BmICE-2 is a novel pro-apoptotic caspase involved in apoptosis in the silkworm, Bombyx mori.

Science.gov (United States)

Yi, Hua-Shan; Pan, Cai-Xia; Pan, Chun; Song, Juan; Hu, Yan-Fen; Wang, La; Pan, Min-Hui; Lu, Cheng

2014-02-28

In this study we identified a potential pro-apoptotic caspase gene, Bombyx mori(B. mori)ICE-2 (BmICE-2) which encoded a polypeptide of 284 amino acid residues, including a (169)QACRG(173) sequence which surrounded the catalytic site and contained a p20 and a p10 domain. BmICE-2 expressed in Escherichia coli (E. coli) exhibited high proteolytic activity for the synthetic human initiator caspase-9 substrates Ac-LEHD-pNA, but little activity towards the effector caspase-3 substrates Ac-DEVD-pNA. When BmICE-2 was transiently expressed in BmN-SWU1 silkworm B. mori cells, we found that the high proteolytic activity for Ac-LEHD-pNA triggered caspase-3-like protease activity resulting in spontaneous cleavage and apoptosis in these cells. This effect was not replicated in Spodoptera frugiperda 9 cells. In addition, spontaneous cleavage of endogenous BmICE-2 in BmN-SWU1 cells could be induced by actinomycin D. These results suggest that BmICE-2 may be a novel pro-apoptotic gene with caspase-9 activity which is involved apoptotic processes in BmN-SWU1 silkworm B. mori cells. Copyright © 2014 Elsevier Inc. All rights reserved.

The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments.

Science.gov (United States)

Piatkov, Konstantin I; Brower, Christopher S; Varshavsky, Alexander

2012-07-03

In the course of apoptosis, activated caspases cleave ∼500 to ∼1,000 different proteins in a mammalian cell. The dynamics of apoptosis involve a number of previously identified, caspase-generated proapoptotic protein fragments, defined as those that increase the probability of apoptosis. In contrast to activated caspases, which can be counteracted by inhibitor of apoptosis proteins, there is little understanding of antiapoptotic responses to proapoptotic protein fragments. One possibility is the regulation of proapoptotic fragments through their selective degradation. The previously identified proapoptotic fragments Cys-RIPK1, Cys-TRAF1, Asp-BRCA1, Leu-LIMK1, Tyr-NEDD9, Arg-BID, Asp-BCL(XL), Arg-BIM(EL), Asp-EPHA4, and Tyr-MET bear destabilizing N-terminal residues. Tellingly, the destabilizing nature (but not necessarily the actual identity) of N-terminal residues of proapoptotic fragments was invariably conserved in evolution. Here, we show that these proapoptotic fragments are short-lived substrates of the Arg/N-end rule pathway. Metabolic stabilization of at least one such fragment, Cys-RIPK1, greatly augmented the activation of the apoptosis-inducing effector caspase-3. In agreement with this understanding, even a partial ablation of the Arg/N-end rule pathway in two specific N-end rule mutants is shown to sensitize cells to apoptosis. We also found that caspases can inactivate components of the Arg/N-end rule pathway, suggesting a mutual suppression between this pathway and proapoptotic signaling. Together, these results identify a mechanistically specific and functionally broad antiapoptotic role of the Arg/N-end rule pathway. In conjunction with other apoptosis-suppressing circuits, the Arg/N-end rule pathway contributes to thresholds that prevent a transient or otherwise weak proapoptotic signal from reaching the point of commitment to apoptosis.

Human Thyroid Cancer-1 (TC-1 is a vertebrate specific oncogenic protein that protects against copper and pro-apoptotic genes in yeast

Directory of Open Access Journals (Sweden)

Natalie K. Jones

2015-07-01

Full Text Available The human Thyroid Cancer-1 (hTC-1 protein, also known as C8orf4 was initially identified as a gene that was up-regulated in human thyroid cancer. Here we show that hTC-1 is a peptide that prevents the effects of over-expressing Bax in yeast. Analysis of the 106 residues of hTC-1 in available protein databases revealed direct orthologues in jawed-vertebrates, including mammals, frogs, fish and sharks. No TC-1 orthologue was detected in lower organisms, including yeast. Here we show that TC-1 is a general pro-survival peptide since it prevents the growth- and cell death-inducing effects of copper in yeast. Human TC-1 also prevented the deleterious effects that occur due to the over-expression of a number of key pro-apoptotic peptides, including YCA1, YBH3, NUC1, and AIF1. Even though the protective effects were more pronounced with the over-expression of YBH3 and YCA1, hTC-1 could still protect yeast mutants lacking YBH3 and YCA1 from the effects of copper sulfate. This suggests that the protective effects of TC-1 are not limited to specific pathways or processes. Taken together, our results indicate that hTC-1 is a pro-survival protein that retains its function when heterologously expressed in yeast. Thus yeast is a useful model to characterize the potential roles in cell death and survival of cancer related genes.

β3 integrin promotes chemoresistance to epirubicin in MDA-MB-231 through repression of the pro-apoptotic protein, BAD

Energy Technology Data Exchange (ETDEWEB)

Nair, Madhumathy G.; Desai, Krisha; Prabhu, Jyothi S.; Hari, P.S.; Remacle, Jose; Sridhar, T.S., E-mail: tssridhar@sjri.res.in

2016-08-01

Resistance to anthracycline based chemotherapy is a major limitation in the treatment of breast cancer, particularly of the triple negative sub-type that lacks targeted therapies. Resistance that arises from tumor-stromal interaction facilitated by integrins provides the possibility of targeted disruption. In the present study, we demonstrate that integrin β3 signaling inhibits apoptosis induced by a DNA-damaging chemotherapeutic agent, epirubicin, in MDA-MB-231 breast cancer cells. Drug efflux based mechanisms do not contribute to this effect. We show that integrin β3 employs the PI3K-Akt and the MAPK pathway for enabling cell survival and proliferation. Further, our results indicate that integrin β3 helps inhibit epirubicin induced cytotoxicity by repression of the pro-apoptotic protein BAD, thus promoting an anti-apoptotic response. Myristoylated RGT peptide and a monoclonal antibody against integrin β3 brought about a reversal of this effect and chemosensitized the cells. These results identify β3 integrin signaling via repression of BAD as an important survival pathway used by breast cancer cells to evade chemotherapy induced stress. - Highlights: • Integrin β3 signaling promotes chemoresistance to epirubicin in breast cancer cells. • Integrin β3 promotes cell survival and proliferation in drug treated cells through the PI3K and MAPK pathways. • Integrin signaling helps evade drug induced cytotoxicity by repression of pro-apoptotic molecule; BAD.

Fem1b, a proapoptotic protein, mediates proteasome inhibitor-induced apoptosis of human colon cancer cells.

Science.gov (United States)

Subauste, M Cecilia; Sansom, Owen J; Porecha, Nehal; Raich, Natacha; Du, Liqin; Maher, Joseph F

2010-02-01

In the treatment of colon cancer, the development of resistance to apoptosis is a major factor in resistance to therapy. New molecular approaches to overcome apoptosis resistance, such as selectively upregulating proapoptotic proteins, are needed in colon cancer therapy. In a mouse model with inactivation of the adenomatous polyposis coli (Apc) tumor suppressor gene, reflecting the pathogenesis of most human colon cancers, the gene encoding feminization-1 homolog b (Fem1b) is upregulated in intestinal epithelium following Apc inactivation. Fem1b is a proapoptotic protein that interacts with apoptosis-inducing proteins Fas, tumor necrosis factor receptor-1 (TNFR1), and apoptotic protease activating factor-1 (Apaf-1). Increasing Fem1b expression induces apoptosis of cancer cells, but effects on colon cancer cells have not been reported. Fem1b is a homolog of feminization-1 (FEM-1), a protein in Caenorhabditis elegans that is regulated by proteasomal degradation, but whether Fem1b is likewise regulated by proteasomal degradation is unknown. Herein, we found that Fem1b protein is expressed in primary human colon cancer specimens, and in malignant SW620, HCT-116, and DLD-1 colon cancer cells. Increasing Fem1b expression, by transfection of a Fem1b expression construct, induced apoptosis of these cells. We found that proteasome inhibitor treatment of SW620, HCT-116, and DLD-1 cells caused upregulation of Fem1b protein levels, associated with induction of apoptosis. Blockade of Fem1b upregulation with morpholino antisense oligonucleotide suppressed the proteasome inhibitor-induced apoptosis of these cells. In conclusion, the proapoptotic protein Fem1b is downregulated by the proteasome in malignant colon cancer cells and mediates proteasome inhibitor-induced apoptosis of these cells. Therefore, Fem1b could represent a novel molecular target to overcome apoptosis resistance in therapy of colon cancer.

Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors

International Nuclear Information System (INIS)

Ahmed, M.

2003-01-01

Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation

Epigenetic Silencing of the Proapoptotic Gene BIM in Anaplastic Large Cell Lymphoma through an MeCP2/SIN3a Deacetylating Complex

Directory of Open Access Journals (Sweden)

Rocco Piazza

2013-05-01

Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.

Hypoxia causes IL-8 secretion, Charcot Leyden crystal formation, and suppression of corticosteroid-induced apoptosis in human eosinophils.

Science.gov (United States)

Porter, L M; Cowburn, A S; Farahi, N; Deighton, J; Farrow, S N; Fiddler, C A; Juss, J K; Condliffe, A M; Chilvers, E R

2017-06-01

Inflamed environments are typically hypercellular, rich in pro-inflammatory cytokines, and profoundly hypoxic. While the effects of hypoxia on neutrophil longevity and function have been widely studied, little is known about the consequences of this stimulus on eosinophils. We sought to investigate the effects of hypoxia on several key aspects of eosinophil biology, namely secretion, survival, and their sensitivity to glucocorticosteroids (GCS), agents that normally induce eosinophil apoptosis. Eosinophils derived from patients with asthma/atopy or healthy controls were incubated under normoxia and hypoxia, with or without glucocorticoids. Activation was measured by flow cytometry, ELISA of cultured supernatants, and F-actin staining; apoptosis and efferocytosis by morphology and flow cytometry; and GCS efficacy by apoptosis assays and qPCR. Hypoxic incubation (3 kPa) caused (i) stabilization of HIF-2α and up-regulation of hypoxia-regulated genes including BNIP3 (BCL2/adenovirus E1B 19-kDa protein-interacting protein 3) and GLUT1 (glucose transporter 1); (ii) secretion of pre-formed IL-8, and Charcot Leyden crystal (CLC) formation, which was most evident in eosinophils derived from atopic and asthmatic donors; (iii) enhanced F-actin formation; (iv) marked prolongation of eosinophil lifespan (via a NF-κB and Class I PI3-kinase-dependent mechanism); and (v) complete abrogation of the normal pro-apoptotic effect of dexamethasone and fluticasone furoate. This latter effect was evident despite preservation of GCS-mediated gene transactivation under hypoxia. These data indicate that hypoxia promotes an eosinophil pro-inflammatory phenotype by enhancing eosinophil secretory function, delaying constitutive apoptosis, and importantly, antagonizing the normal pro-apoptotic effect of GCS. As eosinophils typically accumulate at sites that are relatively hypoxic, particularly during periods of inflammation, these findings may have important implications to understanding the

WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer

Energy Technology Data Exchange (ETDEWEB)

Zeilstra, Jurrit; Joosten, Sander P.J. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Wensveen, Felix M. [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Dessing, Mark C.; Schuetze, Denise M. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Eldering, Eric [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Spaargaren, Marcel [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Pals, Steven T., E-mail: s.t.pals@amc.uva.nl [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands)

2011-03-04

Research highlights: {yields} Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. {yields} Expression profiling of apoptosis-related genes in Apc{sup Min/+} mice revealed the differential expression of pro-apoptotic Bok and Bax. {yields} APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. {yields} Blocking of {beta}-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or {beta}-catenin causes constitutively active {beta}-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc{sup Min/+} mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of {beta}-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which

WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer

International Nuclear Information System (INIS)

Zeilstra, Jurrit; Joosten, Sander P.J.; Wensveen, Felix M.; Dessing, Mark C.; Schuetze, Denise M.; Eldering, Eric; Spaargaren, Marcel; Pals, Steven T.

2011-01-01

Research highlights: → Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. → Expression profiling of apoptosis-related genes in Apc Min/+ mice revealed the differential expression of pro-apoptotic Bok and Bax. → APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. → Blocking of β-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or β-catenin causes constitutively active β-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc Min/+ mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of β-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which uncontrolled epithelial cell proliferation in the

Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling

Directory of Open Access Journals (Sweden)

Takehara Tadamichi

2006-03-01

Full Text Available Abstract Background Porphyromonas gingivalis is the foremost oral pathogen of adult periodontitis in humans. However, the mechanisms of bacterial invasion and the resultant destruction of the gingival tissue remain largely undefined. Results We report host-P. gingivalis interactions in primary human gingival fibroblast (HGF cells. Quantitative immunostaining revealed the need for a high multiplicity of infection for optimal infection. Early in infection (2–12 h, P. gingivalis activated the proinflammatory transcription factor NF-kappa B, partly via the PI3 kinase/AKT pathway. This was accompanied by the induction of cellular anti-apoptotic genes, including Bfl-1, Boo, Bcl-XL, Bcl2, Mcl-1, Bcl-w and Survivin. Late in infection (24–36 h the anti-apoptotic genes largely shut down and the pro-apoptotic genes, including Nip3, Hrk, Bak, Bik, Bok, Bax, Bad, Bim and Moap-1, were activated. Apoptosis was characterized by nuclear DNA degradation and activation of caspases-3, -6, -7 and -9 via the intrinsic mitochondrial pathway. Use of inhibitors revealed an anti-apoptotic function of NF-kappa B and PI3 kinase in P. gingivalis-infected HGF cells. Use of a triple protease mutant P. gingivalis lacking three major gingipains (rgpA rgpB kgp suggested a role of some or all these proteases in myriad aspects of bacteria-gingival interaction. Conclusion The pathology of the gingival fibroblast in P. gingivalis infection is affected by a temporal shift from cellular survival response to apoptosis, regulated by a number of anti- and pro-apoptotic molecules. The gingipain group of proteases affects bacteria-host interactions and may directly promote apoptosis by intracellular proteolytic activation of caspase-3.

RACK1 downregulates levels of the pro-apoptotic protein Fem1b in apoptosis-resistant colon cancer cells.

Science.gov (United States)

Subauste, M Cecilia; Ventura-Holman, Tereza; Du, Liqin; Subauste, Jose S; Chan, Shing-Leng; Yu, Victor C; Maher, Joseph F

2009-12-01

Evasion of apoptosis plays an important role in colon cancer progression. Following loss of the Apc tumor suppressor gene in mice, the gene encoding Fem1b is upregulated early in neoplastic intestinal epithelium. Fem1b is a pro-apoptotic protein that interacts with Fas, TNFR1 and Apaf-1, and increased expression of Fem1b induces apoptosis of cancer cells. Fem1b is a homolog of FEM-1, a protein in Caenorhabditis elegans that is negatively regulated by ubiquitination and proteasomal degradation. To study Fem1b regulation in colon cancer progression, we used apoptotis-sensitive SW480 cells, derived from a primary colon cancer, and their isogenic, apoptosis-resistant counterparts SW620 cells, derived from a subsequent metastatic lesion in the same patient. Treatment with proteasome inhibitor increased Fem1b protein levels in SW620 cells, but not in SW480 cells. In SW620 cells we found that endogenous Fem1b co-immunoprecipitates in complexes with RACK1, a protein known to mediate ubiquitination and proteasomal degradation of other pro-apoptotic proteins and to be upregulated in colon cancer. Full-length Fem1b, or the N-terminal region of Fem1b, associated with RACK1 when co-expressed in HEK293T cells, and RACK1 stimulated ubiquitination of Fem1b. RACK1 overexpression in SW620 cells led to downregulation of Fem1b protein levels. Conversely, downregulation of RACK1 led to upregulation of Fem1b protein levels, associated with induction of apoptosis, and this apoptosis was inhibited by blocking Fem1b protein upregulation. In conclusion, RACK1 downregulates levels of the pro-apoptotic protein Fem1b in metastatic, apoptosis-resistant colon cancer cells, which may promote apoptosis-resistance during progression of colon cancer.

MicroRNA-302/367 Cluster Governs hESC Self-Renewal by Dually Regulating Cell Cycle and Apoptosis Pathways

Directory of Open Access Journals (Sweden)

Zhonghui Zhang

2015-04-01

Full Text Available miR-302/367 is the most abundant miRNA cluster in human embryonic stem cells (hESCs and can promote somatic cell reprogramming. However, its role in hESCs remains poorly understood. Here, we studied functional roles of the endogenous miR-302/367 cluster in hESCs by employing specific TALE-based transcriptional repressors. We revealed that miR-302/367 cluster dually regulates hESC cell cycle and apoptosis in dose-dependent manner. Gene profiling and functional studies identified key targets of the miR-302/367 cluster in regulating hESC self-renewal and apoptosis. We demonstrate that in addition to its role in cell cycle regulation, miR-302/367 cluster conquers apoptosis by downregulating BNIP3L/Nix (a BH3-only proapoptotic factor and upregulating BCL-xL expression. Furthermore, we show that butyrate, a natural compound, upregulates miR-302/367 cluster expression and alleviates hESCs from apoptosis induced by knockdown of miR-302/367 cluster. In summary, our findings provide new insights in molecular mechanisms of how miR-302/367 cluster regulates hESCs.

Pro-apoptotic signaling induced by Retinoic acid and dsRNA is under the control of Interferon Regulatory Factor-3 in breast cancer cells.

Science.gov (United States)

Bernardo, Ana R; Cosgaya, José M; Aranda, Ana; Jiménez-Lara, Ana M

2017-07-01

Breast cancer is one of the most lethal malignancies for women. Retinoic acid (RA) and double-stranded RNA (dsRNA) are considered signaling molecules with potential anticancer activity. RA, co-administered with the dsRNA mimic polyinosinic-polycytidylic acid (poly(I:C)), synergizes to induce a TRAIL (Tumor-Necrosis-Factor Related Apoptosis-Inducing Ligand)- dependent apoptotic program in breast cancer cells. Here, we report that RA/poly(I:C) co-treatment, synergically, induce the activation of Interferon Regulatory Factor-3 (IRF3) in breast cancer cells. IRF3 activation is mediated by a member of the pathogen recognition receptors, Toll-like receptor-3 (TLR3), since its depletion abrogates IRF3 activation by RA/poly(I:C) co-treatment. Besides induction of TRAIL, apoptosis induced by RA/poly(I:C) correlates with the increased expression of pro-apoptotic TRAIL receptors, TRAIL-R1/2, and the inhibition of the antagonistic receptors TRAIL-R3/4. IRF3 plays an important role in RA/poly(I:C)-induced apoptosis since IRF3 depletion suppresses caspase-8 and caspase-3 activation, TRAIL expression upregulation and apoptosis. Interestingly, RA/poly(I:C) combination synergizes to induce a bioactive autocrine/paracrine loop of type-I Interferons (IFNs) which is ultimately responsible for TRAIL and TRAIL-R1/2 expression upregulation, while inhibition of TRAIL-R3/4 expression is type-I IFN-independent. Our results highlight the importance of IRF3 and type-I IFNs signaling for the pro-apoptotic effects induced by RA and synthetic dsRNA in breast cancer cells.

Dual role of proapoptotic BAD in insulin secretion and beta cell survival

OpenAIRE

Danial, Nika N.; Walensky, Loren D.; Zhang, Chen-Yu; Choi, Cheol Soo; Fisher, Jill K.; Molina, Anthony J. A.; Datta, Sandeep Robert; Pitter, Kenneth L.; Bird, Gregory H.; Wikstrom, Jakob D.; Deeney, Jude T.; Robertson, Kirsten; Morash, Joel; Kulkarni, Ameya; Neschen, Susanne

2008-01-01

The proapoptotic BCL-2 family member BAD resides in a glucokinase-containing complex that regulates glucose-driven mitochondrial respiration. Here, we present genetic evidence of a physiologic role for BAD in glucose-stimulated insulin secretion by beta cells. This novel function of BAD is specifically dependent upon the phosphorylation of its BH3 sequence, previously defined as an essential death domain. We highlight the pharmacologic relevance of phosphorylated BAD BH3 by using cell-permeab...

FoxP3 inhibits proliferation and induces apoptosis of gastric cancer cells by activating the apoptotic signaling pathway

International Nuclear Information System (INIS)

Ma, Gui-Fen; Chen, Shi-Yao; Sun, Zhi-Rong; Miao, Qing; Liu, Yi-Mei; Zeng, Xiao-Qing; Luo, Tian-Cheng; Ma, Li-Li; Lian, Jing-Jing; Song, Dong-Li

2013-01-01

Highlights: ► The article revealed FoxP3 gene function in gastric cancer firstly. ► Present the novel roles of FoxP3 in inhibiting proliferation and promoting apoptosis in gastric cancer cells. ► Overexpression of FoxP3 increased proapoptotic molecules and repressed antiapoptotic molecules. ► Silencing of FoxP3 reduced the expression of proapoptotic genes, such as PARP, caspase-3 and caspase-9. ► FoxP3 is sufficient for activating the apoptotic signaling pathway. -- Abstract: Forkhead Box Protein 3 (FoxP3) was identified as a key transcription factor to the occurring and function of the regulatory T cells (Tregs). However, limited evidence indicated its function in tumor cells. To elucidate the precise roles and underlying molecular mechanism of FoxP3 in gastric cancer (GC), we examined the expression of FoxP3 and the consequences of interfering with FoxP3 gene in human GC cell lines, AGS and MKN45, by multiple cellular and molecular approaches, such as immunofluorescence, gene transfection, CCK-8 assay, clone formation assay, TUNEL assay, Flow cytometry, immunoassay and quantities polymerase chain reaction (PCR). As a result, FoxP3 was expressed both in nucleus and cytoplasm of GC cells. Up-regulation of FoxP3 inhibited cell proliferation and promoted cell apoptosis. Overexpression of FoxP3 increased the protein and mRNA levels of proapoptotic molecules, such as poly ADP-ribose polymerase1 (PARP), caspase-3 and caspase-9, and repressed the expression of antiapoptotic molecules, such as cellular inhibitor of apoptosis-1 (c-IAP1) and the long isoform of B cell leukemia/lymphoma-2 (Bcl-2). Furthermore, silencing of FoxP3 by siRNA in GC cells reduced the expression of proapoptotic genes, such as PARP, caspase-3 and caspase-9. Collectively, our findings identify the novel roles of FoxP3 in inhibiting proliferation and inducing apoptosis in GC cells by regulating apoptotic signaling, which could be a promising therapeutic approach for gastric cancer.

FoxP3 inhibits proliferation and induces apoptosis of gastric cancer cells by activating the apoptotic signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Ma, Gui-Fen [Department of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai (China); Chen, Shi-Yao, E-mail: shiyao_chen@163.com [Department of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai (China); Endoscopy Center, Zhongshan Hospital, Fudan University, Shanghai (China); Sun, Zhi-Rong [Department of Anesthesiology, Cancer Center, Fudan University, Shanghai (China); Miao, Qing; Liu, Yi-Mei; Zeng, Xiao-Qing; Luo, Tian-Cheng [Department of Gastroenterology, Zhongshan Hospital, Fudan University, Shanghai (China); Ma, Li-Li; Lian, Jing-Jing [Endoscopy Center, Zhongshan Hospital, Fudan University, Shanghai (China); Song, Dong-Li [Biomedical Research Center, Zhongshan Hospital, Fudan University, Shanghai (China)

2013-01-11

Highlights: Black-Right-Pointing-Pointer The article revealed FoxP3 gene function in gastric cancer firstly. Black-Right-Pointing-Pointer Present the novel roles of FoxP3 in inhibiting proliferation and promoting apoptosis in gastric cancer cells. Black-Right-Pointing-Pointer Overexpression of FoxP3 increased proapoptotic molecules and repressed antiapoptotic molecules. Black-Right-Pointing-Pointer Silencing of FoxP3 reduced the expression of proapoptotic genes, such as PARP, caspase-3 and caspase-9. Black-Right-Pointing-Pointer FoxP3 is sufficient for activating the apoptotic signaling pathway. -- Abstract: Forkhead Box Protein 3 (FoxP3) was identified as a key transcription factor to the occurring and function of the regulatory T cells (Tregs). However, limited evidence indicated its function in tumor cells. To elucidate the precise roles and underlying molecular mechanism of FoxP3 in gastric cancer (GC), we examined the expression of FoxP3 and the consequences of interfering with FoxP3 gene in human GC cell lines, AGS and MKN45, by multiple cellular and molecular approaches, such as immunofluorescence, gene transfection, CCK-8 assay, clone formation assay, TUNEL assay, Flow cytometry, immunoassay and quantities polymerase chain reaction (PCR). As a result, FoxP3 was expressed both in nucleus and cytoplasm of GC cells. Up-regulation of FoxP3 inhibited cell proliferation and promoted cell apoptosis. Overexpression of FoxP3 increased the protein and mRNA levels of proapoptotic molecules, such as poly ADP-ribose polymerase1 (PARP), caspase-3 and caspase-9, and repressed the expression of antiapoptotic molecules, such as cellular inhibitor of apoptosis-1 (c-IAP1) and the long isoform of B cell leukemia/lymphoma-2 (Bcl-2). Furthermore, silencing of FoxP3 by siRNA in GC cells reduced the expression of proapoptotic genes, such as PARP, caspase-3 and caspase-9. Collectively, our findings identify the novel roles of FoxP3 in inhibiting proliferation and inducing apoptosis

Pro-Apoptotic Role of the Human YPEL5 Gene Identified by Functional Complementation of a Yeast moh1Δ Mutation.

Science.gov (United States)

Lee, Ji Young; Jun, Do Youn; Park, Ju Eun; Kwon, Gi Hyun; Kim, Jong-Sik; Kim, Young Ho

2017-03-28

To examine the pro-apoptotic role of the human ortholog (YPEL5) of the Drosophila Yippee protein, the cell viability of Saccharomyces cerevisiae mutant strain with deleted MOH1 , the yeast ortholog, was compared with that of the wild-type (WT)- MOH1 strain after exposure to different apoptogenic stimulants, including UV irradiation, methyl methanesulfonate (MMS), camptothecin (CPT), heat shock, and hyperosmotic shock. The moh1 Δ mutant exhibited enhanced cell viability compared with the WT- MOH1 strain when treated with lethal UV irradiation, 1.8 mM MMS, 100 µ CPT, heat shock at 50°C, or 1.2 M KCl. At the same time, the level of Moh1 protein was commonly up-regulated in the WT- MOH1 strain as was that of Ynk1 protein, which is known as a marker for DNA damage. Although the enhanced UV resistance of the moh1 Δ mutant largely disappeared following transformation with the yeast MOH1 gene or one of the human YPEL1-YPEL5 genes, the transformant bearing pYES2- YPEL5 was more sensitive to lethal UV irradiation and its UV sensitivity was similar to that of the WT- MOH1 strain. Under these conditions, the UV irradiation-induced apoptotic events, such as FITC-Annexin V stainability, mitochondrial membrane potential (ΔΨm) loss, and metacaspase activation, occurred to a much lesser extent in the moh1 Δ mutant compared with the WT- MOH1 strain and the mutant strain bearing pYES2- MOH1 or pYES2- YPEL5 . These results demonstrate the functional conservation between yeast Moh1 and human YPEL5, and their involvement in mitochondria-dependent apoptosis induced by DNA damage.

miR-148a is upregulated by Twist1 and T-bet and promotes Th1-cell survival by regulating the proapoptotic gene Bim.

Science.gov (United States)

Haftmann, Claudia; Stittrich, Anna-Barbara; Zimmermann, Jakob; Fang, Zhuo; Hradilkova, Kristyna; Bardua, Markus; Westendorf, Kerstin; Heinz, Gitta A; Riedel, René; Siede, Julia; Lehmann, Katrin; Weinberger, Esther E; Zimmel, David; Lauer, Uta; Häupl, Thomas; Sieper, Joachim; Backhaus, Marina; Neumann, Christian; Hoffmann, Ute; Porstner, Martina; Chen, Wei; Grün, Joachim R; Baumgrass, Ria; Matz, Mareen; Löhning, Max; Scheffold, Alexander; Wittmann, Jürgen; Chang, Hyun-Dong; Rajewsky, Nikolaus; Jäck, Hans-Martin; Radbruch, Andreas; Mashreghi, Mir-Farzin

2015-04-01

Repeatedly activated T helper 1 (Th1) cells present during chronic inflammation can efficiently adapt to the inflammatory milieu, for example, by expressing the transcription factor Twist1, which limits the immunopathology caused by Th1 cells. Here, we show that in repeatedly activated murine Th1 cells, Twist1 and T-bet induce expression of microRNA-148a (miR-148a). miR-148a regulates expression of the proapoptotic gene Bim, resulting in a decreased Bim/Bcl2 ratio. Inhibition of miR-148a by antagomirs in repeatedly activated Th1 cells increases the expression of Bim, leading to enhanced apoptosis. Knockdown of Bim expression by siRNA in miR-148a antagomir-treated cells restores viability of the Th1 cells, demonstrating that miR-148a controls survival by regulating Bim expression. Thus, Twist1 and T-bet not only control the differentiation and function of Th1 cells, but also their persistence in chronic inflammation. © 2014 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The proapoptotic activity of C-terminal domain of apoptosis-inducing factor (AIF is separated from its N-terminal

Directory of Open Access Journals (Sweden)

YONG ZHANG

2009-01-01

Full Text Available Apoptosis-inducing factor (AIF is a mitochondrial flavoprotein that mediates both NADH-oxidizing and caspase-independent apoptosis. Further, the proapoptotic activity of AIF is located in the C-terminus of AIF, although the precise minimum sequence responsible for apoptosis induction remains to be investigated. In the present study, we generated two truncated AIFs, AIFΔ1-480-FLAG, which is a FLAG-tagged C-terminal peptide comprising amino acids from 481 to 613, and AIF360-480 containing amino acids from 360 to 480 of AIF. We used confocal microscopy to demonstrate that both the truncated proteins are expressed and located in the cytoplasm of transfected cells. AIFΔ1-480 but not AIF360-480 induces apoptosis in transfected cells. We also found that the expression of AIFΔ1-480 could initiate the release of cytochrome c from the mitochondria. The suppression of caspase-9 via siRNA blocked the proapoptotic activity of AIFΔ1-480. Therefore, AIFΔ 1-480 is sufficient for inducing caspase-9-dependent apoptotic signaling, probably by promoting the release of cytochrome c. At last, we generated a chimeric immuno-AIFΔ 1-480 protein, which comprised an HER2 antibody, a Pseudomonas exotoxin A translocation domain and AIFΔ 1-480. Human Jurkat cells transfected with the immuno-AIFΔl-480 gene could express and secrete the chimeric protein, which selectively recognize and kill HER2-overexpressing tumor cells. Our study demonstrates the feasibility of the immuno-AIFΔl-480 gene as a novel approach to treating HER2-overexpressing cancers.

Pro-apoptotic effect of a Mycoplasma hyopneumoniae putative type I signal peptidase on PK(15) swine cells.

Science.gov (United States)

Paes, Jéssica A; Virginio, Veridiana G; Cancela, Martín; Leal, Fernanda M A; Borges, Thiago J; Jaeger, Natália; Bonorino, Cristina; Schrank, Irene S; Ferreira, Henrique B

2017-03-01

Mycoplasma hyopneumoniae is an economically significant swine pathogen that causes porcine enzootic pneumonia (PEP). Important processes for swine infection by M. hyopneumoniae depend on cell surface proteins, many of which are secreted by secretion pathways not completely elucidated so far. A putative type I signal peptidase (SPase I), a possible component of a putative Sec-dependent pathway, was annotated as a product of the sipS gene in the pathogenic M. hyopneumoniae 7448 genome. This M. hyopneumoniae putative SPase I (MhSPase I) displays only 14% and 23% of sequence identity/similarity to Escherichia coli bona fide SPase I, and, in complementation assays performed with a conditional E. coli SPase I mutant, only a partial restoration of growth was achieved with the heterologous expression of a recombinant MhSPase I (rMhSPase I). Considering the putative surface location of MhSPase I and its previously demonstrated capacity to induce a strong humoral response, we then assessed its potential to elicit a cellular and possible immunomodulatory response. In assays for immunogenicity assessment, rMhSPase I unexpectedly showed a cytotoxic effect on murine splenocytes. This cytotoxic effect was further confirmed using the swine epithelial PK(15) cell line in MTT and annexin V-flow cytometry assays, which showed that rMhSPase I induces apoptosis in a dose dependent-way. It was also demonstrated that this pro-apoptotic effect of rMhSPase I involves activation of a caspase-3 cascade. The potential relevance of the rMhSPase I pro-apoptotic effect for M. hyopneumoniae-host interactions in the context of PEP is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas.

Science.gov (United States)

Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F

2013-09-01

The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

Alteration of apoptosis-related genes in postmenopausal women with uterine prolapse.

