PROBABILITY SURVEYS , CONDITIONAL PROBABILITIES AND ECOLOGICAL RISK ASSESSMENT

Science.gov (United States)

We show that probability-based environmental resource monitoring programs, such as the U.S. Environmental Protection Agency's (U.S. EPA) Environmental Monitoring and Assessment Program, and conditional probability analysis can serve as a basis for estimating ecological risk over ...

Interaction probability value calculi for some scintillators

International Nuclear Information System (INIS)

Garcia-Torano Martinez, E.; Grau Malonda, A.

1989-01-01

Interaction probabilities for 17 gamma-ray energies between 1 and 1.000 KeV have been computed and tabulated. The tables may be applied to the case of cylindrical vials with radius 1,25 cm and volumes 5, 10 and 15 ml. Toluene, Toluene/Alcohol, Dioxane-Naftalen, PCS, INSTAGEL and HISAFE II scintillators are considered. Graphical results for 10 ml are also given. (Author) 11 refs

On the discretization of probability density functions and the ...

Indian Academy of Sciences (India)

important for most applications or theoretical problems of interest. In statistics ... In probability theory, statistics, statistical mechanics, communication theory, and other .... (1) by taking advantage of SMVT as a general mathematical approach.

Left passage probability of Schramm-Loewner Evolution

Science.gov (United States)

Najafi, M. N.

2013-06-01

SLE(κ,ρ⃗) is a variant of Schramm-Loewner Evolution (SLE) which describes the curves which are not conformal invariant, but are self-similar due to the presence of some other preferred points on the boundary. In this paper we study the left passage probability (LPP) of SLE(κ,ρ⃗) through field theoretical framework and find the differential equation governing this probability. This equation is numerically solved for the special case κ=2 and hρ=0 in which hρ is the conformal weight of the boundary changing (bcc) operator. It may be referred to loop erased random walk (LERW) and Abelian sandpile model (ASM) with a sink on its boundary. For the curve which starts from ξ0 and conditioned by a change of boundary conditions at x0, we find that this probability depends significantly on the factor x0-ξ0. We also present the perturbative general solution for large x0. As a prototype, we apply this formalism to SLE(κ,κ-6) which governs the curves that start from and end on the real axis.

Probability of bystander effect induced by alpha-particles emitted by radon progeny using the analytical model of tracheobronchial tree

International Nuclear Information System (INIS)

Jovanovic, B.; Nikezic, D.

2010-01-01

Radiation-induced biological bystander effects have become a phenomenon associated with the interaction of radiation with cells. There is a need to include the influence of biological effects in the dosimetry of the human lung. With this aim, the purpose of this work is to calculate the probability of bystander effect induced by alpha-particle radiation on sensitive cells of the human lung. Probability was calculated by applying the analytical model cylinder bifurcation, which was created to simulate the geometry of the human lung with the geometric distribution of cell nuclei in the airway wall of the tracheobronchial tree. This analytical model of the human tracheobronchial tree represents the extension of the ICRP 66 model, and follows it as much as possible. Reported probabilities are calculated for various targets and alpha-particle energies. Probability of bystander effect has been calculated for alpha particles with 6 and 7.69 MeV energies, which are emitted in the 222 Rn chain. The application of these results may enhance current dose risk estimation approaches in the sense of the inclusion of the influence of the biological effects. (authors)

Contributions to quantum probability

International Nuclear Information System (INIS)

Fritz, Tobias

2010-01-01

Chapter 1: On the existence of quantum representations for two dichotomic measurements. Under which conditions do outcome probabilities of measurements possess a quantum-mechanical model? This kind of problem is solved here for the case of two dichotomic von Neumann measurements which can be applied repeatedly to a quantum system with trivial dynamics. The solution uses methods from the theory of operator algebras and the theory of moment problems. The ensuing conditions reveal surprisingly simple relations between certain quantum-mechanical probabilities. It also shown that generally, none of these relations holds in general probabilistic models. This result might facilitate further experimental discrimination between quantum mechanics and other general probabilistic theories. Chapter 2: Possibilistic Physics. I try to outline a framework for fundamental physics where the concept of probability gets replaced by the concept of possibility. Whereas a probabilistic theory assigns a state-dependent probability value to each outcome of each measurement, a possibilistic theory merely assigns one of the state-dependent labels ''possible to occur'' or ''impossible to occur'' to each outcome of each measurement. It is argued that Spekkens' combinatorial toy theory of quantum mechanics is inconsistent in a probabilistic framework, but can be regarded as possibilistic. Then, I introduce the concept of possibilistic local hidden variable models and derive a class of possibilistic Bell inequalities which are violated for the possibilistic Popescu-Rohrlich boxes. The chapter ends with a philosophical discussion on possibilistic vs. probabilistic. It can be argued that, due to better falsifiability properties, a possibilistic theory has higher predictive power than a probabilistic one. Chapter 3: The quantum region for von Neumann measurements with postselection. It is determined under which conditions a probability distribution on a finite set can occur as the outcome

Quantum Zeno and anti-Zeno effects measured by transition probabilities

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenxian, E-mail: wxzhang@whu.edu.cn [School of Physics and Technology, Wuhan University, Wuhan, Hubei 430072 (China); Department of Optical Science and Engineering, Fudan University, Shanghai 200433 (China); CEMS, RIKEN, Saitama 351-0198 (Japan); Kavli Institute for Theoretical Physics China, CAS, Beijing 100190 (China); Kofman, A.G. [CEMS, RIKEN, Saitama 351-0198 (Japan); Department of Physics, The University of Michigan, Ann Arbor, MI 48109-1040 (United States); Zhuang, Jun [Department of Optical Science and Engineering, Fudan University, Shanghai 200433 (China); You, J.Q. [Beijing Computational Science Research Center, Beijing 10084 (China); Department of Physics, Fudan University, Shanghai 200433 (China); CEMS, RIKEN, Saitama 351-0198 (Japan); Nori, Franco [CEMS, RIKEN, Saitama 351-0198 (Japan); Department of Physics, The University of Michigan, Ann Arbor, MI 48109-1040 (United States)

2013-10-30

Using numerical calculations, we compare the transition probabilities of many spins in random magnetic fields, subject to either frequent projective measurements, frequent phase modulations, or a mix of modulations and measurements. For various distribution functions, we find the transition probability under frequent modulations is suppressed most if the pulse delay is short and the evolution time is larger than a critical value. Furthermore, decay freezing occurs only under frequent modulations as the pulse delay approaches zero. In the large pulse-delay region, however, the transition probabilities under frequent modulations are highest among the three control methods.

A Regional Guidebook for Applying The Approach to Assessing Wetland Functions of Depressed Wetlands in Peninsular, Florida

National Research Council Canada - National Science Library

Noble, Chris

2004-01-01

The Hydrogeomophic (HGM) Approach is a method for developing functional indices and the protocols used to apply these indices to the assessment of wetland functions at a site-specific scale The HGM Approach was initially...

The possibilities of applying a risk-oriented approach to the NPP reliability and safety enhancement problem

Science.gov (United States)

Komarov, Yu. A.

2014-10-01

An analysis and some generalizations of approaches to risk assessments are presented. Interconnection between different interpretations of the "risk" notion is shown, and the possibility of applying the fuzzy set theory to risk assessments is demonstrated. A generalized formulation of the risk assessment notion is proposed in applying risk-oriented approaches to the problem of enhancing reliability and safety in nuclear power engineering. The solution of problems using the developed risk-oriented approaches aimed at achieving more reliable and safe operation of NPPs is described. The results of studies aimed at determining the need (advisability) to modernize/replace NPP elements and systems are presented together with the results obtained from elaborating the methodical principles of introducing the repair concept based on the equipment technical state. The possibility of reducing the scope of tests and altering the NPP systems maintenance strategy is substantiated using the risk-oriented approach. A probabilistic model for estimating the validity of boric acid concentration measurements is developed.

Probability, Statistics, and Stochastic Processes

CERN Document Server

Olofsson, Peter

2012-01-01

This book provides a unique and balanced approach to probability, statistics, and stochastic processes.   Readers gain a solid foundation in all three fields that serves as a stepping stone to more advanced investigations into each area.  The Second Edition features new coverage of analysis of variance (ANOVA), consistency and efficiency of estimators, asymptotic theory for maximum likelihood estimators, empirical distribution function and the Kolmogorov-Smirnov test, general linear models, multiple comparisons, Markov chain Monte Carlo (MCMC), Brownian motion, martingales, and

Evaluations of Structural Failure Probabilities and Candidate Inservice Inspection Programs

Energy Technology Data Exchange (ETDEWEB)

Khaleel, Mohammad A.; Simonen, Fredric A.

2009-05-01

The work described in this report applies probabilistic structural mechanics models to predict the reliability of nuclear pressure boundary components. These same models are then applied to evaluate the effectiveness of alternative programs for inservice inspection to reduce these failure probabilities. Results of the calculations support the development and implementation of risk-informed inservice inspection of piping and vessels. Studies have specifically addressed the potential benefits of ultrasonic inspections to reduce failure probabilities associated with fatigue crack growth and stress-corrosion cracking. Parametric calculations were performed with the computer code pc-PRAISE to generate an extensive set of plots to cover a wide range of pipe wall thicknesses, cyclic operating stresses, and inspection strategies. The studies have also addressed critical inputs to fracture mechanics calculations such as the parameters that characterize the number and sizes of fabrication flaws in piping welds. Other calculations quantify uncertainties associated with the inputs calculations, the uncertainties in the fracture mechanics models, and the uncertainties in the resulting calculated failure probabilities. A final set of calculations address the effects of flaw sizing errors on the effectiveness of inservice inspection programs.

Probability-Based Ship Design Procedures: A Demonstration. Phase 1.

Science.gov (United States)

1992-09-01

Although actuarially speaking, this should refer to the probability that the structure catastrophically fails, the term is generally and widely used as a...termed "empty", while otherwise they are called "qualified" upcrossings, a terminology devised by Vanmarcke ( ASME , J. Applied Mechanics, March 1975

DETERMINING TYPE Ia SUPERNOVA HOST GALAXY EXTINCTION PROBABILITIES AND A STATISTICAL APPROACH TO ESTIMATING THE ABSORPTION-TO-REDDENING RATIO R{sub V}

Energy Technology Data Exchange (ETDEWEB)

Cikota, Aleksandar [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching b. München (Germany); Deustua, Susana [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Marleau, Francine, E-mail: acikota@eso.org [Institute for Astro- and Particle Physics, University of Innsbruck, Technikerstrasse 25/8, A-6020 Innsbruck (Austria)

2016-03-10

We investigate limits on the extinction values of Type Ia supernovae (SNe Ia) to statistically determine the most probable color excess, E(B – V), with galactocentric distance, and use these statistics to determine the absorption-to-reddening ratio, R{sub V}, for dust in the host galaxies. We determined pixel-based dust mass surface density maps for 59 galaxies from the Key Insight on Nearby Galaxies: a Far-infrared Survey with Herschel (KINGFISH). We use SN Ia spectral templates to develop a Monte Carlo simulation of color excess E(B – V) with R{sub V} = 3.1 and investigate the color excess probabilities E(B – V) with projected radial galaxy center distance. Additionally, we tested our model using observed spectra of SN 1989B, SN 2002bo, and SN 2006X, which occurred in three KINGFISH galaxies. Finally, we determined the most probable reddening for Sa–Sap, Sab–Sbp, Sbc–Scp, Scd–Sdm, S0, and irregular galaxy classes as a function of R/R{sub 25}. We find that the largest expected reddening probabilities are in Sab–Sb and Sbc–Sc galaxies, while S0 and irregular galaxies are very dust poor. We present a new approach for determining the absorption-to-reddening ratio R{sub V} using color excess probability functions and find values of R{sub V} = 2.71 ± 1.58 for 21 SNe Ia observed in Sab–Sbp galaxies, and R{sub V} = 1.70 ± 0.38, for 34 SNe Ia observed in Sbc–Scp galaxies.

Probability an introduction

CERN Document Server

Goldberg, Samuel

1960-01-01

Excellent basic text covers set theory, probability theory for finite sample spaces, binomial theorem, probability distributions, means, standard deviations, probability function of binomial distribution, more. Includes 360 problems with answers for half.

Raman spectroscopy detection of platelet for Alzheimer’s disease with predictive probabilities

International Nuclear Information System (INIS)

Wang, L J; Du, X Q; Du, Z W; Yang, Y Y; Chen, P; Wang, X H; Cheng, Y; Peng, J; Shen, A G; Hu, J M; Tian, Q; Shang, X L; Liu, Z C; Yao, X Q; Wang, J Z

2014-01-01

Alzheimer’s disease (AD) is a common form of dementia. Early and differential diagnosis of AD has always been an arduous task for the medical expert due to the unapparent early symptoms and the currently imperfect imaging examination methods. Therefore, obtaining reliable markers with clinical diagnostic value in easily assembled samples is worthy and significant. Our previous work with laser Raman spectroscopy (LRS), in which we detected platelet samples of different ages of AD transgenic mice and non-transgenic controls, showed great effect in the diagnosis of AD. In addition, a multilayer perception network (MLP) classification method was adopted to discriminate the spectral data. However, there were disturbances, which were induced by noise from the machines and so on, in the data set; thus the MLP method had to be trained with large-scale data. In this paper, we aim to re-establish the classification models of early and advanced AD and the control group with fewer features, and apply some mechanism of noise reduction to improve the accuracy of models. An adaptive classification method based on the Gaussian process (GP) featured, with predictive probabilities, is proposed, which could tell when a data set is related to some kind of disease. Compared with MLP on the same feature set, GP showed much better performance in the experimental results. What is more, since the spectra of platelets are isolated from AD, GP has good expansibility and can be applied in diagnosis of many other similar diseases, such as Parkinson’s disease (PD). Spectral data of 4 month and 12 month AD platelets, as well as control data, were collected. With predictive probabilities, the proposed GP classification method improved the diagnostic sensitivity to nearly 100%. Samples were also collected from PD platelets as classification and comparison to the 12 month AD. The presented approach and our experiments indicate that utilization of GP with predictive probabilities in

Estimating the joint survival probabilities of married individuals

NARCIS (Netherlands)

Sanders, Lisanne; Melenberg, Bertrand

We estimate the joint survival probability of spouses using a large random sample drawn from a Dutch census. As benchmarks we use two bivariate Weibull models. We consider more flexible models, using a semi-nonparametric approach, by extending the independent Weibull distribution using squared

[95/95] Approach for design limits analysis in WWER

International Nuclear Information System (INIS)

Shishkov, L.; Tsyganov, S.

2008-01-01

The paper discusses a well-known condition [95%/95%], which is important for monitoring some limits of core parameters in the course of designing the reactors (such as PWR or WWER). The condition ensures the postulate 'there is at least a 95 % probability at a 95 % confidence level that' some parameter does not exceed the limit. Such conditions are stated, for instance, in US standards and IAEA norms as recommendations for DNBR and fuel temperature. A question may arise: why can such approach for the limits be only applied to these parameters, while not normally applied to any other parameters? What is the way to ensure the limits in design practice? Using the general statements of mathematical statistics the authors interpret the [95/95] approach as applied to WWER design limits. (Authors)

Modern Approaches to the Computation of the Probability of Target Detection in Cluttered Environments

Science.gov (United States)

Meitzler, Thomas J.

The field of computer vision interacts with fields such as psychology, vision research, machine vision, psychophysics, mathematics, physics, and computer science. The focus of this thesis is new algorithms and methods for the computation of the probability of detection (Pd) of a target in a cluttered scene. The scene can be either a natural visual scene such as one sees with the naked eye (visual), or, a scene displayed on a monitor with the help of infrared sensors. The relative clutter and the temperature difference between the target and background (DeltaT) are defined and then used to calculate a relative signal -to-clutter ratio (SCR) from which the Pd is calculated for a target in a cluttered scene. It is shown how this definition can include many previous definitions of clutter and (DeltaT). Next, fuzzy and neural -fuzzy techniques are used to calculate the Pd and it is shown how these methods can give results that have a good correlation with experiment. The experimental design for actually measuring the Pd of a target by observers is described. Finally, wavelets are applied to the calculation of clutter and it is shown how this new definition of clutter based on wavelets can be used to compute the Pd of a target.

Analysis of intra-pulse frequency-modulated, low probability of ...

Indian Academy of Sciences (India)

A R SACHIN

In this paper, we investigate the problem of analysis of low probability of ... concepts, algorithms, technologies, sensors and systems. It ..... A linear programming approach [27] using ... flipped. Solutions are obtained by solving for unknowns as.

Probability 1/e

Science.gov (United States)

Koo, Reginald; Jones, Martin L.

2011-01-01

Quite a number of interesting problems in probability feature an event with probability equal to 1/e. This article discusses three such problems and attempts to explain why this probability occurs with such frequency.

Clan structure analysis and rapidity gap probability

International Nuclear Information System (INIS)

Lupia, S.; Giovannini, A.; Ugoccioni, R.

1995-01-01

Clan structure analysis in rapidity intervals is generalized from negative binomial multiplicity distribution to the wide class of compound Poisson distributions. The link of generalized clan structure analysis with correlation functions is also established. These theoretical results are then applied to minimum bias events and evidentiate new interesting features, which can be inspiring and useful in order to discuss data on rapidity gap probability at TEVATRON and HERA. (orig.)