Science.gov (United States)

Saatli, Bahadir; Kizildag, Sefa; Cagliyan, Erkan; Dogan, Erbil; Saygili, Ugur

2014-07-01

We aimed to compare expression levels of antiapoptotic and proapoptotic genes in parametrial and vaginal tissues from postmenopausal women with and without pelvic organ prolapse (POP). We hypothesized that the expression of genes that induce apoptosis may be altered in vaginal and parametrial tissues in postmenopausal women with POP. Samples of vaginal and parametrial tissues were obtained from postmenopausal women with (n = 10) and without (n = 10) POP who underwent vaginal or abdominal hysterectomy. Expression levels of antiapoptotic (BCL-2, BCL-XL) and proapoptotic (BAX, BAD) genes were studied by real-time reverse-transcription polymerase chain reaction (RT-PCR). Gene expression levels of BCL-2 (P gene expression levels of BCL-2 (p gene expression levels differed significantly between postmenopausal women with and without POP. Bcl-2 family genes were overexpressed in the parametrium of patients with POP compared with vaginal tissue, suggesting that the processes responsible for POP have a greater effect on parametrial tissue than vaginal tissue during the development of POP.

Possible mechanism of PNS protection against cisplatin-induced nephrotoxicity in rat models.

Science.gov (United States)

Liu, Xinwen; Huang, Zhenguang; Zou, Xiaoqin; Yang, Yufang; Qiu, Yue; Wen, Yan

2015-01-01

This study investigates the mechanism of the protective effect of Panax notoginsenosides (PNS) against cisplatin-induced nephrotoxicity via the hypoxia inducible factor 1 (HIF-1)/Bcl-2/adenovirus E1B 19 kDa-interacting protein 3 (BNIP3) pathway of autophagy. The rats underwent intraperitoneal injection with a single dose of cisplatin and a subset of rats were also intraperitoneally injected with 31.35 mg/kg PNS once a day. After 24 h exposure to cisplatin, the concentrations of urinary N-acetyl-β-D-glucosaminidase (NAG), blood urea nitrogen (BUN) and serum creatinine (Scr) were determined. The rat renal tissue was examined using H&E-staining, and the mitochondria of renal tubular epithelial cells were observed using transmission electron microscopy. The expressions of microtubule-associated protein-1 light chain (LC)3, autophagy-related gene (Atg)5, Beclin-1 and BNIP3 in rat renal tissue were detected using western blotting. The expression of HIF-1 was detected by immunohistochemistry. The results showed that PNS significantly protected against cisplatin-induced nephrotoxicity, as evidenced by decreasing the concentration of blood BUN and Scr, the attenuation of renal histopathological changes and the mitochondrial damages of renal cells, and the increase of mitochondria autophagosome in renal tubular epithelial cells. Additionally, PNS significantly increased the expression of LC3 and the ratio of LC3II/LC3I in rat renal tissue. Moreover, PNS significantly increased the expression of HIF-1α, BNIP3, Atg5 and Beclin-1 in rat renal tissue. In conclusion, the protective effect of PNS on cisplatin-induced nephrotoxicity was mainly due to its ability to enhancing the mitochondrial autophagy of renal tissue via the HIF-1α/BNIP3 pathway, and here is the first demonstration about it.

Gene expression profiles in asbestos-exposed epithelial and mesothelial lung cell lines

Directory of Open Access Journals (Sweden)

Kaski Samuel

2007-03-01

Full Text Available Abstract Background Asbestos has been shown to cause chromosomal damage and DNA aberrations. Exposure to asbestos causes many lung diseases e.g. asbestosis, malignant mesothelioma, and lung cancer, but the disease-related processes are still largely unknown. We exposed the human cell lines A549, Beas-2B and Met5A to crocidolite asbestos and determined time-dependent gene expression profiles by using Affymetrix arrays. The hybridization data was analyzed by using an algorithm specifically designed for clustering of short time series expression data. A canonical correlation analysis was applied to identify correlations between the cell lines, and a Gene Ontology analysis method for the identification of enriched, differentially expressed biological processes. Results We recognized a large number of previously known as well as new potential asbestos-associated genes and biological processes, and identified chromosomal regions enriched with genes potentially contributing to common responses to asbestos in these cell lines. These include genes such as the thioredoxin domain containing gene (TXNDC and the potential tumor suppressor, BCL2/adenovirus E1B 19kD-interacting protein gene (BNIP3L, GO-terms such as "positive regulation of I-kappaB kinase/NF-kappaB cascade" and "positive regulation of transcription, DNA-dependent", and chromosomal regions such as 2p22, 9p13, and 14q21. We present the complete data sets as Additional files. Conclusion This study identifies several interesting targets for further investigation in relation to asbestos-associated diseases.

Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma

International Nuclear Information System (INIS)

Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van

2005-01-01

Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype

Dual role of proapoptotic BAD in insulin secretion and beta cell survival.

Science.gov (United States)

Danial, Nika N; Walensky, Loren D; Zhang, Chen-Yu; Choi, Cheol Soo; Fisher, Jill K; Molina, Anthony J A; Datta, Sandeep Robert; Pitter, Kenneth L; Bird, Gregory H; Wikstrom, Jakob D; Deeney, Jude T; Robertson, Kirsten; Morash, Joel; Kulkarni, Ameya; Neschen, Susanne; Kim, Sheene; Greenberg, Michael E; Corkey, Barbara E; Shirihai, Orian S; Shulman, Gerald I; Lowell, Bradford B; Korsmeyer, Stanley J

2008-02-01

The proapoptotic BCL-2 family member BAD resides in a glucokinase-containing complex that regulates glucose-driven mitochondrial respiration. Here, we present genetic evidence of a physiologic role for BAD in glucose-stimulated insulin secretion by beta cells. This novel function of BAD is specifically dependent upon the phosphorylation of its BH3 sequence, previously defined as an essential death domain. We highlight the pharmacologic relevance of phosphorylated BAD BH3 by using cell-permeable, hydrocarbon-stapled BAD BH3 helices that target glucokinase, restore glucose-driven mitochondrial respiration and correct the insulin secretory response in Bad-deficient islets. Our studies uncover an alternative target and function for the BAD BH3 domain and emphasize the therapeutic potential of phosphorylated BAD BH3 mimetics in selectively restoring beta cell function. Furthermore, we show that BAD regulates the physiologic adaptation of beta cell mass during high-fat feeding. Our findings provide genetic proof of the bifunctional activities of BAD in both beta cell survival and insulin secretion.

The Indolic Diet-Derivative, 3,3′-Diindolylmethane, Induced Apoptosis in Human Colon Cancer Cells through Upregulation of NDRG1

Directory of Open Access Journals (Sweden)

A. Lerner

2012-01-01

Full Text Available N-myc downstream regulated gene-1 participates in carcinogenesis, angiogenesis, metastases, and anticancer drug resistance. In the present study, we analyzed the expression pattern of N-myc downstream regulated gene-1 following treatment of human colonic cancer cell lines; HCT-116 (well differentiated with wild-type p53 gene and Colo-320 (poorly differentiated with mutant p53 gene, with 3,3′-diindolylmethane, a well-established proapoptotic agent product derived from indole-3-carbinol. Treatment of Colo-320 and HCT-116 with 3,3′-diindolylmethane disclosed inhibition of cell viability in a dose-dependent manner, mediated through apoptosis induction. The increased expression of N-myc downstream regulated gene-1 was detected only in poorly differentiated colon cancer cells, Colo-320 cell line. Our results suggest that N-myc downstream regulated gene-1 expression is enhanced by 3,3′-diindolylmethane in poorly differentiated cells and followed by induction of apoptosis. 3,3′-diindolylmethane induced apoptosis may represent a new regulator of N-myc downstream regulated gene-1 in poorly differentiated colonic cancer cells.

Hilar granule cells of the mouse dentate gyrus: effects of age, septotemporal location, strain, and selective deletion of the proapoptotic gene BAX.

Science.gov (United States)

Bermudez-Hernandez, Keria; Lu, Yi-Ling; Moretto, Jillian; Jain, Swati; LaFrancois, John J; Duffy, Aine M; Scharfman, Helen E

2017-09-01

The dentate gyrus (DG) principal cells are glutamatergic granule cells (GCs), and they are located in a compact cell layer. However, GCs are also present in the adjacent hilar region, but have been described in only a few studies. Therefore, we used the transcription factor prospero homeobox 1 (Prox1) to quantify GCs at postnatal day (PND) 16, 30, and 60 in a common mouse strain, C57BL/6J mice. At PND16, there was a large population of Prox1-immunoreactive (ir) hilar cells, with more in the septal than temporal hippocampus. At PND30 and 60, the size of the hilar Prox1-ir cell population was reduced. Similar numbers of hilar Prox1-expressing cells were observed in PND30 and 60 Swiss Webster mice. Prox1 is usually considered to be a marker of postmitotic GCs. However, many Prox1-ir hilar cells, especially at PND16, were not double-labeled with NeuN, a marker typically found in mature neurons. Most hilar Prox1-positive cells at PND16 co-expressed doublecortin (DCX) and calretinin, markers of immature GCs. Double-labeling with a marker of actively dividing cells, Ki67, was not detected. These results suggest that, surprisingly, a large population of cells in the hilus at PND16 are immature GCs (Type 2b and Type 3 cells). We also asked whether hilar Prox1-ir cell numbers are modifiable. To examine this issue, we conditionally deleted the proapoptotic gene BAX in Nestin-expressing cells at a time when there are numerous immature GCs in the hilus, PND2-8. When these mice were examined at PND60, the numbers of Prox1-ir hilar cells were significantly increased compared to control mice. However, deletion of BAX did not appear to change the proportion that co-expressed NeuN, suggesting that the size of the hilar Prox1-expressing population is modifiable. However, deleting BAX, a major developmental disruption, does not appear to change the proportion that ultimately becomes neurons.

[Autophagy-lysosome pathway in skeletal muscle of diabetic nephropathy rats and the effect of low-protein diet plus α-keto acids on it].

Science.gov (United States)

Huang, Juan; Yuan, Wei-jie; Wang, Jia-lin; Gu, Li-jie; Yin, Jun; Dong, Ting; Bao, Jin-fang; Tang, Zhi-huan

2013-11-26

To explore the regulation of autophagy-lysosome pathway (ALP) in skeletal muscle of diabetic nephropathy and examine the effect of low protein diet plus α-keto acid on ALP. A total of 45 24-week-old Goto-Kakizaki rats were randomized to receive normal protein (22%) diet (NPD), low-protein (6%) diet (LPD) or low-protein (5%) plus α-keto acids (1%) diet (Keto) (n = 15 each). Wistar control rats had a normal protein diet. The mRNA and protein levels of ALP markers LC3B, Bnip3, Cathepsin L in soleus muscle were evaluated at 48 weeks. Electron microscopy was used to confirm the changes of autophagy. Compared with CTL group, the mRNA levels of LC3B, Bnip3, Cathepsin L in soleus muscle of rats on NPD were higher, and protein levels of LC3B-I, LC3B-II, Bnip3, Cathepsin L in soleus muscle of rats on NPD also higher than CTL group (0.82 ± 0.33 vs 0.25 ± 0.07, 0.76 ± 0.38 vs 0.20 ± 0.12, 1.25 ± 0.30 vs 0.56 ± 0.19, 1.29 ± 0.40 vs 0.69 ± 0.20). The mRNA levels of LC3B, Bnip3 and Cathepsin L in LPD group were slightly lower, compared with NPD group. However there was no statistical significance. Similarly the protein levels of LC3B-I, LC3B-II, Bnip3 and Cathepsin L in LPD group were slightly lower with no statistical significance. In contrast, the mRNA levels of LC3B, Bnip3 and Cathepsin L were greatly lower in Keto group in comparison with NPD and LPD. And protein levels of LC3B-I, LC3B-II, Bnip3 and Cathepsin L were also greatly lower in Keto group in comparison with NPD and LPD. Additionally, autophagosome or auto-lysosome was found in NPD and LPD groups by electron microscopy. ALP is activated in skeletal muscle of diabetic nephropathy rats. And low protein plus α-keto acid decrease the activation of ALP and improve muscle wasting.

Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.

Science.gov (United States)

Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke

2011-11-01

Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.

A supermolecular curcumin for enhanced antiproliferative and proapoptotic activities: molecular characteristics, computer modeling and in vivo pharmacokinetics

International Nuclear Information System (INIS)

Tan Qunyou; Wu Jianyong; Li Yi; Zhang Jingqing; Mei Hu; Zhao Chunjing

2013-01-01

The supermolecular curcumin (SMCCM) exhibiting remarkably improved solubility and release characteristics was fabricated to increase the oral bioavailability in rat as well as the antiproliferative and proapoptotic activities of curcumin (CCM) against human lung adenocarcinoma cell A549. SMCCM was characterized by differential scanning calorimetry, Fourier transform infrared spectroscopy, morphology and structure, aqueous solubility, and release behavior in vitro. Computer modeling of the supermolecular structure was performed. The pharmacokinetics, antiproliferative and proapoptotic activities of SMCCM were evaluated. The mechanisms by which SMCCM inhibited proliferation and induced apoptosis were identified. The formation of SMCCM was testified and the supermolecular structure was studied by a computer modeling technique. Compared to free CCM, SMCCM with much higher aqueous solubility exhibited obviously enhanced release and more favorable pharmacokinetic profiles, and, furthermore, SMCCM showed higher anticancer efficacy, enhanced induction of G2/M-phase arrest and apoptosis in A549 cells, which might be involved with the increases in reactive oxygen species production and intracellular Ca 2+ accumulation, and a decrease in mitochondrial membrane potential. SMCCM remarkably enhanced not only the oral bioavailability but also the antiproliferative and proapoptotic activities of CCM along with improved solubility and release characteristics of CCM. (paper)

A supermolecular curcumin for enhanced antiproliferative and proapoptotic activities: molecular characteristics, computer modeling and in vivo pharmacokinetics

Science.gov (United States)

Tan, Qunyou; Wu, Jianyong; Li, Yi; Mei, Hu; Zhao, Chunjing; Zhang, Jingqing

2013-01-01

The supermolecular curcumin (SMCCM) exhibiting remarkably improved solubility and release characteristics was fabricated to increase the oral bioavailability in rat as well as the antiproliferative and proapoptotic activities of curcumin (CCM) against human lung adenocarcinoma cell A549. SMCCM was characterized by differential scanning calorimetry, Fourier transform infrared spectroscopy, morphology and structure, aqueous solubility, and release behavior in vitro. Computer modeling of the supermolecular structure was performed. The pharmacokinetics, antiproliferative and proapoptotic activities of SMCCM were evaluated. The mechanisms by which SMCCM inhibited proliferation and induced apoptosis were identified. The formation of SMCCM was testified and the supermolecular structure was studied by a computer modeling technique. Compared to free CCM, SMCCM with much higher aqueous solubility exhibited obviously enhanced release and more favorable pharmacokinetic profiles, and, furthermore, SMCCM showed higher anticancer efficacy, enhanced induction of G2/M-phase arrest and apoptosis in A549 cells, which might be involved with the increases in reactive oxygen species production and intracellular Ca2+ accumulation, and a decrease in mitochondrial membrane potential. SMCCM remarkably enhanced not only the oral bioavailability but also the antiproliferative and proapoptotic activities of CCM along with improved solubility and release characteristics of CCM.

Combined effects of EGFR tyrosine kinase inhibitors and vATPase inhibitors in NSCLC cells

Energy Technology Data Exchange (ETDEWEB)

Jin, Hyeon-Ok [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Hong, Sung-Eun [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Kim, Chang Soon [Department of Microbiological Engineering, Kon-Kuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul, 143–701 (Korea, Republic of); Park, Jin-Ah; Kim, Jin-Hee; Kim, Ji-Young; Kim, Bora [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Chang, Yoon Hwan; Hong, Seok-Il; Hong, Young Jun [Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Park, In-Chul, E-mail: parkic@kirams.re.kr [Division of Radiation Cancer Research, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Lee, Jin Kyung, E-mail: jklee@kirams.re.kr [KIRAMS Radiation Biobank, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of); Department of Laboratory Medicine, Korea Cancer Center Hospital, Korea Institute of Radiological and Medical Sciences, 75 Nowon-ro, Nowon-gu, Seoul, 139–706 (Korea, Republic of)

2015-08-15

Despite excellent initial clinical responses of non-small cell lung cancer (NSCLC) patients to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs), many patients eventually develop resistance. According to a recent report, vacuolar H + ATPase (vATPase) is overexpressed and is associated with chemotherapy drug resistance in NSCLC. We investigated the combined effects of EGFR TKIs and vATPase inhibitors and their underlying mechanisms in the regulation of NSCLC cell death. We found that combined treatment with EGFR TKIs (erlotinib, gefitinib, or lapatinib) and vATPase inhibitors (bafilomycin A1 or concanamycin A) enhanced synergistic cell death compared to treatments with each drug alone. Treatment with bafilomycin A1 or concanamycin A led to the induction of Bnip3 expression in an Hif-1α dependent manner. Knock-down of Hif-1α or Bnip3 by siRNA further enhanced cell death induced by bafilomycin A1, suggesting that Hif-1α/Bnip3 induction promoted resistance to cell death induced by the vATPase inhibitors. EGFR TKIs suppressed Hif-1α and Bnip3 expression induced by the vATPase inhibitors, suggesting that they enhanced the sensitivity of the cells to these inhibitors by decreasing Hif-1α/Bnip3 expression. Taken together, we conclude that EGFR TKIs enhance the sensitivity of NSCLC cells to vATPase inhibitors by decreasing Hif-1α/Bnip3 expression. We suggest that combined treatment with EGFR TKIs and vATPase inhibitors is potentially effective for the treatment of NSCLC. - Highlights: • Co-treatment with EGFR TKIs and vATPase inhibitors induces synergistic cell death • EGFR TKIs enhance cell sensitivity to vATPase inhibitors via Hif-1α downregulation • Co-treatment of these inhibitors is potentially effective for the treatment of NSCLC.

Evidence of galectin-1 involvement in glioma chemoresistance

International Nuclear Information System (INIS)

Le Mercier, Marie; Lefranc, Florence; Mijatovic, Tatjana; Debeir, Olivier; Haibe-Kains, Benjamin; Bontempi, Gianluca; Decaestecker, Christine; Kiss, Robert; Mathieu, Veronique

2008-01-01

Glioblastomas (GBMs) are resistant to apoptosis but less so to autophagy; a fact that may at least partly explain the therapeutic benefits of the pro-autophagic drug temozolomide in the treatment of GBM patients. Galectin-1 (Gal1) whose expression is stimulated by hypoxia is a potent modulator of GBM cell migration and a pro-angiogenic molecule. Hypoxia is also known to confer cancer cells with resistance to chemotherapy and radiotherapy and to modulate the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. The present study investigates whether decreasing Gal1 expression (by means of a siRNA approach) in human Hs683 GBM cells increases their sensitivity to pro-autophagic or pro-apoptotic drugs. The data reveal that temozolomide, the standard treatment for glioma patients, increases Gal1 expression in Hs683 cells both in vitro and in vivo. However, reducing Gal1 expression in these cells by siRNA increases the anti-tumor effects of various chemotherapeutic agents, in particular temozolomide both in vitro and in vivo. This decrease in Gal1 expression in Hs683 cells does not induce apoptotic or autophagic features, but is found to modulate p53 transcriptional activity and decrease p53-targeted gene expression including DDIT3/GADD153/CHOP, DUSP5 ATF3 and GADD45A. The decrease in Gal1 expression also impairs the expression levels of seven other genes implicated in chemoresistance: ORP150, HERP, GRP78/Bip, TRA1, BNIP3L, GADD45B and CYR61, some of which are located in the ER and whose expression is also known to be modified by hypoxia. This novel facet of Gal1 involvement in glioblastoma biology may be amenable to therapeutic manipulation

Cholesterol and phytosterols differentially regulate the expression of caveolin 1 and a downstream prostate cell growth-suppressor gene

Science.gov (United States)

Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.

2010-01-01

Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling

AMP-activated protein kinase couples 3-bromopyruvate-induced energy depletion to apoptosis via activation of FoxO3a and upregulation of proapoptotic Bcl-2 proteins.

Science.gov (United States)

Bodur, Cagri; Karakas, Bahriye; Timucin, Ahmet Can; Tezil, Tugsan; Basaga, Huveyda

2016-11-01

Most tumors primarily rely on glycolysis rather than mitochondrial respiration for ATP production. This phenomenon, also known as Warburg effect, renders tumors more sensitive to glycolytic disturbances compared to normal cells. 3-bromopyruvate is a potent inhibitor of glycolysis that shows promise as an anticancer drug candidate. Although investigations revealed that 3-BP triggers apoptosis through ATP depletion and subsequent AMPK activation, the underlying molecular mechanisms coupling AMPK to apoptosis are poorly understood. We showed that 3-BP leads to a rapid ATP depletion which was followed by growth inhibition and Bax-dependent apoptosis in HCT116 cells. Apoptosis was accompanied with activation of caspase-9 and -3 while pretreatment with a general caspase inhibitor attenuated cell death. AMPK, p38, JNK, and Akt were phosphorylated immediately upon treatment. Pharmacological inhibition and silencing of AMPK largely inhibited 3-BP-induced apoptosis and reversed phosphorylation of JNK. Transcriptional activity of FoxO3a was dramatically increased subsequent to AMPK-mediated phosphorylation of FoxO3a at Ser413. Cell death analysis of cells transiently transfected with wt or AMPK-phosphorylation-deficient FoxO3 expression plasmids verified the contributory role of AMPK-FoxO3a axis in 3-BP-induced apoptosis. In addition, expression of proapoptotic Bcl-2 proteins Bim and Bax were upregulated in an AMPK-dependent manner. Bim was transcriptionally activated in association with FoxO3a activity, while Bax upregulation was abolished in p53-null cells. Together, these data suggest that AMPK couples 3-BP-induced metabolic disruption to intrinsic apoptosis via modulation of FoxO3a-Bim axis and Bax expression. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

IFNB1/interferon-ß-induced autophagy in MCF-7 breast cancer cells counteracts its proapoptotic function

DEFF Research Database (Denmark)

Ambjørn, Malene; Ejlerskov, Patrick; Liu, Yawei

2013-01-01

IFNB1/interferon (IFN)-ß belongs to the type I IFNs and exerts potent antiproliferative, proapoptotic, antiangiogenic and immunemodulatory functions. Despite the beneficial effects of IFNB1 in experimental breast cancers, clinical translation has been disappointing, possibly due to induction of s...

Kaempferol increases apoptosis in human acute promyelocytic leukemia cells and inhibits multidrug resistance genes.

Science.gov (United States)

Moradzadeh, Maliheh; Tabarraei, Alijan; Sadeghnia, Hamid Reza; Ghorbani, Ahmad; Mohamadkhani, Ashraf; Erfanian, Saiedeh; Sahebkar, Amirhossein

2018-02-01

Acute promyelocytic leukemia (APL) is one of the most life-threatening hematological malignancies. Defects in the cell growth and apoptotic pathways are responsible for both disease pathogenesis and treatment resistance. Therefore, pro-apoptotic agents are potential candidates for APL treatment. Kaempferol is a flavonoid with antioxidant and anti-tumor properties. This study was designed to investigate the cytotoxic, pro-apoptotic, and differentiation-inducing effects of kaempferol on HL-60 and NB4 leukemia cells. Resazurin assay was used to determine cell viability following treatment with kaempferol (12.5-100 μM) and all-trans retinoic acid (ATRA; 10 μM; used as a positive control). Apoptosis and differentiation were also detected using propidium iodide and NBT staining techniques, respectively. Furthermore, the expression levels of genes involved in apoptosis (PI3 K, AKT, BCL2, BAX, p53, p21, PTEN, CASP3, CASP8, and CASP9), differentiation (PML-RAR and HDAC1), and multi-drug resistance (ABCB1 and ABCC1) were determined using quantitative real-time PCR. The protein expressions of Bax/Bcl2 and casp3 were confirmed using Western blot. The results showed that kaempferol decreased cell viability and increased subG1 population in the tested leukemic cells. This effect was associated with decreased expression of Akt, BCL2, ABCB1, and ABCC1 genes, while the expression of CASP3 and BAX/BCL-2 ratio were significantly increased at both gene and protein levels. Kaempferol promoted apoptosis and inhibited multidrug resistance in a concentration-dependent manner, without any differential effect on leukemic cells. In conclusion, this study suggested that kaempferol may be utilized as an appropriate alternative for ATRA in APL patients. © 2017 Wiley Periodicals, Inc.

The chemopreventive action of bromelain, from pineapple stem (Ananas comosus L.), on colon carcinogenesis is related to antiproliferative and proapoptotic effects.

Science.gov (United States)

Romano, Barbara; Fasolino, Ines; Pagano, Ester; Capasso, Raffaele; Pace, Simona; De Rosa, Giuseppe; Milic, Natasa; Orlando, Pierangelo; Izzo, Angelo A; Borrelli, Francesca

2014-03-01

Colorectal cancer is an important health problem across the world. Here, we investigated the possible antiproliferative/proapoptotic effects of bromelain (from the pineapple stem Ananas comosus L., family Bromeliaceae) in a human colorectal carcinoma cell line and its potential chemopreventive effect in a murine model of colon cancer. Proliferation and apoptosis were evaluated in human colon adenocarcinoma (Caco-2) cells by the (3) H-thymidine incorporation assay and caspase 3/7 activity measurement, respectively. Extracellular signal-related kinase (ERK) and Akt expression were evaluated by Western blot analysis, reactive oxygen species production by a fluorimetric method. In vivo, bromelain was evaluated using the azoxymethane murine model of colon carcinogenesis. Bromelain reduced cell proliferation and promoted apoptosis in Caco-2 cells. The effect of bromelain was associated to downregulation of pERK1/2/total, ERK, and pAkt/Akt expression as well as to reduction of reactive oxygen species production. In vivo, bromelain reduced the development of aberrant crypt foci, polyps, and tumors induced by azoxymethane. Bromelain exerts antiproliferative and proapoptotic effects in colorectal carcinoma cells and chemopreventive actions in colon carcinogenesis in vivo. Bromelain-containing foods and/or bromelain itself may represent good candidates for colorectal cancer chemoprevention. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

Energy Technology Data Exchange (ETDEWEB)

Wu, Dan, E-mail: danw@bjmu.edu.cn [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Liu, Jing; Wu, Baiyan [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Tu, Bo; Zhu, Weiguo [Department of Biochemistry and Molecular Biology, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Luo, Jianyuan, E-mail: jluo@som.umaryland.edu [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Department of Medical and Research Technology, School of Medicine, University of Maryland, Baltimore 21201 (United States)

2014-04-25

Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration.

The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

International Nuclear Information System (INIS)

Wu, Dan; Liu, Jing; Wu, Baiyan; Tu, Bo; Zhu, Weiguo; Luo, Jianyuan

2014-01-01

Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration

Chronic social isolation suppresses proplastic response and promotes proapoptotic signalling in prefrontal cortex of Wistar rats.

Science.gov (United States)

Djordjevic, Ana; Adzic, Miroslav; Djordjevic, Jelena; Radojcic, Marija B

2010-08-15

Successful adaptation to stress involves synergized actions of glucocorticoids and catecholamines at several levels of the CNS, including the prefrontal cortex (PFC). Inside the PFC, hormonal signals trigger concerted actions of transcriptional factors, such as glucocorticoid receptor (GR) and nuclear factor kappa B (NFkappaB), culminating in a balanced, proadaptive expression of their common genes, such as proplastic NCAM and/or apoptotic Bax and Bcl-2. In the present study, we hypothesized that chronic stress may compromise the balance between GR and NFkappaB signals and lead to an altered/maladaptive expression of their cognate genes in the PFC. Our results obtained with Wistar rats exposed to chronic social isolation indicated alterations of the GR relative to the NFkappaB, in favor of the GR, in both the cytoplasmic and the nuclear compartments of the PFC. Although these alterations did not affect the induction of proplastic NCAM gene, they decreased the NCAM sialylation necessary for plastic response and caused marked relocation of the mitochondrial membrane antiapoptotic Bcl-2 protein to its cytoplasmic form. Moreover, the compromised PSA-NCAM plastic response found under chronic stress was sustained after exposure of animals to the subsequent acute stress, whereas the proapoptotic signals were further emphasized. It is concluded that chronic social isolation of Wistar animals leads to a maladaptive response of the PFC, considering the diminishment of its plastic potential and potentiating of apoptosis. Such conditions in the PFC are likely to compromise its ability to interact with other CNS structures, such as the hippocampus, which is necessary for successful adaptation to stress. (c) 2010 Wiley-Liss, Inc.

Modulation of Apoptosis Pathways by Oxidative Stress and Autophagy in β Cells

Directory of Open Access Journals (Sweden)

Maorong Wang

2012-01-01

Full Text Available Human islets isolated for transplantation are exposed to multiple stresses including oxidative stress and hypoxia resulting in significant loss of functional β cell mass. In this study we examined the modulation of apoptosis pathway genes in islets exposed to hydrogen peroxide, peroxynitrite, hypoxia, and cytokines. We observed parallel induction of pro- and antiapoptotic pathways and identified several novel genes including BFAR, CARD8, BNIP3, and CIDE-A. As BNIP3 is an inducer of autophagy, we examined this pathway in MIN6 cells, a mouse beta cell line and in human islets. Culture of MIN6 cells under low serum conditions increased the levels of several proteins in autophagy pathway, including ATG4, Beclin 1, LAMP-2, and UVRAG. Amino acid deprivation led to induction of autophagy in human islets. Preconditioning of islets with inducers of autophagy protected them from hypoxia-induced apoptosis. However, induction of autophagy during hypoxia exacerbated apoptotic cell death. ER stress led to induction of autophagy and apoptosis in β cells. Overexpression of MnSOD, an enzyme that scavenges free radicals, resulted in protection of MIN6 cells from cytokine-induced apoptosis. Ceramide, a mediator of cytokine-induced injury, reduced the active phosphorylated form of Akt and downregulated the promoter activity of the antiapoptotic gene bcl-2. Furthermore, cytokine-stimulated JNK pathway downregulated the bcl-2 promoter activity which was reversed by preincubation with SP600125, a JNK inhibitor. Our findings suggest that β cell apoptosis by multiple stresses in islets isolated for transplantation is the result of orchestrated gene expression in apoptosis pathway.

Association of Pro-apoptotic Bad Gene Expression Changes with Benign Thyroid Nodules.

Science.gov (United States)

Gül, Nurdan; Temel, Berna; Ustek, Duran; Sirma-Ekmekçi, Sema; Kapran, Yersu; Tunca, Fatih; Giles-Şenyürek, Yasemin; Özbek, Uğur; Alagöl, Faruk

2018-01-01

This study aimed to investigate the role of the mitochondrial apoptotic pathway in benign thyroid nodules. Paired samples of nodular and normal tissues were collected from 26 patients with nodular goiters undergoing thyroidectomy. Variable expression of Bcl-2, Bax and Bad genes were evaluated by quantitative PCR. Expression level of Bad gene in nodules was found to be significantly decreased compared to normal tissues (p=0.049). A positive correlation was observed between nodule size and Bad expression levels (correlation coefficient=0.563, p=0.004); and this correlation was stronger in hot nodules (n=18, correlation coefficient=0.689, p=0.003). No significant difference was observed between nodular and normal tissue expressions of Bax and Bcl-2. These results suggest that Bad expression correlates with the size of benign thyroid nodules and also its relatively lower expression in nodules, warrant further investigation. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Synthesis and Proapoptotic Activity on Cervical Cancer Cell of Ester Eugenol 1-(3-Methoxy-4-hydroxy)phenyl-2-propylmethanoate

Science.gov (United States)

Farid Rahman, Moh.; Nazhif Haykal, Muhammad; Andriani Siagian, Novi; Maiselina Sriepindonnta, Priscilla; Tampubolon, Norman Alexander

2018-01-01

Proapoptotic activity of ester eugenol,1-(3-methoxy-4-hydroxy)phenyl-2-propylmethanoat, which synthesized from eugenol is reported. Eugenol as starting material in the synthesis of ester eugenol was obtained from fractional distillation of clove oil with the yield of 70.66%. Synthesis of ester eugenol was camed out by addition-esterification reaction through reaction between eugenol and formic acid with mol ratio of 1:27 and reaction time for11 h. GC-MS analysis showed ester eugenol was afforded purity of 92.42% and the yield in of 93.34%. UV spectra of ester eugenol was observed the formation of carbonyl group at λmax 290 nm and supported by FT-IR analysis at 1714.60 cm-1 (carbonyl group), 1193.65 cm-1 (C-O-C ester group) and the absence of vynil group in eugenol structure at region 914.20 and 995.20 cm-1. Mass spectra showed ion molecule at m/z 210 was accordance with molecular weight of ester eugenol. Afterward, HeLa cell culture media was prepared for cervical cancer antiproliferative test. The result which showed in histogram indicated that LC50 of ester eugenol was reached at concentration below 0.01% while eugenol was up to 0.01% that observed cervical cancer cell apoptotic activity. LC50 value of ester eugenol was obtained at concentration 48.73 ppm. This research reported that natural product modified its structure has potency to cure cervical cancer.

Immune-mediated beta-cell destruction in vitro and in vivo-A pivotal role for galectin-3

DEFF Research Database (Denmark)

Karlsen, Allan E; Størling, Zenia M; Sparre, Thomas

2006-01-01

Pro-apoptotic cytokines are toxic to the pancreatic beta-cells and have been associated with the pathogenesis of Type 1 diabetes (T1D). Proteome analysis of IL-1beta exposed isolated rat islets identified galectin-3 (gal-3) as the most up-regulated protein. Here analysis of human and rat islets a....... In summary, combined proteome-transcriptome-genome and functional analyses identify gal-3 as a candidate gene/protein in T1D susceptibility that may prove valuable in future intervention/prevention strategies....

Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

Directory of Open Access Journals (Sweden)

Zodwa Dlamini

2015-11-01

Full Text Available Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets.

Phylogenetic and Molecular Evolutionary Analysis of Mitophagy Receptors under Hypoxic Conditions

Directory of Open Access Journals (Sweden)

Xiaomei Wu

2017-07-01

Full Text Available As animals evolved to use oxygen as the main strategy to produce ATP through the process of mitochondrial oxidative phosphorylation, the ability to adapt to fluctuating oxygen concentrations is a crucial component of evolutionary pressure. Three mitophagy receptors, FUNDC1, BNIP3 and NIX, induce the removal of dysfunctional mitochondria (mitophagy under prolonged hypoxic conditions in mammalian cells, to maintain oxygen homeostasis and prevent cell death. However, the evolutionary origins and structure-function relationships of these receptors remain poorly understood. Here, we found that FUN14 domain-containing proteins are present in archaeal, bacterial and eukaryotic genomes, while the family of BNIP3 domain-containing proteins evolved from early animals. We investigated conservation patterns of the critical amino acid residues of the human mitophagy receptors. These residues are involved in receptor regulation, mainly through phosphorylation, and in interaction with LC3 on the phagophore. Whereas FUNDC1 may be able to bind to LC3 under the control of post-translational regulations during the early evolution of vertebrates, BINP3 and NIX had already gained the ability for LC3 binding in early invertebrates. Moreover, FUNDC1 and BNIP3 each lack a layer of phosphorylation regulation in fishes that is conserved in land vertebrates. Molecular evolutionary analysis revealed that BNIP3 and NIX, as the targets of oxygen sensing HIF-1α, showed higher rates of substitution in fishes than in mammals. Conversely, FUNDC1 and its regulator MARCH5 showed higher rates of substitution in mammals. Thus, we postulate that the structural traces of mitophagy receptors in land vertebrates and fishes may reflect the process of vertebrate transition from water onto land, during which the changes in atmospheric oxygen concentrations acted as a selection force in vertebrate evolution. In conclusion, our study, combined with previous experimental results, shows that

Triterpenoidal saponins from the fruits of Gleditsia caspica with proapoptotic properties.

Science.gov (United States)

Shaheen, Usama; Ragab, Ehab A; Abdalla, Ashraf N; Bader, Ammar

2018-01-01

Three previously undescribed oleanane-type triterpenoidal saponins named caspicaosides L-N were isolated from the fruits of Gleditsia caspica Desf. The aglycons of these saponins were echinocystic acid, erythrodiol and 12-oleanene-3,28,30-triol. Caspicaoside L is a bisdesmosidic saponin acylated with two monoterpenic acids. It has a disaccharide moiety made up of glucose and arabinose attached to C-3 and pentasaccharide moiety linked to C-28 made up of one glucose, 2 xyloses, one inner rhamnose and one terminal rhamnose which was acylated with two identical monoterpenic acids. Caspicaoside M is a monodesmosidic saponin with a trisaccharide moiety at C-3 made up of glucose, xylose and arabinose, while caspicaoside N has a disaccharide moiety at C-3 made up of glucose and arabinose. Their structures were determined by extensive 1D and 2D (DQF-COSY, HSQC, TOCSY, 1 H- 13 C-HSQC-TOCSY, HMBC, ROESY, NOESY) NMR, HRESIMS analyses and chemical degradation. The cytotoxicity MTT-based assay showed that caspicaosides M, N and L, respectively, exhibited high cytotoxic activity with IC 50  ≤ 10 μM (72 h) at least against one of the three used cancer cell lines, MCF 7, A2780 and HT 29; and were 2-34 folds selective against the normal fibroblasts (MRC 5). All compounds also induced apoptosis and caused G 2 /M arrest in MCF 7 cells (24 h); thus showing pro-apoptotic properties. Copyright © 2017 Elsevier Ltd. All rights reserved.

LncRNA TUG1 serves an important role in hypoxia-induced myocardial cell injury by regulating the miR-145-5p-Binp3 axis

Science.gov (United States)

Wu, Zhongwei; Zhao, Shengji; Li, Chunfu; Liu, Chaoquan

2018-01-01

The aim of the present study was to investigate the function of long non-coding RNA TUG1 in hypoxia-induced myocardial cell injury and to explore the potential molecular mechanisms. The cardiomyocyte cell line H9c2 was cultured under hypoxic and normoxic conditions. TUG1 expression under hypoxic conditions was then detected. The effects of TUG1 overexpression on viability, apoptosis, migration and invasion were assayed. In addition, the microRNA (miR)-145-5p expression was detected. Following H9c2 cell transfection with miR-145-5p mimics, the H9c2 cell viability, apoptosis, migration and invasion were also detected. Additionally, the target gene of miR-145-5p was assayed by Luciferase reporter assay. The protein expressions of Wnt-3a, Wnt5a, and β-catenin in H9c2 cells under hypoxic conditions were also determined. The results revealed that hypoxia induced injury in H9c2 cells, including inhibiting cell viability, migration and invasion, and promoting cell apoptosis. Overexpression of TUG1 aggravated hypoxia-induced injury in H9c2 cells. In addition, miR-145-5p was negatively regulated by TUG1, and TUG1 overexpression aggravated hypoxia-induced injury via the downregulation of miR-145-5p. Furthermore, B-cell lymphoma 2 interacting protein 3 (Bnip3) was a target of miR-145-5p, and overexpression of Bnip3 aggravated hypoxia-induced cell injury by activating Wnt/β-catenin signaling pathways in H9c2 cells. In conclusion, overexpression of TUG1 aggravated hypoxia-induced injury in cardiomyocytes by regulating the miR-145-5p-Binp3 axis. Activation of the Wnt/β-catenin signaling pathway may be a key mechanism to mediate the role of TUG1 in regulating hypoxia-induced myocardial injury. TUG1 may be an effective diagnostic marker and therapeutic target for myocardial ischemia. PMID:29207102

LncRNA TUG1 serves an important role in hypoxia-induced myocardial cell injury by regulating the miR‑145‑5p‑Binp3 axis.

Science.gov (United States)

Wu, Zhongwei; Zhao, Shengji; Li, Chunfu; Liu, Chaoquan

2018-02-01

The aim of the present study was to investigate the function of long non‑coding RNA TUG1 in hypoxia‑induced myocardial cell injury and to explore the potential molecular mechanisms. The cardiomyocyte cell line H9c2 was cultured under hypoxic and normoxic conditions. TUG1 expression under hypoxic conditions was then detected. The effects of TUG1 overexpression on viability, apoptosis, migration and invasion were assayed. In addition, the microRNA (miR)‑145‑5p expression was detected. Following H9c2 cell transfection with miR‑145‑5p mimics, the H9c2 cell viability, apoptosis, migration and invasion were also detected. Additionally, the target gene of miR‑145‑5p was assayed by Luciferase reporter assay. The protein expressions of Wnt‑3a, Wnt5a, and β‑catenin in H9c2 cells under hypoxic conditions were also determined. The results revealed that hypoxia induced injury in H9c2 cells, including inhibiting cell viability, migration and invasion, and promoting cell apoptosis. Overexpression of TUG1 aggravated hypoxia‑induced injury in H9c2 cells. In addition, miR‑145‑5p was negatively regulated by TUG1, and TUG1 overexpression aggravated hypoxia‑induced injury via the downregulation of miR‑145‑5p. Furthermore, B‑cell lymphoma 2 interacting protein 3 (Bnip3) was a target of miR‑145‑5p, and overexpression of Bnip3 aggravated hypoxia‑induced cell injury by activating Wnt/β‑catenin signaling pathways in H9c2 cells. In conclusion, overexpression of TUG1 aggravated hypoxia‑induced injury in cardiomyocytes by regulating the miR‑145‑5p‑Binp3 axis. Activation of the Wnt/β‑catenin signaling pathway may be a key mechanism to mediate the role of TUG1 in regulating hypoxia‑induced myocardial injury. TUG1 may be an effective diagnostic marker and therapeutic target for myocardial ischemia.

Altered gene expression in blood and sputum in COPD frequent exacerbators in the ECLIPSE cohort.

Directory of Open Access Journals (Sweden)

Dave Singh

Full Text Available Patients with chronic obstructive pulmonary disease (COPD who are defined as frequent exacerbators suffer with 2 or more exacerbations every year. The molecular mechanisms responsible for this phenotype are poorly understood. We investigated gene expression profile patterns associated with frequent exacerbations in sputum and blood cells in a well-characterised cohort. Samples from subjects from the ECLIPSE COPD cohort were used; sputum and blood samples from 138 subjects were used for microarray gene expression analysis, while blood samples from 438 subjects were used for polymerase chain reaction (PCR testing. Using microarray, 150 genes were differentially expressed in blood (>±1.5 fold change, p≤0.01 between frequent compared to non-exacerbators. In sputum cells, only 6 genes were differentially expressed. The differentially regulated genes in blood included downregulation of those involved in lymphocyte signalling and upregulation of pro-apoptotic signalling genes. Multivariate analysis of the microarray data followed by confirmatory PCR analysis identified 3 genes that predicted frequent exacerbations; B3GNT, LAF4 and ARHGEF10. The sensitivity and specificity of these 3 genes to predict the frequent exacerbator phenotype was 88% and 33% respectively. There are alterations in systemic immune function associated with frequent exacerbations; down-regulation of lymphocyte function and a shift towards pro-apoptosis mechanisms are apparent in patients with frequent exacerbations.

Homozygous Deletions and Recurrent Amplifications Implicate New Genes Involved in Prostate Cancer

Directory of Open Access Journals (Sweden)

Wennuan Liu

2008-08-01

Full Text Available Prostate cancer cell lines provide ideal in vitro systems for the identification and analysis of prostate tumor suppressors and oncogenes. A detailed characterization of the architecture of prostate cancer cell line genomes would facilitate the study of precise roles of various genes in prostate tumorigenesis in general. To contribute to such a characterization, we used the GeneChip 500K single nucleotide polymorphic (SNP array for analysis of genotypes and relative DNA copy number changes across the genome of 11 cell lines derived from both normal and cancerous prostate tissues. For comparison purposes, we also examined the alterations observed in the cell lines in tumor/normal pairs of clinical samples from 72 patients. Along with genome-wide maps of DNA copy number changes and loss of heterozygosity for these cell lines, we report previously unreported homozygous deletions and recurrent amplifications in prostate cancers in this study. The homozygous deletions affected a number of biologically important genes, including PPP2R2A and BNIP3L identified in this study and CDKN2A/CDKN2B reported previously. Although most amplified genomic regions tended to be large, amplifications at 8q24.21 were of particular interest because the affected regions are relatively small, are found in multiple cell lines, are located near MYC, an oncogene strongly implicated in prostate tumorigenesis, and are known to harbor SNPs that are associated with inherited susceptibility for prostate cancer. The genomic alterations revealed in this study provide an important catalog of positional information relevant to efforts aimed at deciphering the molecular genetic basis of prostate cancer.

The MDM-2 Antagonist Nutlin-3 Promotes the Maturation of Acute Myeloid Leukemic Blasts

Directory of Open Access Journals (Sweden)

Paola Secchiero

2007-10-01

Full Text Available The small-molecule inhibitor of murine double minute (MDM-2, Nutlin-3, induced variable apoptosis in primary acute myeloid leukemia (AML blasts, promoted myeloid maturation of surviving cells, as demonstrated by analysis of CD11 b, CD14 surface antigens, by morphologic examination. Although the best-characterized activity of Nutlin-3 is activation of the p53 pathway, Nutlin-3 induced maturation also in one AML sample characterized by p53 deletion, as well as in the p53-/- human myeloblastic HL-60 cell line. At the molecular level, the maturational activity of Nutlin-3 in HL-60 cells was accompanied by the induction of E2F1 transcription factor, it was significantly counteracted by specific gene knockdown with small interfering RNA for E2F1. Moreover, Nutlin-3, as well as tumor necrosis factor (TNF α, potentiated the maturational activity of recombinant TNF-related apoptosis-inducing lig, (TRAIL in HL-60 cells. However, although TNF-α significantly counteracted the proapoptotic activity of TRAIL, Nutlin-3 did not interfere with the proapoptotic activity of TRAIL. Taken together, these data disclose a novel, potentially relevant therapeutic role for Nutlin-3 in the treatment of both p53 wild-type, p53-/- AML, possibly in association with recombinant TRAIL.

Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

Science.gov (United States)

Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

2012-01-01

During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

Stat1 activation attenuates IL-6 induced Stat3 activity but does not alter apoptosis sensitivity in multiple myeloma

Directory of Open Access Journals (Sweden)

Dimberg Lina Y

2012-07-01

Full Text Available Abstract Background Multiple myeloma (MM is at present an incurable malignancy, characterized by apoptosis-resistant tumor cells. Interferon (IFN treatment sensitizes MM cells to Fas-induced apoptosis and is associated with an increased activation of Signal transducer and activator of transcription (Stat1. The role of Stat1 in MM has not been elucidated, but Stat1 has in several studies been ascribed a pro-apoptotic role. Conversely, IL-6 induction of Stat3 is known to confer resistance to apoptosis in MM. Methods To delineate the role of Stat1 in IFN mediated sensitization to apoptosis, sub-lines of the U-266-1970 MM cell line with a stable expression of the active mutant Stat1C were utilized. The influence of Stat1C constitutive transcriptional activation on endogenous Stat3 expression and activation, and the expression of apoptosis-related genes were analyzed. To determine whether Stat1 alone would be an important determinant in sensitizing MM cells to apoptosis, the U-266-1970-Stat1C cell line and control cells were exposed to high throughput compound screening (HTS. Results To explore the role of Stat1 in IFN mediated apoptosis sensitization of MM, we established sublines of the MM cell line U-266-1970 constitutively expressing the active mutant Stat1C. We found that constitutive nuclear localization and transcriptional activity of Stat1 was associated with an attenuation of IL-6-induced Stat3 activation and up-regulation of mRNA for the pro-apoptotic Bcl-2 protein family genes Harakiri, the short form of Mcl-1 and Noxa. However, Stat1 activation alone was not sufficient to sensitize cells to Fas-induced apoptosis. In a screening of > 3000 compounds including bortezomib, dexamethasone, etoposide, suberoylanilide hydroxamic acid (SAHA, geldanamycin (17-AAG, doxorubicin and thalidomide, we found that the drug response and IC50 in cells constitutively expressing active Stat1 was mainly unaltered. Conclusion We conclude that Stat1 alters IL-6

Stat1 activation attenuates IL-6 induced Stat3 activity but does not alter apoptosis sensitivity in multiple myeloma

International Nuclear Information System (INIS)

Dimberg, Lina Y; Nilsson, Kenneth; Öberg, Fredrik; Wiklund, Helena Jernberg; Dimberg, Anna; Ivarsson, Karolina; Fryknäs, Mårten; Rickardson, Linda; Tobin, Gerard; Ekman, Simon; Larsson, Rolf; Gullberg, Urban

2012-01-01

Multiple myeloma (MM) is at present an incurable malignancy, characterized by apoptosis-resistant tumor cells. Interferon (IFN) treatment sensitizes MM cells to Fas-induced apoptosis and is associated with an increased activation of Signal transducer and activator of transcription (Stat)1. The role of Stat1 in MM has not been elucidated, but Stat1 has in several studies been ascribed a pro-apoptotic role. Conversely, IL-6 induction of Stat3 is known to confer resistance to apoptosis in MM. To delineate the role of Stat1 in IFN mediated sensitization to apoptosis, sub-lines of the U-266-1970 MM cell line with a stable expression of the active mutant Stat1C were utilized. The influence of Stat1C constitutive transcriptional activation on endogenous Stat3 expression and activation, and the expression of apoptosis-related genes were analyzed. To determine whether Stat1 alone would be an important determinant in sensitizing MM cells to apoptosis, the U-266-1970-Stat1C cell line and control cells were exposed to high throughput compound screening (HTS). To explore the role of Stat1 in IFN mediated apoptosis sensitization of MM, we established sublines of the MM cell line U-266-1970 constitutively expressing the active mutant Stat1C. We found that constitutive nuclear localization and transcriptional activity of Stat1 was associated with an attenuation of IL-6-induced Stat3 activation and up-regulation of mRNA for the pro-apoptotic Bcl-2 protein family genes Harakiri, the short form of Mcl-1 and Noxa. However, Stat1 activation alone was not sufficient to sensitize cells to Fas-induced apoptosis. In a screening of > 3000 compounds including bortezomib, dexamethasone, etoposide, suberoylanilide hydroxamic acid (SAHA), geldanamycin (17-AAG), doxorubicin and thalidomide, we found that the drug response and IC50 in cells constitutively expressing active Stat1 was mainly unaltered. We conclude that Stat1 alters IL-6 induced Stat3 activity and the expression of pro-apoptotic

Inhibition of Hepatocarcinogenesis by ArtinM via Anti-proliferative and Pro-apoptotic Mechanisms.

Science.gov (United States)

Braz, Mariana M; Roque-Barreira, Maria Cristina; Ramalho, Fernando S; Oliveira, Carlos A; Augusto, Marlei J; Ramalho, Leandra N Z

ArtinM is a d-mannose-binding lectin found in the seeds of Artocarpus heterophyllus (jackfruit) that interacts with N-glycans, that is associated with receptors on the surface of phagocytic cells and induces the production of inflammatory mediators. Some of them are especially important because they may be required for antitumor immune response. This study aimed to evaluate the effect of ArtinM on hepatocellular preneoplastic foci. Wistar rats received 50 mg/kg of diethyl-nitrosamine (DEN) intraperitoneal weekly for 12 weeks. From the 14th week, the treated animals received 50 μg/kg of ArtinM subcutaneous every 2 weeks until the 18th week, whereas control animals were injected with vehicle alone. Preneoplastic-related factors were estimated using histological, western blotting and RT-PCR analysis. In comparison to the groups exposed to DEN, the ArtinM-treated rats showed diminution of preneoplastic foci, decreased expression of proliferating cell nuclear antigen (PCNA), increased number of nuclear p21 and p27 stained cells, augmented number of apoptotic cells, increased expression of p53, p42/44 MAPK and p21 proteins, reduced cyclin D1 (CCND1) protein levels and increased expression of TNFα and IFNγ genes. No difference was observed in interleukin 12 (IL12) protein levels. These findings indicate that ArtinM may provide protection against hepatocarcinogenesis as a result of the induction of cell-cycle blockage and pro-apoptotic mechanisms. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Low-Dose Radiation Induces Genes Promoting Cell Survival

International Nuclear Information System (INIS)

Liu, Shu-Zheng; Chen, Dong; Mu, Ying

1999-01-01

Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

Minor cell-death defects but reduced tumor latency in mice lacking the BH3-only proteins Bad and Bmf.

Science.gov (United States)

Baumgartner, F; Woess, C; Pedit, V; Tzankov, A; Labi, V; Villunger, A

2013-01-31

Proapoptotic Bcl-2 family members of the Bcl-2 homology (BH)3-only subgroup are critical for the establishment and maintenance of tissue homeostasis and can mediate apoptotic cell death in response to developmental cues or exogenously induced forms of cell stress. On the basis of the biochemical experiments as well as genetic studies in mice, the BH3-only proteins Bad and Bmf have been implicated in different proapoptotic events such as those triggered by glucose- or trophic factor-deprivation, glucocorticoids, or histone deacetylase inhibition, as well as suppression of B-cell lymphomagenesis upon aberrant expression of c-Myc. To address possible redundancies in cell death regulation and tumor suppression, we generated compound mutant mice lacking both genes. Our studies revealed lack of redundancy in most paradigms of lymphocyte apoptosis tested in tissue culture. Only spontaneous cell death of thymocytes kept in low glucose or that of pre-B cells deprived of cytokines was significantly delayed when both genes were lacking. Of note, despite these minor apoptosis defects we observed compromised lymphocyte homeostasis in vivo that affected mainly the B-cell lineage. Long-term follow-up revealed significantly reduced latency to spontaneous tumor formation in aged mice when both genes were lacking. Together our study suggests that Bad and Bmf co-regulate lymphocyte homeostasis and limit spontaneous transformation by mechanisms that may not exclusively be linked to the induction of lymphocyte apoptosis.

CEBPA exerts a specific and biologically important proapoptotic role in pancreatic β cells through its downstream network targets

Science.gov (United States)

Barbagallo, Davide; Condorelli, Angelo Giuseppe; Piro, Salvatore; Parrinello, Nunziatina; Fløyel, Tina; Ragusa, Marco; Rabuazzo, Agata Maria; Størling, Joachim; Purrello, Francesco; Di Pietro, Cinzia; Purrello, Michele

2014-01-01

Transcription factor CEBPA has been widely studied for its involvement in hematopoietic cell differentiation and causal role in hematological malignancies. We demonstrate here that it also performs a causal role in cytokine-induced apoptosis of pancreas β cells. Treatment of two mouse pancreatic α and β cell lines (αTC1-6 and βTC1) with proinflammatory cytokines IL-1β, IFN-γ, and TNF-α at doses that specifically induce apoptosis of βTC1 significantly increased the amount of mRNA and protein encoded by Cebpa and its proapoptotic targets, Arl6ip5 and Tnfrsf10b, in βTC1 but not in αTC1-6. Cebpa knockdown in βTC1 significantly decreased cytokine-induced apoptosis, together with the amount of Arl6ip5 and Tnfrsf10b. Analysis of the network comprising CEBPA, its targets, their first interactants, and proteins encoded by genes known to regulate cytokine-induced apoptosis in pancreatic β cells (genes from the apoptotic machinery and from MAPK and NFkB pathways) revealed that CEBPA, ARL6IP5, TNFRSF10B, TRAF2, and UBC are the top five central nodes. In silico analysis further suggests TRAF2 as trait d'union node between CEBPA and the NFkB pathway. Our results strongly suggest that Cebpa is a key regulator within the apoptotic network activated in pancreatic β cells during insulitis, and Arl6ip5, Tnfrsf10b, Traf2, and Ubc are key executioners of this program. PMID:24943845

The effect of octreotide and bromocriptine on expression of a pro-apoptotic Bax protein in rat prolactinoma.

Directory of Open Access Journals (Sweden)

Jolanta Kunert-Radek

2004-03-01

Full Text Available It is well established that disruption of apoptosis may lead to tumor initiation, progression or metastasis. It is also well documented that many anticancer drugs induce apoptosis. In the earlier studies, the dopamine D2 receptor agonist bromocriptine (BC and somatostatin analog octreotide (OCT were found to inhibit the growth of the estrogen-induced rat prolactinoma. Our previous investigations, applying the TUNEL method showed the involvement of the pro-apoptotic effect in the action of BC, and to a lesser degree, in the action of OCT. The aim of the present study was to investigate whether the pro-apoptotic action of these drugs involves the increased expression of Bax--a member of Bcl-2 protein family which is known to play an important role in the regulation of apoptosis. Male four-week Fisher 344 rats were used in the experiment. Capsules containing diethylstilboestrol (DES were implanted subcutaneously. Six weeks after the implantation the rats were given OCT (2 x 25 microg/animal/24, BC (3 mg/kg b.w./24 h or OCT and BC at the above doses for 10 days. Bax expression was detected by immunohistochemistry. Prolactin (PRL in blood serum was measured by radioimmunoassay (RIA. It has been found that both OCT and BC, alone or in combination, significantly reduce the tumor weight. Both OCT and BC suppressed PRL levels, but the inhibitory effect of BC was stronger than that of OCT. It has been found that the treatment with OCT and BC, alone or in combination, causes a significant increase in Bax expression in the rat prolactinoma cells. Our findings indicate that anti-tumoral action of bromocriptine and to some extent the action of octreotide in the experimental rat prolactinoma is connected with the induction of apoptosis and is associated with increased Bax expression.

Induction of Pro-Apoptotic Endoplasmic Reticulum Stress in Multiple Myeloma Cells by NEO214, Perillyl Alcohol Conjugated to Rolipram.

Science.gov (United States)

Chen, Thomas C; Chan, Nymph; Labib, Shirin; Yu, Jiali; Cho, Hee-Yeon; Hofman, Florence M; Schönthal, Axel H

2018-01-17

Despite the introduction of new therapies for multiple myeloma (MM), many patients are still dying from this disease and novel treatments are urgently needed. We have designed a novel hybrid molecule, called NEO214, that was generated by covalent conjugation of the natural monoterpene perillyl alcohol (POH), an inducer of endoplasmic reticulum (ER) stress, to rolipram (Rp), an inhibitor of phosphodiesterase-4 (PDE4). Its potential anticancer effects were investigated in a panel of MM cell lines. We found that NEO214 effectively killed MM cells in vitro with a potency that was over an order of magnitude stronger than that of its individual components, either alone or in combination. The cytotoxic mechanism of NEO214 involved severe ER stress and prolonged induction of CCAAT/enhancer-binding protein homologous protein (CHOP), a key pro-apoptotic component of the ER stress response. These effects were prevented by salubrinal, a pharmacologic inhibitor of ER stress, and by CHOP gene knockout. Conversely, combination of NEO214 with bortezomib, a drug in clinical use for patients with MM, resulted in synergistic enhancement of MM cell death. Combination with the adenylate cyclase stimulant forskolin did not enhance NEO214 impact, indicating that cyclic adenosine 3',5'-monophosphate (AMP) pathways might play a lesser role. Our study introduces the novel agent NEO214 as a potent inducer of ER stress with significant anti-MM activity in vitro. It should be further investigated as a potential MM therapy aimed at exploiting this tumor's distinct sensitivity to ER stress.

Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death

Science.gov (United States)

Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M

2016-01-01

The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393

Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

Directory of Open Access Journals (Sweden)

Edberg Jeffrey C

2010-03-01

Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

Induction of Bim and Bid gene expression during accelerated apoptosis in severe sepsis.

Science.gov (United States)

Weber, Stefan U; Schewe, Jens-Christian; Lehmann, Lutz E; Müller, Stefan; Book, Malte; Klaschik, Sven; Hoeft, Andreas; Stüber, Frank

2008-01-01

In transgenic animal models of sepsis, members of the Bcl-2 family of proteins regulate lymphocyte apoptosis and survival of sepsis. This study investigates the gene regulation of pro-apoptotic and anti-apoptotic members of the Bcl-2 family of proteins in patients with early stage severe sepsis. In this prospective case-control study, patients were recruited from three intensive care units (ICUs) in a university hospital. Sixteen patients were enrolled when they fulfilled the criteria of severe sepsis. Ten critically ill but non-septic patients and 11 healthy volunteers served as controls. Blood samples were immediately obtained at inclusion. To confirm the presence of accelerated apoptosis in the patient groups, caspase-3 activation and phosphatidylserine externalisation in CD4+, CD8+ and CD19+ lymphocyte subsets were assessed using flow cytometry. Specific mRNAs of Bcl-2 family members were quantified from whole blood by real-time PCR. To test for statistical significance, Kruskal-Wallis testing with Dunn's multiple comparison test for post hoc analysis was performed. In all lymphocyte populations caspase-3 (p < 0.05) was activated, which was reflected in an increased phosphatidylserine externalisation (p < 0.05). Accordingly, lymphocyte counts were decreased in early severe sepsis. In CD4+ T-cells (p < 0.05) and B-cells (p < 0.001) the Bcl-2 protein was decreased in severe sepsis. Gene expression of the BH3-only Bim was massively upregulated as compared with critically ill patients (p < 0.001) and 51.6-fold as compared with healthy controls (p < 0.05). Bid was increased 12.9-fold compared with critically ill patients (p < 0.001). In the group of mitochondrial apoptosis inducers, Bak was upregulated 5.6-fold, while the expression of Bax showed no significant variations. By contrast, the pro-survival members Bcl-2 and Bcl-xl were both downregulated in severe sepsis (p < 0.001 and p < 0.05, respectively). In early severe sepsis a gene expression pattern with

MiR-7 triggers cell cycle arrest at the G1/S transition by targeting multiple genes including Skp2 and Psme3.

Directory of Open Access Journals (Sweden)

Noelia Sanchez

Full Text Available MiR-7 acts as a tumour suppressor in many cancers and abrogates proliferation of CHO cells in culture. In this study we demonstrate that miR-7 targets key regulators of the G1 to S phase transition, including Skp2 and Psme3, to promote increased levels of p27(KIP and temporary growth arrest of CHO cells in the G1 phase. Simultaneously, the down-regulation of DNA repair-specific proteins via miR-7 including Rad54L, and pro-apoptotic regulators such as p53, combined with the up-regulation of anti-apoptotic factors like p-Akt, promoted cell survival while arrested in G1. Thus miR-7 can co-ordinate the levels of multiple genes and proteins to influence G1 to S phase transition and the apoptotic response in order to maintain cellular homeostasis. This work provides further mechanistic insight into the role of miR-7 as a regulator of cell growth in times of cellular stress.

A close connection between the PERK and IRE arms of the UPR and the transcriptional regulation of autophagy.

Science.gov (United States)

Deegan, Shane; Koryga, Izabela; Glynn, Sharon A; Gupta, Sanjeev; Gorman, Adrienne M; Samali, Afshin

2015-01-02

Endoplasmic reticulum (ER) stress is known to lead to activation of both the unfolded protein response (UPR) and autophagy. Although regulatory connections have been identified between the UPR and autophagy, it is still unclear to what extent the UPR regulates the genes involved at the different stages of the autophagy pathway. Here, we carried out a microarray analysis of HCT116 cells subjected to ER stress and observed the transcriptional upregulation of a large cohort of autophagy-related genes. Of particular interest, we identified the transcriptional upregulation of the autophagy receptor genes SQSTM1/p62, NBR1 and BNIP3L/NIX in response to ER stress and show that the inhibition of the UPR transmembrane receptors, PERK and IRE1, abrogates this upregulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Design and synthesis of thienopyrimidine urea derivatives with potential cytotoxic and pro-apoptotic activity against breast cancer cell line MCF-7.

Science.gov (United States)

Abdelhaleem, Eman F; Abdelhameid, Mohammed K; Kassab, Asmaa E; Kandeel, Manal M

2018-01-01

A series of novel tetrahydrobenzothieno[2,3-d]pyrimidine urea derivatives was synthesized according to fragment-based design strategy. They were evaluated for their anticancer activity against MCF-7 cell line. Three compounds 9c, 9d and 11b showed 1.5-1.03 folds more potent anticancer activity than doxorubicin. In this study, a promising multi-sited enzyme small molecule inhibitor 9c, which showed the most potent anti-proliferative activity, was identified. The anti-proliferative activity of this compound appears to correlate well with its ability to inhibit topoisomerase II (IC 50  = 9.29 μM). Moreover, compound 9c showed excellent VEGFR-2 inhibitory activity, at the sub-micromolar level with IC 50 value 0.2 μM, which is 2.1 folds more potent than sorafenib. Moreover, activation of damage response pathway of the DNA leads to cell cycle arrest at G2/M phase, accumulation of cells in pre-G1 phase and annexin-V and propidium iodide staining, indicating that cell death proceeds through an apoptotic mechanism. Compound 9c showed potent pro-apoptotic effect through induction of the intrinsic mitochondrial pathway of apoptosis. This mechanistic pathway was confirmed by a significant increase in the expression of the tumor suppressor gene p53, elevation in Bax/BCL-2 ratio and a significant increase in the level of active caspase-3. Quantitative structure-activity relationship (QSAR) studies delivered equations of five 3D descriptors with R 2  = 0.814. This QSAR model provides an effective technique for understanding the observed antitumor properties and thus could be adopted for developing effective lead structures. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Endoplasmic Reticulum Stress Induces the Early Appearance of Pro-apoptotic and Anti-apoptotic Proteins in Neurons of Five Familial Alzheimer′s Disease Mice

Directory of Open Access Journals (Sweden)

Hui Shen

2016-01-01

Conclusions: These findings suggest that compared with those of age-matched WT mice, ERS-associated pro-apoptotic and anti-apoptotic proteins are upregulated in 2-month-old 5×FAD mice, consistent with intracellular Aβ aggregation in neurons.

Cambogin exerts anti-proliferative and pro-apoptotic effects on breast adenocarcinoma through the induction of NADPH oxidase 1 and the alteration of mitochondrial morphology and dynamics.