Clan structure analysis and rapidity gap probability

Energy Technology Data Exchange (ETDEWEB)

Lupia, S. [Turin Univ. (Italy). Ist. di Fisica Teorica]|[Istituto Nazionale di Fisica Nucleare, Turin (Italy); Giovannini, A. [Turin Univ. (Italy). Ist. di Fisica Teorica]|[Istituto Nazionale di Fisica Nucleare, Turin (Italy); Ugoccioni, R. [Turin Univ. (Italy). Ist. di Fisica Teorica]|[Istituto Nazionale di Fisica Nucleare, Turin (Italy)

1995-03-01

Clan structure analysis in rapidity intervals is generalized from negative binomial multiplicity distribution to the wide class of compound Poisson distributions. The link of generalized clan structure analysis with correlation functions is also established. These theoretical results are then applied to minimum bias events and evidentiate new interesting features, which can be inspiring and useful in order to discuss data on rapidity gap probability at TEVATRON and HERA. (orig.)

Quantum probabilities of composite events in quantum measurements with multimode states

International Nuclear Information System (INIS)

Yukalov, V I; Sornette, D

2013-01-01

The problem of defining quantum probabilities of composite events is considered. This problem is of great importance for the theory of quantum measurements and for quantum decision theory, which is a part of measurement theory. We show that the Lüders probability of consecutive measurements is a transition probability between two quantum states and that this probability cannot be treated as a quantum extension of the classical conditional probability. The Wigner distribution is shown to be a weighted transition probability that cannot be accepted as a quantum extension of the classical joint probability. We suggest the definition of quantum joint probabilities by introducing composite events in multichannel measurements. The notion of measurements under uncertainty is defined. We demonstrate that the necessary condition for mode interference is the entanglement of the composite prospect together with the entanglement of the composite statistical state. As an illustration, we consider an example of a quantum game. Special attention is paid to the application of the approach to systems with multimode states, such as atoms, molecules, quantum dots, or trapped Bose-condensed atoms with several coherent modes. (paper)

Half-life measurements and photon emission probabilities of frequently applied radioisotopes

International Nuclear Information System (INIS)

Schoetzig, U.; Schrader, H.

1998-09-01

It belongs to the duties of the PTB department for 'Radioactivity' to determine the radioactivity emitted by radioactive radiation sources and publish their specific decay data, also called ''standards'', so that appliers of such sources may calibrate their equipment accordingly, as e.g. photon detectors. Further data required for proper calibration are those defining the photon emission probability per decay, P(E), at the relevant photon energy E. The emission rate R(E) is derived from the activity A, by the calculus R(E)=A x P(E), and the half-lives of decay, T 1 /2, together with the standards are used for determining the time of measurement. The calibration quality essentially is determined by those two parameters and the incertainties involved. The PTB 'Radioactivity' department therefore publishes for users recommended decay data elaborated and used by the experts at PTB. The tabulated data are either measured at PTB, or critically selected from data compilations of other publication sources. The tabulated decay data presented here are intended to serve as a source of reference for laboratory work and should be used in combination with the comprehensive data collections available (see the bibliography of this document: 86BRFI, 91TECD, 96FI, Nuclear Data Sheets, e.g. 98ND84). (orig./CB) [de

Fatigue damage approach applied to Li-ion batteries ageing characterization

Energy Technology Data Exchange (ETDEWEB)

Dudézert, C. [Renault, Technocentre, Guyancourt (France); Université Paris Sud/Université Paris-Saclay, ICMMO (UMR CNRS 8182), Orsay (France); CEA/LITEN, Grenoble (France); Reynier, Y. [CEA/LITEN, Grenoble (France); Duffault, J.-M. [Université Paris Sud/Université Paris-Saclay, ICMMO (UMR CNRS 8182), Orsay (France); Franger, S., E-mail: sylvain.franger@u-psud.fr [Université Paris Sud/Université Paris-Saclay, ICMMO (UMR CNRS 8182), Orsay (France)

2016-11-15

Reliability of energy storage devices is one of the foremost concerns in electric vehicles (EVs) development. Battery ageing, i.e. the degradation of battery energy and power, depends mainly on time, on the environmental conditions and on the in-use solicitations endured by the storage system. In case of EV, the heavy dependence of the battery use with the car performance, the driving cycles, and the weather conditions make the battery life prediction an intricate issue. Mechanical physicists have developed a quick and exhaustive methodology to diagnose reliability of complex structures enduring complex loads. This “fatigue” approach expresses the performance fading due to a complex load through the evolution corresponding to basic ones. Thus, a state of health variable named “damage” binds the load history and ageing. The battery ageing study described here consists in applying this mechanical approach to electrochemical systems by connecting the ageing factors with the battery characteristics evolutions. In that way, a specific “fatigue” test protocol has been established. This experimental confrontation has led to distinguishing calendar from cycling ageing mechanisms.

Fatigue damage approach applied to Li-ion batteries ageing characterization

International Nuclear Information System (INIS)

Dudézert, C.; Reynier, Y.; Duffault, J.-M.; Franger, S.

2016-01-01

Reliability of energy storage devices is one of the foremost concerns in electric vehicles (EVs) development. Battery ageing, i.e. the degradation of battery energy and power, depends mainly on time, on the environmental conditions and on the in-use solicitations endured by the storage system. In case of EV, the heavy dependence of the battery use with the car performance, the driving cycles, and the weather conditions make the battery life prediction an intricate issue. Mechanical physicists have developed a quick and exhaustive methodology to diagnose reliability of complex structures enduring complex loads. This “fatigue” approach expresses the performance fading due to a complex load through the evolution corresponding to basic ones. Thus, a state of health variable named “damage” binds the load history and ageing. The battery ageing study described here consists in applying this mechanical approach to electrochemical systems by connecting the ageing factors with the battery characteristics evolutions. In that way, a specific “fatigue” test protocol has been established. This experimental confrontation has led to distinguishing calendar from cycling ageing mechanisms.

Impact of the probability of causation on the radiation protection program

International Nuclear Information System (INIS)

Meinhold, C.B.

1988-01-01

Although the probability of causation approach is the only scientific basis on which a given cancer can be judged to be causally related to a given exposure, the impact of this concept on the radiation safety program could be counter-productive. As health physicists, the practices and the concepts we employ have been developed to protect the worker. Effective dose equivalent and committed dose equivalent are protective concepts but useless for probability of causation analysis. Perhaps extensive records will be the only way that good radiation protection and probability of causation analysis can coexist

Wald Sequential Probability Ratio Test for Analysis of Orbital Conjunction Data

Science.gov (United States)

Carpenter, J. Russell; Markley, F. Landis; Gold, Dara

2013-01-01

We propose a Wald Sequential Probability Ratio Test for analysis of commonly available predictions associated with spacecraft conjunctions. Such predictions generally consist of a relative state and relative state error covariance at the time of closest approach, under the assumption that prediction errors are Gaussian. We show that under these circumstances, the likelihood ratio of the Wald test reduces to an especially simple form, involving the current best estimate of collision probability, and a similar estimate of collision probability that is based on prior assumptions about the likelihood of collision.

Geospatial tools effectively estimate nonexceedance probabilities of daily streamflow at ungauged and intermittently gauged locations in Ohio

Directory of Open Access Journals (Sweden)

William H. Farmer

2017-10-01

New hydrological insights for the region: Several methods for estimating nonexceedance probabilities of daily mean streamflows are explored, including single-index methodologies (nearest-neighboring index and geospatial tools (kriging and topological kriging. These methods were evaluated by conducting leave-one-out cross-validations based on analyses of nearly 7 years of daily streamflow data from 79 unregulated streamgages in Ohio and neighboring states. The pooled, ordinary kriging model, with a median Nash–Sutcliffe performance of 0.87, was superior to the single-site index methods, though there was some bias in the tails of the probability distribution. Incorporating network structure through topological kriging did not improve performance. The pooled, ordinary kriging model was applied to 118 locations without systematic streamgaging across Ohio where instantaneous streamflow measurements had been made concurrent with water-quality sampling on at least 3 separate days. Spearman rank correlations between estimated nonexceedance probabilities and measured streamflows were high, with a median value of 0.76. In consideration of application, the degree of regulation in a set of sample sites helped to specify the streamgages required to implement kriging approaches successfully.

The probable effect of integrated reporting on audit quality

Directory of Open Access Journals (Sweden)

Tamer A. El Nashar

2016-06-01

Full Text Available This paper examines a probable effect of integrated reporting on improving the audit quality of organizations. I correlate the hypothesis of this paper in relation to the current trends of protecting the economies, the financial markets and the societies. I predict an improvement of the audit quality, as a result to an estimated percentage of organizations’ reliance on the integrated reporting in their accountability perspective. I used a decision tree and a Bayes’ theorem approach, to predict the probabilities of the significant effect on improving the auditing quality. I find the overall result of this paper, indicates that the probability of organizations to rely on the integrated reporting by a significant percentage, predicts also a significant improvement in audit quality.

Simulation approaches to probabilistic structural design at the component level

International Nuclear Information System (INIS)

Stancampiano, P.A.

1978-01-01

In this paper, structural failure of large nuclear components is viewed as a random process with a low probability of occurrence. Therefore, a statistical interpretation of probability does not apply and statistical inferences cannot be made due to the sparcity of actual structural failure data. In such cases, analytical estimates of the failure probabilities may be obtained from stress-strength interference theory. Since the majority of real design applications are complex, numerical methods are required to obtain solutions. Monte Carlo simulation appears to be the best general numerical approach. However, meaningful applications of simulation methods suggest research activities in three categories: methods development, failure mode models development, and statistical data models development. (Auth.)

Contributions to quantum probability

Energy Technology Data Exchange (ETDEWEB)

Fritz, Tobias

2010-06-25

Chapter 1: On the existence of quantum representations for two dichotomic measurements. Under which conditions do outcome probabilities of measurements possess a quantum-mechanical model? This kind of problem is solved here for the case of two dichotomic von Neumann measurements which can be applied repeatedly to a quantum system with trivial dynamics. The solution uses methods from the theory of operator algebras and the theory of moment problems. The ensuing conditions reveal surprisingly simple relations between certain quantum-mechanical probabilities. It also shown that generally, none of these relations holds in general probabilistic models. This result might facilitate further experimental discrimination between quantum mechanics and other general probabilistic theories. Chapter 2: Possibilistic Physics. I try to outline a framework for fundamental physics where the concept of probability gets replaced by the concept of possibility. Whereas a probabilistic theory assigns a state-dependent probability value to each outcome of each measurement, a possibilistic theory merely assigns one of the state-dependent labels ''possible to occur'' or ''impossible to occur'' to each outcome of each measurement. It is argued that Spekkens' combinatorial toy theory of quantum mechanics is inconsistent in a probabilistic framework, but can be regarded as possibilistic. Then, I introduce the concept of possibilistic local hidden variable models and derive a class of possibilistic Bell inequalities which are violated for the possibilistic Popescu-Rohrlich boxes. The chapter ends with a philosophical discussion on possibilistic vs. probabilistic. It can be argued that, due to better falsifiability properties, a possibilistic theory has higher predictive power than a probabilistic one. Chapter 3: The quantum region for von Neumann measurements with postselection. It is determined under which conditions a probability distribution on a

Multiclass Posterior Probability Twin SVM for Motor Imagery EEG Classification.

Science.gov (United States)

She, Qingshan; Ma, Yuliang; Meng, Ming; Luo, Zhizeng

2015-01-01

Motor imagery electroencephalography is widely used in the brain-computer interface systems. Due to inherent characteristics of electroencephalography signals, accurate and real-time multiclass classification is always challenging. In order to solve this problem, a multiclass posterior probability solution for twin SVM is proposed by the ranking continuous output and pairwise coupling in this paper. First, two-class posterior probability model is constructed to approximate the posterior probability by the ranking continuous output techniques and Platt's estimating method. Secondly, a solution of multiclass probabilistic outputs for twin SVM is provided by combining every pair of class probabilities according to the method of pairwise coupling. Finally, the proposed method is compared with multiclass SVM and twin SVM via voting, and multiclass posterior probability SVM using different coupling approaches. The efficacy on the classification accuracy and time complexity of the proposed method has been demonstrated by both the UCI benchmark datasets and real world EEG data from BCI Competition IV Dataset 2a, respectively.

Probability intervals for the top event unavailability of fault trees

International Nuclear Information System (INIS)

Lee, Y.T.; Apostolakis, G.E.

1976-06-01

The evaluation of probabilities of rare events is of major importance in the quantitative assessment of the risk from large technological systems. In particular, for nuclear power plants the complexity of the systems, their high reliability and the lack of significant statistical records have led to the extensive use of logic diagrams in the estimation of low probabilities. The estimation of probability intervals for the probability of existence of the top event of a fault tree is examined. Given the uncertainties of the primary input data, a method is described for the evaluation of the first four moments of the top event occurrence probability. These moments are then used to estimate confidence bounds by several approaches which are based on standard inequalities (e.g., Tchebycheff, Cantelli, etc.) or on empirical distributions (the Johnson family). Several examples indicate that the Johnson family of distributions yields results which are in good agreement with those produced by Monte Carlo simulation

Foundations of probability

International Nuclear Information System (INIS)

Fraassen, B.C. van

1979-01-01

The interpretation of probabilities in physical theories are considered, whether quantum or classical. The following points are discussed 1) the functions P(μ, Q) in terms of which states and propositions can be represented, are classical (Kolmogoroff) probabilities, formally speaking, 2) these probabilities are generally interpreted as themselves conditional, and the conditions are mutually incompatible where the observables are maximal and 3) testing of the theory typically takes the form of confronting the expectation values of observable Q calculated with probability measures P(μ, Q) for states μ; hence, of comparing the probabilities P(μ, Q)(E) with the frequencies of occurrence of the corresponding events. It seems that even the interpretation of quantum mechanics, in so far as it concerns what the theory says about the empirical (i.e. actual, observable) phenomena, deals with the confrontation of classical probability measures with observable frequencies. This confrontation is studied. (Auth./C.F.)

Use of soft probabilities in evaluating physical-security systems

International Nuclear Information System (INIS)

Green, J.N.

1982-03-01

The complexity of evaluating how a physical security system would perform against a broad array of threat situations dictates the use by an inspector of methods which are not completely rigorous. Intuition and judgment based on experience have a large role to play. The use of soft probabilities can give meaningful results when the nature of the situation to which they are applied is sufficiently understood. Although the scoring method proposed is based on complex theory, it is feasible to apply on an intuitive basis. 6 figures

Comparative analysis through probability distributions of a data set

Science.gov (United States)

Cristea, Gabriel; Constantinescu, Dan Mihai

2018-02-01

In practice, probability distributions are applied in such diverse fields as risk analysis, reliability engineering, chemical engineering, hydrology, image processing, physics, market research, business and economic research, customer support, medicine, sociology, demography etc. This article highlights important aspects of fitting probability distributions to data and applying the analysis results to make informed decisions. There are a number of statistical methods available which can help us to select the best fitting model. Some of the graphs display both input data and fitted distributions at the same time, as probability density and cumulative distribution. The goodness of fit tests can be used to determine whether a certain distribution is a good fit. The main used idea is to measure the "distance" between the data and the tested distribution, and compare that distance to some threshold values. Calculating the goodness of fit statistics also enables us to order the fitted distributions accordingly to how good they fit to data. This particular feature is very helpful for comparing the fitted models. The paper presents a comparison of most commonly used goodness of fit tests as: Kolmogorov-Smirnov, Anderson-Darling, and Chi-Squared. A large set of data is analyzed and conclusions are drawn by visualizing the data, comparing multiple fitted distributions and selecting the best model. These graphs should be viewed as an addition to the goodness of fit tests.

Framework for applying RI-ISI methodology for Indian PHWRs

International Nuclear Information System (INIS)

Vinod, Gopika; Saraf, R.K.; Ghosh, A.K.; Kushwaha, H.S.

2006-01-01

Risk Informed In-Service Inspection (RI-ISI) aims at categorizing the components for In-Service inspection based on their contribution to Risk. For defining the contribution of risk from components, their failure probabilities and its subsequent effect on Core Damage Frequency (CDF) needs to be evaluated using Probabilistic Safety Assessment methodology. During the last several years, both the U.S. Nuclear Regulatory Commission (NRC) and the nuclear industry have recognized that Probabilistic Safety Assessment (PSA) has evolved to be more useful in supplementing traditional engineering approaches in reactor regulation. The paper highlights the various stages involved in applying RI-ISI and then compares the findings with existing ISI practices. (author)

Sundanese ancient manuscripts search engine using probability approach

Science.gov (United States)

Suryani, Mira; Hadi, Setiawan; Paulus, Erick; Nurma Yulita, Intan; Supriatna, Asep K.