Science.gov (United States)

Shen, Kaikai; Lu, Fangfang; Xie, Jianling; Wu, Minfeng; Cai, Bo; Liu, Yurong; Zhang, Hong; Tan, Hongsheng; Pan, Yingyi; Xu, Hongxi

2016-08-02

Cambogin, a bioactive polycyclic polyprenylated acylphoroglucinol (PPAP) derived from the Garcinia genus, possesses proapoptotic effect in medulloblastoma and breast cancer cells. We have previously demonstrated that the proapoptotic effect of cambogin is driven by the production of reactive oxygen species (ROS). Here we have shown that the inhibitory effect of cambogin on cell proliferation is associated with the loss of mitochondrial transmembrane potential (ΔΨm) and mitochondrial fragmentation. Cambogin also promotes the mutual complex formation of the membrane-bound subunit p22phox of NADPH oxidase 1 (NOX1), as well as the phosphorylation of the cytosolic subunit p47phox, subsequently enhancing membrane-bound NOX1 activity, which leads to increases in intracellular and mitochondrial levels of O2.- and H2O2. Pharmacological inhibition of NOX1 using apocynin (pan-NOX inhibitor), ML171 (NOX1 inhibitor) or siRNA against NOX1 prevents the increases in O2.- and H2O2 levels and the anti-proliferative effect of cambogin. Antioxidants, including SOD (superoxide dismutase), CAT (catalase) and EUK-8, are also able to restore cell viability in the presence of cambogin. Besides, cambogin increases the dissociation of thioredoxin-1 (Trx1) from ASK1, switching the inactive form of ASK1 to the active kinase, subsequently leads to the phosphorylation of JNK/SAPK, which is abolished upon ML171 treatment. The proapoptotic effect of cambogin in breast cancer cells is also aggravated upon knocking down Trx1 in MCF-7 cells. Taken in conjunction, these data indicate that the anti-proliferative and pro-apoptotic effect of cambogin is mediated via inducing NOX1-dependent ROS production and the dissociation of ASK1 and Trx1.

Biochemical and biophysical investigations of the interaction between human glucokinase and pro-apoptotic BAD.

Science.gov (United States)

Rexford, Alix; Zorio, Diego A R; Miller, Brian G

2017-01-01

The glycolytic enzyme glucokinase (GCK) and the pro-apoptotic protein BAD reportedly reside within a five-membered complex that localizes to the mitochondria of mammalian hepatocytes and pancreatic β-cells. Photochemical crosslinking studies using a synthetic analog of BAD's BH3 domain and in vitro transcription/translation experiments support a direct interaction between BAD and GCK. To investigate the biochemical and biophysical consequences of the BAD:GCK interaction, we developed a method for the production of recombinant human BAD. Consistent with published reports, recombinant BAD displays high affinity for Bcl-xL (KD = 7 nM), and phosphorylation of BAD at S118, within the BH3 domain, abolishes this interaction. Unexpectedly, we do not detect association of recombinant, full-length BAD with recombinant human pancreatic GCK over a range of protein concentrations using various biochemical methods including size-exclusion chromatography, chemical cross-linking, analytical ultracentrifugation, and isothermal titration calorimetry. Furthermore, fluorescence polarization assays and isothermal titration calorimetry detect no direct interaction between GCK and BAD BH3 peptides. Kinetic characterization of GCK in the presence of high concentrations of recombinant BAD show modest (BAD BH3 peptides. These results raise questions as to the mechanism of action of stapled peptide analogs modeled after the BAD BH3 domain, which reportedly enhance the Vmax value of GCK and stimulate insulin release in BAD-deficient islets. Based on our results, we postulate that the BAD:GCK interaction, and any resultant regulatory effect(s) upon GCK activity, requires the participation of additional members of the mitochondrial complex.

Gene expression analysis of cell death induction by Taurolidine in different malignant cell lines

International Nuclear Information System (INIS)

Chromik, Ansgar M; Weyhe, Dirk; Mittelkötter, Ulrich; Uhl, Waldemar; Hahn, Stephan A; Daigeler, Adrien; Flier, Annegret; Bulut, Daniel; May, Christina; Harati, Kamran; Roschinsky, Jan; Sülberg, Dominique

2010-01-01

The anti-infective agent Taurolidine (TRD) has been shown to have cell death inducing properties, but the mechanism of its action is largely unknown. The aim of this study was to identify potential common target genes modulated at the transcriptional level following TRD treatment in tumour cell lines originating from different cancer types. Five different malignant cell lines (HT29, Chang Liver, HT1080, AsPC-1 and BxPC-3) were incubated with TRD (100 μM, 250 μM and 1000 μM). Proliferation after 8 h and cell viability after 24 h were analyzed by BrdU assay and FACS analysis, respectively. Gene expression analyses were carried out using the Agilent -microarray platform to indentify genes which displayed conjoint regulation following the addition of TRD in all cell lines. Candidate genes were subjected to Ingenuity Pathways Analysis and selected genes were validated by qRT-PCR and Western Blot. TRD 250 μM caused a significant inhibition of proliferation as well as apoptotic cell death in all cell lines. Among cell death associated genes with the strongest regulation in gene expression, we identified pro-apoptotic transcription factors (EGR1, ATF3) as well as genes involved in the ER stress response (PPP1R15A), in ubiquitination (TRAF6) and mitochondrial apoptotic pathways (PMAIP1). This is the first conjoint analysis of potential target genes of TRD which was performed simultaneously in different malignant cell lines. The results indicate that TRD might be involved in different signal transduction pathways leading to apoptosis

The pro-apoptotic BH3-only protein Bim interacts with components of the translocase of the outer mitochondrial membrane (TOM.

Directory of Open Access Journals (Sweden)

Daniel O Frank

Full Text Available The pro-apoptotic Bcl-2-family protein Bim belongs to the BH3-only proteins known as initiators of apoptosis. Recent data show that Bim is constitutively inserted in the outer mitochondrial membrane via a C-terminal transmembrane anchor from where it can activate the effector of cytochrome c-release, Bax. To identify regulators of Bim-activity, we conducted a search for proteins interacting with Bim at mitochondria. We found an interaction of Bim with Tom70, Tom20 and more weakly with Tom40, all components of the Translocase of the Outer Membrane (TOM. In vitro import assays performed on tryptically digested yeast mitochondria showed reduced Bim insertion into the outer mitochondrial membrane (OMM indicating that protein receptors may be involved in the import process. However, RNAi against components of TOM (Tom40, Tom70, Tom22 or Tom20 by siRNA, individually or in combination, did not consistently change the amount of Bim on HeLa mitochondria, either at steady state or upon de novo-induction. In support of this, the individual or combined knock-downs of TOM receptors also failed to alter the susceptibility of HeLa cells to Bim-induced apoptosis. In isolated yeast mitochondria, lack of Tom70 or the TOM-components Tom20 or Tom22 alone did not affect the import of Bim into the outer mitochondrial membrane. In yeast, expression of Bim can sensitize the cells to Bax-dependent killing. This sensitization was unaffected by the absence of Tom70 or by an experimental reduction in Tom40. Although thus the physiological role of the Bim-TOM-interaction remains unclear, TOM complex components do not seem to be essential for Bim insertion into the OMM. Nevertheless, this association should be noted and considered when the regulation of Bim in other cells and situations is investigated.

The pro-apoptotic BH3-only protein Bim interacts with components of the translocase of the outer mitochondrial membrane (TOM).

Science.gov (United States)

Frank, Daniel O; Dengjel, Jörn; Wilfling, Florian; Kozjak-Pavlovic, Vera; Häcker, Georg; Weber, Arnim

2015-01-01

The pro-apoptotic Bcl-2-family protein Bim belongs to the BH3-only proteins known as initiators of apoptosis. Recent data show that Bim is constitutively inserted in the outer mitochondrial membrane via a C-terminal transmembrane anchor from where it can activate the effector of cytochrome c-release, Bax. To identify regulators of Bim-activity, we conducted a search for proteins interacting with Bim at mitochondria. We found an interaction of Bim with Tom70, Tom20 and more weakly with Tom40, all components of the Translocase of the Outer Membrane (TOM). In vitro import assays performed on tryptically digested yeast mitochondria showed reduced Bim insertion into the outer mitochondrial membrane (OMM) indicating that protein receptors may be involved in the import process. However, RNAi against components of TOM (Tom40, Tom70, Tom22 or Tom20) by siRNA, individually or in combination, did not consistently change the amount of Bim on HeLa mitochondria, either at steady state or upon de novo-induction. In support of this, the individual or combined knock-downs of TOM receptors also failed to alter the susceptibility of HeLa cells to Bim-induced apoptosis. In isolated yeast mitochondria, lack of Tom70 or the TOM-components Tom20 or Tom22 alone did not affect the import of Bim into the outer mitochondrial membrane. In yeast, expression of Bim can sensitize the cells to Bax-dependent killing. This sensitization was unaffected by the absence of Tom70 or by an experimental reduction in Tom40. Although thus the physiological role of the Bim-TOM-interaction remains unclear, TOM complex components do not seem to be essential for Bim insertion into the OMM. Nevertheless, this association should be noted and considered when the regulation of Bim in other cells and situations is investigated.

Resveratrol analogue 3,4,4′,5-tetramethoxystilbene inhibits growth, arrests cell cycle and induces apoptosis in ovarian SKOV‐3 and A-2780 cancer cells

Energy Technology Data Exchange (ETDEWEB)

Piotrowska, Hanna; Myszkowski, Krzysztof; Ziółkowska, Alicja [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland); Kulcenty, Katarzyna [Chair of Medical Biotechnology, Poznan University of Medical Sciences, Poznan (Poland); Wierzchowski, Marcin [Department of Chemical Technology of Drugs, Poznan University of Medical Sciences, Poznan (Poland); Kaczmarek, Mariusz [Department of Clinical Immunology, Poznan University of Medical Sciences, Poznan (Poland); Murias, Marek [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland); Kwiatkowska-Borowczyk, Eliza [Chair of Medical Biotechnology, Poznan University of Medical Sciences, Poznan (Poland); Department of Cancer Diagnostics and Immunology, Greater Poland Cancer Centre, Poznan (Poland); Jodynis-Liebert, Jadwiga, E-mail: liebert@ump.edu.pl [Department of Toxicology, Poznan University of Medical Sciences, Poznan (Poland)

2012-08-15

In the screening studies, cytotoxicity of 12 methylated resveratrol analogues on 11 human cancer cell lines was examined. The most active compound 3,4,4′5-tetramethoxystilbene (DMU-212) and two ovarian cancer cell lines A-2780 (IC{sub 50} = 0.71 μM) and SKOV-3 (IC{sub 50} = 11.51 μM) were selected for further investigation. To determine the mechanism of DMU-212 cytotoxicity, its ability to induce apoptosis was examined. DMU-212 arrested cell cycle in the G2/M or G0/G1 phase which resulted in apoptosis of both cell lines. The expression level of 84 apoptosis-related genes was investigated. In SKOV-3 cells DMU-212 caused up-regulation of pro-apoptotic Bax, Apaf-1 and p53 genes, specific to intrinsic pathway of apoptosis, and a decrease in Bcl-2 and Bcl 2110 mRNA expressions. Conversely, in A-2780 cells an increased expression of pro-apoptotic genes Fas, FasL, TNF, TNFRSF10A, TNFRSF21, TNFRSF16 specific to extracellular mechanism of apoptosis was observed. There are no data published so far regarding the receptor mediated apoptosis induced by DMU-212. The activation of caspase-3/7 was correlated with decreased TRAF-1 and BIRC-2 expression level in A-2780 cells exposed to DMU-212. DMU-212 caused a decrease in CYP1A1 and CYP1B1 mRNA levels in A-2780 by 50% and 75%, and in SKOV-3 cells by 15% and 45%, respectively. The protein expression was also reduced in both cell lines. It is noteworthy that the expression of CYP1B1 protein was entirely inhibited in A-2780 cells treated with DMU-212. It can be suggested that different CYP1B1 expression patterns in either ovarian cell line may affect their sensitivity to cytotoxic activity of DMU-212. -- Highlights: ► DMU-212 was the most cytotoxic among 12 O-methylated resveratrol analogues. ► DMU-212 arrested cell cycle at G2/M and G0/G1phase ► DMU-212 triggered mitochondria- and receptor‐mediated apoptosis. ► DMU-212 entirely inhibited CYP1B1 protein expression in A-2780 cells.

Resveratrol analogue 3,4,4′,5-tetramethoxystilbene inhibits growth, arrests cell cycle and induces apoptosis in ovarian SKOV‐3 and A-2780 cancer cells

International Nuclear Information System (INIS)

Piotrowska, Hanna; Myszkowski, Krzysztof; Ziółkowska, Alicja; Kulcenty, Katarzyna; Wierzchowski, Marcin; Kaczmarek, Mariusz; Murias, Marek; Kwiatkowska-Borowczyk, Eliza; Jodynis-Liebert, Jadwiga

2012-01-01

In the screening studies, cytotoxicity of 12 methylated resveratrol analogues on 11 human cancer cell lines was examined. The most active compound 3,4,4′5-tetramethoxystilbene (DMU-212) and two ovarian cancer cell lines A-2780 (IC 50 = 0.71 μM) and SKOV-3 (IC 50 = 11.51 μM) were selected for further investigation. To determine the mechanism of DMU-212 cytotoxicity, its ability to induce apoptosis was examined. DMU-212 arrested cell cycle in the G2/M or G0/G1 phase which resulted in apoptosis of both cell lines. The expression level of 84 apoptosis-related genes was investigated. In SKOV-3 cells DMU-212 caused up-regulation of pro-apoptotic Bax, Apaf-1 and p53 genes, specific to intrinsic pathway of apoptosis, and a decrease in Bcl-2 and Bcl 2110 mRNA expressions. Conversely, in A-2780 cells an increased expression of pro-apoptotic genes Fas, FasL, TNF, TNFRSF10A, TNFRSF21, TNFRSF16 specific to extracellular mechanism of apoptosis was observed. There are no data published so far regarding the receptor mediated apoptosis induced by DMU-212. The activation of caspase-3/7 was correlated with decreased TRAF-1 and BIRC-2 expression level in A-2780 cells exposed to DMU-212. DMU-212 caused a decrease in CYP1A1 and CYP1B1 mRNA levels in A-2780 by 50% and 75%, and in SKOV-3 cells by 15% and 45%, respectively. The protein expression was also reduced in both cell lines. It is noteworthy that the expression of CYP1B1 protein was entirely inhibited in A-2780 cells treated with DMU-212. It can be suggested that different CYP1B1 expression patterns in either ovarian cell line may affect their sensitivity to cytotoxic activity of DMU-212. -- Highlights: ► DMU-212 was the most cytotoxic among 12 O-methylated resveratrol analogues. ► DMU-212 arrested cell cycle at G2/M and G0/G1phase ► DMU-212 triggered mitochondria- and receptor‐mediated apoptosis. ► DMU-212 entirely inhibited CYP1B1 protein expression in A-2780 cells.

The roles of autophagy and hypoxia in human inflammatory periapical lesions.

Science.gov (United States)

Huang, H Y; Wang, W C; Lin, P Y; Huang, C P; Chen, C Y; Chen, Y K

2018-02-01

To determine the expressions of hypoxia-related [hypoxia-inducible transcription factors (HIF)-1α, BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) and phospho-adenosine monophosphate activated protein kinase (pAMPK)] and autophagy-related [microtubule-associated protein 1 light chain 3 (LC3), beclin-1 (BECN-1), autophagy-related gene (Atg)5-12, and p62] proteins in human inflammatory periapical lesions. Fifteen samples of radicular cysts (RCs) and 21 periapical granulomas (PGs), combined with 17 healthy dental pulp tissues, were examined. Enzyme-linked immunosorbent assay (ELISA) was used to detect interleukin (IL)-1β cytokine; immunohistochemical (IHC) and Western blot (WB) analyses were employed to examine autophagy-related and hypoxia-related proteins. Transmission electron microscopy (TEM) was used to explore the ultrastructural morphology of autophagy in periapical lesions. Nonparametric Kruskal-Wallis tests and Mann-Whitney U-tests were used for statistical analyses. ELISA revealed a significantly higher (P periapical lesions than in normal pulp tissue. Immunoscores of IHC expressions of pAMPK, HIF-1α, BNIP3, BECN-1 and Atg5-12 proteins in periapical lesions were significantly higher (P periapical lesions were noted as compared to normal pulp tissue. Upon TEM, ultrastructural double-membrane autophagosomes and autolysosomes were observed in PGs and RCs. Autophagy associated with hypoxia may play a potential causative role in the development and maintenance of inflamed periapical lesions. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

N-3 poly-unsaturated fatty acids shift estrogen signaling to inhibit human breast cancer cell growth.

Directory of Open Access Journals (Sweden)

Wenqing Cao

Full Text Available Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6, eicosapentaenoic acid (EPA, C20:5 shifted the pro-survival and proliferative effect of estrogen to a pro-apoptotic effect in human breast cancer (BCa MCF-7 and T47D cells. 17 β-estradiol (E2 enhanced the inhibitory effect of n-3 PUFAs on BCa cell growth. The IC50 of DHA or EPA in MCF-7 cells decreased when combined with E2 (10 nM treatment (from 173 µM for DHA only to 113 µM for DHA+E2, and from 187 µm for EPA only to 130 µm for EPA+E2. E2 also augmented apoptosis in n-3 PUFA-treated BCa cells. In contrast, in cells treated with stearic acid (SA, C18:0 as well as cells not treated with fatty acid, E2 promoted breast cancer cell growth. Classical (nuclear estrogen receptors may not be involved in the pro-apoptotic effects of E2 on the n-3 PUFA-treated BCa cells because ERα agonist failed to elicit, and ERα knockdown failed to block E2 pro-apoptotic effects. Subsequent studies reveal that G protein coupled estrogen receptor 1 (GPER1 may mediate the pro-apoptotic effect of estrogen. N-3 PUFA treatment initiated the pro-apoptotic signaling of estrogen by increasing GPER1-cAMP-PKA signaling response, and blunting EGFR, Erk 1/2, and AKT activity. These findings may not only provide the evidence to link n-3 PUFAs biologic effects and the pro-apoptotic signaling of estrogen in breast cancer cells, but also shed new insight into the potential application of n-3 PUFAs in BCa treatment.

Antiproliferative and Pro-Apoptotic Effect of Novel Nitro-Substituted Hydroxynaphthanilides on Human Cancer Cell Lines

Directory of Open Access Journals (Sweden)

Tereza Kauerova

2016-07-01

Full Text Available Ring-substituted hydroxynaphthanilides are considered as cyclic analogues of salicylanilides, compounds possessing a wide range of pharmacological activities, including promising anticancer properties. The aim of this study was to evaluate the potential anticancer effect of novel nitro-substituted hydroxynaphthanilides with a special focus on structure-activity relationships. The antiproliferative effect was assessed by Water Soluble Tetrazolium Salts-1 (WST-1 assay, and cytotoxicity was evaluated via dye exclusion test. Flow cytometry was used for cell cycle analysis and detection of apoptosis using Annexin V-FITC/PI assay. Protein expression was estimated by Western blotting. Our data indicate that the potential to cause the antiproliferative effect increases with the shift of the nitro substituent from the ortho- to the para-position. The most potent compounds, 3-hydroxy-N-(3-nitrophenylnaphthalene-2-carboxamide (2, and 2-hydroxy-N-(4-nitrophenyl-naphthalene-1-carboxamide (6 showed antiproliferative activity against THP-1 and MCF-7 cancer cells without affecting the proliferation of 3T3-L1 non-tumour cells. Compounds 2 and 6 induced the accumulation of THP-1 and MCF-7 cells in G1 phase associated with the downregulation of cyclin E1 protein levels, while the levels of cyclin B1 were not affected. Moreover, compound 2 was found to exert the pro-apoptotic effect on the THP-1 cells. These results suggest that hydroxynaphthanilides might represent a potential model structure for the development of novel anticancer agents.

Vitrification affects nuclear maturation and gene expression of immature human oocytes

Directory of Open Access Journals (Sweden)

Abbas Shahedi

2017-02-01

Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro  (fIVM , and  (II GV oocytes (n=107 that initially vitrified, then matured in  in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile. 

MicroRNA-145 protects cardiomyocytes against hydrogen peroxide (H₂O₂-induced apoptosis through targeting the mitochondria apoptotic pathway.

Directory of Open Access Journals (Sweden)

Ruotian Li

Full Text Available MicroRNAs, a class of small and non-encoding RNAs that transcriptionally or post-transcriptionally modulate the expression of their target genes, has been implicated as critical regulatory molecules in many cardiovascular diseases, including ischemia/reperfusion induced cardiac injury. Here, we report microRNA-145, a tumor suppressor miRNA, can protect cardiomyocytes from hydrogen peroxide H₂O₂-induced apoptosis through targeting the mitochondrial pathway. Quantitative real-time PCR (qPCR demonstrated that the expression of miR-145 in either ischemia/reperfused mice myocardial tissues or H₂O₂-treated neonatal rat ventricle myocytes (NRVMs was markedly down-regulated. Over-expression of miR-145 significantly inhibited the H₂O₂-induced cellular apoptosis, ROS production, mitochondrial structure disruption as well as the activation of key signaling proteins in mitochondrial apoptotic pathway. These protective effects of miR-145 were abrogated by over-expression of Bnip3, an initiation factor of the mitochondrial apoptotic pathway in cardiomyocytes. Finally, we utilized both luciferase reporter assay and western blot analysis to identify Bnip3 as a direct target of miR-145. Our results suggest miR-145 plays an important role in regulating mitochondrial apoptotic pathway in heart challenged with oxidative stress. MiR-145 may represent a potential therapeutic target for treatment of oxidative stress-associated cardiovascular diseases, such as myocardial ischemia/reperfusion injury.

Reversal of methylation silencing of Apo2L/TRAIL receptor 1 (DR4) expression overcomes resistance of SK-MEL-3 and SK-MEL-28 melanoma cells to interferons (IFNs) or Apo2L/TRAIL.

Science.gov (United States)

Bae, S I; Cheriyath, V; Jacobs, B S; Reu, F J; Borden, E C

2008-01-17

Human melanoma cell lines, SK-MEL-3 and SK-MEL-28, despite induction of the proapoptotic cytokine, Apo2L/TRAIL, did not undergo apoptosis in response to interferons (IFN-alpha2b or IFN-beta). Postulating that genes important for apoptosis induction by IFNs might be silenced by methylation, the DNA demethylating agent 5-aza-2'-deoxycytidine (5-AZAdC) was assessed. DR4 (TRAIL-R1) was identified as one of the genes reactivated by 5-AZAdC with a >3-fold increase in 8 of 10 melanoma cell lines. Pretreatment with 5-AZAdC sensitized SK-MEL-3 and SK-MEL-28 cells to apoptosis induced by IFN-alpha2b and IFN-beta; methylation-specific PCR and bisulfite sequencing confirmed demethylation of 5'CpG islands of DR4 and flow cytometry showed an increase in DR4 protein on the cell surface. In cells with reactivated DR4, neutralizing mAB to TRAIL reduced apoptosis in response to IFN-beta or Apo2L/TRAIL. To further confirm the role of DR4, it was expressed by retroviral vector in SK-MEL-3 and SK-MEL-28 cells with reversal of resistance to IFN-beta and Apo2L/TRAIL. Thus, reexpressing DR4 by 5-AZAdC or retroviral transfection in melanoma cell in which promoter methylation had suppressed its expression, potentiated apoptosis by IFN-alpha2b, IFN-beta and Apo2L/TRAIL. Reactivation of silenced proapoptotic genes by inhibitors of DNA methylation may enhance clinical response to IFNs or Apo2L/TRAIL.

Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.

Science.gov (United States)

Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

2017-06-08

A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.

Butyrate-induced proapoptotic and antiangiogenic pathways in EAT cells require activation of CAD and downregulation of VEGF

International Nuclear Information System (INIS)

Belakavadi, Madesh; Prabhakar, B.T.; Salimath, Bharathi P.

2005-01-01

Butyrate, a short-chain fatty acid produced in the colon, induces cell cycle arrest, differentiation, and apoptosis in transformed cell lines. In this report, we study the effects of butyrate (BuA) on the growth of Ehrlich ascites tumor (EAT) cells in vivo. BuA, when injected intraperitoneally (i.p) into mice, inhibited proliferation of EAT cells. Further, induction of apoptosis in EAT cells was monitored by nuclear condensation, annexin-V staining, DNA fragmentation, and translocation of caspase-activated DNase into nucleus upon BuA-treatment. Ac-DEVD-CHO, a caspase-3 inhibitor, completely inhibited BuA-induced apoptosis, indicating that activation of caspase-3 mediates the apoptotic pathway in EAT cells. The proapoptotic effect of BuA also reflects on the antiangiogenic pathway in EAT cells. The antiangiogenic effect of BuA in vivo was demonstrated by the downregulation of the secretion of VEGF in EAT cells. CD31 immunohistochemical staining of peritoneum sections clearly indicated a potential angioinhibitory effect of BuA in EAT cells. These results suggest that BuA, besides regulating other fundamental cellular processes, is able to modulate the expression/secretion of the key angiogenic growth factor VEGF in EAT cells

Onconase responsive genes in human mesothelioma cells: implications for an RNA damaging therapeutic agent

International Nuclear Information System (INIS)

Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima

2010-01-01

Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment

The SARS Coronavirus 3a protein causes endoplasmic reticulum stress and induces ligand-independent downregulation of the type 1 interferon receptor.

Directory of Open Access Journals (Sweden)

Rinki Minakshi

2009-12-01

Full Text Available The Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV is reported to cause apoptosis of infected cells and several of its proteins including the 3a accessory protein, are pro-apoptotic. Since the 3a protein localizes to the endoplasmic reticulum (ER-Golgi compartment, its role in causing ER stress was investigated in transiently transfected cells. Cells expressing the 3a proteins showed ER stress based on activation of genes for the ER chaperones GRP78 and GRP94. Since ER stress can cause differential modulation of the unfolded protein response (UPR, which includes the inositol-requiring enzyme 1 (IRE-1, activating transcription factor 6 (ATF6 and PKR-like ER kinase (PERK pathways, these were individually tested in 3a-expressing cells. Only the PERK pathway was found to be activated in 3a-expressing cells based on (1 increased phosphorylation of eukaryotic initiation factor 2 alpha (eIF2alpha and inhibitory effects of a dominant-negative form of eIF2alpha on GRP78 promoter activity, (2 increased translation of activating transcription factor 4 (ATF4 mRNA, and (3 ATF4-dependent activation of the C/EBP homologous protein (CHOP gene promoter. Activation of PERK affects innate immunity by suppression of type 1 interferon (IFN signaling. The 3a protein was found to induce serine phosphorylation within the IFN alpha-receptor subunit 1 (IFNAR1 degradation motif and to increase IFNAR1 ubiquitination. Confocal microscopic analysis showed increased translocation of IFNAR1 into the lysosomal compartment and flow cytometry showed reduced levels of IFNAR1 in 3a-expressing cells. These results provide further mechanistic details of the pro-apoptotic effects of the SARS-CoV 3a protein, and suggest a potential role for it in attenuating interferon responses and innate immunity.

Apoptosis is signalled early by low doses of ionising radiation in a radiation-induced bystander effect

International Nuclear Information System (INIS)

Furlong, Hayley; Mothersill, Carmel; Lyng, Fiona M.; Howe, Orla

2013-01-01

Highlights: ► Molecular mechanisms involved in the production of a radiation induced bystander effect are not well known. ► We investigate gene expression changes in apoptotic genes in both direct and bystander responses. ► We demonstrate initiation of the apoptotic cascade in a bystander response. ► Lower doses reveal a specific but differential response related to apoptosis compared to higher doses. - Abstract: It is known that ionising radiation (IR) induces a complex signalling apoptotic cascade post-exposure to low doses ultimately to remove damaged cells from a population, specifically via the intrinsic pathway. Therefore, it was hypothesised that bystander reporter cells may initiate a similar apoptotic response if exposed to low doses of IR (0.05 Gy and 0.5 Gy) and compared to directly irradiated cells. Key apoptotic genes were selected according to their role in the apoptotic cascade; tumour suppressor gene TP53, pro-apoptotic Bax and anti-apoptotic Bcl2, pro-apoptotic JNK and anti-apoptotic ERK, initiator caspase 2 and 9 and effector caspase 3, 6 and 7. The data generated consolidated the role of apoptosis following direct IR exposure for all doses and time points as pro-apoptotic genes such as Bax and JNK as well as initiator caspase 7 and effector caspase 3 and 9 were up-regulated. However, the gene expression profile for the bystander response was quite different and more complex in comparison to the direct response. The 0.05 Gy dose point had a more significant apoptosis gene expression profile compared to the 0.5 Gy dose point and genes were not always expressed within 1 h but were sometimes expressed 24 h later. The bystander data clearly demonstrates initiation of the apoptotic cascade by the up-regulation of TP53, Bax, Bcl-2, initiator caspase 2 and effector caspase 6. The effector caspases 3 and 7 of the bystander samples demonstrated down-regulation in their gene expression levels at 0.05 Gy and 0.5 Gy at both time points therefore not

Apoptosis is signalled early by low doses of ionising radiation in a radiation-induced bystander effect

Energy Technology Data Exchange (ETDEWEB)

Furlong, Hayley, E-mail: hayley.furlong@dit.ie [DIT Centre for Radiation and Environmental Science, Focas Research Institute, Dublin Institute of Technology, Kevin St, Dublin 8 (Ireland); School of Biological Sciences, College of Sciences and Health, Dublin Institute of Technology, Kevin St, Dublin 8 (Ireland); Mothersill, Carmel [Medical Physics and Applied Radiation Sciences, Nuclear Research Building, 1280 Hamilton, Ontario L8S 4K1 (Canada); Lyng, Fiona M. [DIT Centre for Radiation and Environmental Science, Focas Research Institute, Dublin Institute of Technology, Kevin St, Dublin 8 (Ireland); Howe, Orla [DIT Centre for Radiation and Environmental Science, Focas Research Institute, Dublin Institute of Technology, Kevin St, Dublin 8 (Ireland); School of Biological Sciences, College of Sciences and Health, Dublin Institute of Technology, Kevin St, Dublin 8 (Ireland)

2013-01-15

Highlights: ► Molecular mechanisms involved in the production of a radiation induced bystander effect are not well known. ► We investigate gene expression changes in apoptotic genes in both direct and bystander responses. ► We demonstrate initiation of the apoptotic cascade in a bystander response. ► Lower doses reveal a specific but differential response related to apoptosis compared to higher doses. - Abstract: It is known that ionising radiation (IR) induces a complex signalling apoptotic cascade post-exposure to low doses ultimately to remove damaged cells from a population, specifically via the intrinsic pathway. Therefore, it was hypothesised that bystander reporter cells may initiate a similar apoptotic response if exposed to low doses of IR (0.05 Gy and 0.5 Gy) and compared to directly irradiated cells. Key apoptotic genes were selected according to their role in the apoptotic cascade; tumour suppressor gene TP53, pro-apoptotic Bax and anti-apoptotic Bcl2, pro-apoptotic JNK and anti-apoptotic ERK, initiator caspase 2 and 9 and effector caspase 3, 6 and 7. The data generated consolidated the role of apoptosis following direct IR exposure for all doses and time points as pro-apoptotic genes such as Bax and JNK as well as initiator caspase 7 and effector caspase 3 and 9 were up-regulated. However, the gene expression profile for the bystander response was quite different and more complex in comparison to the direct response. The 0.05 Gy dose point had a more significant apoptosis gene expression profile compared to the 0.5 Gy dose point and genes were not always expressed within 1 h but were sometimes expressed 24 h later. The bystander data clearly demonstrates initiation of the apoptotic cascade by the up-regulation of TP53, Bax, Bcl-2, initiator caspase 2 and effector caspase 6. The effector caspases 3 and 7 of the bystander samples demonstrated down-regulation in their gene expression levels at 0.05 Gy and 0.5 Gy at both time points therefore not

Anticancer Drug 2-Methoxyestradiol Protects against Renal Ischemia/Reperfusion Injury by Reducing Inflammatory Cytokines Expression

Directory of Open Access Journals (Sweden)

Ying-Yin Chen

2014-01-01

Full Text Available Background. Ischemia/reperfusion (I/R injury is a major cause of acute renal failure and allograft dysfunction in kidney transplantation. ROS/inflammatory cytokines are involved in I/R injury. 2-Methoxyestradiol (2ME2, an endogenous metabolite of estradiol, inhibits inflammatory cytokine expression and is an antiangiogenic and antitumor agent. We investigated the inhibitory effect of 2ME2 on renal I/R injury and possible molecular actions. Methods. BALB/c mice were intraperitoneally injected with 2ME2 (10 or 20 mg/kg or vehicle 12 h before and immediately after renal I/R experiments. The kidney weight, renal function, tubular damages, and apoptotic response were examined 24 h after I/R injury. The expression of mRNA of interleukin-1β, tumor necrosis factor- (TNF α, caspase-3, hypoxia inducible factor- (HIF 1α, and proapoptotic Bcl-2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3 in kidney tissue was determined using RT-PCR, while the expression of nuclear factor κB (NF-κB, BCL-2, and BCL-xL, activated caspase-9, and HIF-1α was determined using immunoblotting. In vitro, we determined the effect of 2ME2 on reactive oxygen species (ROS production and cell viability in antimycin-A-treated renal mesangial (RMC and tubular (NRK52E cells. Results. Serum creatinine and blood urea nitrogen were significantly higher in mice with renal I/R injury than in sham control and in I/R+2ME2-treated mice. Survival in I/R+2ME2-treated mice was higher than in I/R mice. Histological examination showed that 2ME2 attenuated tubular damage in I/R mice, which was associated with lower expression TNF-α, IL-1β, caspase-9, HIF-1α, and BNIP3 mRNA in kidney tissue. Western blotting showed that 2ME2 treatment substantially decreased the expression of activated caspase-9, NF-κB, and HIF-1α but increased the antiapoptotic proteins BCL-2 and BCL-xL in kidney of I/R injury. In vitro, 2MR2 decreased ROS production and increased cell viability in antimycin

STAT3 Target Genes Relevant to Human Cancers

International Nuclear Information System (INIS)

Carpenter, Richard L.; Lo, Hui-Wen

2014-01-01

Since its discovery, the STAT3 transcription factor has been extensively studied for its function as a transcriptional regulator and its role as a mediator of development, normal physiology, and pathology of many diseases, including cancers. These efforts have uncovered an array of genes that can be positively and negatively regulated by STAT3, alone and in cooperation with other transcription factors. Through regulating gene expression, STAT3 has been demonstrated to play a pivotal role in many cellular processes including oncogenesis, tumor growth and progression, and stemness. Interestingly, recent studies suggest that STAT3 may behave as a tumor suppressor by activating expression of genes known to inhibit tumorigenesis. Additional evidence suggested that STAT3 may elicit opposing effects depending on cellular context and tumor types. These mixed results signify the need for a deeper understanding of STAT3, including its upstream regulators, parallel transcription co-regulators, and downstream target genes. To help facilitate fulfilling this unmet need, this review will be primarily focused on STAT3 downstream target genes that have been validated to associate with tumorigenesis and/or malignant biology of human cancers

Downregulation of the proapoptotic protein MOAP-1 by the UBR5 ubiquitin ligase and its role in ovarian cancer resistance to cisplatin

Science.gov (United States)

Matsuura, K; Huang, N-J; Cocce, K; Zhang, L; Kornbluth, S

2017-01-01

Evasion of apoptosis allows many cancers to resist chemotherapy. Apoptosis is mediated by the serial activation of caspase family proteins. These proteases are often activated upon the release of cytochrome c from the mitochondria, which is promoted by the proapoptotic Bcl-2 family protein, Bax. This function of Bax is enhanced by the MOAP-1 (modulator of apoptosis protein 1) protein in response to DNA damage. Previously, we reported that MOAP-1 is targeted for ubiquitylation and degradation by the APC/CCdh1 ubiquitin ligase. In this study, we identify the HECT (homologous to the E6-AP carboxyl terminus) family E3 ubiquitin ligase, UBR5, as a novel ubiquitin ligase for MOAP-1. We demonstrate that UBR5 interacts physically with MOAP-1, ubiquitylates MOAP-1 in vitro and inhibits MOAP-1 stability in cultured cells. In addition, we show that Dyrk2 kinase, a reported UBR5 interactor, cooperates with UBR5 in mediating MOAP-1 ubiquitylation. Importantly, we found that cisplatin-resistant ovarian cancer cell lines exhibit lower levels of MOAP-1 accumulation than their sensitive counterparts upon cisplatin treatment, consistent with the previously reported role of MOAP-1 in modulating cisplatin-induced apoptosis. Accordingly, UBR5 knockdown increased MOAP-1 expression, enhanced Bax activation and sensitized otherwise resistant cells to cisplatin-induced apoptosis. Furthermore, UBR5 expression was higher in ovarian cancers from cisplatin-resistant patients than from cisplatin-responsive patients. These results show that UBR5 downregulates proapoptotic MOAP-1 and suggest that UBR5 can confer cisplatin resistance in ovarian cancer. Thus UBR5 may be an attractive therapeutic target for ovarian cancer treatment. PMID:27721409

Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

International Nuclear Information System (INIS)

Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

2003-01-01

The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

Identification of the 14-3-3 gene family in Rafflesia cantleyi

Science.gov (United States)

Rosli, Khadijah; Wan, Kiew-Lian

2018-04-01

Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

Proapoptotic Bak and Bax guard against fatal systemic and organ-specific autoimmune disease

Science.gov (United States)

Mason, Kylie D.; Lin, Ann; Robb, Lorraine; Josefsson, Emma C.; Henley, Katya J.; Gray, Daniel H. D.; Kile, Benjamin T.; Roberts, Andrew W.; Strasser, Andreas; Huang, David C. S.; Waring, Paul; O’Reilly, Lorraine A.