2017-10-01

Today, Information and Communication Technology (ICT) has become a regular thing for every aspect of live include cultural and heritage aspect. Sundanese ancient manuscripts as Sundanese heritage are in damage condition and also the information that containing on it. So in order to preserve the information in Sundanese ancient manuscripts and make them easier to search, a search engine has been developed. The search engine must has good computing ability. In order to get the best computation in developed search engine, three types of probabilistic approaches: Bayesian Networks Model, Divergence from Randomness with PL2 distribution, and DFR-PL2F as derivative form DFR-PL2 have been compared in this study. The three probabilistic approaches supported by index of documents and three different weighting methods: term occurrence, term frequency, and TF-IDF. The experiment involved 12 Sundanese ancient manuscripts. From 12 manuscripts there are 474 distinct terms. The developed search engine tested by 50 random queries for three types of query. The experiment results showed that for the single query and multiple query, the best searching performance given by the combination of PL2F approach and TF-IDF weighting method. The performance has been evaluated using average time responds with value about 0.08 second and Mean Average Precision (MAP) about 0.33.

Handbook of probability

CERN Document Server

Florescu, Ionut

2013-01-01

THE COMPLETE COLLECTION NECESSARY FOR A CONCRETE UNDERSTANDING OF PROBABILITY Written in a clear, accessible, and comprehensive manner, the Handbook of Probability presents the fundamentals of probability with an emphasis on the balance of theory, application, and methodology. Utilizing basic examples throughout, the handbook expertly transitions between concepts and practice to allow readers an inclusive introduction to the field of probability. The book provides a useful format with self-contained chapters, allowing the reader easy and quick reference. Each chapter includes an introductio

Probability sampling design in ethnobotanical surveys of medicinal plants

Directory of Open Access Journals (Sweden)

Mariano Martinez Espinosa

2012-07-01

Full Text Available Non-probability sampling design can be used in ethnobotanical surveys of medicinal plants. However, this method does not allow statistical inferences to be made from the data generated. The aim of this paper is to present a probability sampling design that is applicable in ethnobotanical studies of medicinal plants. The sampling design employed in the research titled "Ethnobotanical knowledge of medicinal plants used by traditional communities of Nossa Senhora Aparecida do Chumbo district (NSACD, Poconé, Mato Grosso, Brazil" was used as a case study. Probability sampling methods (simple random and stratified sampling were used in this study. In order to determine the sample size, the following data were considered: population size (N of 1179 families; confidence coefficient, 95%; sample error (d, 0.05; and a proportion (p, 0.5. The application of this sampling method resulted in a sample size (n of at least 290 families in the district. The present study concludes that probability sampling methods necessarily have to be employed in ethnobotanical studies of medicinal plants, particularly where statistical inferences have to be made using data obtained. This can be achieved by applying different existing probability sampling methods, or better still, a combination of such methods.

Probability-1

CERN Document Server

Shiryaev, Albert N

2016-01-01

This book contains a systematic treatment of probability from the ground up, starting with intuitive ideas and gradually developing more sophisticated subjects, such as random walks, martingales, Markov chains, the measure-theoretic foundations of probability theory, weak convergence of probability measures, and the central limit theorem. Many examples are discussed in detail, and there are a large number of exercises. The book is accessible to advanced undergraduates and can be used as a text for independent study. To accommodate the greatly expanded material in the third edition of Probability, the book is now divided into two volumes. This first volume contains updated references and substantial revisions of the first three chapters of the second edition. In particular, new material has been added on generating functions, the inclusion-exclusion principle, theorems on monotonic classes (relying on a detailed treatment of “π-λ” systems), and the fundamental theorems of mathematical statistics.

Introduction to tensorial resistivity probability tomography

OpenAIRE

Mauriello, Paolo; Patella, Domenico

2005-01-01

The probability tomography approach developed for the scalar resistivity method is here extended to the 2D tensorial apparent resistivity acquisition mode. The rotational invariant derived from the trace of the apparent resistivity tensor is considered, since it gives on the datum plane anomalies confined above the buried objects. Firstly, a departure function is introduced as the difference between the tensorial invariant measured over the real structure and that computed for a reference uni...

Exact combinatorial approach to finite coagulating systems

Science.gov (United States)

Fronczak, Agata; Chmiel, Anna; Fronczak, Piotr

2018-02-01

This paper outlines an exact combinatorial approach to finite coagulating systems. In this approach, cluster sizes and time are discrete and the binary aggregation alone governs the time evolution of the systems. By considering the growth histories of all possible clusters, an exact expression is derived for the probability of a coagulating system with an arbitrary kernel being found in a given cluster configuration when monodisperse initial conditions are applied. Then this probability is used to calculate the time-dependent distribution for the number of clusters of a given size, the average number of such clusters, and that average's standard deviation. The correctness of our general expressions is proved based on the (analytical and numerical) results obtained for systems with the constant kernel. In addition, the results obtained are compared with the results arising from the solutions to the mean-field Smoluchowski coagulation equation, indicating its weak points. The paper closes with a brief discussion on the extensibility to other systems of the approach presented herein, emphasizing the issue of arbitrary initial conditions.

Introduction to probability and statistics for ecosystem managers simulation and resampling

CERN Document Server

Haas, Timothy C

2013-01-01

Explores computer-intensive probability and statistics for ecosystem management decision making Simulation is an accessible way to explain probability and stochastic model behavior to beginners. This book introduces probability and statistics to future and practicing ecosystem managers by providing a comprehensive treatment of these two areas. The author presents a self-contained introduction for individuals involved in monitoring, assessing, and managing ecosystems and features intuitive, simulation-based explanations of probabilistic and statistical concepts. Mathematical programming details are provided for estimating ecosystem model parameters with Minimum Distance, a robust and computer-intensive method. The majority of examples illustrate how probability and statistics can be applied to ecosystem management challenges. There are over 50 exercises - making this book suitable for a lecture course in a natural resource and/or wildlife management department, or as the main text in a program of self-stud...

Nuclear power: accident probabilities, risks, and benefits. A bibliography

International Nuclear Information System (INIS)

1976-02-01

This report is a selected listing of 396 documents pertaining to nuclear accident probability and nuclear risk. Because of the attention focused on these concepts by the recent (August 1974) publication of the draft of WASH-1400, ''Reactor Safety Study,'' it is intended that this bibliography make conveniently available the existence of relevant literature on these concepts. Such an awareness will enhance an understanding of probability and risk as applied to nuclear power plants and is essential to their further development and/or application. This bibliography includes first a listing of the selected documents with abstracts and keywords, followed by three indexes: (1) keyword, (2) author, and (3) permuted title

PHOTOMETRIC REDSHIFTS AND QUASAR PROBABILITIES FROM A SINGLE, DATA-DRIVEN GENERATIVE MODEL

International Nuclear Information System (INIS)

Bovy, Jo; Hogg, David W.; Weaver, Benjamin A.; Myers, Adam D.; Hennawi, Joseph F.; McMahon, Richard G.; Schiminovich, David; Sheldon, Erin S.; Brinkmann, Jon; Schneider, Donald P.

2012-01-01

We describe a technique for simultaneously classifying and estimating the redshift of quasars. It can separate quasars from stars in arbitrary redshift ranges, estimate full posterior distribution functions for the redshift, and naturally incorporate flux uncertainties, missing data, and multi-wavelength photometry. We build models of quasars in flux-redshift space by applying the extreme deconvolution technique to estimate the underlying density. By integrating this density over redshift, one can obtain quasar flux densities in different redshift ranges. This approach allows for efficient, consistent, and fast classification and photometric redshift estimation. This is achieved by combining the speed obtained by choosing simple analytical forms as the basis of our density model with the flexibility of non-parametric models through the use of many simple components with many parameters. We show that this technique is competitive with the best photometric quasar classification techniques—which are limited to fixed, broad redshift ranges and high signal-to-noise ratio data—and with the best photometric redshift techniques when applied to broadband optical data. We demonstrate that the inclusion of UV and NIR data significantly improves photometric quasar-star separation and essentially resolves all of the redshift degeneracies for quasars inherent to the ugriz filter system, even when included data have a low signal-to-noise ratio. For quasars spectroscopically confirmed by the SDSS 84% and 97% of the objects with Galaxy Evolution Explorer UV and UKIDSS NIR data have photometric redshifts within 0.1 and 0.3, respectively, of the spectroscopic redshift; this amounts to about a factor of three improvement over ugriz-only photometric redshifts. Our code to calculate quasar probabilities and redshift probability distributions is publicly available.

Estimated probability of stroke among medical outpatients in Enugu ...

African Journals Online (AJOL)

Risk factors for stroke were evaluated using a series of laboratory tests, medical history and physical examinations. The 10‑year probability of stroke was determined by applying the Framingham stroke risk equation. Statistical analysis was performed with the use of the SPSS 17.0 software package (SPSS Inc., Chicago, IL, ...

Effects produced by oscillations applied to nonlinear dynamic systems: a general approach and examples

DEFF Research Database (Denmark)

Blekhman, I. I.; Sorokin, V. S.

2016-01-01

A general approach to study effects produced by oscillations applied to nonlinear dynamic systems is developed. It implies a transition from initial governing equations of motion to much more simple equations describing only the main slow component of motions (the vibro-transformed dynamics.......g., the requirement for the involved nonlinearities to be weak. The approach is illustrated by several relevant examples from various fields of science, e.g., mechanics, physics, chemistry and biophysics....... equations). The approach is named as the oscillatory strobodynamics, since motions are perceived as under a stroboscopic light. The vibro-transformed dynamics equations comprise terms that capture the averaged effect of oscillations. The method of direct separation of motions appears to be an efficient...

Simple Planar Truss (Linear, Nonlinear and Stochastic Approach

Directory of Open Access Journals (Sweden)

Frydrýšek Karel

2016-11-01

Full Text Available This article deals with a simple planar and statically determinate pin-connected truss. It demonstrates the processes and methods of derivations and solutions according to 1st and 2nd order theories. The article applies linear and nonlinear approaches and their simplifications via a Maclaurin series. Programming connected with the stochastic Simulation-Based Reliability Method (i.e. the direct Monte Carlo approach is used to conduct a probabilistic reliability assessment (i.e. a calculation of the probability that plastic deformation will occur in members of the truss.

An Overview of Modeling Approaches Applied to Aggregation-Based Fleet Management and Integration of Plug-in Electric Vehicles †

DEFF Research Database (Denmark)

You, Shi; Hu, Junjie; Ziras, Charalampos

2016-01-01

The design and implementation of management policies for plug-in electric vehicles (PEVs) need to be supported by a holistic understanding of the functional processes, their complex interactions, and their response to various changes. Models developed to represent different functional processes...... and systems are seen as useful tools to support the related studies for different stakeholders in a tangible way. This paper presents an overview of modeling approaches applied to support aggregation-based management and integration of PEVs from the perspective of fleet operators and grid operators......, respectively. We start by explaining a structured modeling approach, i.e., a flexible combination of process models and system models, applied to different management and integration studies. A state-of-the-art overview of modeling approaches applied to represent several key processes, such as charging...

On calculating the probability of a set of orthologous sequences

Directory of Open Access Journals (Sweden)

Junfeng Liu

2009-02-01

Full Text Available Junfeng Liu1,2, Liang Chen3, Hongyu Zhao4, Dirk F Moore1,2, Yong Lin1,2, Weichung Joe Shih1,21Biometrics Division, The Cancer, Institute of New Jersey, New Brunswick, NJ, USA; 2Department of Biostatistics, School of Public Health, University of Medicine and Dentistry of New Jersey, Piscataway, NJ, USA; 3Department of Biological Sciences, University of Southern California, Los Angeles, CA, USA; 4Department of Epidemiology and Public Health, Yale University School of Medicine, New Haven, CT, USAAbstract: Probabilistic DNA sequence models have been intensively applied to genome research. Within the evolutionary biology framework, this article investigates the feasibility for rigorously estimating the probability of a set of orthologous DNA sequences which evolve from a common progenitor. We propose Monte Carlo integration algorithms to sample the unknown ancestral and/or root sequences a posteriori conditional on a reference sequence and apply pairwise Needleman–Wunsch alignment between the sampled and nonreference species sequences to estimate the probability. We test our algorithms on both simulated and real sequences and compare calculated probabilities from Monte Carlo integration to those induced by single multiple alignment.Keywords: evolution, Jukes–Cantor model, Monte Carlo integration, Needleman–Wunsch alignment, orthologous

Calculating failure probabilities for TRISO-coated fuel particles using an integral formulation

International Nuclear Information System (INIS)

Miller, Gregory K.; Maki, John T.; Knudson, Darrell L.; Petti, David A.

2010-01-01

The fundamental design for a gas-cooled reactor relies on the safe behavior of the coated particle fuel. The coating layers surrounding the fuel kernels in these spherical particles, termed the TRISO coating, act as a pressure vessel that retains fission products. The quality of the fuel is reflected in the number of particle failures that occur during reactor operation, where failed particles become a source for fission products that can then diffuse through the fuel element. The failure probability for any batch of particles, which has traditionally been calculated using the Monte Carlo method, depends on statistical variations in design parameters and on variations in the strengths of coating layers among particles in the batch. An alternative approach to calculating failure probabilities is developed herein that uses direct numerical integration of a failure probability integral. Because this is a multiple integral where the statistically varying parameters become integration variables, a fast numerical integration approach is also developed. In sample cases analyzed involving multiple failure mechanisms, results from the integration methods agree closely with Monte Carlo results. Additionally, the fast integration approach, particularly, is shown to significantly improve efficiency of failure probability calculations. These integration methods have been implemented in the PARFUME fuel performance code along with the Monte Carlo method, where each serves to verify accuracy of the others.

Determination of stability of epimetamorphic rock slope using Minimax Probability Machine

Directory of Open Access Journals (Sweden)

Manoj Kumar

2016-01-01

Full Text Available The article employs Minimax Probability Machine (MPM for the prediction of the stability status of epimetamorphic rock slope. The MPM gives a worst-case bound on the probability of misclassification of future data points. Bulk density (d, height (H, inclination (β, cohesion (c and internal friction angle (φ have been used as input of the MPM. This study uses the MPM as a classification technique. Two models {Linear Minimax Probability Machine (LMPM and Kernelized Minimax Probability Machine (KMPM} have been developed. The generalization capability of the developed models has been checked by a case study. The experimental results demonstrate that MPM-based approaches are promising tools for the prediction of the stability status of epimetamorphic rock slope.

Poisson statistics of PageRank probabilities of Twitter and Wikipedia networks

Science.gov (United States)

Frahm, Klaus M.; Shepelyansky, Dima L.

2014-04-01

We use the methods of quantum chaos and Random Matrix Theory for analysis of statistical fluctuations of PageRank probabilities in directed networks. In this approach the effective energy levels are given by a logarithm of PageRank probability at a given node. After the standard energy level unfolding procedure we establish that the nearest spacing distribution of PageRank probabilities is described by the Poisson law typical for integrable quantum systems. Our studies are done for the Twitter network and three networks of Wikipedia editions in English, French and German. We argue that due to absence of level repulsion the PageRank order of nearby nodes can be easily interchanged. The obtained Poisson law implies that the nearby PageRank probabilities fluctuate as random independent variables.

Gamma-Ray interaction probabilities for some liquid scintillators

International Nuclear Information System (INIS)

Garcia-Torano Martinez, E.; Grau Malonda, A.

1989-01-01

Interaction probabilities for 17 gamma-Ray energies between 1 and 1.000 KeV have been computed and tabulated. The tables may be applied to the case of cylindrical vials with radius 1,25 cm and volumes 5, 10 and 15 ml. Toluene, Toluene/Alcohol, Dioxane-Naftalene, PCS, INSTAGEL and HISAFE II scintillators are considered. Graphical results for 10 ml are also given. (Author)

An novel frequent probability pattern mining algorithm based on circuit simulation method in uncertain biological networks

Science.gov (United States)

2014-01-01

Background Motif mining has always been a hot research topic in bioinformatics. Most of current research on biological networks focuses on exact motif mining. However, due to the inevitable experimental error and noisy data, biological network data represented as the probability model could better reflect the authenticity and biological significance, therefore, it is more biological meaningful to discover probability motif in uncertain biological networks. One of the key steps in probability motif mining is frequent pattern discovery which is usually based on the possible world model having a relatively high computational complexity. Methods In this paper, we present a novel method for detecting frequent probability patterns based on circuit simulation in the uncertain biological networks. First, the partition based efficient search is applied to the non-tree like subgraph mining where the probability of occurrence in random networks is small. Then, an algorithm of probability isomorphic based on circuit simulation is proposed. The probability isomorphic combines the analysis of circuit topology structure with related physical properties of voltage in order to evaluate the probability isomorphism between probability subgraphs. The circuit simulation based probability isomorphic can avoid using traditional possible world model. Finally, based on the algorithm of probability subgraph isomorphism, two-step hierarchical clustering method is used to cluster subgraphs, and discover frequent probability patterns from the clusters. Results The experiment results on data sets of the Protein-Protein Interaction (PPI) networks and the transcriptional regulatory networks of E. coli and S. cerevisiae show that the proposed method can efficiently discover the frequent probability subgraphs. The discovered subgraphs in our study contain all probability motifs reported in the experiments published in other related papers. Conclusions The algorithm of probability graph isomorphism

Estimation of probability of failure for damage-tolerant aerospace structures

Science.gov (United States)

Halbert, Keith

dissertation describes and develops new PDTA methodologies that directly address the deficiencies of the currently used tools. The new methods are implemented as a free, publicly licensed and open source R software package that can be downloaded from the Comprehensive R Archive Network. The tools consist of two main components. First, an explicit (and expensive) Monte Carlo approach is presented which simulates the life of an aircraft structural component flight-by-flight. This straightforward MC routine can be used to provide defensible estimates of the failure probabilities for future flights and repair probabilities for future inspections under a variety of failure and maintenance scenarios. This routine is intended to provide baseline estimates against which to compare the results of other, more efficient approaches. Second, an original approach is described which models the fatigue process and future scheduled inspections as a hidden Markov model. This model is solved using a particle-based approximation and the sequential importance sampling algorithm, which provides an efficient solution to the PDTA problem. Sequential importance sampling is an extension of importance sampling to a Markov process, allowing for efficient Bayesian updating of model parameters. This model updating capability, the benefit of which is demonstrated, is lacking in other PDTA approaches. The results of this approach are shown to agree with the results of the explicit Monte Carlo routine for a number of PDTA problems. Extensions to the typical PDTA problem, which cannot be solved using currently available tools, are presented and solved in this work. These extensions include incorporating observed evidence (such as non-destructive inspection results), more realistic treatment of possible future repairs, and the modeling of failure involving more than one crack (the so-called continuing damage problem). The described hidden Markov model / sequential importance sampling approach to PDTA has the

Interpretations of probability

CERN Document Server

Khrennikov, Andrei

2009-01-01

This is the first fundamental book devoted to non-Kolmogorov probability models. It provides a mathematical theory of negative probabilities, with numerous applications to quantum physics, information theory, complexity, biology and psychology. The book also presents an interesting model of cognitive information reality with flows of information probabilities, describing the process of thinking, social, and psychological phenomena.