2013-01-01

Dysregulation of the “intrinsic” apoptotic pathway is associated with the development of cancer and autoimmune disease. Bak and Bax are two proapoptotic members of the Bcl-2 protein family with overlapping, essential roles in the intrinsic apoptotic pathway. Their activity is critical for the control of cell survival during lymphocyte development and homeostasis, best demonstrated by defects in thymic T-cell differentiation and peripheral lymphoid homeostasis caused by their combined loss. Because most bak−/−bax−/− mice die perinatally, the roles of Bax and Bak in immunological tolerance and prevention of autoimmune disease remain unclear. We show that mice reconstituted with a Bak/Bax doubly deficient hematopoietic compartment develop a fatal systemic lupus erythematosus-like autoimmune disease characterized by hypergammaglobulinemia, autoantibodies, lymphadenopathy, glomerulonephritis, and vasculitis. Importantly, these mice also develop a multiorgan autoimmune disease with autoantibodies against most solid glandular structures and evidence of glandular atrophy and necrotizing vasculitis. Interestingly, similar albeit less severe pathology was observed in mice containing a hematopoietic compartment deficient for only Bak, a phenotype reminiscent of the disease seen in patients with point mutations in BAK. These studies demonstrate a critical role for Bak and an ancillary role for Bax in safeguarding immunological tolerance and prevention of autoimmune disease. This suggests that direct activators of the intrinsic apoptotic pathway, such as BH3 mimetics, may be useful for treatment of diverse autoimmune diseases. PMID:23349374

Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

Science.gov (United States)

Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

2017-06-01

To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

Post-transcriptional gene expression control by NANOS is up-regulated and functionally important in pRb-deficient cells.

Science.gov (United States)

Miles, Wayne O; Korenjak, Michael; Griffiths, Lyra M; Dyer, Michael A; Provero, Paolo; Dyson, Nicholas J

2014-10-01

Inactivation of the retinoblastoma tumor suppressor (pRb) is a common oncogenic event that alters the expression of genes important for cell cycle progression, senescence, and apoptosis. However, in many contexts, the properties of pRb-deficient cells are similar to wild-type cells suggesting there may be processes that counterbalance the transcriptional changes associated with pRb inactivation. Therefore, we have looked for sets of evolutionary conserved, functionally related genes that are direct targets of pRb/E2F proteins. We show that the expression of NANOS, a key facilitator of the Pumilio (PUM) post-transcriptional repressor complex, is directly repressed by pRb/E2F in flies and humans. In both species, NANOS expression increases following inactivation of pRb/RBF1 and becomes important for tissue homeostasis. By analyzing datasets from normal retinal tissue and pRb-null retinoblastomas, we find a strong enrichment for putative PUM substrates among genes de-regulated in tumors. These include pro-apoptotic genes that are transcriptionally down-regulated upon pRb loss, and we characterize two such candidates, MAP2K3 and MAP3K1, as direct PUM substrates. Our data suggest that NANOS increases in importance in pRb-deficient cells and helps to maintain homeostasis by repressing the translation of transcripts containing PUM Regulatory Elements (PRE). © 2014 The Authors.

Insulin-like growth factor 1 signaling is essential for mitochondrial biogenesis and mitophagy in cancer cells.

Science.gov (United States)

Lyons, Amy; Coleman, Michael; Riis, Sarah; Favre, Cedric; O'Flanagan, Ciara H; Zhdanov, Alexander V; Papkovsky, Dmitri B; Hursting, Stephen D; O'Connor, Rosemary

2017-10-13

Mitochondrial activity and metabolic reprogramming influence the phenotype of cancer cells and resistance to targeted therapy. We previously established that an insulin-like growth factor 1 (IGF-1)-inducible mitochondrial UTP carrier (PNC1/SLC25A33) promotes cell growth. This prompted us to investigate whether IGF signaling is essential for mitochondrial maintenance in cancer cells and whether this contributes to therapy resistance. Here we show that IGF-1 stimulates mitochondrial biogenesis in a range of cell lines. In MCF-7 and ZR75.1 breast cancer cells, IGF-1 induces peroxisome proliferator-activated receptor γ coactivator 1β (PGC-1β) and PGC-1α-related coactivator (PRC). Suppression of PGC-1β and PRC with siRNA reverses the effects of IGF-1 and disrupts mitochondrial morphology and membrane potential. IGF-1 also induced expression of the redox regulator nuclear factor-erythroid-derived 2-like 2 (NFE2L2 alias NRF-2). Of note, MCF-7 cells with acquired resistance to an IGF-1 receptor (IGF-1R) tyrosine kinase inhibitor exhibited reduced expression of PGC-1β, PRC, and mitochondrial biogenesis. Interestingly, these cells exhibited mitochondrial dysfunction, indicated by reactive oxygen species expression, reduced expression of the mitophagy mediators BNIP3 and BNIP3L, and impaired mitophagy. In agreement with this, IGF-1 robustly induced BNIP3 accumulation in mitochondria. Other active receptor tyrosine kinases could not compensate for reduced IGF-1R activity in mitochondrial protection, and MCF-7 cells with suppressed IGF-1R activity became highly dependent on glycolysis for survival. We conclude that IGF-1 signaling is essential for sustaining cancer cell viability by stimulating both mitochondrial biogenesis and turnover through BNIP3 induction. This core mitochondrial protective signal is likely to strongly influence responses to therapy and the phenotypic evolution of cancer. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Gene expression in mdx mouse muscle in relation to age and exercise: aberrant mechanical-metabolic coupling and implications for pre-clinical studies in Duchenne muscular dystrophy.

Science.gov (United States)

Camerino, Giulia Maria; Cannone, Maria; Giustino, Arcangela; Massari, Ada Maria; Capogrosso, Roberta Francesca; Cozzoli, Anna; De Luca, Annamaria

2014-11-01

Weakness and fatigability are typical features of Duchenne muscular dystrophy patients and are aggravated in dystrophic mdx mice by chronic treadmill exercise. Mechanical activity modulates gene expression and muscle plasticity. Here, we investigated the outcome of 4 (T4, 8 weeks of age) and 12 (T12, 16 weeks of age) weeks of either exercise or cage-based activity on a large set of genes in the gastrocnemius muscle of mdx and wild-type (WT) mice using quantitative real-time PCR. Basal expression of the exercise-sensitive genes peroxisome-proliferator receptor γ coactivator 1α (Pgc-1α) and Sirtuin1 (Sirt1) was higher in mdx versus WT mice at both ages. Exercise increased Pgc-1α expression in WT mice; Pgc-1α was downregulated by T12 exercise in mdx muscles, along with Sirt1, Pparγ and the autophagy marker Bnip3. Sixteen weeks old mdx mice showed a basal overexpression of the slow Mhc1 isoform and Serca2; T12 exercise fully contrasted this basal adaptation as well as the high expression of follistatin and myogenin. Conversely, T12 exercise was ineffective in WT mice. Damage-related genes such as gp91-phox (NADPH-oxidase2), Tgfβ, Tnfα and c-Src tyrosine kinase were overexpressed in mdx muscles and not affected by exercise. Likewise, the anti-inflammatory adiponectin was lower in T12-exercised mdx muscles. Chronic exercise with minor adaptive effects in WT muscles leads to maladaptation in mdx muscles with a disequilibrium between protective and damaging signals. Increased understanding of the pathways involved in the altered mechanical-metabolic coupling may help guide appropriate physical therapies while better addressing pharmacological interventions in translational research. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

5' Analysis of the soybean leghaemoglobin lbc(3) gene

DEFF Research Database (Denmark)

Stougaard, J; Sandal, N N; Grøn, A

1987-01-01

The soybean leghaemoglobin lbc(3) gene promoter was analysed in transgenic Lotus corniculatus plants. Hybrid-promoter constructions and 5' deletions were studied using chimeric genes composed of the various promoters, the chloramphenicol acetyltransferase (CAT) coding sequence and the lbc(3) 3...

Exercise and exercise training-induced increase in autophagy markers in human skeletal muscle

DEFF Research Database (Denmark)

Brandt, Nina; Gunnarsson, Thomas Gunnar Petursson; Bangsbo, Jens

2018-01-01

Moderately trained male subjects (mean age 25 years; range 19-33 years) completed an 8-week exercise training intervention consisting of continuous moderate cycling at 157 ± 20 W for 60 min (MOD; n = 6) or continuous moderate cycling (157 ± 20 W) interspersed by 30-sec sprints (473 ± 79 W) every 10...... muscle AMPKThr172 and ULKSer317 phosphorylation was elevated immediately after exercise, whereas mTORSer2448 and ULKSer757 phosphorylation was unchanged. Two hours after exercise LC3I, LC3II and BNIP3 protein content was overall higher than before exercise with no change in p62 protein. In MOD, Beclin1...... protein content was higher immediately and 2 h after exercise than before exercise, while there were no differences within SPRINT. Oxphos complex I, LC3I, BNIP3 and Parkin protein content was higher after the training intervention than before in both groups, while there was no difference in LC3II and p62...

Antiproliferative and proapoptotic effects of topotecan in combination with thymoquinone on acute myelogenous leukemia.

Science.gov (United States)

Khalife, Rana; El-Hayek, Stephany; Stephany, El-Hayek; Tarras, Omayr; Hodroj, Mohammad Hassan; Rizk, Sandra

2014-09-01

Topotecan has shown promising antineoplastic activity in solid tumors and acute leukemia. Because of the primary dose-limiting toxicity of topotecan, it is necessary to identify other agents that can work synergistically with topotecan, potentially increasing its efficacy while limiting its toxicity. Many studies showed synergism in combination of topotecan with gemcitabine and bortezomib. Other studies report the increase in growth inhibition of gemcitabine or oxaliplatin when cells were preexposed to naturally occurring drugs such as thymoquinone. The aim of this project was to study the mode of action of topotecan along with thymoquinone, on survival and apoptosis pathways in acute myelogenous leukemia (AML) cell lines, and to investigate the potential synergistic effect of thymoquinone on topotecan. U937 cells were incubated with different topotecan and thymoquinone concentrations for 24 and 48 hours, separately and in combination. Cell proliferation was determined using WST-1 (Roche) reagent. The effect of the compounds on protein expression of Bax, Bcl2, p53, caspase-9, -8, and -3 was determined using Western blot analysis. Cell cycle analysis was performed in addition to annexin/propidium iodide staining. Thymoquinone and topotecan exhibited antiproliferative effects on U937 cells when applied separately. In combination, the reduction in proliferation was extremely significant with a major increase in the expression levels of Bax/Bcl2, p53, and caspase-3 and -9. Preexposure with thymoquinone resulted in an increase in cell growth inhibition compared with topotecan treatment. Thymoquinone, when combined with topotecan in noncytotoxic doses, produced synergistic antiproliferative and proapoptotic effects in AML cells. Preexposure to thymoquinone seems to be more effective than simultaneous application with topotecan. Copyright © 2014 Elsevier Inc. All rights reserved.

Relationship between Gene Body DNA Methylation and Intragenic H3K9me3 and H3K36me3 Chromatin Marks

OpenAIRE

Hahn, Maria A.; Wu, Xiwei; Li, Arthur X.; Hahn, Torsten; Pfeifer, Gerd P.

2011-01-01

To elucidate the relationship between intragenic DNA methylation and chromatin marks, we performed epigenetic profiling of chromosome 19 in human bronchial epithelial cells (HBEC) and in the colorectal cancer cell line HCT116 as well as its counterpart with double knockout of DNMT1 and DNMT3B (HCT116-DKO). Analysis of H3K36me3 profiles indicated that this intragenic mark of active genes is associated with two categories of genes: (i) genes with low CpG density and H3K9me3 in the gene body or ...

Intact initiation of autophagy and mitochondrial fission by acute exercise in skeletal muscle of patientswith type 2 diabetes

DEFF Research Database (Denmark)

Kruse Sørensen, Rikke; Pedersen, Andreas James Thestrup; Kristensen, Jonas Møller

2017-01-01

AIMS: Type 2 diabetes (T2D) is characterized by insulin resistance, mitochondrial dysregulation, and, in some studies, exercise resistance in skeletal muscle. Regulation of autophagy and mitochondrial dynamics during exercise and recovery is important for skeletal muscle homeostasis......, and these responses may be altered in T2D. MATERIALS AND METHODS: We examined the effect of acute exercise on markers of autophagy and mitochondrial fusion and fission in skeletal muscle biopsies from patients with T2D (n=13) and weight-matched controls (n=14) before, immediately after and 3h after an acute bout...... of exercise. RESULTS: While mRNA levels of most markers of autophagy ( PIK3C, MAP1LC3B, SQSTM1, BNIP3, BNIP3L ) and mitochondrial dynamics ( OPA1, FIS1 ) remained unchanged, some either increased during and after exercise (GABARAPL1 ), decreased in the recovery period ( BECN1, ATG7, DNM1L ), or both ( MFN2...

The pro-apoptotic action of the peptide hormone Neb-colloostatin on insect haemocytes.

Science.gov (United States)

Czarniewska, E; Mrówczynska, L; Kuczer, M; Rosinski, G

2012-12-15

The gonadoinhibitory peptide hormone Neb-colloostatin was first isolated from ovaries of the flesh fly Neobellieria bullata. This 19-mer peptide is thought to be a cleaved product of a collagen-like precursor molecule that is formed during remodelling of the extracellular matrix. In this study, we report that upon injection of picomolar and nanomolar doses, this peptide exerts a pro-apoptotic action on haemocytes of Tenebrio molitor adults, as visualized by changes in morphology and viability. The F-actin cytoskeleton was found to aggregate into distinctive patches. This may be responsible for the observed inhibition of adhesion of haemocytes and for the stimulation of filopodia formation. However, Neb-colloostatin injection did not induce the formation of autophagic vacuoles. Our results suggest that physiological concentrations of Neb-colloostatin play an important role in controlling the quantity and activity of haemocytes in insect haemolymph. They also suggest that during periods in which Neb-colloostatin is released, this peptide may cause a weakening of the insects' immune system. This is the first report that exposure to a peptide hormone causes apoptosis in insect haemocytes.

Deregulation of apoptosis-related genes is associated with PRV1 overexpression and JAK2 V617F allele burden in Essential Thrombocythemia and Myelofibrosis

Directory of Open Access Journals (Sweden)

Tognon Raquel

2012-02-01

Full Text Available Abstract Background Essential Thrombocythemia (ET and Primary Myelofibrosis (PMF are Chronic Myeloproliferative Neoplasms (MPN characterized by clonal myeloproliferation/myeloaccumulation without cell maturation impairment. The JAK2 V617F mutation and PRV1 gene overexpression may contribute to MPN physiopathology. We hypothesized that deregulation of the apoptotic machinery may also play a role in the pathogenesis of ET and PMF. In this study we evaluated the apoptosis-related gene and protein expression of BCL2 family members in bone marrow CD34+ hematopoietic stem cells (HSC and peripheral blood leukocytes from ET and PMF patients. We also tested whether the gene expression results were correlated with JAK2 V617F allele burden percentage, PRV1 overexpression, and clinical and laboratory parameters. Results By real time PCR assay, we observed that A1, MCL1, BIK and BID, as well as A1, BCLW and BAK gene expression were increased in ET and PMF CD34+ cells respectively, while pro-apoptotic BAX and anti-apoptotic BCL2 mRNA levels were found to be lower in ET and PMF CD34+ cells respectively, in relation to controls. In patients' leukocytes, we detected an upregulation of anti-apoptotic genes A1, BCL2, BCL-XL and BCLW. In contrast, pro-apoptotic BID and BIMEL expression were downregulated in ET leukocytes. Increased BCL-XL protein expression in PMF leukocytes and decreased BID protein expression in ET leukocytes were observed by Western Blot. In ET leukocytes, we found a correlation between JAK2 V617F allele burden and BAX, BIK and BAD gene expression and between A1, BAX and BIK and PRV1 gene expression. A negative correlation between PRV1 gene expression and platelet count was observed, as well as a positive correlation between PRV1 gene expression and splenomegaly. Conclusions Our results suggest the participation of intrinsic apoptosis pathway in the MPN physiopathology. In addition, PRV1 and JAK2 V617F allele burden were linked to deregulation

Downregulation of the proapoptotic protein MOAP-1 by the UBR5 ubiquitin ligase and its role in ovarian cancer resistance to cisplatin

OpenAIRE

Matsuura, K; Huang, N-J; Cocce, K; Zhang, L; Kornbluth, S

2016-01-01

Evasion of apoptosis allows many cancers to resist chemotherapy. Apoptosis is mediated by the serial activation of caspase family proteins. These proteases are often activated upon the release of cytochrome c from the mitochondria, which is promoted by the proapoptotic Bcl-2 family protein, Bax. This function of Bax is enhanced by the MOAP-1 (modulator of apoptosis protein 1) protein in response to DNA damage. Previously, we reported that MOAP-1 is targeted for ubiquitylation and degradation ...

Arabidopsis ATRX Modulates H3.3 Occupancy and Fine-Tunes Gene Expression

KAUST Repository

Duc, Céline

2017-07-07

Histones are essential components of the nucleosome, the major chromatin subunit that structures linear DNA molecules and regulates access of other proteins to DNA. Specific histone chaperone complexes control the correct deposition of canonical histones and their variants to modulate nucleosome structure and stability. In this study, we characterize the Arabidopsis Alpha Thalassemia-mental Retardation X-linked (ATRX) ortholog and show that ATRX is involved in histone H3 deposition. Arabidopsis ATRX mutant alleles are viable, but show developmental defects and reduced fertility. Their combination with mutants of the histone H3.3 chaperone HIRA (Histone Regulator A) results in impaired plant survival, suggesting that HIRA and ATRX function in complementary histone deposition pathways. Indeed, ATRX loss of function alters cellular histone H3.3 pools and in consequence modulates the H3.1/H3.3 balance in the cell. H3.3 levels are affected especially at genes characterized by elevated H3.3 occupancy, including the 45S ribosomal DNA (45S rDNA) loci, where loss of ATRX results in altered expression of specific 45S rDNA sequence variants. At the genome-wide scale, our data indicate that ATRX modifies gene expression concomitantly to H3.3 deposition at a set of genes characterized both by elevated H3.3 occupancy and high expression. Altogether, our results show that ATRX is involved in H3.3 deposition and emphasize the role of histone chaperones in adjusting genome expression.

Scaling proprioceptor gene transcription by retrograde NT3 signaling.

Directory of Open Access Journals (Sweden)

Jun Lee

Full Text Available Cell-type specific intrinsic programs instruct neuronal subpopulations before target-derived factors influence later neuronal maturation. Retrograde neurotrophin signaling controls neuronal survival and maturation of dorsal root ganglion (DRG sensory neurons, but how these potent signaling pathways intersect with transcriptional programs established at earlier developmental stages remains poorly understood. Here we determine the consequences of genetic alternation of NT3 signaling on genome-wide transcription programs in proprioceptors, an important sensory neuron subpopulation involved in motor reflex behavior. We find that the expression of many proprioceptor-enriched genes is dramatically altered by genetic NT3 elimination, independent of survival-related activities. Combinatorial analysis of gene expression profiles with proprioceptors isolated from mice expressing surplus muscular NT3 identifies an anticorrelated gene set with transcriptional levels scaled in opposite directions. Voluntary running experiments in adult mice further demonstrate the maintenance of transcriptional adjustability of genes expressed by DRG neurons, pointing to life-long gene expression plasticity in sensory neurons.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Molecular characterization of barley 3H semi-dwarf genes.

Directory of Open Access Journals (Sweden)

Haobing Li

Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

H3K27me3 and H3K4me3 chromatin environment at super-induced dehydration stress memory genes of Arabidopsis thaliana.

Science.gov (United States)

Liu, Ning; Fromm, Michael; Avramova, Zoya

2014-03-01

Pre-exposure to a stress may alter the plant's cellular, biochemical, and/or transcriptional responses during future encounters as a 'memory' from the previous stress. Genes increasing transcription in response to a first dehydration stress, but producing much higher transcript levels in a subsequent stress, represent the super-induced 'transcription memory' genes in Arabidopsis thaliana. The chromatin environment (histone H3 tri-methylations of Lys 4 and Lys 27, H3K4me3, and H3K27me3) studied at five dehydration stress memory genes revealed existence of distinct memory-response subclasses that responded differently to CLF deficiency and displayed different transcriptional activities during the watered recovery periods. Among the most important findings is the novel aspect of the H3K27me3 function observed at specific dehydration stress memory genes. In contrast to its well-known role as a chromatin repressive mechanism at developmentally regulated genes, H3K27me3 did not prevent transcription from the dehydration stress-responding genes. The high H3K27me3 levels present during transcriptionally inactive states did not interfere with the transition to active transcription and with H3K4me3 accumulation. H3K4me3 and H3K27me3 marks function independently and are not mutually exclusive at the dehydration stress-responding memory genes.

Suppression subtractive hybridization identified differentially expressed genes in lung adenocarcinoma: ERGIC3 as a novel lung cancer-related gene

International Nuclear Information System (INIS)

Wu, Mingsong; Tu, Tao; Huang, Yunchao; Cao, Yi

2013-01-01

To understand the carcinogenesis caused by accumulated genetic and epigenetic alterations and seek novel biomarkers for various cancers, studying differentially expressed genes between cancerous and normal tissues is crucial. In the study, two cDNA libraries of lung cancer were constructed and screened for identification of differentially expressed genes. Two cDNA libraries of differentially expressed genes were constructed using lung adenocarcinoma tissue and adjacent nonmalignant lung tissue by suppression subtractive hybridization. The data of the cDNA libraries were then analyzed and compared using bioinformatics analysis. Levels of mRNA and protein were measured by quantitative real-time polymerase chain reaction (q-RT-PCR) and western blot respectively, as well as expression and localization of proteins were determined by immunostaining. Gene functions were investigated using proliferation and migration assays after gene silencing and gene over-expression. Two libraries of differentially expressed genes were obtained. The forward-subtracted library (FSL) and the reverse-subtracted library (RSL) contained 177 and 59 genes, respectively. Bioinformatic analysis demonstrated that these genes were involved in a wide range of cellular functions. The vast majority of these genes were newly identified to be abnormally expressed in lung cancer. In the first stage of the screening for 16 genes, we compared lung cancer tissues with their adjacent non-malignant tissues at the mRNA level, and found six genes (ERGIC3, DDR1, HSP90B1, SDC1, RPSA, and LPCAT1) from the FSL were significantly up-regulated while two genes (GPX3 and TIMP3) from the RSL were significantly down-regulated (P < 0.05). The ERGIC3 protein was also over-expressed in lung cancer tissues and cultured cells, and expression of ERGIC3 was correlated with the differentiated degree and histological type of lung cancer. The up-regulation of ERGIC3 could promote cellular migration and proliferation in vitro. The

Cytotoxic and Pro-Apoptotic Effects of Honey Bee Venom and Chrysin on Human Ovarian Cancer Cells

Directory of Open Access Journals (Sweden)

Elaheh Amini

2015-06-01

Full Text Available Background: The anti-cancer effects of honey bee venom (BV and chrysin might open a new window for treatment of chemo-resistant cancers. This study was designed to evaluate cytotoxic and pro-apoptotic effects of BV and chrysin on A2780cp cistplatin- resistant human ovarian cancer cells. Methods: As per the study objectives, A2780cp cells were categorized to 4 groups: 3 experiment groups (treated either with BV or chrysin or BV + chrysin and 1 control group (untreated cells.  Experiment group cells were cultured and treated by different concentrations of BV and chrysin for 24 hours. Then, experiment and control cells were studied with MTT assay, Annexin V-FITC, DAPI and Acridine Orange / Propidium Iodide statining, flow cytometry, caspase-3 and -9 assay, measurement of intracellular level of reactive oxygen species (ROS and RT-PCR. Results: MTT assay showed that 8 μg/mL BV, 40 µg/ml chrysin and 6 + 15 μg/mL BV + chrysin co-treatment induced 50% cell death on A2780cp cells compared with controls (P < 0.001. Morphological observations by inverted and fluorescent microscopy revealed ROS generation and apoptotic cell death under exposure to BV or chrysin or BV + chrysin co-treatment. Caspase-3 and -9 assay demonstrated that BV and chrysin triggered apoptosis through intrinsic pathway and RT-PCR demonstrated down-regulation of Bcl-2. Conclusion: Honey bee venom and chrysin are effective for destroying chemoresistant ovarian cancer cells through activation of intrinsic apoptosis, which propose them as potential candidates to be used in development of improved chemotherapeutic agents in the future.

Gene Expression Profiles of Main Olfactory Epithelium in Adenylyl Cyclase 3 Knockout Mice

Directory of Open Access Journals (Sweden)

Zhenshan Wang

2015-11-01

Full Text Available Adenylyl Cyclase 3 (AC3 plays an important role in the olfactory sensation-signaling pathway in mice. AC3 deficiency leads to defects in olfaction. However, it is still unknown whether AC3 deficiency affects gene expression or olfactory signal transduction pathways within the main olfactory epithelium (MOE. In this study, gene microarrays were used to screen differentially expressed genes in MOE from AC3 knockout (AC3−/− and wild-type (AC3+/+ mice. The differentially expressed genes identified were subjected to bioinformatic analysis and verified by qRT-PCR. Gene expression in the MOE from AC3−/− mice was significantly altered, compared to AC3+/+ mice. Of the 41266 gene probes, 3379 had greater than 2-fold fold change in expression levels between AC3−/− and AC3+/+ mice, accounting for 8% of the total gene probes. Of these genes, 1391 were up regulated, and 1988 were down regulated, including 425 olfactory receptor genes, 99 genes that are specifically expressed in the immature olfactory neurons, 305 genes that are specifically expressed in the mature olfactory neurons, and 155 genes that are involved in epigenetic regulation. Quantitative RT-PCR verification of the differentially expressed epigenetic regulation related genes, olfactory receptors, ion transporter related genes, neuron development and differentiation related genes, lipid metabolism and membrane protein transport etc. related genes showed that P75NTR, Hinfp, Gadd45b, and Tet3 were significantly up-regulated, while Olfr370, Olfr1414, Olfr1208, Golf, Faim2, Tsg101, Mapk10, Actl6b, H2BE, ATF5, Kirrrel2, OMP, Drd2 etc. were significantly down-regulated. In summary, AC3 may play a role in proximal olfactory signaling and play a role in the regulation of differentially expressed genes in mouse MOE.

Interaction of a putative BH3 domain of clusterin with anti-apoptotic Bcl-2 family proteins as revealed by NMR spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Lee, Dong-Hwa; Ha, Ji-Hyang [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Kim, Yul [Department of Bio and Brain Engineering, KAIST, Daejeon 305-701 (Korea, Republic of); Bae, Kwang-Hee [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Park, Jae-Yong [Department of Physiology, Institute of Health Science, School of Medicine, Gyeongsang National University, Jinju, Gyeongnam 660-751 (Korea, Republic of); Choi, Wan Sung [Department of Anatomy and Neurobiology, Institute of Health Science, School of Medicine, Gyeongsang National University, Jinju, Gyeongnam 660-751 (Korea, Republic of); Yoon, Ho Sup [Division of Structural and Computational Biology, School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive, Singapore 637511 (Singapore); Park, Sung Goo; Park, Byoung Chul [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of); Yi, Gwan-Su, E-mail: gsyi@kaist.ac.kr [Department of Bio and Brain Engineering, KAIST, Daejeon 305-701 (Korea, Republic of); Chi, Seung-Wook, E-mail: swchi@kribb.re.kr [Medical Proteomics Research Center, KRIBB, Daejeon 305-806 (Korea, Republic of)

2011-05-20

Highlights: {yields} Identification of a conserved BH3 motif in C-terminal coiled coil region of nCLU. {yields} The nCLU BH3 domain binds to BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. {yields} A conserved binding mechanism of nCLU BH3 and the other pro-apoptotic BH3 peptides with Bcl-X{sub L}. {yields} The absolutely conserved Leu323 and Asp328 of nCLU BH3 domain are critical for binding to Bcl-X{sub L.} {yields} Molecular understanding of the pro-apoptotic function of nCLU as a novel BH3-only protein. -- Abstract: Clusterin (CLU) is a multifunctional glycoprotein that is overexpressed in prostate and breast cancers. Although CLU is known to be involved in the regulation of apoptosis and cell survival, the precise molecular mechanism underlying the pro-apoptotic function of nuclear CLU (nCLU) remains unclear. In this study, we identified a conserved BH3 motif in C-terminal coiled coil (CC2) region of nCLU by sequence analysis and characterized the molecular interaction of the putative nCLU BH3 domain with anti-apoptotic Bcl-2 family proteins by nuclear magnetic resonance (NMR) spectroscopy. The chemical shift perturbation data demonstrated that the nCLU BH3 domain binds to pro-apoptotic BH3 peptide-binding grooves in both Bcl-X{sub L} and Bcl-2. A structural model of the Bcl-X{sub L}/nCLU BH3 peptide complex reveals that the binding mode is remarkably similar to those of other Bcl-X{sub L}/BH3 peptide complexes. In addition, mutational analysis confirmed that Leu323 and Asp328 of nCLU BH3 domain, absolutely conserved in the BH3 motifs of BH3-only protein family, are critical for binding to Bcl-X{sub L}. Taken altogether, our results suggest a molecular basis for the pro-apoptotic function of nCLU by elucidating the residue specific interactions of the BH3 motif in nCLU with anti-apoptotic Bcl-2 family proteins.