Probability in reasoning: a developmental test on conditionals.

Science.gov (United States)

Barrouillet, Pierre; Gauffroy, Caroline

2015-04-01

Probabilistic theories have been claimed to constitute a new paradigm for the psychology of reasoning. A key assumption of these theories is captured by what they call the Equation, the hypothesis that the meaning of the conditional is probabilistic in nature and that the probability of If p then q is the conditional probability, in such a way that P(if p then q)=P(q|p). Using the probabilistic truth-table task in which participants are required to evaluate the probability of If p then q sentences, the present study explored the pervasiveness of the Equation through ages (from early adolescence to adulthood), types of conditionals (basic, causal, and inducements) and contents. The results reveal that the Equation is a late developmental achievement only endorsed by a narrow majority of educated adults for certain types of conditionals depending on the content they involve. Age-related changes in evaluating the probability of all the conditionals studied closely mirror the development of truth-value judgements observed in previous studies with traditional truth-table tasks. We argue that our modified mental model theory can account for this development, and hence for the findings related with the probability task, which do not consequently support the probabilistic approach of human reasoning over alternative theories. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantum probability ranking principle for ligand-based virtual screening

Science.gov (United States)

Al-Dabbagh, Mohammed Mumtaz; Salim, Naomie; Himmat, Mubarak; Ahmed, Ali; Saeed, Faisal

2017-04-01

Chemical libraries contain thousands of compounds that need screening, which increases the need for computational methods that can rank or prioritize compounds. The tools of virtual screening are widely exploited to enhance the cost effectiveness of lead drug discovery programs by ranking chemical compounds databases in decreasing probability of biological activity based upon probability ranking principle (PRP). In this paper, we developed a novel ranking approach for molecular compounds inspired by quantum mechanics, called quantum probability ranking principle (QPRP). The QPRP ranking criteria would make an attempt to draw an analogy between the physical experiment and molecular structure ranking process for 2D fingerprints in ligand based virtual screening (LBVS). The development of QPRP criteria in LBVS has employed the concepts of quantum at three different levels, firstly at representation level, this model makes an effort to develop a new framework of molecular representation by connecting the molecular compounds with mathematical quantum space. Secondly, estimate the similarity between chemical libraries and references based on quantum-based similarity searching method. Finally, rank the molecules using QPRP approach. Simulated virtual screening experiments with MDL drug data report (MDDR) data sets showed that QPRP outperformed the classical ranking principle (PRP) for molecular chemical compounds.

Quantum probability ranking principle for ligand-based virtual screening.

Science.gov (United States)

Al-Dabbagh, Mohammed Mumtaz; Salim, Naomie; Himmat, Mubarak; Ahmed, Ali; Saeed, Faisal

2017-04-01

Chemical libraries contain thousands of compounds that need screening, which increases the need for computational methods that can rank or prioritize compounds. The tools of virtual screening are widely exploited to enhance the cost effectiveness of lead drug discovery programs by ranking chemical compounds databases in decreasing probability of biological activity based upon probability ranking principle (PRP). In this paper, we developed a novel ranking approach for molecular compounds inspired by quantum mechanics, called quantum probability ranking principle (QPRP). The QPRP ranking criteria would make an attempt to draw an analogy between the physical experiment and molecular structure ranking process for 2D fingerprints in ligand based virtual screening (LBVS). The development of QPRP criteria in LBVS has employed the concepts of quantum at three different levels, firstly at representation level, this model makes an effort to develop a new framework of molecular representation by connecting the molecular compounds with mathematical quantum space. Secondly, estimate the similarity between chemical libraries and references based on quantum-based similarity searching method. Finally, rank the molecules using QPRP approach. Simulated virtual screening experiments with MDL drug data report (MDDR) data sets showed that QPRP outperformed the classical ranking principle (PRP) for molecular chemical compounds.

Application of Probability Calculations to the Study of the Permissible Step and Touch Potentials to Ensure Personnel Safety

International Nuclear Information System (INIS)

Eisawy, E.A.

2011-01-01

The aim of this paper is to develop a practical method to evaluate the actual step and touch potential distributions in order to determine the risk of failure of the grounding system. The failure probability, indicating the safety level of the grounding system, is related to both applied (stress) and withstand (strength) step or touch potentials. The probability distributions of the applied step and touch potentials as well as the corresponding withstand step and touch potentials which represent the capability of the human body to resist stress potentials are presented. These two distributions are used to evaluate the failure probability of the grounding system which denotes the probability that the applied potential exceeds the withstand potential. The method is accomplished in considering the resistance of the human body, the foot contact resistance and the fault clearing time as an independent random variables, rather than fixed values as treated in the previous analysis in determining the safety requirements for a given grounding system

A formalism to generate probability distributions for performance-assessment modeling

International Nuclear Information System (INIS)

Kaplan, P.G.

1990-01-01

A formalism is presented for generating probability distributions of parameters used in performance-assessment modeling. The formalism is used when data are either sparse or nonexistent. The appropriate distribution is a function of the known or estimated constraints and is chosen to maximize a quantity known as Shannon's informational entropy. The formalism is applied to a parameter used in performance-assessment modeling. The functional form of the model that defines the parameter, data from the actual field site, and natural analog data are analyzed to estimate the constraints. A beta probability distribution of the example parameter is generated after finding four constraints. As an example of how the formalism is applied to the site characterization studies of Yucca Mountain, the distribution is generated for an input parameter in a performance-assessment model currently used to estimate compliance with disposal of high-level radioactive waste in geologic repositories, 10 CFR 60.113(a)(2), commonly known as the ground water travel time criterion. 8 refs., 2 figs

A Generalized Estimating Equations Approach to Model Heterogeneity and Time Dependence in Capture-Recapture Studies

Directory of Open Access Journals (Sweden)

Akanda Md. Abdus Salam

2017-03-01

Full Text Available Individual heterogeneity in capture probabilities and time dependence are fundamentally important for estimating the closed animal population parameters in capture-recapture studies. A generalized estimating equations (GEE approach accounts for linear correlation among capture-recapture occasions, and individual heterogeneity in capture probabilities in a closed population capture-recapture individual heterogeneity and time variation model. The estimated capture probabilities are used to estimate animal population parameters. Two real data sets are used for illustrative purposes. A simulation study is carried out to assess the performance of the GEE estimator. A Quasi-Likelihood Information Criterion (QIC is applied for the selection of the best fitting model. This approach performs well when the estimated population parameters depend on the individual heterogeneity and the nature of linear correlation among capture-recapture occasions.

Applying a new ensemble approach to estimating stock status of marine fisheries around the world

DEFF Research Database (Denmark)

Rosenberg, Andrew A.; Kleisner, Kristin M.; Afflerbach, Jamie

2018-01-01

The exploitation status of marine fisheries stocks worldwide is of critical importance for food security, ecosystem conservation, and fishery sustainability. Applying a suite of data-limited methods to global catch data, combined through an ensemble modeling approach, we provide quantitative esti...

Multiple model cardinalized probability hypothesis density filter

Science.gov (United States)

Georgescu, Ramona; Willett, Peter

2011-09-01

The Probability Hypothesis Density (PHD) filter propagates the first-moment approximation to the multi-target Bayesian posterior distribution while the Cardinalized PHD (CPHD) filter propagates both the posterior likelihood of (an unlabeled) target state and the posterior probability mass function of the number of targets. Extensions of the PHD filter to the multiple model (MM) framework have been published and were implemented either with a Sequential Monte Carlo or a Gaussian Mixture approach. In this work, we introduce the multiple model version of the more elaborate CPHD filter. We present the derivation of the prediction and update steps of the MMCPHD particularized for the case of two target motion models and proceed to show that in the case of a single model, the new MMCPHD equations reduce to the original CPHD equations.

Cluster Validity Classification Approaches Based on Geometric Probability and Application in the Classification of Remotely Sensed Images

Directory of Open Access Journals (Sweden)

LI Jian-Wei

2014-08-01

Full Text Available On the basis of the cluster validity function based on geometric probability in literature [1, 2], propose a cluster analysis method based on geometric probability to process large amount of data in rectangular area. The basic idea is top-down stepwise refinement, firstly categories then subcategories. On all clustering levels, use the cluster validity function based on geometric probability firstly, determine clusters and the gathering direction, then determine the center of clustering and the border of clusters. Through TM remote sensing image classification examples, compare with the supervision and unsupervised classification in ERDAS and the cluster analysis method based on geometric probability in two-dimensional square which is proposed in literature 2. Results show that the proposed method can significantly improve the classification accuracy.

Predicting footbridge vibrations using a probability-based approach

DEFF Research Database (Denmark)

Pedersen, Lars; Frier, Christian

2017-01-01

Vibrations in footbridges may be problematic as excessive vibrations may occur as a result of actions of pedestrians. Design-stage predictions of levels of footbridge vibration to the action of a pedestrian are useful and have been employed for many years based on a deterministic approach to mode...

STADIC: a computer code for combining probability distributions

International Nuclear Information System (INIS)

Cairns, J.J.; Fleming, K.N.

1977-03-01

The STADIC computer code uses a Monte Carlo simulation technique for combining probability distributions. The specific function for combination of the input distribution is defined by the user by introducing the appropriate FORTRAN statements to the appropriate subroutine. The code generates a Monte Carlo sampling from each of the input distributions and combines these according to the user-supplied function to provide, in essence, a random sampling of the combined distribution. When the desired number of samples is obtained, the output routine calculates the mean, standard deviation, and confidence limits for the resultant distribution. This method of combining probability distributions is particularly useful in cases where analytical approaches are either too difficult or undefined

Path Integration Applied to Structural Systems with Uncertain Properties

DEFF Research Database (Denmark)

Nielsen, Søren R.K.; Köylüoglu, H. Ugur

Path integration (cell-to-cell mapping) method is applied to evaluate the joint probability density function (jpdf) of the response of the structural systems, with uncertain properties, subject to white noise excitation. A general methodology to deal with uncertainties is outlined and applied...... to the friction controlled slip of a structure on a foundation where the friction coefficient is modelled as a random variable. Exact results derived using the total probability theorem are compared to the ones obtained via path integration....

The statistical significance of error probability as determined from decoding simulations for long codes

Science.gov (United States)

Massey, J. L.

1976-01-01

The very low error probability obtained with long error-correcting codes results in a very small number of observed errors in simulation studies of practical size and renders the usual confidence interval techniques inapplicable to the observed error probability. A natural extension of the notion of a 'confidence interval' is made and applied to such determinations of error probability by simulation. An example is included to show the surprisingly great significance of as few as two decoding errors in a very large number of decoding trials.

Improving Ranking Using Quantum Probability

OpenAIRE

Melucci, Massimo

2011-01-01

The paper shows that ranking information units by quantum probability differs from ranking them by classical probability provided the same data used for parameter estimation. As probability of detection (also known as recall or power) and probability of false alarm (also known as fallout or size) measure the quality of ranking, we point out and show that ranking by quantum probability yields higher probability of detection than ranking by classical probability provided a given probability of ...

Dopaminergic Drug Effects on Probability Weighting during Risky Decision Making.

Science.gov (United States)

Ojala, Karita E; Janssen, Lieneke K; Hashemi, Mahur M; Timmer, Monique H M; Geurts, Dirk E M; Ter Huurne, Niels P; Cools, Roshan; Sescousse, Guillaume

2018-01-01

Dopamine has been associated with risky decision-making, as well as with pathological gambling, a behavioral addiction characterized by excessive risk-taking behavior. However, the specific mechanisms through which dopamine might act to foster risk-taking and pathological gambling remain elusive. Here we test the hypothesis that this might be achieved, in part, via modulation of subjective probability weighting during decision making. Human healthy controls ( n = 21) and pathological gamblers ( n = 16) played a decision-making task involving choices between sure monetary options and risky gambles both in the gain and loss domains. Each participant played the task twice, either under placebo or the dopamine D 2 /D 3 receptor antagonist sulpiride, in a double-blind counterbalanced design. A prospect theory modelling approach was used to estimate subjective probability weighting and sensitivity to monetary outcomes. Consistent with prospect theory, we found that participants presented a distortion in the subjective weighting of probabilities, i.e., they overweighted low probabilities and underweighted moderate to high probabilities, both in the gain and loss domains. Compared with placebo, sulpiride attenuated this distortion in the gain domain. Across drugs, the groups did not differ in their probability weighting, although gamblers consistently underweighted losing probabilities in the placebo condition. Overall, our results reveal that dopamine D 2 /D 3 receptor antagonism modulates the subjective weighting of probabilities in the gain domain, in the direction of more objective, economically rational decision making.

Dopaminergic Drug Effects on Probability Weighting during Risky Decision Making

Science.gov (United States)

Timmer, Monique H. M.; ter Huurne, Niels P.

2018-01-01

Abstract Dopamine has been associated with risky decision-making, as well as with pathological gambling, a behavioral addiction characterized by excessive risk-taking behavior. However, the specific mechanisms through which dopamine might act to foster risk-taking and pathological gambling remain elusive. Here we test the hypothesis that this might be achieved, in part, via modulation of subjective probability weighting during decision making. Human healthy controls (n = 21) and pathological gamblers (n = 16) played a decision-making task involving choices between sure monetary options and risky gambles both in the gain and loss domains. Each participant played the task twice, either under placebo or the dopamine D2/D3 receptor antagonist sulpiride, in a double-blind counterbalanced design. A prospect theory modelling approach was used to estimate subjective probability weighting and sensitivity to monetary outcomes. Consistent with prospect theory, we found that participants presented a distortion in the subjective weighting of probabilities, i.e., they overweighted low probabilities and underweighted moderate to high probabilities, both in the gain and loss domains. Compared with placebo, sulpiride attenuated this distortion in the gain domain. Across drugs, the groups did not differ in their probability weighting, although gamblers consistently underweighted losing probabilities in the placebo condition. Overall, our results reveal that dopamine D2/D3 receptor antagonism modulates the subjective weighting of probabilities in the gain domain, in the direction of more objective, economically rational decision making. PMID:29632870

An Alternative Teaching Method of Conditional Probabilities and Bayes' Rule: An Application of the Truth Table

Science.gov (United States)

Satake, Eiki; Vashlishan Murray, Amy

2015-01-01

This paper presents a comparison of three approaches to the teaching of probability to demonstrate how the truth table of elementary mathematical logic can be used to teach the calculations of conditional probabilities. Students are typically introduced to the topic of conditional probabilities--especially the ones that involve Bayes' rule--with…

Estimating the concordance probability in a survival analysis with a discrete number of risk groups.

Science.gov (United States)

Heller, Glenn; Mo, Qianxing

2016-04-01

A clinical risk classification system is an important component of a treatment decision algorithm. A measure used to assess the strength of a risk classification system is discrimination, and when the outcome is survival time, the most commonly applied global measure of discrimination is the concordance probability. The concordance probability represents the pairwise probability of lower patient risk given longer survival time. The c-index and the concordance probability estimate have been used to estimate the concordance probability when patient-specific risk scores are continuous. In the current paper, the concordance probability estimate and an inverse probability censoring weighted c-index are modified to account for discrete risk scores. Simulations are generated to assess the finite sample properties of the concordance probability estimate and the weighted c-index. An application of these measures of discriminatory power to a metastatic prostate cancer risk classification system is examined.