Lithium-Induced Neuroprotection is Associated with Epigenetic Modification of Specific BDNF Gene Promoter and Altered Expression of Apoptotic-Regulatory Proteins

Directory of Open Access Journals (Sweden)

Tushar eDwivedi

2015-01-01

Full Text Available Bipolar disorder (BD, one of the most debilitating mental disorders, is associated with increased morbidity and mortality. Lithium is the first line of treatment option for BD and is often used for maintenance therapy. Recently, the neuroprotective action of lithium has gained tremendous attention, given that BD is associated with structural and functional abnormalities of the brain. However, the precise molecular mechanism by which lithium exerts its neuroprotective action is not clearly understood. In hippocampal neurons, the effects of lithium on neuronal viability against glutamate-induced cytotoxicity, dendritic length and number, and expression and methylation of BDNF promoter exons and expression of apoptotic regulatory genes were studied. In rat hippocampal neurons, lithium not only increased dendritic length and number, but also neuronal viability against glutamate-induced cytotoxicity. While lithium increased the expression of BDNF as well as genes associated with neuroprotection such as Bcl2 and Bcl-XL, it decreased the expression of pro-apoptotic genes Bax, Bad, and caspases 3. Interestingly, lithium activated transcription of specific exon IV to induce BDNF gene expression. This was accompanied by hypomethylation of BDNF exon IV promoter. This study delineates mechanisms by which lithium mediates its effects in protecting neurons.

A Hybrid CFHR3-1 Gene Causes Familial C3 Glomerulopathy.

LENUS (Irish Health Repository)

Malik, Talat H

2012-07-01

Controlled activation of the complement system, a key component of innate immunity, enables destruction of pathogens with minimal damage to host tissue. Complement factor H (CFH), which inhibits complement activation, and five CFH-related proteins (CFHR1-5) compose a family of structurally related molecules. Combined deletion of CFHR3 and CFHR1 is common and confers a protective effect in IgA nephropathy. Here, we report an autosomal dominant complement-mediated GN associated with abnormal increases in copy number across the CFHR3 and CFHR1 loci. In addition to normal copies of these genes, affected individuals carry a unique hybrid CFHR3-1 gene. In addition to identifying an association between these genetic observations and complement-mediated kidney disease, these results provide insight into the protective role of the combined deletion of CFHR3 and CFHR1 in IgA nephropathy.

Association of transforming growth factor-ß3 gene polymorphism ...

African Journals Online (AJOL)

Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

bmr3, a third multidrug transporter gene of Bacillus subtilis.

OpenAIRE

Ohki, R; Murata, M

1997-01-01

A third multidrug transporter gene named bmr3 was cloned from Bacillus subtilis. Although Bmr3 shows relatively low homology to Bmr and Blt, the substrate specificities of these three transporters overlap. Northern hybridization analysis showed that expression of the bmr3 gene was dependent on the growth phase.

Functions, structure, and read-through alternative splicing of feline APOBEC3 genes

Science.gov (United States)

Münk, Carsten; Beck, Thomas; Zielonka, Jörg; Hotz-Wagenblatt, Agnes; Chareza, Sarah; Battenberg, Marion; Thielebein, Jens; Cichutek, Klaus; Bravo, Ignacio G; O'Brien, Stephen J; Lochelt, Martin; Yuhki, Naoya

2008-01-01

Background Over the past years a variety of host restriction genes have been identified in human and mammals that modulate retrovirus infectivity, replication, assembly, and/or cross-species transmission. Among these host-encoded restriction factors, the APOBEC3 (A3; apolipoprotein B mRNA-editing catalytic polypeptide 3) proteins are potent inhibitors of retroviruses and retrotransposons. While primates encode seven of these genes (A3A to A3H), rodents carry only a single A3 gene. Results Here we identified and characterized several A3 genes in the genome of domestic cat (Felis catus) by analyzing the genomic A3 locus. The cat genome presents one A3H gene and three very similar A3C genes (a-c), probably generated after two consecutive gene duplications. In addition to these four one-domain A3 proteins, a fifth A3, designated A3CH, is expressed by read-through alternative splicing. Specific feline A3 proteins selectively inactivated only defined genera of feline retroviruses: Bet-deficient feline foamy virus was mainly inactivated by feA3Ca, feA3Cb, and feA3Cc, while feA3H and feA3CH were only weakly active. The infectivity of Vif-deficient feline immunodeficiency virus and feline leukemia virus was reduced only by feA3H and feA3CH, but not by any of the feA3Cs. Within Felidae, A3C sequences show significant adaptive selection, but unexpectedly, the A3H sequences present more sites that are under purifying selection. Conclusion Our data support a complex evolutionary history of expansion, divergence, selection and individual extinction of antiviral A3 genes that parallels the early evolution of Placentalia, becoming more intricate in taxa in which the arms race between host and retroviruses is harsher. PMID:18315870

Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

Science.gov (United States)

Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

2002-02-05

Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

Suppression of STAT3 NH2 -terminal domain chemosensitizes medulloblastoma cells by activation of protein inhibitor of activated STAT3 via de-repression by microRNA-21.

Science.gov (United States)

Ray, Sutapa; Coulter, Don W; Gray, Shawn D; Sughroue, Jason A; Roychoudhury, Shrabasti; McIntyre, Erin M; Chaturvedi, Nagendra K; Bhakat, Kishor K; Joshi, Shantaram S; McGuire, Timothy R; Sharp, John G

2018-04-01

Medulloblastoma (MB) is a malignant pediatric brain tumor with poor prognosis. Signal transducers and activators of transcription-3 (STAT3) is constitutively activated in MB where it functions as an oncoprotein, mediating cancer progression and metastasis. Here, we have delineated the functional role of activated STAT3 in MB, by using a cell permeable STAT3-NH 2 terminal domain inhibitor (S3-NTDi) that specifically perturbs the structure/function of STAT3. We have implemented several biochemical experiments using human MB tumor microarray (TMA) and pediatric MB cell lines, derived from high-risk SHH-TP53-mutated and MYC-amplified Non-WNT/SHH tumors. Treatment of MB cells with S3-NTDi leads to growth inhibition, cell cycle arrest, and apoptosis. S3-NTDi downregulated expression of STAT3 target genes, delayed migration of MB cells, attenuated epithelial-mesenchymal transition (EMT) marker expressions and reduced cancer stem-cell associated protein expressions in MB-spheres. To elucidate mechanisms, we showed that S3-NTDi induce expression of pro-apoptotic gene, C/EBP-homologous protein (CHOP), and decrease association of STAT3 to the proximal promoter of CCND1 and BCL2. Of note, S3-NTDi downregulated microRNA-21, which in turn, de-repressed Protein Inhibitor of Activated STAT3 (PIAS3), a negative regulator of STAT3 signaling pathway. Furthermore, combination therapy with S3-NTDi and cisplatin significantly decreased highly aggressive MYC-amplified MB cell growth and induced apoptosis by downregulating STAT3 regulated proliferation and anti-apoptotic gene expression. Together, our results revealed an important role of STAT3 in regulating MB pathogenesis. Disruption of this pathway with S3-NTDi, therefore, may serves as a promising candidate for targeted MB therapy by enhancing chemosensitivity of MB cells and potentially improving outcomes in high-risk patients. © 2017 Wiley Periodicals, Inc.

Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression.

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne

2010-03-15

Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.

EcoGene 3.0.

Science.gov (United States)

Zhou, Jindan; Rudd, Kenneth E

2013-01-01

EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection.

EcoGene 3.0

Science.gov (United States)

Zhou, Jindan; Rudd, Kenneth E.

2013-01-01

EcoGene (http://ecogene.org) is a database and website devoted to continuously improving the structural and functional annotation of Escherichia coli K-12, one of the most well understood model organisms, represented by the MG1655(Seq) genome sequence and annotations. Major improvements to EcoGene in the past decade include (i) graphic presentations of genome map features; (ii) ability to design Boolean queries and Venn diagrams from EcoArray, EcoTopics or user-provided GeneSets; (iii) the genome-wide clone and deletion primer design tool, PrimerPairs; (iv) sequence searches using a customized EcoBLAST; (v) a Cross Reference table of synonymous gene and protein identifiers; (vi) proteome-wide indexing with GO terms; (vii) EcoTools access to >2000 complete bacterial genomes in EcoGene-RefSeq; (viii) establishment of a MySql relational database; and (ix) use of web content management systems. The biomedical literature is surveyed daily to provide citation and gene function updates. As of September 2012, the review of 37 397 abstracts and articles led to creation of 98 425 PubMed-Gene links and 5415 PubMed-Topic links. Annotation updates to Genbank U00096 are transmitted from EcoGene to NCBI. Experimental verifications include confirmation of a CTG start codon, pseudogene restoration and quality assurance of the Keio strain collection. PMID:23197660

HDAC Inhibitors Disrupt Programmed Resistance to Apoptosis During Drosophila Development

Directory of Open Access Journals (Sweden)

Yunsik Kang

2017-06-01

Full Text Available We have previously shown that the ability to respond to apoptotic triggers is regulated during Drosophila development, effectively dividing the fly life cycle into stages that are either sensitive or resistant to apoptosis. Here, we show that the developmentally programmed resistance to apoptosis involves transcriptional repression of critical proapoptotic genes by histone deacetylases (HDACs. Administration of HDAC inhibitors (HDACi, like trichostatin A or suberoylanilide hydroxamic acid, increases expression of proapoptotic genes and is sufficient to sensitize otherwise resistant stages. Conversely, reducing levels of proapoptotic genes confers resistance to otherwise sensitive stages. Given that resistance to apoptosis is a hallmark of cancer cells, and that HDACi have been recently added to the repertoire of FDA-approved agents for cancer therapy, our results provide new insights for how HDACi help kill malignant cells and also raise concerns for their potential unintended effects on healthy cells.

Cardioprotection by gene therapy: A review paper on behalf of the Working Group on Drug Cardiotoxicity and Cardioprotection of the Italian Society of Cardiology.

Science.gov (United States)

Madonna, Rosalinda; Cadeddu, Christian; Deidda, Martino; Giricz, Zoltán; Madeddu, Clelia; Mele, Donato; Monte, Ines; Novo, Giuseppina; Pagliaro, Pasquale; Pepe, Alessia; Spallarossa, Paolo; Tocchetti, Carlo Gabriele; Varga, Zoltán V; Zito, Concetta; Geng, Yong-Jian; Mercuro, Giuseppe; Ferdinandy, Peter

2015-07-15

Ischemic heart disease remains the leading cause of death worldwide. Ischemic pre-, post-, and remote conditionings trigger endogenous cardioprotection that renders the heart resistant to ischemic-reperfusion injury (IRI). Mimicking endogenous cardioprotection by modulating genes involved in cardioprotective signal transduction provides an opportunity to reproduce endogenous cardioprotection with better possibilities of translation into the clinical setting. Genes and signaling pathways by which conditioning maneuvers exert their effects on the heart are partially understood. This is due to the targeted approach that allowed identifying one or a few genes associated with IRI and cardioprotection. Genes critical for signaling pathways in cardioprotection include protectomiRs (e.g., microRNA 125b*), ZAC1 transcription factor, pro-inflammatory genes such as cycloxygenase (COX)-2 and inducible nitric oxide synthase (iNOS), antioxidant enzymes such as hemoxygenase (HO)-1, extracellular and manganese superoxidase dismutases (ec-SOD and Mg-SOD), heat shock proteins (HSPs), growth factors such as insulin like growth factor (IGF)-1 and hepatocyte growth factor (HGF), antiapoptotic proteins such as Bcl-2 and Bcl-xL, pro-apoptotic proteins such as FasL, Bcl-2, Bax, caspase-3 and p53, and proangiogenic genes such as TGFbeta, sphingosine kinase 1 (SPK1), and PI3K-Akt. By identifying the gene expression profiles of IRI and ischemic conditioning, one may reveal potential gene targets responsible for cardioprotection. In this manuscript, we review the current state of the art of gene therapy in cardioprotection and propose that gene expression analysis facilitates the identification of individual genes associated with cardioprotection. We discuss signaling pathways associated with cardioprotection that can be targeted by gene therapy to achieve cardioprotection. Copyright © 2015. Published by Elsevier Ireland Ltd.

Exon-skipping strategy by ratio modulation between cytoprotective versus pro-apoptotic clusterin forms increased sensitivity of LNCaP to cell death.

Directory of Open Access Journals (Sweden)

Abdellatif Essabbani

Full Text Available BACKGROUND: In prostate cancer the secreted form of clusterin (sCLU has been described as an anti-apoptotic protein whose expression is increased after therapeutic intervention, whereas, the nuclear protein form nCLU was reported to have pro-apoptotic properties. METHODOLOGY: In order to provide new therapeutic approaches targeting CLU, we developed a strategy based on exon skipping by using a lentiviral construct to preferentially induce the nuclear spliced form of the protein. The molecular construct was transduced in LNCaP cells for testing the modulation of sensitivity of the transduced cells to pro-apoptotic stress. RESULTS AND CONCLUSIONS: We showed an increase of nCLU/sCLU expression ratio in the prostate cancer cell line "LNCaP" after lentiviral vector-U7 nCLU transduction. Moreover, we showed a significant inhibition of cell proliferation in nCLU-U7 LNCaP cells after treatment with cisplatin and after exposure to ionizing radiation compared to control cells. Finally, we showed that nCLU-U7 LNCaP cells exposure to UV-C significantly reduced an increase of cell death compared to control. Finally, we showed that modulating nCLU expression had profound impact on Ku70/Bax interaction as well as Rad17 expression which could be a key mechanism in sensitizing cells to cell death. In conclusion, this is the first report showing that increasing of nCLU/sCLU expression ratio by using an "on demand alternative splicing" strategy successfully increased sensitivity to radiotherapy and chemotherapy of prostate cancer cells.

Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

Science.gov (United States)

de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

2012-12-01

The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

Association of porcine UCP3 gene polymorphisms with fatness traits ...

African Journals Online (AJOL)

Administrator

2011-04-25

Apr 25, 2011 ... ... for fatness traits in pig. Polymorphism in UCP3 gene may change the function ... NM_214049) and human UCP3 gene DNA sequence (GenBank accession No. NC_000011). ..... Sleep, 29: 645-649. Zhao J, Li H, Kong X, ...

DNA methylation and gene expression of HIF3A

DEFF Research Database (Denmark)

Main, Ailsa Maria; Gillberg, Linn; Jacobsen, Anna Louisa

2016-01-01

from 48 families, from whom we had SAT and muscle biopsies. DNA methylation of four CpG sites in the HIF3A promoter was analyzed in the blood and SAT by pyrosequencing, and HIF3A gene expression was analyzed in SAT and muscle by qPCR. An index of whole-body insulin sensitivity was estimated from oral...... individuals, and whether HIF3A gene expression in SAT and skeletal muscle biopsies showed associations with BMI and insulin resistance. Furthermore, we aimed to investigate gender specificity and heritability of these traits. METHODS: We studied 137 first-degree relatives of type 2 diabetes (T2D) patients...... glucose tolerance tests. RESULTS: BMI was associated with HIF3A methylation at one CpG site in the blood, and there was a positive association between the blood and SAT methylation levels at a different CpG site within the individuals. The SAT methylation level did not correlate with HIF3A gene expression...

The role of signal transducer and activator of transcription 3 in Rift Valley fever virus infection

International Nuclear Information System (INIS)

Pinkham, Chelsea; An, Soyeon; Lundberg, Lindsay; Bansal, Neha; Benedict, Ashwini; Narayanan, Aarthi; Kehn-Hall, Kylene

2016-01-01

Rift Valley fever (RVF) is a zoonotic disease that can cause severe illness in humans and livestock, triggering spontaneous abortion in almost 100% of pregnant ruminants. In this study, we demonstrate that signal transducer and activator of transcription 3 (STAT3) is phosphorylated on its conserved tyrosine residue (Y705) following RVFV infection. This phosphorylation was dependent on a major virulence factor, the viral nonstructural protein NSs. Loss of STAT3 had little effect on viral replication, but rather resulted in cells being more susceptible to RVFV-induced cell death. Phosphorylated STAT3 translocated to the nucleus, coinciding with inhibition of fos, jun, and nr4a2 gene expression, and the presence of STAT3 and NSs at the nr4a2 promoter. NSs was found predominantly in the cytoplasm of STAT3 null cells, indicating that STAT3 influences NSs nuclear localization. Collectively, these data demonstrate that STAT3 functions in a pro-survival capacity through modulation of NSs localization. - Highlights: • STAT3 is phosphorylated on tyrosine residue 705 following RVFV infection. • Phosphorylation of STAT3 was dependent on the viral protein NSs. • STAT3 -/- MEFs were more susceptible to RVFV-induced cell death. • Loss of STAT3 led to an increase in pro-apoptotic gene expression. • STAT3 functions in a pro-survival capacity by modulation of NSs localization.

The role of signal transducer and activator of transcription 3 in Rift Valley fever virus infection

Energy Technology Data Exchange (ETDEWEB)

Pinkham, Chelsea; An, Soyeon; Lundberg, Lindsay; Bansal, Neha; Benedict, Ashwini; Narayanan, Aarthi; Kehn-Hall, Kylene, E-mail: kkehnhal@gmu.edu

2016-09-15

Rift Valley fever (RVF) is a zoonotic disease that can cause severe illness in humans and livestock, triggering spontaneous abortion in almost 100% of pregnant ruminants. In this study, we demonstrate that signal transducer and activator of transcription 3 (STAT3) is phosphorylated on its conserved tyrosine residue (Y705) following RVFV infection. This phosphorylation was dependent on a major virulence factor, the viral nonstructural protein NSs. Loss of STAT3 had little effect on viral replication, but rather resulted in cells being more susceptible to RVFV-induced cell death. Phosphorylated STAT3 translocated to the nucleus, coinciding with inhibition of fos, jun, and nr4a2 gene expression, and the presence of STAT3 and NSs at the nr4a2 promoter. NSs was found predominantly in the cytoplasm of STAT3 null cells, indicating that STAT3 influences NSs nuclear localization. Collectively, these data demonstrate that STAT3 functions in a pro-survival capacity through modulation of NSs localization. - Highlights: • STAT3 is phosphorylated on tyrosine residue 705 following RVFV infection. • Phosphorylation of STAT3 was dependent on the viral protein NSs. • STAT3 -/- MEFs were more susceptible to RVFV-induced cell death. • Loss of STAT3 led to an increase in pro-apoptotic gene expression. • STAT3 functions in a pro-survival capacity by modulation of NSs localization.

Targeting proapoptotic protein BAD inhibits survival and self-renewal of cancer stem cells.

Science.gov (United States)

Sastry, K S R; Al-Muftah, M A; Li, Pu; Al-Kowari, M K; Wang, E; Ismail Chouchane, A; Kizhakayil, D; Kulik, G; Marincola, F M; Haoudi, A; Chouchane, L

2014-12-01

Emerging evidence suggests that the resistance of cancer stem cells (CSC) to many conventional therapies is one of the major limiting factors of cancer therapy efficacy. Identification of mechanisms responsible for survival and self-renewal of CSC will help design new therapeutic strategies that target and eliminate both differentiated cancer cells and CSC. Here we demonstrated the potential role of proapoptotic protein BAD in the biology of CSC in melanoma, prostate and breast cancers. We enriched CD44(+)/CD24(-) cells (CSC) by tumorosphere formation and purified this population by FACS. Both spheres and CSC exhibited increased potential for proliferation, migration, invasion, sphere formation, anchorage-independent growth, as well as upregulation of several stem cell-associated markers. We showed that the phosphorylation of BAD is essential for the survival of CSC. Conversely, ectopic expression of a phosphorylation-deficient mutant BAD induced apoptosis in CSC. This effect was enhanced by treatment with a BH3-mimetic, ABT-737. Both pharmacological agents that inhibit survival kinases and growth factors that are involved in drug resistance delivered their respective cytotoxic and protective effects by modulating the BAD phosphorylation in CSC. Furthermore, the frequency and self-renewal capacity of CSC was significantly reduced by knocking down the BAD expression. Consistent with our in vitro results, significant phosphorylation of BAD was found in CD44(+) CSC of 83% breast tumor specimens. In addition, we also identified a positive correlation between BAD expression and disease stage in prostate cancer, suggesting a role of BAD in tumor advancement. Our studies unveil the role of BAD in the survival and self-renewal of CSC and propose BAD not only as an attractive target for cancer therapy but also as a marker of tumor progression.

IL-1beta-induced chemokine and Fas expression are inhibited by suppressor of cytokine signalling-3 in insulin-producing cells

DEFF Research Database (Denmark)

Jacobsen, M L B; Rønn, S G; Bruun, C

2008-01-01

AIMS/HYPOTHESIS: Chemokines recruit activated immune cells to sites of inflammation and are important mediators of insulitis. Activation of the pro-apoptotic receptor Fas leads to apoptosis-mediated death of the Fas-expressing cell. The pro-inflammatory cytokines IL-1beta and IFN-gamma regulate...... the transcription of genes encoding the Fas receptor and several chemokines. We have previously shown that suppressor of cytokine signalling (SOCS)-3 inhibits IL-1beta- and IFN-gamma-induced nitric oxide production in a beta cell line. The aim of this study was to investigate whether SOCS-3 can influence cytokine......-induced Fas and chemokine expression in beta cells. METHODS: Using a beta cell line with inducible Socs3 expression or primary neonatal rat islet cells transduced with a Socs3-encoding adenovirus, we employed real-time RT-PCR analysis to investigate whether SOCS-3 affects cytokine-induced chemokine and Fas m...

Time-dependent transcriptional response of GOT1 human small intestine neuroendocrine tumor after 177Lu[Lu]-octreotate therapy.

Science.gov (United States)

Spetz, Johan; Rudqvist, Nils; Langen, Britta; Parris, Toshima Z; Dalmo, Johanna; Schüler, Emil; Wängberg, Bo; Nilsson, Ola; Helou, Khalil; Forssell-Aronsson, Eva

2018-05-01

Patients with neuroendocrine tumors expressing somatostatin receptors are often treated with 177 Lu[Lu]-octreotate. Despite being highly effective in animal models, 177 Lu[Lu]-octreotate-based therapies in the clinical setting can be optimized further. The aims of the study were to identify and elucidate possible optimization venues for 177 Lu[Lu]-octreotate tumor therapy by characterizing transcriptional responses in the GOT1 small intestine neuroendocrine tumor model in nude mice. GOT1-bearing female BALB/c nude mice were intravenously injected with 15 MBq 177 Lu[Lu]-octreotate (non-curative amount) or mock-treated with saline solution. Animals were killed 1, 3, 7 or 41 d after injection. Total RNA was extracted from the tumor samples and profiled using Illumina microarray expression analysis. Differentially expressed genes were identified (treated vs. control) and pathway analysis was performed. Distribution of differentially expressed transcripts indicated a time-dependent treatment response in GOT1 tumors after 177 Lu[Lu]-octreotate administration. Regulation of CDKN1A, BCAT1 and PAM at 1 d after injection was compatible with growth arrest as the initial response to treatment. Upregulation of APOE and BAX at 3 d, and ADORA2A, BNIP3, BNIP3L and HSPB1 at 41 d after injection suggests first activation and then inhibition of the intrinsic apoptotic pathway during tumor regression and regrowth, respectively. Transcriptional analysis showed radiation-induced apoptosis as an early response after 177 Lu[Lu]-octreotate administration, followed by pro-survival transcriptional changes in the tumor during the regrowth phase. Time-dependent changes in cell cycle and apoptosis-related processes suggest different time points after radionuclide therapy when tumor cells may be more susceptible to additional treatment, highlighting the importance of timing when administering multiple therapeutic agents. Copyright © 2018 The Authors. Published by Elsevier Inc. All

Gene Expression ‏‏‏‏Profiles of BAD and Bcl-xL in the CA1 Region of the Hippocampus Following Global Ischemic/Reperfusion and FK-506 Administration.

Science.gov (United States)

Badr, Ramak; Hashemi, Mehrdad; Javadi, Gholamreza; Movafagh, Abolfazl; Mahdian, Reza

2015-12-01

The hippocampus is a tiny nub in the mammalian brain that is involved in forming, organizing, and storing memories. Global cerebral ischemia (GCI) and reperfusion induced apoptosis lead to cell injury and death. FK-506 is a strong immunosuppressant drug that has neuroprotective effects on the hypoxic-ischemic effects of brain damage. BAD and Bcl-xL are pro-apoptotic and anti-apoptotic genes, respectively. These genes belong to The B-cell lymphoma-2 (Bcl-2) family. In this study, we assessed the neurotrophic properties of FK-506 on expression of the BAD and Bcl-xL genes in the hippocampus following global ischemia and reperfusion. In the present experimental study, adult male Wistar rats were obtained and housed under standard conditions in the Tehran University of Medical Science in Iran. Rats were equally distributed in groups of three among the following groups: normal control, treated-1 (ischemia/reperfusion), and treated-2 (ischemia/reperfusion followed by FK-506). Global ischemia was induced for animals in the treated-1 and treated-2 groups. In treated-2, two doses of FK-506 were injected: one dose as an IV injection immediately after reperfusion and another as an intra-peritoneal (IP) injection after 48 hours. Then, the hippocampus tissue was removed after anaesthetizing the rats. RNA was isolated, cDNA was synthesized, and real-time PCR was performed. Finally, the obtained data were analyzed statistically (P value ˂ 0.05). The quantitative results of real-time PCR show that the mRNA expression ratio of Bcl-xL down-regulated was 0.75 ± 0.06 in the ischemia/reperfusion group versus 1.57 ± 0.09 in the control group (P value BAD up-regulated in the ischemia/reperfusion + FK506 group was 3.65 ± 0.49 compared to Normal control (1.39 ± 0.09) and Ischemia/reperfusion + FK506 was 1.09 ± 0.20 (P value BAD /Bcl-xL) confirmed that expression of the pro-apoptotic gene significantly decreased (P value ˂ 0.001) under the ischemia/reperfusion condition. In contrast

Irigenin sensitizes TRAIL-induced apoptosis via enhancing pro-apoptotic molecules in gastric cancer cells.

Science.gov (United States)

Xu, Ying; Gao, Cheng-Cheng; Pan, Zhen-Guo; Zhou, Chuan-Wen

2018-02-12

Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) holds promising value for cancer therapy due to its capacity to induce apoptosis in cancer cells. Nevertheless, TRAIL therapy is greatly hampered by its resistance. Irigenin (Iri), isoflavonoids, can be isolated from the rhizome of Belamcanda chinensis, and has been shown anti-cancer properties. In this study, we explored if Iri could enhance TRAIL-regulated apoptosis in TRAIL resistant gastric cancer cells. Iri significantly potentiated TRAIL-triggered cytotoxicity. Iri alone and TRAIL alone showed no effective role in apoptosis induction, whereas combined treatment with Iri and TRAIL markedly induced apoptosis in cancer cells, as evidenced by the up-regulation of cleaved Caspase-8/-9/-3 and PARP. Additionally, the sensitization to TRAIL was along with the enhancement of pro-apoptotic proteins, including FAS-associated protein with death domain (FADD), death receptor 5 (DR5) and Bax. And suppressing FADD, DR5 and Bax by si RNA significantly reduced the apoptosis and enhanced the cell viability induced by the co-application of Iri and TRAIL. Moreover, the sensitization to TRAIL was accompanied by the decrease of Cellular-FLICE inhibitory protein (c-FLIP), Bcl-2 and Survivin. Additionally, Iri could sensitize TRAIL to produce reactive oxygen species (ROS). Pre-treatment of N-acetyl-cysteine (NAC), ROS scavenger, attenuated Iri plus TRAIL-induced apoptosis and improved cell viability. Finally, combination of Iri and TRAIL inhibited tumor growth in the xenograft model. Collectively, our present study gave new insights into the effects of Iri on potentiating TRAIL-sensitivity, and suggested that Iri could be a potential candidate for sensitizer of TRAIL-resistant cancer cell treatment. Copyright © 2018. Published by Elsevier Inc.

14-3-3theta protects against neurotoxicity in a cellular Parkinson's disease model through inhibition of the apoptotic factor Bax.

Directory of Open Access Journals (Sweden)

Sunny R Slone

Full Text Available Disruption of 14-3-3 function by alpha-synuclein has been implicated in Parkinson's disease. As 14-3-3s are important regulators of cell death pathways, disruption of 14-3-3s could result in the release of pro-apoptotic factors, such as Bax. We have previously shown that overexpression of 14-3-3θ reduces cell loss in response to rotenone and MPP(+ in dopaminergic cell culture and reduces cell loss in transgenic C. elegans that overexpress alpha-synuclein. In this study, we investigate the mechanism for 14-3-3θ's neuroprotection against rotenone toxicity. While 14-3-3s can inhibit many pro-apoptotic factors, we demonstrate that inhibition of one factor in particular, Bax, is important to 14-3-3s' protection against rotenone toxicity in dopaminergic cells. We found that 14-3-3θ overexpression reduced Bax activation and downstream signaling events, including cytochrome C release and caspase 3 activation. Pharmacological inhibition or shRNA knockdown of Bax provided protection against rotenone, comparable to 14-3-3θ's neuroprotective effects. A 14-3-3θ mutant incapable of binding Bax failed to protect against rotenone. These data suggest that 14-3-3θ's neuroprotective effects against rotenone are at least partially mediated by Bax inhibition and point to a potential therapeutic role of 14-3-3s in Parkinson's disease.

RPA Interacts with HIRA and Regulates H3.3 Deposition at Gene Regulatory Elements in Mammalian Cells.

Science.gov (United States)

Zhang, Honglian; Gan, Haiyun; Wang, Zhiquan; Lee, Jeong-Heon; Zhou, Hui; Ordog, Tamas; Wold, Marc S; Ljungman, Mats; Zhang, Zhiguo

2017-01-19

The histone chaperone HIRA is involved in depositing histone variant H3.3 into distinct genic regions, including promoters, enhancers, and gene bodies. However, how HIRA deposits H3.3 to these regions remains elusive. Through a short hairpin RNA (shRNA) screening, we identified single-stranded DNA binding protein replication protein A (RPA) as a regulator of the deposition of newly synthesized H3.3 into chromatin. We show that RPA physically interacts with HIRA to form RPA-HIRA-H3.3 complexes, and it co-localizes with HIRA and H3.3 at gene promoters and enhancers. Depletion of RPA1, the largest subunit of the RPA complex, dramatically reduces both HIRA association with chromatin and the deposition of newly synthesized H3.3 at promoters and enhancers and leads to altered transcription at gene promoters. These results support a model whereby RPA, best known for its role in DNA replication and repair, recruits HIRA to promoters and enhancers and regulates deposition of newly synthesized H3.3 to these regulatory elements for gene regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

BH3-only protein Bim inhibits activity of antiapoptotic members of Bcl-2 family when expressed in yeast.