Risk preferences, probability weighting, and strategy tradeoffs in wildfire management

Science.gov (United States)

Michael S. Hand; Matthew J. Wibbenmeyer; Dave Calkin; Matthew P. Thompson

2015-01-01

Wildfires present a complex applied risk management environment, but relatively little attention has been paid to behavioral and cognitive responses to risk among public agency wildfire managers. This study investigates responses to risk, including probability weighting and risk aversion, in a wildfire management context using a survey-based experiment administered to...

Estimating the probability of rare events: addressing zero failure data.

Science.gov (United States)

Quigley, John; Revie, Matthew

2011-07-01

Traditional statistical procedures for estimating the probability of an event result in an estimate of zero when no events are realized. Alternative inferential procedures have been proposed for the situation where zero events have been realized but often these are ad hoc, relying on selecting methods dependent on the data that have been realized. Such data-dependent inference decisions violate fundamental statistical principles, resulting in estimation procedures whose benefits are difficult to assess. In this article, we propose estimating the probability of an event occurring through minimax inference on the probability that future samples of equal size realize no more events than that in the data on which the inference is based. Although motivated by inference on rare events, the method is not restricted to zero event data and closely approximates the maximum likelihood estimate (MLE) for nonzero data. The use of the minimax procedure provides a risk adverse inferential procedure where there are no events realized. A comparison is made with the MLE and regions of the underlying probability are identified where this approach is superior. Moreover, a comparison is made with three standard approaches to supporting inference where no event data are realized, which we argue are unduly pessimistic. We show that for situations of zero events the estimator can be simply approximated with 1/2.5n, where n is the number of trials. © 2011 Society for Risk Analysis.

Sequential Probability Ratio Test for Spacecraft Collision Avoidance Maneuver Decisions

Science.gov (United States)

Carpenter, J. Russell; Markley, F. Landis

2013-01-01

A document discusses sequential probability ratio tests that explicitly allow decision-makers to incorporate false alarm and missed detection risks, and are potentially less sensitive to modeling errors than a procedure that relies solely on a probability of collision threshold. Recent work on constrained Kalman filtering has suggested an approach to formulating such a test for collision avoidance maneuver decisions: a filter bank with two norm-inequality-constrained epoch-state extended Kalman filters. One filter models the null hypotheses that the miss distance is inside the combined hard body radius at the predicted time of closest approach, and one filter models the alternative hypothesis. The epoch-state filter developed for this method explicitly accounts for any process noise present in the system. The method appears to work well using a realistic example based on an upcoming, highly elliptical orbit formation flying mission.

Probability of detection of clinical seizures using heart rate changes.

Science.gov (United States)

Osorio, Ivan; Manly, B F J

2015-08-01

Heart rate-based seizure detection is a viable complement or alternative to ECoG/EEG. This study investigates the role of various biological factors on the probability of clinical seizure detection using heart rate. Regression models were applied to 266 clinical seizures recorded from 72 subjects to investigate if factors such as age, gender, years with epilepsy, etiology, seizure site origin, seizure class, and data collection centers, among others, shape the probability of EKG-based seizure detection. Clinical seizure detection probability based on heart rate changes, is significantly (pprobability of detecting clinical seizures (>0.8 in the majority of subjects) using heart rate is highest for complex partial seizures, increases with a patient's years with epilepsy, is lower for females than for males and is unrelated to the side of hemisphere origin. Clinical seizure detection probability using heart rate is multi-factorially dependent and sufficiently high (>0.8) in most cases to be clinically useful. Knowledge of the role that these factors play in shaping said probability will enhance its applicability and usefulness. Heart rate is a reliable and practical signal for extra-cerebral detection of clinical seizures originating from or spreading to central autonomic network structures. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Diagnostics of enterprise bankruptcy occurrence probability in an anti-crisis management: modern approaches and classification of models

Directory of Open Access Journals (Sweden)

I.V. Zhalinska

2015-09-01

Full Text Available Diagnostics of enterprise bankruptcy occurrence probability is defined as an important tool ensuring the viability of an organization under conditions of unpredictable dynamic environment. The paper aims to define the basic features of diagnostics of bankruptcy occurrence probability models and their classification. The article grounds the objective increasing of crisis probability in modern enterprises where such increasing leads to the need to improve the efficiency of anti-crisis enterprise activities. The system of anti-crisis management is based on the subsystem of diagnostics of bankruptcy occurrence probability. Such a subsystem is the main one for further measures to prevent and overcome the crisis. The classification of existing models of enterprise bankruptcy occurrence probability has been suggested. The classification is based on methodical and methodological principles of models. The following main groups of models are determined: the models using financial ratios, aggregates and scores, the models of discriminated analysis, the methods of strategic analysis, informal models, artificial intelligence systems and the combination of the models. The classification made it possible to identify the analytical capabilities of each of the groups of models suggested.

Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.

Science.gov (United States)

Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi

2018-02-19

It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .

Predicting critical transitions in dynamical systems from time series using nonstationary probability density modeling.

Science.gov (United States)

Kwasniok, Frank

2013-11-01

A time series analysis method for predicting the probability density of a dynamical system is proposed. A nonstationary parametric model of the probability density is estimated from data within a maximum likelihood framework and then extrapolated to forecast the future probability density and explore the system for critical transitions or tipping points. A full systematic account of parameter uncertainty is taken. The technique is generic, independent of the underlying dynamics of the system. The method is verified on simulated data and then applied to prediction of Arctic sea-ice extent.

From Remotely Sensed Vegetation Onset to Sowing Dates: Aggregating Pixel-Level Detections into Village-Level Sowing Probabilities

Directory of Open Access Journals (Sweden)

Eduardo Marinho

2014-11-01

Full Text Available Monitoring the start of the crop season in Sahel provides decision makers with valuable information for an early assessment of potential production and food security threats. Presently, the most common method for the estimation of sowing dates in West African countries consists of applying given thresholds on rainfall estimations. However, the coarse spatial resolution and the possible inaccuracy of these estimations are limiting factors. In this context, the remote sensing approach, which consists of deriving green-up onset dates from satellite remote sensing data, appears as an interesting alternative. It builds upon a novel statistic model that translates vegetation onset detections derived from MODIS time series into sowing probabilities at the village level. Results for Niger show that this approach outperforms the standard method adopted in the region based on rainfall thresholds.

Failure Probability Estimation of Wind Turbines by Enhanced Monte Carlo

DEFF Research Database (Denmark)

Sichani, Mahdi Teimouri; Nielsen, Søren R.K.; Naess, Arvid

2012-01-01

This paper discusses the estimation of the failure probability of wind turbines required by codes of practice for designing them. The Standard Monte Carlo (SMC) simulations may be used for this reason conceptually as an alternative to the popular Peaks-Over-Threshold (POT) method. However......, estimation of very low failure probabilities with SMC simulations leads to unacceptably high computational costs. In this study, an Enhanced Monte Carlo (EMC) method is proposed that overcomes this obstacle. The method has advantages over both POT and SMC in terms of its low computational cost and accuracy...... is controlled by the pitch controller. This provides a fair framework for comparison of the behavior and failure event of the wind turbine with emphasis on the effect of the pitch controller. The Enhanced Monte Carlo method is then applied to the model and the failure probabilities of the model are estimated...

The exact probability distribution of the rank product statistics for replicated experiments.

Science.gov (United States)

Eisinga, Rob; Breitling, Rainer; Heskes, Tom

2013-03-18

The rank product method is a widely accepted technique for detecting differentially regulated genes in replicated microarray experiments. To approximate the sampling distribution of the rank product statistic, the original publication proposed a permutation approach, whereas recently an alternative approximation based on the continuous gamma distribution was suggested. However, both approximations are imperfect for estimating small tail probabilities. In this paper we relate the rank product statistic to number theory and provide a derivation of its exact probability distribution and the true tail probabilities. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Advanced RESTART method for the estimation of the probability of failure of highly reliable hybrid dynamic systems

International Nuclear Information System (INIS)

Turati, Pietro; Pedroni, Nicola; Zio, Enrico

2016-01-01

The efficient estimation of system reliability characteristics is of paramount importance for many engineering applications. Real world system reliability modeling calls for the capability of treating systems that are: i) dynamic, ii) complex, iii) hybrid and iv) highly reliable. Advanced Monte Carlo (MC) methods offer a way to solve these types of problems, which are feasible according to the potentially high computational costs. In this paper, the REpetitive Simulation Trials After Reaching Thresholds (RESTART) method is employed, extending it to hybrid systems for the first time (to the authors’ knowledge). The estimation accuracy and precision of RESTART highly depend on the choice of the Importance Function (IF) indicating how close the system is to failure: in this respect, proper IFs are here originally proposed to improve the performance of RESTART for the analysis of hybrid systems. The resulting overall simulation approach is applied to estimate the probability of failure of the control system of a liquid hold-up tank and of a pump-valve subsystem subject to degradation induced by fatigue. The results are compared to those obtained by standard MC simulation and by RESTART with classical IFs available in the literature. The comparison shows the improvement in the performance obtained by our approach. - Highlights: • We consider the issue of estimating small failure probabilities in dynamic systems. • We employ the RESTART method to estimate the failure probabilities. • New Importance Functions (IFs) are introduced to increase the method performance. • We adopt two dynamic, hybrid, highly reliable systems as case studies. • A comparison with literature IFs proves the effectiveness of the new IFs.

Application of a weighted spatial probability model in GIS to analyse landslides in Penang Island, Malaysia

Directory of Open Access Journals (Sweden)

Samy Ismail Elmahdy

2016-01-01

Full Text Available In the current study, Penang Island, which is one of the several mountainous areas in Malaysia that is often subjected to landslide hazard, was chosen for further investigation. A multi-criteria Evaluation and the spatial probability weighted approach and model builder was applied to map and analyse landslides in Penang Island. A set of automated algorithms was used to construct new essential geological and morphometric thematic maps from remote sensing data. The maps were ranked using the weighted probability spatial model based on their contribution to the landslide hazard. Results obtained showed that sites at an elevation of 100–300 m, with steep slopes of 10°–37° and slope direction (aspect in the E and SE directions were areas of very high and high probability for the landslide occurrence; the total areas were 21.393 km2 (11.84% and 58.690 km2 (32.48%, respectively. The obtained map was verified by comparing variogram models of the mapped and the occurred landslide locations and showed a strong correlation with the locations of occurred landslides, indicating that the proposed method can successfully predict the unpredictable landslide hazard. The method is time and cost effective and can be used as a reference for geological and geotechnical engineers.

Sequential probability ratio controllers for safeguards radiation monitors

International Nuclear Information System (INIS)

Fehlau, P.E.; Coop, K.L.; Nixon, K.V.

1984-01-01

Sequential hypothesis tests applied to nuclear safeguards accounting methods make the methods more sensitive to detecting diversion. The sequential tests also improve transient signal detection in safeguards radiation monitors. This paper describes three microprocessor control units with sequential probability-ratio tests for detecting transient increases in radiation intensity. The control units are designed for three specific applications: low-intensity monitoring with Poisson probability ratios, higher intensity gamma-ray monitoring where fixed counting intervals are shortened by sequential testing, and monitoring moving traffic where the sequential technique responds to variable-duration signals. The fixed-interval controller shortens a customary 50-s monitoring time to an average of 18 s, making the monitoring delay less bothersome. The controller for monitoring moving vehicles benefits from the sequential technique by maintaining more than half its sensitivity when the normal passage speed doubles

An Overview of Modeling Approaches Applied to Aggregation-Based Fleet Management and Integration of Plug-in Electric Vehicles †

Directory of Open Access Journals (Sweden)

Shi You

2016-11-01

Full Text Available The design and implementation of management policies for plug-in electric vehicles (PEVs need to be supported by a holistic understanding of the functional processes, their complex interactions, and their response to various changes. Models developed to represent different functional processes and systems are seen as useful tools to support the related studies for different stakeholders in a tangible way. This paper presents an overview of modeling approaches applied to support aggregation-based management and integration of PEVs from the perspective of fleet operators and grid operators, respectively. We start by explaining a structured modeling approach, i.e., a flexible combination of process models and system models, applied to different management and integration studies. A state-of-the-art overview of modeling approaches applied to represent several key processes, such as charging management, and key systems, such as the PEV fleet, is then presented, along with a detailed description of different approaches. Finally, we discuss several considerations that need to be well understood during the modeling process in order to assist modelers and model users in the appropriate decisions of using existing, or developing their own, solutions for further applications.

Dynamic probability control limits for risk-adjusted CUSUM charts based on multiresponses.

Science.gov (United States)

Zhang, Xiang; Loda, Justin B; Woodall, William H

2017-07-20

For a patient who has survived a surgery, there could be several levels of recovery. Thus, it is reasonable to consider more than two outcomes when monitoring surgical outcome quality. The risk-adjusted cumulative sum (CUSUM) chart based on multiresponses has been developed for monitoring a surgical process with three or more outcomes. However, there is a significant effect of varying risk distributions on the in-control performance of the chart when constant control limits are applied. To overcome this disadvantage, we apply the dynamic probability control limits to the risk-adjusted CUSUM charts for multiresponses. The simulation results demonstrate that the in-control performance of the charts with dynamic probability control limits can be controlled for different patient populations because these limits are determined for each specific sequence of patients. Thus, the use of dynamic probability control limits for risk-adjusted CUSUM charts based on multiresponses allows each chart to be designed for the corresponding patient sequence of a surgeon or a hospital and therefore does not require estimating or monitoring the patients' risk distribution. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

A Probability-based Evolutionary Algorithm with Mutations to Learn Bayesian Networks

Directory of Open Access Journals (Sweden)

Sho Fukuda

2014-12-01

Full Text Available Bayesian networks are regarded as one of the essential tools to analyze causal relationship between events from data. To learn the structure of highly-reliable Bayesian networks from data as quickly as possible is one of the important problems that several studies have been tried to achieve. In recent years, probability-based evolutionary algorithms have been proposed as a new efficient approach to learn Bayesian networks. In this paper, we target on one of the probability-based evolutionary algorithms called PBIL (Probability-Based Incremental Learning, and propose a new mutation operator. Through performance evaluation, we found that the proposed mutation operator has a good performance in learning Bayesian networks

A least squares approach to estimating the probability distribution of unobserved data in multiphoton microscopy

Science.gov (United States)

Salama, Paul

2008-02-01

Multi-photon microscopy has provided biologists with unprecedented opportunities for high resolution imaging deep into tissues. Unfortunately deep tissue multi-photon microscopy images are in general noisy since they are acquired at low photon counts. To aid in the analysis and segmentation of such images it is sometimes necessary to initially enhance the acquired images. One way to enhance an image is to find the maximum a posteriori (MAP) estimate of each pixel comprising an image, which is achieved by finding a constrained least squares estimate of the unknown distribution. In arriving at the distribution it is assumed that the noise is Poisson distributed, the true but unknown pixel values assume a probability mass function over a finite set of non-negative values, and since the observed data also assumes finite values because of low photon counts, the sum of the probabilities of the observed pixel values (obtained from the histogram of the acquired pixel values) is less than one. Experimental results demonstrate that it is possible to closely estimate the unknown probability mass function with these assumptions.

Probability in physics

CERN Document Server

Hemmo, Meir

2012-01-01

What is the role and meaning of probability in physical theory, in particular in two of the most successful theories of our age, quantum physics and statistical mechanics? Laws once conceived as universal and deterministic, such as Newton‘s laws of motion, or the second law of thermodynamics, are replaced in these theories by inherently probabilistic laws. This collection of essays by some of the world‘s foremost experts presents an in-depth analysis of the meaning of probability in contemporary physics. Among the questions addressed are: How are probabilities defined? Are they objective or subjective? What is their  explanatory value? What are the differences between quantum and classical probabilities? The result is an informative and thought-provoking book for the scientifically inquisitive. 

INVESTIGATION OF INFLUENCE OF ENCODING FUNCTION COMPLEXITY ON DISTRIBUTION OF ERROR MASKING PROBABILITY

Directory of Open Access Journals (Sweden)

A. B. Levina

2016-03-01

Full Text Available Error detection codes are mechanisms that enable robust delivery of data in unreliable communication channels and devices. Unreliable channels and devices are error-prone objects. Respectively, error detection codes allow detecting such errors. There are two classes of error detecting codes - classical codes and security-oriented codes. The classical codes have high percentage of detected errors; however, they have a high probability to miss an error in algebraic manipulation. In order, security-oriented codes are codes with a small Hamming distance and high protection to algebraic manipulation. The probability of error masking is a fundamental parameter of security-oriented codes. A detailed study of this parameter allows analyzing the behavior of the error-correcting code in the case of error injection in the encoding device. In order, the complexity of the encoding function plays an important role in the security-oriented codes. Encoding functions with less computational complexity and a low probability of masking are the best protection of encoding device against malicious acts. This paper investigates the influence of encoding function complexity on the error masking probability distribution. It will be shownthat the more complex encoding function reduces the maximum of error masking probability. It is also shown in the paper that increasing of the function complexity changes the error masking probability distribution. In particular, increasing of computational complexity decreases the difference between the maximum and average value of the error masking probability. Our resultshave shown that functions with greater complexity have smoothed maximums of error masking probability, which significantly complicates the analysis of error-correcting code by attacker. As a result, in case of complex encoding function the probability of the algebraic manipulation is reduced. The paper discusses an approach how to measure the error masking

White blood cell and platelet count as adjuncts to standard clinical evaluation for risk assessment in patients at low probability of acute aortic syndrome.

Science.gov (United States)

Morello, Fulvio; Cavalot, Giulia; Giachino, Francesca; Tizzani, Maria; Nazerian, Peiman; Carbone, Federica; Pivetta, Emanuele; Mengozzi, Giulio; Moiraghi, Corrado; Lupia, Enrico

2017-08-01

Pre-test probability assessment is key in the approach to suspected acute aortic syndromes (AASs). However, most patients with AAS-compatible symptoms are classified at low probability, warranting further evaluation for decision on aortic imaging. White blood cell count, platelet count and fibrinogen explore pathophysiological pathways mobilized in AASs and are routinely assayed in the workup of AASs. However, the diagnostic performance of these variables for AASs, alone and as a bundle, is unknown. We tested the hypothesis that white blood cell count, platelet count and/or fibrinogen at presentation may be applied as additional tools to standard clinical evaluation for pre-test risk assessment in patients at low probability of AAS. This was a retrospective observational study conducted on consecutive patients managed in our Emergency Department from 2009 to 2014 for suspected AAS. White blood cell count, platelet count and fibrinogen were assayed during evaluation in the Emergency Department. The final diagnosis was obtained by computed tomography angiography. The pre-test probability of AAS was defined according to guidelines. Of 1210 patients with suspected AAS, 1006 (83.1%) were classified at low probability, and 271 (22.4%) were diagnosed with AAS. Within patients at low probability, presence of at least one alteration among white blood cell count >9*10 3 /µl, platelet count probability, white blood cell count >9*10 3 /µl and platelet count probability, the estimated risk of AAS based on the number of alterations amongst white blood cell count >9*10 3 /µl and platelet count probability to fine-tune risk assessment of AAS.

Human Error Probability Assessment During Maintenance Activities of Marine Systems

Directory of Open Access Journals (Sweden)

Rabiul Islam

2018-03-01

Full Text Available Background: Maintenance operations on-board ships are highly demanding. Maintenance operations are intensive activities requiring high man–machine interactions in challenging and evolving conditions. The evolving conditions are weather conditions, workplace temperature, ship motion, noise and vibration, and workload and stress. For example, extreme weather condition affects seafarers' performance, increasing the chances of error, and, consequently, can cause injuries or fatalities to personnel. An effective human error probability model is required to better manage maintenance on-board ships. The developed model would assist in developing and maintaining effective risk management protocols. Thus, the objective of this study is to develop a human error probability model considering various internal and external factors affecting seafarers' performance. Methods: The human error probability model is developed using probability theory applied to Bayesian network. The model is tested using the data received through the developed questionnaire survey of >200 experienced seafarers with >5 years of experience. The model developed in this study is used to find out the reliability of human performance on particular maintenance activities. Results: The developed methodology is tested on the maintenance of marine engine's cooling water pump for engine department and anchor windlass for deck department. In the considered case studies, human error probabilities are estimated in various scenarios and the results are compared between the scenarios and the different seafarer categories. The results of the case studies for both departments are also compared. Conclusion: The developed model is effective in assessing human error probabilities. These probabilities would get dynamically updated as and when new information is available on changes in either internal (i.e., training, experience, and fatigue or external (i.e., environmental and operational conditions

Estimating the empirical probability of submarine landslide occurrence

Science.gov (United States)

Geist, Eric L.; Parsons, Thomas E.; Mosher, David C.; Shipp, Craig; Moscardelli, Lorena; Chaytor, Jason D.; Baxter, Christopher D. P.; Lee, Homa J.; Urgeles, Roger

2010-01-01

The empirical probability for the occurrence of submarine landslides at a given location can be estimated from age dates of past landslides. In this study, tools developed to estimate earthquake probability from paleoseismic horizons are adapted to estimate submarine landslide probability. In both types of estimates, one has to account for the uncertainty associated with age-dating individual events as well as the open time intervals before and after the observed sequence of landslides. For observed sequences of submarine landslides, we typically only have the age date of the youngest event and possibly of a seismic horizon that lies below the oldest event in a landslide sequence. We use an empirical Bayes analysis based on the Poisson-Gamma conjugate prior model specifically applied to the landslide probability problem. This model assumes that landslide events as imaged in geophysical data are independent and occur in time according to a Poisson distribution characterized by a rate parameter λ. With this method, we are able to estimate the most likely value of λ and, importantly, the range of uncertainty in this estimate. Examples considered include landslide sequences observed in the Santa Barbara Channel, California, and in Port Valdez, Alaska. We confirm that given the uncertainties of age dating that landslide complexes can be treated as single events by performing statistical test of age dates representing the main failure episode of the Holocene Storegga landslide complex.

Risk Preferences, Probability Weighting, and Strategy Tradeoffs in Wildfire Management.

Science.gov (United States)

Hand, Michael S; Wibbenmeyer, Matthew J; Calkin, David E; Thompson, Matthew P

2015-10-01

Wildfires present a complex applied risk management environment, but relatively little attention has been paid to behavioral and cognitive responses to risk among public agency wildfire managers. This study investigates responses to risk, including probability weighting and risk aversion, in a wildfire management context using a survey-based experiment administered to federal wildfire managers. Respondents were presented with a multiattribute lottery-choice experiment where each lottery is defined by three outcome attributes: expenditures for fire suppression, damage to private property, and exposure of firefighters to the risk of aviation-related fatalities. Respondents choose one of two strategies, each of which includes "good" (low cost/low damage) and "bad" (high cost/high damage) outcomes that occur with varying probabilities. The choice task also incorporates an information framing experiment to test whether information about fatality risk to firefighters alters managers' responses to risk. Results suggest that managers exhibit risk aversion and nonlinear probability weighting, which can result in choices that do not minimize expected expenditures, property damage, or firefighter exposure. Information framing tends to result in choices that reduce the risk of aviation fatalities, but exacerbates nonlinear probability weighting. © 2015 Society for Risk Analysis.

Next-Generation Mitogenomics: A Comparison of Approaches Applied to Caecilian Amphibian Phylogeny.

Science.gov (United States)

Maddock, Simon T; Briscoe, Andrew G; Wilkinson, Mark; Waeschenbach, Andrea; San Mauro, Diego; Day, Julia J; Littlewood, D Tim J; Foster, Peter G; Nussbaum, Ronald A; Gower, David J

2016-01-01

Mitochondrial genome (mitogenome) sequences are being generated with increasing speed due to the advances of next-generation sequencing (NGS) technology and associated analytical tools. However, detailed comparisons to explore the utility of alternative NGS approaches applied to the same taxa have not been undertaken. We compared a 'traditional' Sanger sequencing method with two NGS approaches (shotgun sequencing and non-indexed, multiplex amplicon sequencing) on four different sequencing platforms (Illumina's HiSeq and MiSeq, Roche's 454 GS FLX, and Life Technologies' Ion Torrent) to produce seven (near-) complete mitogenomes from six species that form a small radiation of caecilian amphibians from the Seychelles. The fastest, most accurate method of obtaining mitogenome sequences that we tested was direct sequencing of genomic DNA (shotgun sequencing) using the MiSeq platform. Bayesian inference and maximum likelihood analyses using seven different partitioning strategies were unable to resolve compellingly all phylogenetic relationships among the Seychelles caecilian species, indicating the need for additional data in this case.

Next-Generation Mitogenomics: A Comparison of Approaches Applied to Caecilian Amphibian Phylogeny.

Directory of Open Access Journals (Sweden)

Simon T Maddock

Full Text Available Mitochondrial genome (mitogenome sequences are being generated with increasing speed due to the advances of next-generation sequencing (NGS technology and associated analytical tools. However, detailed comparisons to explore the utility of alternative NGS approaches applied to the same taxa have not been undertaken. We compared a 'traditional' Sanger sequencing method with two NGS approaches (shotgun sequencing and non-indexed, multiplex amplicon sequencing on four different sequencing platforms (Illumina's HiSeq and MiSeq, Roche's 454 GS FLX, and Life Technologies' Ion Torrent to produce seven (near- complete mitogenomes from six species that form a small radiation of caecilian amphibians from the Seychelles. The fastest, most accurate method of obtaining mitogenome sequences that we tested was direct sequencing of genomic DNA (shotgun sequencing using the MiSeq platform. Bayesian inference and maximum likelihood analyses using seven different partitioning strategies were unable to resolve compellingly all phylogenetic relationships among the Seychelles caecilian species, indicating the need for additional data in this case.

Measuring survival time: a probability-based approach useful in healthcare decision-making.

Science.gov (United States)

2011-01-01

In some clinical situations, the choice between treatment options takes into account their impact on patient survival time. Due to practical constraints (such as loss to follow-up), survival time is usually estimated using a probability calculation based on data obtained in clinical studies or trials. The two techniques most commonly used to estimate survival times are the Kaplan-Meier method and the actuarial method. Despite their limitations, they provide useful information when choosing between treatment options.

Estimating the Probabilities of Default for Callable Bonds: A Duffie-Singleton Approach

OpenAIRE

David Wang

2005-01-01

This paper presents a model for estimating the default risks implicit in the prices of callable corporate bonds. The model considers three essential ingredients in the pricing of callable corporate bonds: stochastic interest rate, default risk, and call provision. The stochastic interest rate is modeled as a square-root diffusion process. The default risk is modeled as a constant spread, with the magnitude of this spread impacting the probability of a Poisson process governing the arrival of ...

A massively parallel algorithm for the collision probability calculations in the Apollo-II code using the PVM library

International Nuclear Information System (INIS)

Stankovski, Z.

1995-01-01

The collision probability method in neutron transport, as applied to 2D geometries, consume a great amount of computer time, for a typical 2D assembly calculation about 90% of the computing time is consumed in the collision probability evaluations. Consequently RZ or 3D calculations became prohibitive. In this paper the author presents a simple but efficient parallel algorithm based on the message passing host/node programmation model. Parallelization was applied to the energy group treatment. Such approach permits parallelization of the existing code, requiring only limited modifications. Sequential/parallel computer portability is preserved, which is a necessary condition for a industrial code. Sequential performances are also preserved. The algorithm is implemented on a CRAY 90 coupled to a 128 processor T3D computer, a 16 processor IBM SPI and a network of workstations, using the Public Domain PVM library. The tests were executed for a 2D geometry with the standard 99-group library. All results were very satisfactory, the best ones with IBM SPI. Because of heterogeneity of the workstation network, the author did not ask high performances for this architecture. The same source code was used for all computers. A more impressive advantage of this algorithm will appear in the calculations of the SAPHYR project (with the future fine multigroup library of about 8000 groups) with a massively parallel computer, using several hundreds of processors

Philosophical theories of probability

CERN Document Server

Gillies, Donald

2000-01-01

The Twentieth Century has seen a dramatic rise in the use of probability and statistics in almost all fields of research. This has stimulated many new philosophical ideas on probability. Philosophical Theories of Probability is the first book to present a clear, comprehensive and systematic account of these various theories and to explain how they relate to one another. Gillies also offers a distinctive version of the propensity theory of probability, and the intersubjective interpretation, which develops the subjective theory.

Classical probability model for Bell inequality

International Nuclear Information System (INIS)

Khrennikov, Andrei

2014-01-01

We show that by taking into account randomness of realization of experimental contexts it is possible to construct common Kolmogorov space for data collected for these contexts, although they can be incompatible. We call such a construction 'Kolmogorovization' of contextuality. This construction of common probability space is applied to Bell's inequality. It is well known that its violation is a consequence of collecting statistical data in a few incompatible experiments. In experiments performed in quantum optics contexts are determined by selections of pairs of angles (θ i ,θ ' j ) fixing orientations of polarization beam splitters. Opposite to the common opinion, we show that statistical data corresponding to measurements of polarizations of photons in the singlet state, e.g., in the form of correlations, can be described in the classical probabilistic framework. The crucial point is that in constructing the common probability space one has to take into account not only randomness of the source (as Bell did), but also randomness of context-realizations (in particular, realizations of pairs of angles (θ i , θ ' j )). One may (but need not) say that randomness of 'free will' has to be accounted for.

A quantitative approach for risk-informed safety significance categorization in option-2

International Nuclear Information System (INIS)

Ha, Jun Su; Seong, Poong Hyun

2004-01-01

OPTION-2 recommends that Structures, Systems, or Components (SSCs) of Nuclear Power Plants (NPPs) should be categorized into four groups according to their safety significance as well as whether they are safety-related or not. With changes to the scope of SSCs covered by 10 CFR 50, safety-related components which categorized into low safety significant SSC (RISC-3 SSC) can be exempted from the existing conservative burden (or requirements). As OPTION-2 paradigm is applied, a lot of SSCs may be categorized into RISC-3 SSCs. Changes in treatment of the RISC-3 SSCs will be recommended and then finally the recommended changes shall be evaluated. Consequently, before recommending the changes in treatment, probable candidate SSCs for the changes in treatment need to be identified for efficient risk-informed regulation and application (RIRA). Hence, in this work, a validation focused on the RISC-3 SSCs is proposed to identify probable candidate SSCs. Burden to Importance Ratio (BIR) is utilized as a quantitative measure for the validation. BIR is a measure representing the extent of resources or requirements imposed on a SSC with respect to the value of the importance measure of the SSC. Therefore SSCs having high BIR can be considered as probable candidate SSCs for the changes in treatment. In addition, the final decision whether RISC-3 SSCs can be considered as probable candidate SSCs or not should be made by an expert panel. For the effective decision making, a structured mathematical decision-making process is constructed based on Belief Networks (BBN) to overcome demerits of conventional group meeting based on unstructured discussion for decision-making. To demonstrate the usefulness of the proposed approach, the approach is applied to 22 components selected from 512 In-Service Test (IST) components of Ulchin unit 3. The results of the application show that the proposed approach can identify probable candidate SSCs for changes in treatment. The identification of the

Risk-taking in disorders of natural and drug rewards: neural correlates and effects of probability, valence, and magnitude.

Science.gov (United States)

Voon, Valerie; Morris, Laurel S; Irvine, Michael A; Ruck, Christian; Worbe, Yulia; Derbyshire, Katherine; Rankov, Vladan; Schreiber, Liana Rn; Odlaug, Brian L; Harrison, Neil A; Wood, Jonathan; Robbins, Trevor W; Bullmore, Edward T; Grant, Jon E

2015-03-01

Pathological behaviors toward drugs and food rewards have underlying commonalities. Risk-taking has a fourfold pattern varying as a function of probability and valence leading to the nonlinearity of probability weighting with overweighting of small probabilities and underweighting of large probabilities. Here we assess these influences on risk-taking in patients with pathological behaviors toward drug and food rewards and examine structural neural correlates of nonlinearity of probability weighting in healthy volunteers. In the anticipation of rewards, subjects with binge eating disorder show greater risk-taking, similar to substance-use disorders. Methamphetamine-dependent subjects had greater nonlinearity of probability weighting along with impaired subjective discrimination of probability and reward magnitude. Ex-smokers also had lower risk-taking to rewards compared with non-smokers. In the anticipation of losses, obesity without binge eating had a similar pattern to other substance-use disorders. Obese subjects with binge eating also have impaired discrimination of subjective value similar to that of the methamphetamine-dependent subjects. Nonlinearity of probability weighting was associated with lower gray matter volume in dorsolateral and ventromedial prefrontal cortex and orbitofrontal cortex in healthy volunteers. Our findings support a distinct subtype of binge eating disorder in obesity with similarities in risk-taking in the reward domain to substance use disorders. The results dovetail with the current approach of defining mechanistically based dimensional approaches rather than categorical approaches to psychiatric disorders. The relationship to risk probability and valence may underlie the propensity toward pathological behaviors toward different types of rewards.