Science.gov (United States)

Juhásová, Barbora; Mentel, Marek; Bhatia-Kiššová, Ingrid; Zeman, Igor; Kolarov, Jordan; Forte, Michael; Polčic, Peter

2011-09-02

Proteins of the Bcl-2 family regulate programmed cell death in mammals by promoting the release of cytochrome c from mitochondria in response to various proapoptotic stimuli. The mechanism by which BH3-only members of the family activate multidomain proapoptotic proteins Bax and Bak to form a pore in mitochondrial membranes remains under dispute. We report that cell death promoting activity of BH3-only protein Bim can be reconstituted in yeast when both Bax and antiapoptotic protein Bcl-X(L) are present, suggesting that Bim likely activates Bax indirectly by inhibiting antiapoptotic proteins. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

MTA3 regulates CGB5 and Snail genes in trophoblast

Energy Technology Data Exchange (ETDEWEB)

Chen, Ying [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Miyazaki, Jun [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Nishizawa, Haruki [Department of Obstetrics and Gynecology, Fujita Health University School of Medicine, Fujita Health University, Toyoake (Japan); Kurahashi, Hiroki [Division of Molecular Genetics, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake (Japan); Leach, Richard, E-mail: Richard.Leach@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States); Department of Obstetrics, Gynecology and Women’s Health, Spectrum Health Medical Group, Grand Rapids, MI 49503 (United States); Wang, Kai, E-mail: Kai.Wang@hc.msu.edu [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids, MI 49503 (United States)

2013-04-19

Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

MTA3 regulates CGB5 and Snail genes in trophoblast

International Nuclear Information System (INIS)

Chen, Ying; Miyazaki, Jun; Nishizawa, Haruki; Kurahashi, Hiroki; Leach, Richard; Wang, Kai

2013-01-01

Highlights: •Impaired MTA3, raised CGB5 and Snail expression are associated with preeclampsia. •Knock-down of MTA3 causes up-regulation of CGB5 and Snail genes in BeWo cells. •MTA3 occupies CGB5 and Snail gene promoters in BeWo cells. -- Abstract: Secreted by the placental trophoblast, human chorionic gonadotropin (hCG) is an important hormone during pregnancy and is required for the maintenance of pregnancy. Previous studies have shown that dys-regulation of hCG expression is associated with preeclampsia. However, the exact relationship between altered hCG levels and development of preeclampsia is unknown. Metastasis associated protein 3 (MTA3), a chromatin remodeling protein, is abundantly expressed in the placental trophoblasts, but its function is unknown. In breast cancer, MTA3 has been shown to repress the expression of Snail and cell migration. However, whether MTA3 acts similarly in the trophoblast has not been investigated. In the present study, we examined the role of MTA3 in regulating the hCG β-subunit gene (gene name: CGB5) and Snail expression in the trophoblast cell line, BeWo, as well as its relevance to the high hCG expression levels seen in preeclampsia. First, we investigated MTA3 expression in preeclamptic placenta as compared to normal control placenta via gene expression microarray and qRT-PCR and found that MTA3 was significantly down-regulated, whereas both CGB5 and Snail were up-regulated in preeclamptic placenta. Secondly, we knocked down MTA3 gene in trophoblast cell line BeWo and found Snail and hCG were both up-regulated, suggesting that MTA3 represses Snail and hCG gene expression in trophoblasts. Next, we cloned the CGB5 and Snail promoters into the pGL3-basic vector individually and found that silencing of MTA3 by siRNA resulted in an increase of both CGB5 and Snail promoter activities. To confirm that this MTA3 inhibition is a direct effect, we performed a chromatin immune-precipitation (ChIP) assay and found that MTA3

Human colon cancer targeted pro-apoptotic, anti-metastatic and cytostatic effects of binuclear Silver(I)-N-Heterocyclic carbene (NHC) complexes.

Science.gov (United States)

Asif, Muhammad; Iqbal, Muhammad Adnan; Hussein, Mouayed A; Oon, Chern Ein; Haque, Rosenani A; Khadeer Ahamed, Mohamed B; Abdul Majid, Aman Shah; Abdul Majid, Amin Malik Shah

2016-01-27

The current mechanistic study was conducted to explore the effects of increased lipophilicity of binuclear silver(I)-NHC complexes on cytotoxicity. Two new silver(I)-N-Heterocyclic Carbene (NHC) complexes (3 and 4), having lypophilic terminal alkyl chains (Octyl and Decyl), were derived from meta-xylyl linked bis-benzimidazolium salts (1 and 2). Each of the synthesized compounds was characterized by microanalysis and spectroscopic techniques. The complexes were tested for their cytotoxicity against a panel of human cancer c as well normal cell lines using MTT assay. Based on MTT assay results, complex 4 was found to be selectively toxic towards human colorectal carcinoma cell line (HCT 116). Complex 4 was further studied in detail to explore the mechanism of cell death and findings of the study revealed that complex 4 has promising pro-apoptotic and anti-metastatic activities against HCT 116 cells. Furthermore, it showed pronounced cytostatic effects in HCT 116 multicellular spheroid model. Hence, binuclear silver(I)-NHC complexes with longer terminal aliphatic chains have worth to be further studied against human colon cancer for the purpose of drug development. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Cry3A δ-endotoxin gene mutagenized for enhanced toxicity

African Journals Online (AJOL)

Bacillus thuringiensis Cry3A gene was redesigned for high expression in Norwegian spruce and the sequence was slightly modified to allow for simple N- and C- terminal deletions and domain II loop 1 exchange for synthetic oligos. Modified Cry3A toxins from 13 variants of the synthetic gene were expressed in Escherichia ...

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

Directory of Open Access Journals (Sweden)

Phelan Anne

2007-06-01

Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

The relationship between Prostate CAncer gene 3 (PCA3) and prostate cancer significance

NARCIS (Netherlands)

van Poppel, Hein; Haese, Alexander; Graefen, Markus; de la Taille, Alexandre; Irani, Jacques; de Reijke, Theo; Remzi, Mesut; Marberger, Michael

2012-01-01

OBJECTIVE To evaluate the relationship between Prostate CAncer gene 3 (PCA3) and prostate cancer significance. PATIENTS AND METHODS Clinical data from two multi-centre European open-label, prospective studies evaluating the clinical utility of the PCA3 assay in guiding initial and repeat biopsy

Association of HS6ST3 gene polymorphisms with obesity and ...

Indian Academy of Sciences (India)

The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes. We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such ...

Arabidopsis ATRX Modulates H3.3 Occupancy and Fine-Tunes Gene Expression

KAUST Repository

Duc, Cé line; Benoit, Matthias; Dé tourné , Gwé naë lle; Simon, Lauriane; Poulet, Axel; Jung, Matthieu; Veluchamy, Alaguraj; Latrasse, David; Le Goff, Samuel; Cotterell, Sylviane; Tatout, Christophe; Benhamed, Moussa; Probst, Aline V.

2017-01-01

, including the 45S ribosomal DNA (45S rDNA) loci, where loss of ATRX results in altered expression of specific 45S rDNA sequence variants. At the genome-wide scale, our data indicate that ATRX modifies gene expression concomitantly to H3.3 deposition at a set

An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

International Nuclear Information System (INIS)

Jin Tao; Zou Liuhe; Yang Ling

2004-01-01

Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

PPARγ partial agonist GQ-16 strongly represses a subset of genes in 3T3-L1 adipocytes

Energy Technology Data Exchange (ETDEWEB)

Milton, Flora Aparecida [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Cvoro, Aleksandra [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Amato, Angelica A. [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Sieglaff, Douglas H.; Filgueira, Carly S.; Arumanayagam, Anithachristy Sigamani [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States); Caro Alves de Lima, Maria do; Rocha Pitta, Ivan [Laboratório de Planejamento e Síntese de Fármacos – LPSF, Universidade Federal de Pernambuco (Brazil); Assis Rocha Neves, Francisco de [Faculdade de Ciências da Saúde, Laboratório de Farmacologia Molecular, Universidade de Brasília (Brazil); Webb, Paul, E-mail: pwebb@HoustonMethodist.org [Genomic Medicine, Houston Methodist Research Institute, Houston, TX (United States)

2015-08-28

Thiazolidinediones (TZDs) are peroxisome proliferator-activated receptor gamma (PPARγ) agonists that improve insulin resistance but trigger side effects such as weight gain, edema, congestive heart failure and bone loss. GQ-16 is a PPARγ partial agonist that improves glucose tolerance and insulin sensitivity in mouse models of obesity and diabetes without inducing weight gain or edema. It is not clear whether GQ-16 acts as a partial agonist at all PPARγ target genes, or whether it displays gene-selective actions. To determine how GQ-16 influences PPARγ activity on a gene by gene basis, we compared effects of rosiglitazone (Rosi) and GQ-16 in mature 3T3-L1 adipocytes using microarray and qRT-PCR. Rosi changed expression of 1156 genes in 3T3-L1, but GQ-16 only changed 89 genes. GQ-16 generally showed weak effects upon Rosi induced genes, consistent with partial agonist actions, but a subset of modestly Rosi induced and strongly repressed genes displayed disproportionately strong GQ-16 responses. PPARγ partial agonists MLR24 and SR1664 also exhibit disproportionately strong effects on transcriptional repression. We conclude that GQ-16 displays a continuum of weak partial agonist effects but efficiently represses some negatively regulated PPARγ responsive genes. Strong repressive effects could contribute to physiologic actions of GQ-16. - Highlights: • GQ-16 is an insulin sensitizing PPARγ ligand with reduced harmful side effects. • GQ-16 displays a continuum of weak partial agonist activities at PPARγ-induced genes. • GQ-16 exerts strong repressive effects at a subset of genes. • These inhibitor actions should be evaluated in models of adipose tissue inflammation.

PPARγ partial agonist GQ-16 strongly represses a subset of genes in 3T3-L1 adipocytes

International Nuclear Information System (INIS)

Milton, Flora Aparecida; Cvoro, Aleksandra; Amato, Angelica A.; Sieglaff, Douglas H.; Filgueira, Carly S.; Arumanayagam, Anithachristy Sigamani; Caro Alves de Lima, Maria do; Rocha Pitta, Ivan; Assis Rocha Neves, Francisco de; Webb, Paul

2015-01-01

Thiazolidinediones (TZDs) are peroxisome proliferator-activated receptor gamma (PPARγ) agonists that improve insulin resistance but trigger side effects such as weight gain, edema, congestive heart failure and bone loss. GQ-16 is a PPARγ partial agonist that improves glucose tolerance and insulin sensitivity in mouse models of obesity and diabetes without inducing weight gain or edema. It is not clear whether GQ-16 acts as a partial agonist at all PPARγ target genes, or whether it displays gene-selective actions. To determine how GQ-16 influences PPARγ activity on a gene by gene basis, we compared effects of rosiglitazone (Rosi) and GQ-16 in mature 3T3-L1 adipocytes using microarray and qRT-PCR. Rosi changed expression of 1156 genes in 3T3-L1, but GQ-16 only changed 89 genes. GQ-16 generally showed weak effects upon Rosi induced genes, consistent with partial agonist actions, but a subset of modestly Rosi induced and strongly repressed genes displayed disproportionately strong GQ-16 responses. PPARγ partial agonists MLR24 and SR1664 also exhibit disproportionately strong effects on transcriptional repression. We conclude that GQ-16 displays a continuum of weak partial agonist effects but efficiently represses some negatively regulated PPARγ responsive genes. Strong repressive effects could contribute to physiologic actions of GQ-16. - Highlights: • GQ-16 is an insulin sensitizing PPARγ ligand with reduced harmful side effects. • GQ-16 displays a continuum of weak partial agonist activities at PPARγ-induced genes. • GQ-16 exerts strong repressive effects at a subset of genes. • These inhibitor actions should be evaluated in models of adipose tissue inflammation

[Toxic effect of trichloroethylene on liver cells with CYP3A4 gene defect].

Science.gov (United States)

Liao, R Y; Liu, S

2016-06-20

To investigate the toxic effect of trichloroethylene on liver cells with CYP3A4 gene defect. The normal human liver cells (L02 cells) and liver cells with CYP3A4 gene defect were exposed to trichloroethylene at different doses (0.0, 0.4, 0.8, 1.6, 3.2, and 6.4 mmol/L). CCK8 assay and RT-qPCR were used to measure cell viability and changes in the expression of apoptosis genes and oncogenes. After being exposed to trichloroethylene at doses of 1.6, 3.2, and 6.4 mmol/L, the liver cells with CYP3A4 gene defect showed significantly higher cell viability than L02 cells (0.91±0.06/0.89±0.05/0.85±0.07 vs 0.80±0.04/0.73±0.06/0.67±0.07, Ptrichloroethylene groups showed significant increases in the expression of the apoptosis genes caspase-3, caspase-8, and caspase-9 (PTrichloroethylene exposure has a less effect on the expression of apoptosis genes and oncogenes in liver cells with CYP3A4 gene defect than in normal human liver cells, suggesting that CYP3A4 gene defect reduces the inductive effect of trichloroethylene on apoptosis genes and oncogenes.

Proapoptotic and Antiproliferative Effects of Thymus caramanicus on Human Breast Cancer Cell Line (MCF-7 and Its Interaction with Anticancer Drug Vincristine

Directory of Open Access Journals (Sweden)

Saeed Esmaeili-Mahani

2014-01-01

Full Text Available Thymus caramanicus Jalas is one of the species of thymus that grows in the wild in different regions of Iran. Traditionally, leaves of this plant are used in the treatment of diabetes, arthritis, and cancerous situation. Therefore, the present study was designed to investigate the selective cytotoxic and antiproliferative properties of Thymus caramanicus extract (TCE. MCF-7 human breast cancer cells were used in this study. Cytotoxicity of the extract was determined using MTT and neutral red assays. Biochemical markers of apoptosis (caspase 3, Bax, and Bcl-2 and cell proliferation (cyclin D1 were evaluated by immunoblotting. Vincristine was used as anticancer control drug in extract combination therapy. The data showed that incubation of cells with TCE (200 and 250 μg/mL significantly increased cell damage, activated caspase 3 and Bax/Bcl2 ratio. In addition, cyclin D1 was significantly decreased in TCE-treated cells. Furthermore, concomitant treatment of cells with extract and anticancer drug produced a significant cytotoxic effect as compared to extract or drugs alone. In conclusion, thymus extract has a potential proapoptotic/antiproliferative property against human breast cancer cells and its combination with chemotherapeutic agent vincristine may induce cell death effectively and be a potent modality to treat this type of cancer.

NCKX3 was compensated by calcium transporting genes and bone resorption in a NCKX3 KO mouse model.

Science.gov (United States)

Yang, Hyun; Ahn, Changhwan; Shin, Eun-Kyeong; Lee, Ji-Sun; An, Beum-Soo; Jeung, Eui-Bae

2017-10-15

Gene knockout is the most powerful tool for determination of gene function or permanent modification of the phenotypic characteristics of an animal. Existing methods for gene disruption are limited by their efficiency, time required for completion and potential for confounding off-target effects. In this study, a rapid single-step approach to knockout of a targeted gene in mice using zinc-finger nucleases (ZFNs) was demonstrated for generation of mutant (knockout; KO) alleles. Specifically, ZFNs to target the sodium/calcium/potassium exchanger3 (NCKX3) gene in C57bl/6j were designed using the concept of this approach. NCKX3 KO mice were generated and the phenotypic characterization and molecular regulation of active calcium transporting genes was assessed when mice were fed different calcium diets during growth. General phenotypes such as body weight and plasma ion level showed no distinct abnormalities. Thus, the potassium/sodium/calcium exchanger of NCKX3 KO mice proceeded normally in this study. As a result, the compensatory molecular regulation of this mechanism was elucidated. Renal TRPV5 mRNA of NCKX3 KO mice increased in both male and female mice. Expression of TRPV6 mRNA was only down-regulated in the duodenum of male KO mice. Renal- and duodenal expression of PTHR and VDR were not changed; however, GR mRNA expression was increased in the kidney of NCKX3 KO mice. Depletion of the NCKX3 gene in a KO mouse model showed loss of bone mineral contents and increased plasma parathyroid hormone, suggesting that NCKX3 may play a role in regulating calcium homeostasis. Copyright © 2017 Elsevier B.V. All rights reserved.

Genes Responsive to Low-Intensity Pulsed Ultrasound in MC3T3-E1 Preosteoblast Cells

Directory of Open Access Journals (Sweden)

Yoshiaki Tabuchi

2013-11-01

Full Text Available Although low-intensity pulsed ultrasound (LIPUS has been shown to enhance bone fracture healing, the underlying mechanism of LIPUS remains to be fully elucidated. Here, to better understand the molecular mechanism underlying cellular responses to LIPUS, we investigated gene expression profiles in mouse MC3T3-E1 preosteoblast cells exposed to LIPUS using high-density oligonucleotide microarrays and computational gene expression analysis tools. Although treatment of the cells with a single 20-min LIPUS (1.5 MHz, 30 mW/cm2 did not affect the cell growth or alkaline phosphatase activity, the treatment significantly increased the mRNA level of Bglap. Microarray analysis demonstrated that 38 genes were upregulated and 37 genes were downregulated by 1.5-fold or more in the cells at 24-h post-treatment. Ingenuity pathway analysis demonstrated that the gene network U (up contained many upregulated genes that were mainly associated with bone morphology in the category of biological functions of skeletal and muscular system development and function. Moreover, the biological function of the gene network D (down, which contained downregulated genes, was associated with gene expression, the cell cycle and connective tissue development and function. These results should help to further clarify the molecular basis of the mechanisms of the LIPUS response in osteoblast cells.

Epstein-Barr virus-induced gene 3 (EBI3) polymorphisms and expression are associated with susceptibility to pulmonary tuberculosis.

Science.gov (United States)

Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue

2015-07-01

Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Allelic variants of melanocortin 3 receptor gene (MC3R) and weight loss in obesity

DEFF Research Database (Denmark)

L. Santos, José; De la Cruz, Rolando; Holst, Claus

2011-01-01

receptor gene (MC3R) have been associated with childhood obesity, higher BMI Z-score and elevated body fat percentage compared to non-carriers. The aim of this study is to assess the association in adults between allelic variants of MC3R with weight loss induced by energy-restricted diets.......The melanocortin system plays an important role in energy homeostasis. Mice genetically deficient in the melanocortin-3 receptor gene have a normal body weight with increased body fat, mild hypophagia compared to wild-type mice. In humans, Thr6Lys and Val81Ile variants of the melanocortin-3...

The HIV-1 Vpu protein induces apoptosis in Drosophila via activation of JNK signaling.

Directory of Open Access Journals (Sweden)

Christelle Marchal

Full Text Available The genome of the human immunodeficiency virus type 1 (HIV-1 encodes the canonical retroviral proteins, as well as additional accessory proteins that enhance the expression of viral genes, the infectivity of the virus and the production of virions. The accessory Viral Protein U (Vpu, in particular, enhances viral particle production, while also promoting apoptosis of HIV-infected human T lymphocytes. Some Vpu effects rely on its interaction with the ubiquitin-proteasome protein degradation system, but the mechanisms responsible for its pro-apoptotic effects in vivo are complex and remain largely to be elucidated.We took advantage of the Drosophila model to study the effects of Vpu activity in vivo. Expression of Vpu in the developing Drosophila wing provoked tissue loss due to caspase-dependent apoptosis. Moreover, Vpu induced expression of the pro-apoptotic gene reaper, known to down-regulate Inhibitor of Apoptosis Proteins (IAPs which are caspase-antagonizing E3 ubiquitin ligases. Indeed, Vpu also reduced accumulation of Drosophila IAP1 (DIAP1. Though our results demonstrate a physical interaction between Vpu and the proteasome-addressing SLIMB/β-TrCP protein, as in mammals, both SLIMB/βTrCP-dependent and -independent Vpu effects were observed in the Drosophila wing. Lastly, the pro-apoptotic effect of Vpu in this tissue was abrogated upon inactivation of the c-Jun N-terminal Kinase (JNK pathway. Our results in the fly thus provide the first functional evidence linking Vpu pro-apoptotic effects to activation of the conserved JNK pathway.

Genes of cell-cell interactions, chemotherapy detoxification and apoptosis are induced during chemotherapy of acute myeloid leukemia

International Nuclear Information System (INIS)

Øyan, Anne Margrete; Ånensen, Nina; Bø, Trond Hellem; Stordrange, Laila; Jonassen, Inge; Bruserud, Øystein; Kalland, Karl-Henning; Gjertsen, Bjørn Tore

2009-01-01

The molecular changes in vivo in acute myeloid leukemia cells early after start of conventional genotoxic chemotherapy are incompletely understood, and it is not known if early molecular modulations reflect clinical response. The gene expression was examined by whole genome 44 k oligo microarrays and 12 k cDNA microarrays in peripheral blood leukocytes collected from seven leukemia patients before treatment, 2–4 h and 18–24 h after start of chemotherapy and validated by real-time quantitative PCR. Statistically significantly upregulated genes were classified using gene ontology (GO) terms. Parallel samples were examined by flow cytometry for apoptosis by annexin V-binding and the expression of selected proteins were confirmed by immunoblotting. Significant differential modulation of 151 genes were found at 4 h after start of induction therapy with cytarabine and anthracycline, including significant overexpression of 31 genes associated with p53 regulation. Within 4 h of chemotherapy the BCL2/BAX and BCL2/PUMA ratio were attenuated in proapoptotic direction. FLT3 mutations indicated that non-responders (5/7 patients, 8 versus 49 months survival) are characterized by a unique gene response profile before and at 4 h. At 18–24 h after chemotherapy, the gene expression of p53 target genes was attenuated, while genes involved in chemoresistance, cytarabine detoxification, chemokine networks and T cell receptor were prominent. No signs of apoptosis were observed in the collected cells, suggesting the treated patients as a physiological source of pre-apoptotic cells. Pre-apoptotic gene expression can be monitored within hours after start of chemotherapy in patients with acute myeloid leukemia, and may be useful in future determination of therapy responders. The low number of patients and the heterogeneity of acute myeloid leukemia limited the identification of gene expression predictive of therapy response. Therapy-induced gene expression reflects the complex

Effects of C-reactive protein on adipokines genes expression in 3T3-L1 adipocytes

Energy Technology Data Exchange (ETDEWEB)

Yuan, Guoyue, E-mail: yuanguoyue@hotmail.com [Department of Endocrinology, The Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212001 (China); Jia, Jue; Di, Liangliang [Department of Endocrinology, The Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212001 (China); Zhou, Libin [Ruijin Hospital, Center of Molecular Medicine, Shanghai Institute of Endocrine and Metabolic Diseases, State Key Laboratory of Medical Genomics, Shanghai Jiaotong University Medical School, 197, Ruijin Road II, Shanghai 200025 (China); Dong, Sijing; Ye, Jingjing; Wang, Dong; Yang, Ling; Wang, Jifang [Department of Endocrinology, The Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212001 (China); Li, Lianxi [Department of Endocrinology and Metabolism, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, 600, Yishan Road, Shanghai 200233 (China); Yang, Ying [Ruijin Hospital, Center of Molecular Medicine, Shanghai Institute of Endocrine and Metabolic Diseases, State Key Laboratory of Medical Genomics, Shanghai Jiaotong University Medical School, 197, Ruijin Road II, Shanghai 200025 (China); Mao, Chaoming [Department of Endocrinology, The Affiliated Hospital of Jiangsu University, Zhenjiang, Jiangsu 212001 (China); Chen, Mingdao, E-mail: mingdaochensh@yahoo.com [Ruijin Hospital, Center of Molecular Medicine, Shanghai Institute of Endocrine and Metabolic Diseases, State Key Laboratory of Medical Genomics, Shanghai Jiaotong University Medical School, 197, Ruijin Road II, Shanghai 200025 (China)

2012-08-03

Highlights: Black-Right-Pointing-Pointer CRP increases TNF-{alpha} and IL-6 genes expression in matured 3T3-L1 adipocytes. Black-Right-Pointing-Pointer CRP suppresses adiponectin, leptin and PPAR-{gamma} mRNA levels in matured 3T3-L1 cells. Black-Right-Pointing-Pointer Wortmannin reverses effects of CRP on adiponectin, TNF-{alpha} and leptin mRNA levels. Black-Right-Pointing-Pointer CRP may regulate IR, obesity and metabolic syndrome by this mechanism. -- Abstract: Adipose tissue is now recognized to be an important endocrine organ, secreting a variety of adipokines that are involved in the regulation of energy metabolism, insulin resistance and metabolic syndrome. C-reactive protein (CRP) is considered as one of the most sensitive markers of inflammation. A number of studies have shown that elevation of CRP concentrations is an independent predictive parameter of type 2 diabetes mellitus, which is also strongly associated with various components of the metabolic syndrome. The aim of the present study is to investigate the effects of CRP on adipokines genes expression in 3T3-L1 adipocytes. Quantitative real-time PCR analysis revealed that CRP inhibited adiponectin, leptin and peroxisome proliferator-activated receptor-gamma (PPAR-{gamma}) genes expression and raised tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6 (IL-6) mRNA levels in matured 3T3-L1 adipocytes in a dose and time-dependent manner. Pharmacological inhibition of phosphatidylinositol (PI)-3 kinase by wortmannin partially reversed the effects of CRP on adiponectin, TNF-{alpha} and leptin genes expression. These results collectively suggest that CRP regulates adiponectin, TNF-{alpha}, leptin, IL-6 and PPAR-{gamma} genes expression, and that might represent a mechanism by which CRP regulates insulin resistance, obesity and metabolic syndrome.

Effects of C-reactive protein on adipokines genes expression in 3T3-L1 adipocytes

International Nuclear Information System (INIS)

Yuan, Guoyue; Jia, Jue; Di, Liangliang; Zhou, Libin; Dong, Sijing; Ye, Jingjing; Wang, Dong; Yang, Ling; Wang, Jifang; Li, Lianxi; Yang, Ying; Mao, Chaoming; Chen, Mingdao

2012-01-01

Highlights: ► CRP increases TNF-α and IL-6 genes expression in matured 3T3-L1 adipocytes. ► CRP suppresses adiponectin, leptin and PPAR-γ mRNA levels in matured 3T3-L1 cells. ► Wortmannin reverses effects of CRP on adiponectin, TNF-α and leptin mRNA levels. ► CRP may regulate IR, obesity and metabolic syndrome by this mechanism. -- Abstract: Adipose tissue is now recognized to be an important endocrine organ, secreting a variety of adipokines that are involved in the regulation of energy metabolism, insulin resistance and metabolic syndrome. C-reactive protein (CRP) is considered as one of the most sensitive markers of inflammation. A number of studies have shown that elevation of CRP concentrations is an independent predictive parameter of type 2 diabetes mellitus, which is also strongly associated with various components of the metabolic syndrome. The aim of the present study is to investigate the effects of CRP on adipokines genes expression in 3T3-L1 adipocytes. Quantitative real-time PCR analysis revealed that CRP inhibited adiponectin, leptin and peroxisome proliferator-activated receptor-gamma (PPAR-γ) genes expression and raised tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) mRNA levels in matured 3T3-L1 adipocytes in a dose and time-dependent manner. Pharmacological inhibition of phosphatidylinositol (PI)-3 kinase by wortmannin partially reversed the effects of CRP on adiponectin, TNF-α and leptin genes expression. These results collectively suggest that CRP regulates adiponectin, TNF-α, leptin, IL-6 and PPAR-γ genes expression, and that might represent a mechanism by which CRP regulates insulin resistance, obesity and metabolic syndrome.

Ethylene induces combinatorial effects of histone H3 acetylation in gene expression in Arabidopsis.

Science.gov (United States)

Wang, Likai; Zhang, Fan; Rode, Siddharth; Chin, Kevin K; Ko, Eun Esther; Kim, Jonghwan; Iyer, Vishwanath R; Qiao, Hong

2017-07-17

Histone acetylation and deacetylation are essential for gene regulation and have been implicated in the regulation of plant hormone responses. Many studies have indicated the role of histone acetylation in ethylene signaling; however, few studies have investigated how ethylene signaling regulates the genomic landscape of chromatin states. Recently, we found that ethylene can specifically elevate histone H3K14 acetylation and the non-canonical histone H3K23 acetylation in etiolated seedlings and the gene activation is positively associated with the elevation of H3K14Ac and H3K23Ac in response to ethylene. To assess the role of H3K9, H3K14, and H3K23 histone modifications in the ethylene response, we examined how ethylene regulates histone acetylation and the transcriptome at global level and in ethylene regulated genes both in wild type (Col-0) and ein2-5 seedlings. Our results revealed that H3K9Ac, H3K14Ac, and H3K23Ac are preferentially enriched around the transcription start sites and are positively correlated with gene expression levels in Col-0 and ein2-5 seedlings both with and without ethylene treatment. In the absence of ethylene, no combinatorial effect of H3K9Ac, H3K14Ac, and H3K23Ac on gene expression was detected. In the presence of ethylene, however, combined enrichment of the three histone acetylation marks was associated with high gene expression levels, and this ethylene-induced change was EIN2 dependent. In addition, we found that ethylene-regulated genes are expressed at medium or high levels, and a group of ethylene regulated genes are marked by either one of H3K9Ac, H3K14Ac or H3K23Ac. In this group of genes, the levels of H3K9Ac were altered by ethylene, but in the absence of ethylene the levels of H3K9Ac and peak breadths are distinguished in up- and down- regulated genes. In the presence of ethylene, the changes in the peak breadths and levels of H3K14Ac and H3K23Ac are required for the alteration of gene expressions. Our study reveals that

Vaccine-induced modulation of gene expression in turbot peritoneal cells. A microarray approach.

Science.gov (United States)

Fontenla, Francisco; Blanco-Abad, Verónica; Pardo, Belén G; Folgueira, Iria; Noia, Manuel; Gómez-Tato, Antonio; Martínez, Paulino; Leiro, José M; Lamas, Jesús

2016-07-01

We used a microarray approach to examine changes in gene expression in turbot peritoneal cells after injection of the fish with vaccines containing the ciliate parasite Philasterides dicentrarchi as antigen and one of the following adjuvants: chitosan-PVMMA microspheres, Freund́s complete adjuvant, aluminium hydroxide gel or Matrix-Q (Isconova, Sweden). We identified 374 genes that were differentially expressed in all groups of fish. Forty-two genes related to tight junctions and focal adhesions and/or actin cytoskeleton were differentially expressed in free peritoneal cells. The profound changes in gene expression related to cell adherence and cytoskeleton may be associated with cell migration and also with the formation of cell-vaccine masses and their attachment to the peritoneal wall. Thirty-five genes related to apoptosis were differentially expressed. Although most of the proteins coded by these genes have a proapoptotic effect, others are antiapoptotic, indicating that both types of signals occur in peritoneal leukocytes of vaccinated fish. Interestingly, many of the genes related to lymphocytes and lymphocyte activity were downregulated in the groups injected with vaccine. We also observed decreased expression of genes related to antigen presentation, suggesting that macrophages (which were abundant in the peritoneal cavity after vaccination) did not express these during the early inflammatory response in the peritoneal cavity. Finally, several genes that participate in the inflammatory response were differentially expressed, and most participated in resolution of inflammation, indicating that an M2 macrophage response is generated in the peritoneal cavity of fish one day post vaccination. Copyright © 2016 Elsevier Ltd. All rights reserved.

Association study between schizophrenia and dopamine D3 receptor gene polymorphism

Energy Technology Data Exchange (ETDEWEB)

Tanaka, Toshihisa; Takahashi, Makoto; Maeda, Masaya [Niigata Univ. (Japan)] [and others

1996-07-26

Crocq et al. reported the existence of an association between schizophrenia and homozygosity of a BalI polymorphism in the first exon of the dopamine D3 receptor (DRD3) gene. In response to this report, further studies were conducted; however, these studies yielded conflicting results. In the present study, we examined 100 unrelated Japanese schizophrenics and 100 normal controls to determine any association between this polymorphism and schizophrenia. Results suggest that neither allele nor genotype frequencies of the DRD3 gene in the schizophrenics as a whole are significantly different from those of the controls. Further, we found no association between any allele or genotype and any clinical subtype based on family history of schizophrenia and age-at-onset. A significantly high frequency of homozygosity of a dopamine D3 receptor gene allele was not observed in the schizophrenics as a whole, or in clinical subtypes. Our results suggest that an association between the dopamine D3 receptor gene and schizophrenia is unlikely to exist. 26 refs., 1 tab.

Gene expression in cortex and hippocampus during acute pneumococcal meningitis

Directory of Open Access Journals (Sweden)

Wittwer Matthias

2006-06-01

Full Text Available Abstract Background Pneumococcal meningitis is associated with high mortality (~30% and morbidity. Up to 50% of survivors are affected by neurological sequelae due to a wide spectrum of brain injury mainly affecting the cortex and hippocampus. Despite this significant disease burden, the genetic program that regulates the host response leading to brain damage as a consequence of bacterial meningitis is largely unknown. We used an infant rat model of pneumococcal meningitis to assess gene expression profiles in cortex and hippocampus at 22 and 44 hours after infection and in controls at 22 h after mock-infection with saline. To analyze the biological significance of the data generated by Affymetrix DNA microarrays, a bioinformatics pipeline was used combining (i a literature-profiling algorithm to cluster genes based on the vocabulary of abstracts indexed in MEDLINE (NCBI and (ii the self-organizing map (SOM, a clustering technique based on covariance in gene expression kinetics. Results Among 598 genes differentially regulated (change factor ≥ 1.5; p ≤ 0.05, 77% were automatically assigned to one of 11 functional groups with 94% accuracy. SOM disclosed six patterns of expression kinetics. Genes associated with growth control/neuroplasticity, signal transduction, cell death/survival, cytoskeleton, and immunity were generally upregulated. In contrast, genes related to neurotransmission and lipid metabolism were transiently downregulated on the whole. The majority of the genes associated with ionic homeostasis, neurotransmission, signal transduction and lipid metabolism were differentially regulated specifically in the hippocampus. Of the cell death/survival genes found to be continuously upregulated only in hippocampus, the majority are pro-apoptotic, while those continuously upregulated only in cortex are anti-apoptotic. Conclusion Temporal and spatial analysis of gene expression in experimental pneumococcal meningitis identified potential

Potential gene regulatory role for cyclin D3 in muscle cells

Indian Academy of Sciences (India)

Using chromatin immunoprecipitation assays, we demonstrated that expression of cyclin D3 in undifferentiated myoblasts altered histone epigenetic marks at promoters of muscle-specific genes like MyoD, Pax7, myogenin and muscle creatine kinase but not non-muscle genes. Cyclin D3 expression also reduced the mRNA ...