Evolvement simulation of the probability of neutron-initiating persistent fission chain

International Nuclear Information System (INIS)

Wang Zhe; Hong Zhenying

2014-01-01

Background: Probability of neutron-initiating persistent fission chain, which has to be calculated in analysis of critical safety, start-up of reactor, burst waiting time on pulse reactor, bursting time on pulse reactor, etc., is an inherent parameter in a multiplying assembly. Purpose: We aim to derive time-dependent integro-differential equation for such probability in relative velocity space according to the probability conservation, and develop the deterministic code Dynamic Segment Number Probability (DSNP) based on the multi-group S N method. Methods: The reliable convergence of dynamic calculation was analyzed and numerical simulation of the evolvement process of dynamic probability for varying concentration was performed under different initial conditions. Results: On Highly Enriched Uranium (HEU) Bare Spheres, when the time is long enough, the results of dynamic calculation approach to those of static calculation. The most difference of such results between DSNP and Partisn code is less than 2%. On Baker model, over the range of about 1 μs after the first criticality, the most difference between the dynamic and static calculation is about 300%. As for a super critical system, the finite fission chains decrease and the persistent fission chains increase as the reactivity aggrandizes, the dynamic evolvement curve of initiation probability is close to the static curve within the difference of 5% when the K eff is more than 1.2. The cumulative probability curve also indicates that the difference of integral results between the dynamic calculation and the static calculation decreases from 35% to 5% as the K eff increases. This demonstrated that the ability of initiating a self-sustaining fission chain reaction approaches stabilization, while the former difference (35%) showed the important difference of the dynamic results near the first criticality with the static ones. The DSNP code agrees well with Partisn code. Conclusions: There are large numbers of

An evaluation method for tornado missile strike probability with stochastic correction

Energy Technology Data Exchange (ETDEWEB)

Eguchi, Yuzuru; Murakami, Takahiro; Hirakuchi, Hiromaru; Sugimoto, Soichiro; Hattori, Yasuo [Nuclear Risk Research Center (External Natural Event Research Team), Central Research Institute of Electric Power Industry, Abiko (Japan)

2017-03-15

An efficient evaluation method for the probability of a tornado missile strike without using the Monte Carlo method is proposed in this paper. A major part of the proposed probability evaluation is based on numerical results computed using an in-house code, Tornado-borne missile analysis code, which enables us to evaluate the liftoff and flight behaviors of unconstrained objects on the ground driven by a tornado. Using the Tornado-borne missile analysis code, we can obtain a stochastic correlation between local wind speed and flight distance of each object, and this stochastic correlation is used to evaluate the conditional strike probability, QV(r), of a missile located at position r, where the local wind speed is V. In contrast, the annual exceedance probability of local wind speed, which can be computed using a tornado hazard analysis code, is used to derive the probability density function, p(V). Then, we finally obtain the annual probability of tornado missile strike on a structure with the convolutional integration of product of QV(r) and p(V) over V. The evaluation method is applied to a simple problem to qualitatively confirm the validity, and to quantitatively verify the results for two extreme cases in which an object is located just in the vicinity of or far away from the structure.

An evaluation method for tornado missile strike probability with stochastic correction

International Nuclear Information System (INIS)

Eguchi, Yuzuru; Murakami, Takahiro; Hirakuchi, Hiromaru; Sugimoto, Soichiro; Hattori, Yasuo

2017-01-01

An efficient evaluation method for the probability of a tornado missile strike without using the Monte Carlo method is proposed in this paper. A major part of the proposed probability evaluation is based on numerical results computed using an in-house code, Tornado-borne missile analysis code, which enables us to evaluate the liftoff and flight behaviors of unconstrained objects on the ground driven by a tornado. Using the Tornado-borne missile analysis code, we can obtain a stochastic correlation between local wind speed and flight distance of each object, and this stochastic correlation is used to evaluate the conditional strike probability, QV(r), of a missile located at position r, where the local wind speed is V. In contrast, the annual exceedance probability of local wind speed, which can be computed using a tornado hazard analysis code, is used to derive the probability density function, p(V). Then, we finally obtain the annual probability of tornado missile strike on a structure with the convolutional integration of product of QV(r) and p(V) over V. The evaluation method is applied to a simple problem to qualitatively confirm the validity, and to quantitatively verify the results for two extreme cases in which an object is located just in the vicinity of or far away from the structure

Accelerating rejection-based simulation of biochemical reactions with bounded acceptance probability

Energy Technology Data Exchange (ETDEWEB)

Thanh, Vo Hong, E-mail: vo@cosbi.eu [The Microsoft Research - University of Trento Centre for Computational and Systems Biology, Piazza Manifattura 1, Rovereto 38068 (Italy); Priami, Corrado, E-mail: priami@cosbi.eu [The Microsoft Research - University of Trento Centre for Computational and Systems Biology, Piazza Manifattura 1, Rovereto 38068 (Italy); Department of Mathematics, University of Trento, Trento (Italy); Zunino, Roberto, E-mail: roberto.zunino@unitn.it [Department of Mathematics, University of Trento, Trento (Italy)

2016-06-14

Stochastic simulation of large biochemical reaction networks is often computationally expensive due to the disparate reaction rates and high variability of population of chemical species. An approach to accelerate the simulation is to allow multiple reaction firings before performing update by assuming that reaction propensities are changing of a negligible amount during a time interval. Species with small population in the firings of fast reactions significantly affect both performance and accuracy of this simulation approach. It is even worse when these small population species are involved in a large number of reactions. We present in this paper a new approximate algorithm to cope with this problem. It is based on bounding the acceptance probability of a reaction selected by the exact rejection-based simulation algorithm, which employs propensity bounds of reactions and the rejection-based mechanism to select next reaction firings. The reaction is ensured to be selected to fire with an acceptance rate greater than a predefined probability in which the selection becomes exact if the probability is set to one. Our new algorithm improves the computational cost for selecting the next reaction firing and reduces the updating the propensities of reactions.

Solution of the neutron point kinetics equations with temperature feedback effects applying the polynomial approach method

International Nuclear Information System (INIS)

Tumelero, Fernanda; Petersen, Claudio Z.; Goncalves, Glenio A.; Lazzari, Luana

2015-01-01

In this work, we present a solution of the Neutron Point Kinetics Equations with temperature feedback effects applying the Polynomial Approach Method. For the solution, we consider one and six groups of delayed neutrons precursors with temperature feedback effects and constant reactivity. The main idea is to expand the neutron density, delayed neutron precursors and temperature as a power series considering the reactivity as an arbitrary function of the time in a relatively short time interval around an ordinary point. In the first interval one applies the initial conditions of the problem and the analytical continuation is used to determine the solutions of the next intervals. With the application of the Polynomial Approximation Method it is possible to overcome the stiffness problem of the equations. In such a way, one varies the time step size of the Polynomial Approach Method and performs an analysis about the precision and computational time. Moreover, we compare the method with different types of approaches (linear, quadratic and cubic) of the power series. The answer of neutron density and temperature obtained by numerical simulations with linear approximation are compared with results in the literature. (author)

Solution of the neutron point kinetics equations with temperature feedback effects applying the polynomial approach method

Energy Technology Data Exchange (ETDEWEB)

Tumelero, Fernanda, E-mail: fernanda.tumelero@yahoo.com.br [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Programa de Pos-Graduacao em Engenharia Mecanica; Petersen, Claudio Z.; Goncalves, Glenio A.; Lazzari, Luana, E-mail: claudiopeteren@yahoo.com.br, E-mail: gleniogoncalves@yahoo.com.br, E-mail: luana-lazzari@hotmail.com [Universidade Federal de Pelotas (DME/UFPEL), Capao do Leao, RS (Brazil). Instituto de Fisica e Matematica

2015-07-01

In this work, we present a solution of the Neutron Point Kinetics Equations with temperature feedback effects applying the Polynomial Approach Method. For the solution, we consider one and six groups of delayed neutrons precursors with temperature feedback effects and constant reactivity. The main idea is to expand the neutron density, delayed neutron precursors and temperature as a power series considering the reactivity as an arbitrary function of the time in a relatively short time interval around an ordinary point. In the first interval one applies the initial conditions of the problem and the analytical continuation is used to determine the solutions of the next intervals. With the application of the Polynomial Approximation Method it is possible to overcome the stiffness problem of the equations. In such a way, one varies the time step size of the Polynomial Approach Method and performs an analysis about the precision and computational time. Moreover, we compare the method with different types of approaches (linear, quadratic and cubic) of the power series. The answer of neutron density and temperature obtained by numerical simulations with linear approximation are compared with results in the literature. (author)

Probable Maximum Precipitation in the U.S. Pacific Northwest in a Changing Climate

Science.gov (United States)

Chen, Xiaodong; Hossain, Faisal; Leung, L. Ruby

2017-11-01

The safety of large and aging water infrastructures is gaining attention in water management given the accelerated rate of change in landscape, climate, and society. In current engineering practice, such safety is ensured by the design of infrastructure for the Probable Maximum Precipitation (PMP). Recently, several numerical modeling approaches have been proposed to modernize the conventional and ad hoc PMP estimation approach. However, the underlying physics have not been fully investigated and thus differing PMP estimates are sometimes obtained without physics-based interpretations. In this study, we present a hybrid approach that takes advantage of both traditional engineering practice and modern climate science to estimate PMP for current and future climate conditions. The traditional PMP approach is modified and applied to five statistically downscaled CMIP5 model outputs, producing an ensemble of PMP estimates in the Pacific Northwest (PNW) during the historical (1970-2016) and future (2050-2099) time periods. The hybrid approach produced consistent historical PMP estimates as the traditional estimates. PMP in the PNW will increase by 50% ± 30% of the current design PMP by 2099 under the RCP8.5 scenario. Most of the increase is caused by warming, which mainly affects moisture availability through increased sea surface temperature, with minor contributions from changes in storm efficiency in the future. Moist track change tends to reduce the future PMP. Compared with extreme precipitation, PMP exhibits higher internal variability. Thus, long-time records of high-quality data in both precipitation and related meteorological fields (temperature, wind fields) are required to reduce uncertainties in the ensemble PMP estimates.

Probability distributions with truncated, log and bivariate extensions

CERN Document Server

Thomopoulos, Nick T

2018-01-01

This volume presents a concise and practical overview of statistical methods and tables not readily available in other publications. It begins with a review of the commonly used continuous and discrete probability distributions. Several useful distributions that are not so common and less understood are described with examples and applications in full detail: discrete normal, left-partial, right-partial, left-truncated normal, right-truncated normal, lognormal, bivariate normal, and bivariate lognormal. Table values are provided with examples that enable researchers to easily apply the distributions to real applications and sample data. The left- and right-truncated normal distributions offer a wide variety of shapes in contrast to the symmetrically shaped normal distribution, and a newly developed spread ratio enables analysts to determine which of the three distributions best fits a particular set of sample data. The book will be highly useful to anyone who does statistical and probability analysis. This in...

Camera-Model Identification Using Markovian Transition Probability Matrix

Science.gov (United States)

Xu, Guanshuo; Gao, Shang; Shi, Yun Qing; Hu, Ruimin; Su, Wei

Detecting the (brands and) models of digital cameras from given digital images has become a popular research topic in the field of digital forensics. As most of images are JPEG compressed before they are output from cameras, we propose to use an effective image statistical model to characterize the difference JPEG 2-D arrays of Y and Cb components from the JPEG images taken by various camera models. Specifically, the transition probability matrices derived from four different directional Markov processes applied to the image difference JPEG 2-D arrays are used to identify statistical difference caused by image formation pipelines inside different camera models. All elements of the transition probability matrices, after a thresholding technique, are directly used as features for classification purpose. Multi-class support vector machines (SVM) are used as the classification tool. The effectiveness of our proposed statistical model is demonstrated by large-scale experimental results.

Maximum parsimony, substitution model, and probability phylogenetic trees.

Science.gov (United States)

Weng, J F; Thomas, D A; Mareels, I

2011-01-01

The problem of inferring phylogenies (phylogenetic trees) is one of the main problems in computational biology. There are three main methods for inferring phylogenies-Maximum Parsimony (MP), Distance Matrix (DM) and Maximum Likelihood (ML), of which the MP method is the most well-studied and popular method. In the MP method the optimization criterion is the number of substitutions of the nucleotides computed by the differences in the investigated nucleotide sequences. However, the MP method is often criticized as it only counts the substitutions observable at the current time and all the unobservable substitutions that really occur in the evolutionary history are omitted. In order to take into account the unobservable substitutions, some substitution models have been established and they are now widely used in the DM and ML methods but these substitution models cannot be used within the classical MP method. Recently the authors proposed a probability representation model for phylogenetic trees and the reconstructed trees in this model are called probability phylogenetic trees. One of the advantages of the probability representation model is that it can include a substitution model to infer phylogenetic trees based on the MP principle. In this paper we explain how to use a substitution model in the reconstruction of probability phylogenetic trees and show the advantage of this approach with examples.

Probability for statisticians

CERN Document Server

Shorack, Galen R

2017-01-01

This 2nd edition textbook offers a rigorous introduction to measure theoretic probability with particular attention to topics of interest to mathematical statisticians—a textbook for courses in probability for students in mathematical statistics. It is recommended to anyone interested in the probability underlying modern statistics, providing a solid grounding in the probabilistic tools and techniques necessary to do theoretical research in statistics. For the teaching of probability theory to post graduate statistics students, this is one of the most attractive books available. Of particular interest is a presentation of the major central limit theorems via Stein's method either prior to or alternative to a characteristic function presentation. Additionally, there is considerable emphasis placed on the quantile function as well as the distribution function. The bootstrap and trimming are both presented. Martingale coverage includes coverage of censored data martingales. The text includes measure theoretic...

Determination of the failure probability in the weld region of ap-600 vessel for transient condition

International Nuclear Information System (INIS)

Wahyono, I.P.

1997-01-01

Failure probability in the weld region of AP-600 vessel was determined for transient condition scenario. The type of transient is increase of the heat removal from primary cooling system due to sudden opening of safety valves or steam relief valves on the secondary cooling system or the steam generator. Temperature and pressure in the vessel was considered as the base of deterministic calculation of the stress intensity factor. Calculation of film coefficient of the convective heat transfers is a function of the transient time and water parameter. Pressure, material temperature, flaw depth and transient time are variables for the stress intensity factor. Failure probability consideration was done by using the above information in regard with the flaw and probability distributions of Octavia II and Marshall. Calculation of the failure probability by probability fracture mechanic simulation is applied on the weld region. Failure of the vessel is assumed as a failure of the weld material with one crack which stress intensity factor applied is higher than the critical stress intensity factor. VISA II code (Vessel Integrity Simulation Analysis II) was used for deterministic calculation and simulation. Failure probability of the material is 1.E-5 for Octavia II distribution and 4E-6 for marshall distribution for each transient event postulated. The failure occurred at the 1.7th menit of the initial transient under 12.53 ksi of the pressure

Choice probability generating functions

DEFF Research Database (Denmark)

Fosgerau, Mogens; McFadden, Daniel; Bierlaire, Michel

2013-01-01

This paper considers discrete choice, with choice probabilities coming from maximization of preferences from a random utility field perturbed by additive location shifters (ARUM). Any ARUM can be characterized by a choice-probability generating function (CPGF) whose gradient gives the choice...... probabilities, and every CPGF is consistent with an ARUM. We relate CPGF to multivariate extreme value distributions, and review and extend methods for constructing CPGF for applications. The choice probabilities of any ARUM may be approximated by a cross-nested logit model. The results for ARUM are extended...

Probability of satellite collision

Science.gov (United States)

Mccarter, J. W.

1972-01-01

A method is presented for computing the probability of a collision between a particular artificial earth satellite and any one of the total population of earth satellites. The collision hazard incurred by the proposed modular Space Station is assessed using the technique presented. The results of a parametric study to determine what type of satellite orbits produce the greatest contribution to the total collision probability are presented. Collision probability for the Space Station is given as a function of Space Station altitude and inclination. Collision probability was also parameterized over miss distance and mission duration.

Real analysis and probability

CERN Document Server

Ash, Robert B; Lukacs, E

1972-01-01

Real Analysis and Probability provides the background in real analysis needed for the study of probability. Topics covered range from measure and integration theory to functional analysis and basic concepts of probability. The interplay between measure theory and topology is also discussed, along with conditional probability and expectation, the central limit theorem, and strong laws of large numbers with respect to martingale theory.Comprised of eight chapters, this volume begins with an overview of the basic concepts of the theory of measure and integration, followed by a presentation of var

Probability and Measure

CERN Document Server

Billingsley, Patrick

2012-01-01

Praise for the Third Edition "It is, as far as I'm concerned, among the best books in math ever written....if you are a mathematician and want to have the top reference in probability, this is it." (Amazon.com, January 2006) A complete and comprehensive classic in probability and measure theory Probability and Measure, Anniversary Edition by Patrick Billingsley celebrates the achievements and advancements that have made this book a classic in its field for the past 35 years. Now re-issued in a new style and format, but with the reliable content that the third edition was revered for, this

Experimental Probability in Elementary School

Science.gov (United States)

Andrew, Lane

2009-01-01

Concepts in probability can be more readily understood if students are first exposed to probability via experiment. Performing probability experiments encourages students to develop understandings of probability grounded in real events, as opposed to merely computing answers based on formulae.

USING THE WEB-SERVICES WOLFRAM|ALPHA TO SOLVE PROBLEMS IN PROBABILITY THEORY

Directory of Open Access Journals (Sweden)

Taras Kobylnyk

2015-10-01

Full Text Available The trend towards the use of remote network resources on the Internet clearly delineated. Traditional training combined with increasingly networked, remote technologies become popular cloud computing. Research methods of probability theory are used in various fields. Of particular note is the use of methods of probability theory in psychological and educational research in statistical analysis of experimental data. Conducting such research is impossible without the use of modern information technology. Given the advantages of web-based software, the article describes web-service Wolfram|Alpha. Detailed analysis of the possibilities of using web-service Wolfram|Alpha for solving problems of probability theory. In the case studies described the results of queries for solving of probability theory, in particular the sections random events and random variables. Considered and analyzed the problem of the number of occurrences of event A in n independent trials using Wolfram|Alpha, detailed analysis of the possibilities of using the service Wolfram|Alpha for the study of continuous random variable that has a normal and uniform probability distribution, including calculating the probability of getting the value of a random variable in a given interval. The problem in applying the binomial and hypergeometric probability distribution of a discrete random variable and demonstrates the possibility of using the service Wolfram|Alpha for solving it.

Comments on the sequential probability ratio testing methods

Energy Technology Data Exchange (ETDEWEB)

Racz, A. [Hungarian Academy of Sciences, Budapest (Hungary). Central Research Inst. for Physics

1996-07-01

In this paper the classical sequential probability ratio testing method (SPRT) is reconsidered. Every individual boundary crossing event of the SPRT is regarded as a new piece of evidence about the problem under hypothesis testing. The Bayes method is applied for belief updating, i.e. integrating these individual decisions. The procedure is recommended to use when the user (1) would like to be informed about the tested hypothesis continuously and (2) would like to achieve his final conclusion with high confidence level. (Author).

Probabilities in physics

CERN Document Server

Hartmann, Stephan

2011-01-01

Many results of modern physics--those of quantum mechanics, for instance--come in a probabilistic guise. But what do probabilistic statements in physics mean? Are probabilities matters of objective fact and part of the furniture of the world, as objectivists think? Or do they only express ignorance or belief, as Bayesians suggest? And how are probabilistic hypotheses justified and supported by empirical evidence? Finally, what does the probabilistic nature of physics imply for our understanding of the world? This volume is the first to provide a philosophical appraisal of probabilities in all of physics. Its main aim is to make sense of probabilistic statements as they occur in the various physical theories and models and to provide a plausible epistemology and metaphysics of probabilities. The essays collected here consider statistical physics, probabilistic modelling, and quantum mechanics, and critically assess the merits and disadvantages of objectivist and subjectivist views of probabilities in these fie...

Probability an introduction

CERN Document Server

Grimmett, Geoffrey

2014-01-01

Probability is an area of mathematics of tremendous contemporary importance across all aspects of human endeavour. This book is a compact account of the basic features of probability and random processes at the level of first and second year mathematics undergraduates and Masters' students in cognate fields. It is suitable for a first course in probability, plus a follow-up course in random processes including Markov chains. A special feature is the authors' attention to rigorous mathematics: not everything is rigorous, but the need for rigour is explained at difficult junctures. The text is enriched by simple exercises, together with problems (with very brief hints) many of which are taken from final examinations at Cambridge and Oxford. The first eight chapters form a course in basic probability, being an account of events, random variables, and distributions - discrete and continuous random variables are treated separately - together with simple versions of the law of large numbers and the central limit th...

Marrakesh International Conference on Probability and Statistics

CERN Document Server

Ouassou, Idir; Rachdi, Mustapha

2015-01-01

This volume, which highlights recent advances in statistical methodology and applications, is divided into two main parts. The first part presents theoretical results on estimation techniques in functional statistics, while the second examines three key areas of application: estimation problems in queuing theory, an application in signal processing, and the copula approach to epidemiologic modelling. The book’s peer-reviewed contributions are based on papers originally presented at the Marrakesh International Conference on Probability and Statistics held in December 2013.

Introduction to probability

CERN Document Server

Freund, John E

1993-01-01

Thorough, lucid coverage of permutations and factorials, probabilities and odds, frequency interpretation, mathematical expectation, decision making, postulates of probability, rule of elimination, binomial distribution, geometric distribution, standard deviation, law of large numbers, and much more. Exercises with some solutions. Summary. Bibliography. Includes 42 black-and-white illustrations. 1973 edition.

Probably not future prediction using probability and statistical inference

CERN Document Server

Dworsky, Lawrence N

2008-01-01

An engaging, entertaining, and informative introduction to probability and prediction in our everyday lives Although Probably Not deals with probability and statistics, it is not heavily mathematical and is not filled with complex derivations, proofs, and theoretical problem sets. This book unveils the world of statistics through questions such as what is known based upon the information at hand and what can be expected to happen. While learning essential concepts including "the confidence factor" and "random walks," readers will be entertained and intrigued as they move from chapter to chapter. Moreover, the author provides a foundation of basic principles to guide decision making in almost all facets of life including playing games, developing winning business strategies, and managing personal finances. Much of the book is organized around easy-to-follow examples that address common, everyday issues such as: How travel time is affected by congestion, driving speed, and traffic lights Why different gambling ...

Applying Adverse Outcome Pathways (AOPs) to support Integrated Approaches to Testing and Assessment (IATA).

Science.gov (United States)

Tollefsen, Knut Erik; Scholz, Stefan; Cronin, Mark T; Edwards, Stephen W; de Knecht, Joop; Crofton, Kevin; Garcia-Reyero, Natalia; Hartung, Thomas; Worth, Andrew; Patlewicz, Grace

2014-12-01

Chemical regulation is challenged by the large number of chemicals requiring assessment for potential human health and environmental impacts. Current approaches are too resource intensive in terms of time, money and animal use to evaluate all chemicals under development or already on the market. The need for timely and robust decision making demands that regulatory toxicity testing becomes more cost-effective and efficient. One way to realize this goal is by being more strategic in directing testing resources; focusing on chemicals of highest concern, limiting testing to the most probable hazards, or targeting the most vulnerable species. Hypothesis driven Integrated Approaches to Testing and Assessment (IATA) have been proposed as practical solutions to such strategic testing. In parallel, the development of the Adverse Outcome Pathway (AOP) framework, which provides information on the causal links between a molecular initiating event (MIE), intermediate key events (KEs) and an adverse outcome (AO) of regulatory concern, offers the biological context to facilitate development of IATA for regulatory decision making. This manuscript summarizes discussions at the Workshop entitled "Advancing AOPs for Integrated Toxicology and Regulatory Applications" with particular focus on the role AOPs play in informing the development of IATA for different regulatory purposes. Copyright © 2014 Elsevier Inc. All rights reserved.

A counterfactual p-value approach for benefit-risk assessment in clinical trials.

Science.gov (United States)

Zeng, Donglin; Chen, Ming-Hui; Ibrahim, Joseph G; Wei, Rachel; Ding, Beiying; Ke, Chunlei; Jiang, Qi

2015-01-01

Clinical trials generally allow various efficacy and safety outcomes to be collected for health interventions. Benefit-risk assessment is an important issue when evaluating a new drug. Currently, there is a lack of standardized and validated benefit-risk assessment approaches in drug development due to various challenges. To quantify benefits and risks, we propose a counterfactual p-value (CP) approach. Our approach considers a spectrum of weights for weighting benefit-risk values and computes the extreme probabilities of observing the weighted benefit-risk value in one treatment group as if patients were treated in the other treatment group. The proposed approach is applicable to single benefit and single risk outcome as well as multiple benefit and risk outcomes assessment. In addition, the prior information in the weight schemes relevant to the importance of outcomes can be incorporated in the approach. The proposed CPs plot is intuitive with a visualized weight pattern. The average area under CP and preferred probability over time are used for overall treatment comparison and a bootstrap approach is applied for statistical inference. We assess the proposed approach using simulated data with multiple efficacy and safety endpoints and compare its performance with a stochastic multi-criteria acceptability analysis approach.

Probability with applications in engineering, science, and technology

CERN Document Server

Carlton, Matthew A

2017-01-01

This updated and revised first-course textbook in applied probability provides a contemporary and lively post-calculus introduction to the subject of probability. The exposition reflects a desirable balance between fundamental theory and many applications involving a broad range of real problem scenarios. It is intended to appeal to a wide audience, including mathematics and statistics majors, prospective engineers and scientists, and those business and social science majors interested in the quantitative aspects of their disciplines. The textbook contains enough material for a year-long course, though many instructors will use it for a single term (one semester or one quarter). As such, three course syllabi with expanded course outlines are now available for download on the book’s page on the Springer website. A one-term course would cover material in the core chapters (1-4), supplemented by selections from one or more of the remaining chapters on statistical inference (Ch. 5), Markov chains (Ch. 6), stoch...

Estimating migratory connectivity of birds when re-encounter probabilities are heterogeneous

Science.gov (United States)

Cohen, Emily B.; Hostelter, Jeffrey A.; Royle, J. Andrew; Marra, Peter P.

2014-01-01

Understanding the biology and conducting effective conservation of migratory species requires an understanding of migratory connectivity – the geographic linkages of populations between stages of the annual cycle. Unfortunately, for most species, we are lacking such information. The North American Bird Banding Laboratory (BBL) houses an extensive database of marking, recaptures and recoveries, and such data could provide migratory connectivity information for many species. To date, however, few species have been analyzed for migratory connectivity largely because heterogeneous re-encounter probabilities make interpretation problematic. We accounted for regional variation in re-encounter probabilities by borrowing information across species and by using effort covariates on recapture and recovery probabilities in a multistate capture–recapture and recovery model. The effort covariates were derived from recaptures and recoveries of species within the same regions. We estimated the migratory connectivity for three tern species breeding in North America and over-wintering in the tropics, common (Sterna hirundo), roseate (Sterna dougallii), and Caspian terns (Hydroprogne caspia). For western breeding terns, model-derived estimates of migratory connectivity differed considerably from those derived directly from the proportions of re-encounters. Conversely, for eastern breeding terns, estimates were merely refined by the inclusion of re-encounter probabilities. In general, eastern breeding terns were strongly connected to eastern South America, and western breeding terns were strongly linked to the more western parts of the nonbreeding range under both models. Through simulation, we found this approach is likely useful for many species in the BBL database, although precision improved with higher re-encounter probabilities and stronger migratory connectivity. We describe an approach to deal with the inherent biases in BBL banding and re-encounter data to demonstrate

Quantum processes: probability fluxes, transition probabilities in unit time and vacuum vibrations

International Nuclear Information System (INIS)

Oleinik, V.P.; Arepjev, Ju D.

1989-01-01

Transition probabilities in unit time and probability fluxes are compared in studying the elementary quantum processes -the decay of a bound state under the action of time-varying and constant electric fields. It is shown that the difference between these quantities may be considerable, and so the use of transition probabilities W instead of probability fluxes Π, in calculating the particle fluxes, may lead to serious errors. The quantity W represents the rate of change with time of the population of the energy levels relating partly to the real states and partly to the virtual ones, and it cannot be directly measured in experiment. The vacuum background is shown to be continuously distorted when a perturbation acts on a system. Because of this the viewpoint of an observer on the physical properties of real particles continuously varies with time. This fact is not taken into consideration in the conventional theory of quantum transitions based on using the notion of probability amplitude. As a result, the probability amplitudes lose their physical meaning. All the physical information on quantum dynamics of a system is contained in the mean values of physical quantities. The existence of considerable differences between the quantities W and Π permits one in principle to make a choice of the correct theory of quantum transitions on the basis of experimental data. (author)

Evolution of an array of elements with logistic transition probability

International Nuclear Information System (INIS)

Majernik, Vladimir; Surda, Anton

1996-01-01

The paper addresses the problem how the state of an array of elements changes if the transition probabilities of its elements is chosen in the form of a logistic map. This problem leads to a special type of a discrete-time Markov which we simulated numerically for the different transition probabilities and the number of elements in the array. We show that the time evolution of the array exhibits a wide scale of behavior depending on the value of the total number of its elements and on the logistic constant a. We point out that this problem can be applied for description of a spin system with a certain type of mean field and of the multispecies ecosystems with an internal noise. (authors)

Epistemic-based investigation of the probability of hazard scenarios using Bayesian network for the lifting operation of floating objects

Science.gov (United States)

Toroody, Ahmad Bahoo; Abaiee, Mohammad Mahdi; Gholamnia, Reza; Ketabdari, Mohammad Javad

2016-09-01

Owing to the increase in unprecedented accidents with new root causes in almost all operational areas, the importance of risk management has dramatically risen. Risk assessment, one of the most significant aspects of risk management, has a substantial impact on the system-safety level of organizations, industries, and operations. If the causes of all kinds of failure and the interactions between them are considered, effective risk assessment can be highly accurate. A combination of traditional risk assessment approaches and modern scientific probability methods can help in realizing better quantitative risk assessment methods. Most researchers face the problem of minimal field data with respect to the probability and frequency of each failure. Because of this limitation in the availability of epistemic knowledge, it is important to conduct epistemic estimations by applying the Bayesian theory for identifying plausible outcomes. In this paper, we propose an algorithm and demonstrate its application in a case study for a light-weight lifting operation in the Persian Gulf of Iran. First, we identify potential accident scenarios and present them in an event tree format. Next, excluding human error, we use the event tree to roughly estimate the prior probability of other hazard-promoting factors using a minimal amount of field data. We then use the Success Likelihood Index Method (SLIM) to calculate the probability of human error. On the basis of the proposed event tree, we use the Bayesian network of the provided scenarios to compensate for the lack of data. Finally, we determine the resulting probability of each event based on its evidence in the epistemic estimation format by building on two Bayesian network types: the probability of hazard promotion factors and the Bayesian theory. The study results indicate that despite the lack of available information on the operation of floating objects, a satisfactory result can be achieved using epistemic data.

Design and simulation of stratified probability digital receiver with application to the multipath communication

Science.gov (United States)

Deal, J. H.

1975-01-01

One approach to the problem of simplifying complex nonlinear filtering algorithms is through using stratified probability approximations where the continuous probability density functions of certain random variables are represented by discrete mass approximations. This technique is developed in this paper and used to simplify the filtering algorithms developed for the optimum receiver for signals corrupted by both additive and multiplicative noise.

A new approach for structural health monitoring by applying anomaly detection on strain sensor data

Science.gov (United States)

Trichias, Konstantinos; Pijpers, Richard; Meeuwissen, Erik

2014-03-01

Structural Health Monitoring (SHM) systems help to monitor critical infrastructures (bridges, tunnels, etc.) remotely and provide up-to-date information about their physical condition. In addition, it helps to predict the structure's life and required maintenance in a cost-efficient way. Typically, inspection data gives insight in the structural health. The global structural behavior, and predominantly the structural loading, is generally measured with vibration and strain sensors. Acoustic emission sensors are more and more used for measuring global crack activity near critical locations. In this paper, we present a procedure for local structural health monitoring by applying Anomaly Detection (AD) on strain sensor data for sensors that are applied in expected crack path. Sensor data is analyzed by automatic anomaly detection in order to find crack activity at an early stage. This approach targets the monitoring of critical structural locations, such as welds, near which strain sensors can be applied during construction and/or locations with limited inspection possibilities during structural operation. We investigate several anomaly detection techniques to detect changes in statistical properties, indicating structural degradation. The most effective one is a novel polynomial fitting technique, which tracks slow changes in sensor data. Our approach has been tested on a representative test structure (bridge deck) in a lab environment, under constant and variable amplitude fatigue loading. In both cases, the evolving cracks at the monitored locations were successfully detected, autonomously, by our AD monitoring tool.

Assessing the Probability that a Finding Is Genuine for Large-Scale Genetic Association Studies.

Science.gov (United States)

Kuo, Chia-Ling; Vsevolozhskaya, Olga A; Zaykin, Dmitri V

2015-01-01

Genetic association studies routinely involve massive numbers of statistical tests accompanied by P-values. Whole genome sequencing technologies increased the potential number of tested variants to tens of millions. The more tests are performed, the smaller P-value is required to be deemed significant. However, a small P-value is not equivalent to small chances of a spurious finding and significance thresholds may fail to serve as efficient filters against false results. While the Bayesian approach can provide a direct assessment of the probability that a finding is spurious, its adoption in association studies has been slow, due in part to the ubiquity of P-values and the automated way they are, as a rule, produced by software packages. Attempts to design simple ways to convert an association P-value into the probability that a finding is spurious have been met with difficulties. The False Positive Report Probability (FPRP) method has gained increasing popularity. However, FPRP is not designed to estimate the probability for a particular finding, because it is defined for an entire region of hypothetical findings with P-values at least as small as the one observed for that finding. Here we propose a method that lets researchers extract probability that a finding is spurious directly from a P-value. Considering the counterpart of that probability, we term this method POFIG: the Probability that a Finding is Genuine. Our approach shares FPRP's simplicity, but gives a valid probability that a finding is spurious given a P-value. In addition to straightforward interpretation, POFIG has desirable statistical properties. The POFIG average across a set of tentative associations provides an estimated proportion of false discoveries in that set. POFIGs are easily combined across studies and are immune to multiple testing and selection bias. We illustrate an application of POFIG method via analysis of GWAS associations with Crohn's disease.

Learning difficulties of senior high school students based on probability understanding levels

Science.gov (United States)

Anggara, B.; Priatna, N.; Juandi, D.

2018-05-01

Identifying students' difficulties in learning concept of probability is important for teachers to prepare the appropriate learning processes and can overcome obstacles that may arise in the next learning processes. This study revealed the level of students' understanding of the concept of probability and identified their difficulties as a part of the epistemological obstacles identification of the concept of probability. This study employed a qualitative approach that tends to be the character of descriptive research involving 55 students of class XII. In this case, the writer used the diagnostic test of probability concept learning difficulty, observation, and interview as the techniques to collect the data needed. The data was used to determine levels of understanding and the learning difficulties experienced by the students. From the result of students' test result and learning observation, it was found that the mean cognitive level was at level 2. The findings indicated that students had appropriate quantitative information of probability concept but it might be incomplete or incorrectly used. The difficulties found are the ones in arranging sample space, events, and mathematical models related to probability problems. Besides, students had difficulties in understanding the principles of events and prerequisite concept.