Variants of the elongator protein 3 (ELP3) gene are associated with motor neuron degeneration

NARCIS (Netherlands)

Simpson, Claire L.; Lemmens, Robin; Miskiewicz, Katarzyna; Broom, Wendy J.; Hansen, Valerie K.; van Vught, Paul W. J.; Landers, John E.; Sapp, Peter; Van Den Bosch, Ludo; Knight, Joanne; Neale, Benjamin M.; Turner, Martin R.; Veldink, Jan H.; Ophoff, Roel A.; Tripathi, Vineeta B.; Beleza, Ana; Shah, Meera N.; Proitsi, Petroula; Van Hoecke, Annelies; Carmeliet, Peter; Horvitz, H. Robert; Leigh, P. Nigel; Shaw, Christopher E.; van den Berg, Leonard H.; Sham, Pak C.; Powell, John F.; Verstreken, Patrik; Brown, Robert H.; Robberecht, Wim; Al-Chalabi, Ammar

2009-01-01

Amyotrophic lateral sclerosis (ALS) is a spontaneous, relentlessly progressive motor neuron disease, usually resulting in death from respiratory failure within 3 years. Variation in the genes SOD1 and TARDBP accounts for a small percentage of cases, and other genes have shown association in both

Poly(3-Hydroxybutyrate) Synthesis Genes in Azotobacter sp. Strain FA8

OpenAIRE

Pettinari, M. Julia; Vázquez, Gustavo J.; Silberschmidt, Daniel; Rehm, Bernd; Steinbüchel, Alexander; Méndez, Beatriz S.

2001-01-01

Genes responsible for the synthesis of poly(3-hydroxybutyrate) (PHB) in Azotobacter sp. FA8 were cloned and analyzed. A PHB polymerase gene (phbC) was found downstream from genes coding for β-ketothiolase (phbA) and acetoacetyl-coenzyme A reductase (phbB). A PHB synthase mutant was obtained by gene inactivation and used for genetic studies. The phbC gene from this strain was introduced into Ralstonia eutropha PHB-4 (phbC-negative mutant), and the recombinant accumulated PHB when either glucos...

An Involvement of PI3-K/Akt Activation and Inhibition of AIF Translocation in Neuroprotective Effects of Undecylenic Acid (UDA) Against Pro-Apoptotic Factors-Induced Cell Death in Human Neuroblastoma SH-SY5Y Cells.

Science.gov (United States)

Jantas, Danuta; Piotrowski, Marek; Lason, Wladyslaw

2015-12-01

Undecylenic acid (UDA), a naturally occurring 11-carbon unsaturated fatty acid, has been used for several years as an economical antifungal agent and a nutritional supplement. Recently, the potential usefulness of UDA as a neuroprotective drug has been suggested based on the ability of this agent to inhibit μ-calpain activity. In order to verify neuroprotective potential of UDA, we tested protective efficacy of this compound against cell damage evoked by pro-apoptotic factors (staurosporine and doxorubicin) and oxidative stress (hydrogen peroxide) in human neuroblastoma SH-SY5Y cells. We showed that UDA partially protected SH-SY5Y cells against the staurosporine- and doxorubicin-evoked cell death; however, this effect was not connected with its influence on caspase-3 activity. UDA decreased the St-induced changes in mitochondrial and cytosolic AIF level, whereas in Dox-model it affected only the cytosolic AIF content. Moreover, UDA (1-40 μM) decreased the hydrogen peroxide-induced cell damage which was connected with attenuation of hydrogen peroxide-mediated necrotic (PI staining, ADP/ATP ratio) and apoptotic (mitochondrial membrane potential, caspase-3 activation, AIF translocation) changes. Finally, we demonstrated that an inhibitor of PI3-K/Akt (LY294002) but not MAPK/ERK1/2 (U0126) pathway blocked the protection mediated by UDA in all tested models of SH-SY5Y cell injury. These in vitro data point to UDA as potentially effective neuroprotectant the utility of which should be further validated in animal studies. © 2015 Wiley Periodicals, Inc.

Single gene microdeletions and microduplication of 3p26.3 in three unrelated families

DEFF Research Database (Denmark)

Kashevarova, Anna A; Nazarenko, Lyudmila P; Schultz-Pedersen, Soren

2014-01-01

contain several protein-coding genes and regulatory elements, complicating the understanding of genotype-phenotype correlations. We report two siblings with ID and an unrelated patient with atypical autism who had 3p26.3 microdeletions and one intellectually disabled patient with a 3p26.3 microduplication...

Effect of gene transfer of Chlorella vulgaris n-3 fatty acid desaturase ...

African Journals Online (AJOL)

Chlorella vulgaris had the gene of n-3 fatty acid desaturase (CvFad3) which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs) or to convert n-6 to n-3 PUFAs. The objective of this study was to examine whether the CvFad3 gene from C. vulgaris can be functionally expressed in mammalian cells and ...

B cell lymphoma-2 (BCL-2) homology domain 3 (BH3) mimetics demonstrate differential activities dependent upon the functional repertoire of pro- and anti-apoptotic BCL-2 family proteins.

Science.gov (United States)

Renault, Thibaud T; Elkholi, Rana; Bharti, Archana; Chipuk, Jerry E

2014-09-19

The B cell lymphoma-2 (BCL-2) family is the key mediator of cellular sensitivity to apoptosis during pharmacological interventions for numerous human pathologies, including cancer. There is tremendous interest to understand how the proapoptotic BCL-2 effector members (e.g. BCL-2-associated X protein, BAX) cooperate with the BCL-2 homology domain only (BH3-only) subclass (e.g. BCL-2 interacting mediator of death, BIM; BCL-2 interacting-domain death agonist, BID) to induce mitochondrial outer membrane permeabilization (MOMP) and apoptosis and whether these mechanisms may be pharmacologically exploited to enhance the killing of cancer cells. Indeed, small molecule inhibitors of the anti-apoptotic BCL-2 family members have been designed rationally. However, the success of these "BH3 mimetics" in the clinic has been limited, likely due to an incomplete understanding of how these drugs function in the presence of multiple BCL-2 family members. To increase our mechanistic understanding of how BH3 mimetics cooperate with multiple BCL-2 family members in vitro, we directly compared the activity of several BH3-mimetic compounds (i.e. ABT-263, ABT-737, GX15-070, HA14.1, TW-37) in biochemically defined large unilamellar vesicle model systems that faithfully recapitulate BAX-dependent mitochondrial outer membrane permeabilization. Our investigations revealed that the presence of BAX, BID, and BIM differentially regulated the ability of BH3 mimetics to derepress proapoptotic molecules from anti-apoptotic proteins. Using mitochondria loaded with fluorescent BH3 peptides and cells treated with inducers of cell death, these differences were supported. Together, these data suggest that although the presence of anti-apoptotic BCL-2 proteins primarily dictates cellular sensitivity to BH3 mimetics, additional specificity is conferred by proapoptotic BCL-2 proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

PLGA-carbon nanotube conjugates for intercellular delivery of caspase-3 into osteosarcoma cells.

Directory of Open Access Journals (Sweden)

Qingsu Cheng

Full Text Available Cancer has arisen to be of the most prominent health care issues across the world in recent years. Doctors have used physiological intervention as well as chemical and radioactive therapeutics to treat cancer thus far. As an alternative to current methods, gene delivery systems with high efficiency, specificity, and safety that can reduce side effects such as necrosis of tissue are under development. Although viral vectors are highly efficient, concerns have arisen from the fact that viral vectors are sourced from lethal diseases. With this in mind, rod shaped nano-materials such as carbon nanotubes (CNTs have become an attractive option for drug delivery due to the enhanced permeability and retention effect in tumors as well as the ability to penetrate the cell membrane. Here, we successfully engineered poly (lactic-co-glycolic (PLGA functionalized CNTs to reduce toxicity concerns, provide attachment sites for pro-apoptotic protein caspase-3 (CP3, and tune the temporal release profile of CP3 within bone cancer cells. Our results showed that CP3 was able to attach to functionalized CNTs, forming CNT-PLGA-CP3 conjugates. We show this conjugate can efficiently transduce cells at dosages as low as 0.05 μg/ml and suppress cell proliferation up to a week with no further treatments. These results are essential to showing the capabilities of PLGA functionalized CNTs as a non-viral vector gene delivery technique to tune cell fate.

Mutation of the S and 3c genes in genomes of feline coronaviruses.

Science.gov (United States)

Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

2018-05-17

Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

Three inorganic-organic hybrid complexes based on isopolymolybdate and derivatives of 1H-4-nitroimidazole

Science.gov (United States)

Zhang, Xiaoyu; Xi, Rui; Yin, Sulu; Cao, Xiaoran; Zhang, Yongliang; Lin, Ling; Chen, Rui; Wu, Hua

2018-02-01

Three inorganic-organic diverse CuI motifs of [CuI(bnip)]2(Mo6O19) (1), CuI4(bnib)3(β-Mo8O26)(H2O) (2) and [CuI(bnih)]2(Mo6O19)·H2O (3) [bnip = 1,3-bis(4-nitro-1H-imidazol-1-yl)propane, bnib = 1,4-bis(4-nitro-1H-imidazol-1-yl)butane, and bnih = 1,6-bis(4-nitro-1H-imidazol-1-yl)hexane] based on three diverse flexible ligands and isopolyoxomolybdate clusters have been successfully synthesized under solvothermal conditions at different pH values and ratio of the solvents. Their structures have been characterized by single-crystal X-ray diffraction analyses, infrared spectra (IR) and elemental analyses. For compound 1, the CuI ions are linked by bnip ligands to form a 2D 44 cationic layer, the 2D layers are packed in offset fashions through C-H···O hydrogen bonding interactions to generate a 3D supramolecular network with 1D channels, and the isolated [Mo6O19]2- polyanions are located in the channels. In compound 2, three bnib ligands are brigded by four CuI ions to form a unique unit of Cu4(binb)3(H2O)2, and the units are connected by Mo8O264- anions to generate an infinite 1D branched chain, which are further bridged by hydrogen bonding interactions to form a 2D supramolecular structure. In compound 3, two types of -Cu-bnih-Cu- chains are crossed each other to assemble a 3D supramolecular framework with 1D cationic channel by the hydrogen bonding interactions, and the channels are occupied by Mo6O192- anions. Furthermore, the thermal stabilities, power X-ray diffraction, the photoluminescent properties of compounds 1-3 and the electrochemical properties of compounds 1 and 2 have been also investigated.

Maternally Expressed Gene 3, an imprinted non-coding RNA gene, is associated with meningioma pathogenesis and progression

Science.gov (United States)

Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne

2010-01-01

Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190

A high-throughput quantitative expression analysis of cancer-related genes in human HepG2 cells in response to limonene, a potential anticancer agent.

Science.gov (United States)

Hafidh, Rand R; Hussein, Saba Z; MalAllah, Mohammed Q; Abdulamir, Ahmed S; Abu Bakar, Fatimah

2017-11-14

Citrus bioactive compounds, as active anticancer agent, have been under focus by several studies worldwide. However, the underlying genes responsible for the anticancer potential have not been sufficiently highlighted. The current study investigated the gene expression profile of hepatocellular carcinoma, HepG2, cells after treatment with Limonene. The concentration that killed 50% of HepG2 cells was used to elucidate the genetic mechanisms of limonene anticancer activity. The apoptotic induction was detected by flow cytometry and confocal fluorescence microscope. Two of pro-apoptotic events, caspase-3 activation and phosphatidylserine translocation were manifested by confocal fluorescence microscopy. High-throughput real-time PCR was used to profile 1023 cancer-related genes in 16 different gene families related to the cancer development. In comparison to untreated cells, limonene increased the percentage of apoptotic cells up to 89.61%, by flow cytometry, and 48.2% by fluorescence microscopy. There was a significant limonene-driven differential gene expression of HepG2 cells in 15 different gene families. Limonene was shown to significantly (>2log) up-regulate and down-regulate 14 and 59 genes, respectively. The affected gene families, from most to least affected, were apoptosis induction, signal transduction, cancer genes augmentation, alteration in kinases expression, inflammation, DNA damage repair, and cell cycle proteins. The current study reveals that limonene could be a promising, cheap, and effective anticancer compound. The broad spectrum of limonene anticancer activity is interesting for anticancer drug development. Further research is needed to confirm the current findings and to examine the anticancer potential of limonene along with underlying mechanisms on different cell lines. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Latest progress of BIGH3 gene in corneal diseases and diabetic retinopathy

Directory of Open Access Journals (Sweden)

Fan-Qian Song

2017-03-01

Full Text Available BIGH3 gene plays an important role in ocular diseases. On the one hand, it is closely related to the occurrence of corneal diseases. BIGH3 gene can inhibit corneal neovascularization, lead to corneal dystrophy, participate in keratoconus formation. On the other hand, it can lead to the formation of neovascularization in diabetic retinopathy. The latest experiments show that TGF beta secreted by macrophages can promote the expression of BIGH3 mRNA and BIGH3 protein, and promote apoptosis of retinal endothelial cells and pericytes, which leads to the formation of neovascularization in diabetic retinopathy. This article will describe the new progress of BIGH3 gene in ocular diseases from several aspects as mentioned above.

Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene x gender interaction.

Science.gov (United States)

Wang, Ke-Sheng; Wang, Liang; Liu, Xuefeng; Zeng, Min

2013-12-01

The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes.We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such as triglycerides). We examined genetic associations of 117 single-nucleotide polymorphisms (SNPs) within the HS6ST3 gene with obesity and triglycerides using two Caucasian samples: the Marshfield sample (1442 obesity cases and 2122 controls), and the Health aging and body composition (Health ABC) sample (305 cases and 1336 controls). Logistic regression analysis of obesity as a binary trait and linear regression analysis of triglycerides as a continuous trait, adjusted for age and sex, were performed using PLINK. Single marker analysis showed that six SNPs in the Marshfield sample and one SNP in the Health ABC sample were associated with obesity (P triglycerides in the Marshfield sample (P triglycerides in the Marshfield sample. These findings contribute new insights into the pathogenesis of obesity and triglycerides and demonstrate the importance of gender differences in the aetiology.

ZCURVE 3.0: identify prokaryotic genes with higher accuracy as well as automatically and accurately select essential genes

Science.gov (United States)

Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao

2015-01-01

In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. PMID:25977299

Genome-wide expression patterns associated with oncogenesis and sarcomatous transdifferentation of cholangiocarcinoma

International Nuclear Information System (INIS)

Seol, Min-A; Kim, Dae-Ghon; Chu, In-Sun; Lee, Mi-Jin; Yu, Goung-Ran; Cui, Xiang-Dan; Cho, Baik-Hwan; Ahn, Eun-Kyung; Leem, Sun-Hee; Kim, In-Hee

2011-01-01

The molecular mechanisms of CC (cholangiocarcinoma) oncogenesis and progression are poorly understood. This study aimed to determine the genome-wide expression of genes related to CC oncogenesis and sarcomatous transdifferentiation. Genes that were differentially expressed between CC cell lines or tissues and cultured normal biliary epithelial (NBE) cells were identified using DNA microarray technology. Expressions were validated in human CC tissues and cells. Using unsupervised hierarchical clustering analysis of the cell line and tissue samples, we identified a set of 342 commonly regulated (>2-fold change) genes. Of these, 53, including tumor-related genes, were upregulated, and 289, including tumor suppressor genes, were downregulated (<0.5 fold change). Expression of SPP1, EFNB2, E2F2, IRX3, PTTG1, PPARγ, KRT17, UCHL1, IGFBP7 and SPARC proteins was immunohistochemically verified in human and hamster CC tissues. Additional unsupervised hierarchical clustering analysis of sarcomatoid CC cells compared to three adenocarcinomatous CC cell lines revealed 292 differentially upregulated genes (>4-fold change), and 267 differentially downregulated genes (<0.25 fold change). The expression of 12 proteins was validated in the CC cell lines by immunoblot analysis and immunohistochemical staining. Of the proteins analyzed, we found upregulation of the expression of the epithelial-mesenchymal transition (EMT)-related proteins VIM and TWIST1, and restoration of the methylation-silenced proteins LDHB, BNIP3, UCHL1, and NPTX2 during sarcomatoid transdifferentiation of CC. The deregulation of oncogenes, tumor suppressor genes, and methylation-related genes may be useful in identifying molecular targets for CC diagnosis and prognosis

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

Science.gov (United States)

Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

2015-01-08

Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

Non-THC cannabinoids inhibit prostate carcinoma growth in vitro and in vivo: pro-apoptotic effects and underlying mechanisms.

Science.gov (United States)

De Petrocellis, Luciano; Ligresti, Alessia; Schiano Moriello, Aniello; Iappelli, Mariagrazia; Verde, Roberta; Stott, Colin G; Cristino, Luigia; Orlando, Pierangelo; Di Marzo, Vincenzo

2013-01-01

Cannabinoid receptor activation induces prostate carcinoma cell (PCC) apoptosis, but cannabinoids other than Δ(9) -tetrahydrocannabinol (THC), which lack potency at cannabinoid receptors, have not been investigated. Some of these compounds antagonize transient receptor potential melastatin type-8 (TRPM8) channels, the expression of which is necessary for androgen receptor (AR)-dependent PCC survival. We tested pure cannabinoids and extracts from Cannabis strains enriched in particular cannabinoids (BDS), on AR-positive (LNCaP and 22RV1) and -negative (DU-145 and PC-3) cells, by evaluating cell viability (MTT test), cell cycle arrest and apoptosis induction, by FACS scans, caspase 3/7 assays, DNA fragmentation and TUNEL, and size of xenograft tumours induced by LNCaP and DU-145 cells. Cannabidiol (CBD) significantly inhibited cell viability. Other compounds became effective in cells deprived of serum for 24 h. Several BDS were more potent than the pure compounds in the presence of serum. CBD-BDS (i.p.) potentiated the effects of bicalutamide and docetaxel against LNCaP and DU-145 xenograft tumours and, given alone, reduced LNCaP xenograft size. CBD (1-10 µM) induced apoptosis and induced markers of intrinsic apoptotic pathways (PUMA and CHOP expression and intracellular Ca(2+)). In LNCaP cells, the pro-apoptotic effect of CBD was only partly due to TRPM8 antagonism and was accompanied by down-regulation of AR, p53 activation and elevation of reactive oxygen species. LNCaP cells differentiated to androgen-insensitive neuroendocrine-like cells were more sensitive to CBD-induced apoptosis. These data support the clinical testing of CBD against prostate carcinoma. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

Association and expression analyses of the Ucp2 and Ucp3 gene ...

Indian Academy of Sciences (India)

YANING WANG

gest a broader hypothesis for further research into the role of Ucp2 and Ucp3 genes, ... Materials and methods ... CT method. Qualitative trait loci (QTL) pyramiding analysis ... type of the Ucp3 gene exhibited better performance in the aspect of ...

Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

Science.gov (United States)

Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

2017-01-01

The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

OpenAIRE

Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

2007-01-01

Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

Overexpression of the Squalene Epoxidase Gene Alone and in Combination with the 3-Hydroxy-3-methylglutaryl Coenzyme A Gene Increases Ganoderic Acid Production in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Jiang, Lu-Xi; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-06-14

The squalene epoxidase (SE) gene from the biosynthetic pathway of ganoderic acid (GA) was cloned and overexpressed in Ganoderma lingzhi. The strain that overexpressed the SE produced approximately 2 times more GA molecules than the wild-type (WT) strain. Moreover, SE overexpression upregulated lanosterol synthase gene expression in the biosynthetic pathway. These results indicated that SE stimulates GA accumulation. Then, the SE and 3-hydroxy-3-methylglutaryl coenzyme A (HMGR) genes were simultaneously overexpressed in G. lingzhi. Compared with the individual overexpression of SE or HMGR, the combined overexpression of the two genes further enhanced individual GA production. The overexpressing strain produced maximum GA-T, GA-S, GA-Mk, and GA-Me contents of 90.4 ± 7.5, 35.9 ± 5.4, 6.2 ± 0.5, and 61.8 ± 5.8 μg/100 mg dry weight, respectively. These values were 5.9, 4.5, 2.4, and 5.8 times higher than those produced by the WT strain. This is the first example of the successful manipulation of multiple biosynthetic genes to improve GA content in G. lingzhi.

Increased tumour ascorbate is associated with extended disease-free survival and decreased hypoxia-inducible factor-1 activation in human colorectal cancer

Directory of Open Access Journals (Sweden)

Caroline eKuiper

2014-02-01

Full Text Available Ascorbate is a co-factor for the hydroxylases that regulate the transcription factor hypoxia-inducible factor (HIF-1, which provides cancer cells with a metabolic and survival advantage in the hypoxic environment of solid tumors. However, whether ascorbate affects tumor development is a highly debated issue. We aimed to determine whether tumor ascorbate was associated with HIF-1 activation and patient disease-free survival. In this study we undertook a retrospective observational analysis of tissue-banked tumor and paired normal tissue from 49 colorectal cancer patients, measuring ascorbate levels, HIF-1α and its downstream gene products BNIP3 and VEGF. Patient survival was monitored for the first six years after surgery. We found that ascorbate levels were lower in tumor tissue compared to normal tissue (p< 0.001 but overall levels varied considerably. HIF-1α, VEGF and BNIP3 were elevated in tumor samples (p< 0.01. There was an inverse relationship between tumor ascorbate content and HIF-1 pathway activation (p=0.002 and tumor size (p=0.018. Higher tumor ascorbate content was associated with significantly improved disease-free survival in the first 6 years after surgery (p=0.006, with 141 - 1,094 additional disease free days. This was independent of tumor grade and stage. Survival advantage was associated with the amount of ascorbate in the tumor, but not with the amount in adjacent normal tissue. Our results demonstrate that higher tumor ascorbate content is associated decreased HIF-1 activation, most likely due to the co-factor activity of ascorbate for the regulatory HIF hydroxylases. Our findings support the need for future studies to determine whether raising tumor ascorbate is possible with clinical intervention and whether this results in modification of hydroxylase-dependent pathways in the tumor.

Discovering hidden relationships between renal diseases and regulated genes through 3D network visualizations

Directory of Open Access Journals (Sweden)

Bhavnani Suresh K

2010-11-01

Full Text Available Abstract Background In a recent study, two-dimensional (2D network layouts were used to visualize and quantitatively analyze the relationship between chronic renal diseases and regulated genes. The results revealed complex relationships between disease type, gene specificity, and gene regulation type, which led to important insights about the underlying biological pathways. Here we describe an attempt to extend our understanding of these complex relationships by reanalyzing the data using three-dimensional (3D network layouts, displayed through 2D and 3D viewing methods. Findings The 3D network layout (displayed through the 3D viewing method revealed that genes implicated in many diseases (non-specific genes tended to be predominantly down-regulated, whereas genes regulated in a few diseases (disease-specific genes tended to be up-regulated. This new global relationship was quantitatively validated through comparison to 1000 random permutations of networks of the same size and distribution. Our new finding appeared to be the result of using specific features of the 3D viewing method to analyze the 3D renal network. Conclusions The global relationship between gene regulation and gene specificity is the first clue from human studies that there exist common mechanisms across several renal diseases, which suggest hypotheses for the underlying mechanisms. Furthermore, the study suggests hypotheses for why the 3D visualization helped to make salient a new regularity that was difficult to detect in 2D. Future research that tests these hypotheses should enable a more systematic understanding of when and how to use 3D network visualizations to reveal complex regularities in biological networks.

Bcl-2 family of proteins as drug targets for cancer chemotherapy: the long way of BH3 mimetics from bench to bedside.

Science.gov (United States)

Vela, Laura; Marzo, Isabel

2015-08-01

Bcl-2 proteins are key determinants in the life-death balance. In recent years, proteins in this family have been identified as drug targets in the design of new anti-tumor therapies. Advances in the knowledge of the mechanism of action of anti-apoptotic and pro-apoptotic members of the Bcl-2 family have enabled the development of the so-called 'BH3 mimetics'. These compounds act by inhibiting anti-apoptotic proteins of the family, imitating the function of the BH3-only subset of pro-apoptotic members. Combinations of BH3-mimetics with anti-tumor drugs are being evaluated in both preclinical models and clinical trials. Recent advances in these approaches will be reviewed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Correlation between endometriosis combined with infertility and STAT3 gene polymorphisms

Directory of Open Access Journals (Sweden)

Juan Hu

2016-05-01

Full Text Available Objective: To investigate the correlation between STAT3 gene polymorphisms and endometriosis complicated with infertility. Methods: A total of 35 patients with endometriosis complicated with infertility and 35 cases of healthy volunteer from October 2014 to October 2015 in our hospital were selected as research objects. STAT3 gene polymorphisms of all objects were detected by PCR-RFLP method. Results: Polymorphic sites of STAT3 gene rs2293152 were expressed as three genotypes, namely, CC, GC, and GG. There were 18 cases, 10 cases and 7 cases of type CC, GC and GG in the observation group, accounted for 51.43%, 28.57% and 20.00%, respectively. There were 29 cases, 3 cases and 3 cases of type CC, GC and GG in the control group, accounted for 82.86%, 8.57% and 8.57%. There was a statistically difference` between the two groups. The frequency of C and G allele in the observation group and the control group were 65.71%, 34.29% and 87.14%, 12.86%, respectively. There were statistically significant differences between two groups. In addition, compared with the CC genotype, genotype G might increase the risk of the disease. Conclusions: The susceptibility of endometriosis complicated with infertility may be associated with STAT3 gene polymorphism and women who carried the G allele may have an increased the risk of the disease.

Bioactives in cactus (Opuntia ficus-indica) stems possess potent antioxidant and pro-apoptotic activities through COX-2 involvement.

Science.gov (United States)

Kim, Jinhee; Soh, Soon Yil; Shin, Juha; Cho, Chi-Woung; Choi, Young Hee; Nam, Sang-Yong

2015-10-01

Bioactives extracted from cactus (Opuntia ficus-indica) stems were investigated for their chemopreventive activities using human cancer cells in vitro. The bioactives present in crude extracts were detected and quantified using high-performance liquid chromatography. Among all the extracts, such as hexane, ethyl acetate (EtOAc), acetone, methanol (MeOH), and MeOH:water (80:20), the MeOH extract had the highest amount of polyphenolic compounds and the acetone extract exhibited the most potent effect at scavenging the 2,2,-diphenyl-1-picrylhydrazyl (DPPH) and 2,2'-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS(•+) ) radical. In addition, most of the extracts, with the exception of hexane, exhibited significant cytotoxicity in human SW480 colon and MCF7 breast cancer cells. Overall, the SW480 cells were more sensitive than the MCF7 cells to the cytotoxic effect of the O. ficus-indica extracts (OFEs). Cell death by OFE treatment caused significant inhibition of cyclooxygenase-2 and increased the Bax/Bcl2 ratio in both SW480 and MCF7 cell lines. However, degradation of poly (ADP-ribose) polymerase was significantly increased by OFE only in the MCF7 cells, thereby inducing apoptosis. These findings demonstrate the health-benefit roles, including anti-oxidative and anti-proliferative activities as well as pro-apoptotic effects, of bioactive compounds in OFEs, suggesting a chemopreventive role in human cancer cells. © 2014 Society of Chemical Industry.

Operator dependent choice of prostate cancer biopsy has limited impact on a gene signature analysis for the highly expressed genes IGFBP3 and F3 in prostate cancer epithelial cells.

Directory of Open Access Journals (Sweden)

Zhuochun Peng

Full Text Available BACKGROUND: Predicting the prognosis of prostate cancer disease through gene expression analysis is receiving increasing interest. In many cases, such analyses are based on formalin-fixed, paraffin embedded (FFPE core needle biopsy material on which Gleason grading for diagnosis has been conducted. Since each patient typically has multiple biopsy samples, and since Gleason grading is an operator dependent procedure known to be difficult, the impact of the operator's choice of biopsy was evaluated. METHODS: Multiple biopsy samples from 43 patients were evaluated using a previously reported gene signature of IGFBP3, F3 and VGLL3 with potential prognostic value in estimating overall survival at diagnosis of prostate cancer. A four multiplex one-step qRT-PCR test kit, designed and optimized for measuring the signature in FFPE core needle biopsy samples was used. Concordance of gene expression levels between primary and secondary Gleason tumor patterns, as well as benign tissue specimens, was analyzed. RESULTS: The gene expression levels of IGFBP3 and F3 in prostate cancer epithelial cell-containing tissue representing the primary and secondary Gleason patterns were high and consistent, while the low expressed VGLL3 showed more variation in its expression levels. CONCLUSION: The assessment of IGFBP3 and F3 gene expression levels in prostate cancer tissue is independent of Gleason patterns, meaning that the impact of operator's choice of biopsy is low.

Lovastatin prevents cisplatin-induced activation of pro-apoptotic DNA damage response (DDR) of renal tubular epithelial cells

Energy Technology Data Exchange (ETDEWEB)

Krüger, Katharina; Ziegler, Verena; Hartmann, Christina; Henninger, Christian [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany); Thomale, Jürgen [Institute of Cell Biology, University Duisburg-Essen, 45122 Essen (Germany); Schupp, Nicole [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany); Fritz, Gerhard, E-mail: fritz@uni-duesseldorf.de [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany)

2016-02-01

The platinating agent cisplatin (CisPt) is commonly used in the therapy of various types of solid tumors. The anticancer efficacy of CisPt largely depends on the formation of bivalent DNA intrastrand crosslinks, which stimulate mechanisms of the DNA damage response (DDR), thereby triggering checkpoint activation, gene expression and cell death. The clinically most relevant adverse effect associated with CisPt treatment is nephrotoxicity that results from damage to renal tubular epithelial cells. Here, we addressed the question whether the HMG-CoA-reductase inhibitor lovastatin affects the DDR of renal cells by employing rat renal proximal tubular epithelial (NRK-52E) cells as in vitro model. The data show that lovastatin has extensive inhibitory effects on CisPt-stimulated DDR of NRK-52E cells as reflected on the levels of phosphorylated ATM, Chk1, Chk2, p53 and Kap1. Mitigation of CisPt-induced DDR by lovastatin was independent of the formation of DNA damage as demonstrated by (i) the analysis of Pt-(GpG) intrastrand crosslink formation by Southwestern blot analyses and (ii) the generation of DNA strand breaks as analyzed on the level of nuclear γH2AX foci and employing the alkaline comet assay. Lovastatin protected NRK-52E cells from the cytotoxicity of high CisPt doses as shown by measuring cell viability, cellular impedance and flow cytometry-based analyses of cell death. Importantly, the statin also reduced the level of kidney DNA damage and apoptosis triggered by CisPt treatment of mice. The data show that the lipid-lowering drug lovastatin extensively counteracts pro-apoptotic signal mechanisms of the DDR of tubular epithelial cells following CisPt injury. - Highlights: • Lovastatin blocks ATM/ATR-regulated DDR of tubular cells following CisPt treatment. • Lovastatin attenuates CisPt-induced activation of protein kinase ATM in vitro. • Statin-mediated DDR inhibition is independent of initial DNA damage formation. • Statin-mediated blockage of Cis

Lovastatin prevents cisplatin-induced activation of pro-apoptotic DNA damage response (DDR) of renal tubular epithelial cells

International Nuclear Information System (INIS)

Krüger, Katharina; Ziegler, Verena; Hartmann, Christina; Henninger, Christian; Thomale, Jürgen; Schupp, Nicole; Fritz, Gerhard

2016-01-01

The platinating agent cisplatin (CisPt) is commonly used in the therapy of various types of solid tumors. The anticancer efficacy of CisPt largely depends on the formation of bivalent DNA intrastrand crosslinks, which stimulate mechanisms of the DNA damage response (DDR), thereby triggering checkpoint activation, gene expression and cell death. The clinically most relevant adverse effect associated with CisPt treatment is nephrotoxicity that results from damage to renal tubular epithelial cells. Here, we addressed the question whether the HMG-CoA-reductase inhibitor lovastatin affects the DDR of renal cells by employing rat renal proximal tubular epithelial (NRK-52E) cells as in vitro model. The data show that lovastatin has extensive inhibitory effects on CisPt-stimulated DDR of NRK-52E cells as reflected on the levels of phosphorylated ATM, Chk1, Chk2, p53 and Kap1. Mitigation of CisPt-induced DDR by lovastatin was independent of the formation of DNA damage as demonstrated by (i) the analysis of Pt-(GpG) intrastrand crosslink formation by Southwestern blot analyses and (ii) the generation of DNA strand breaks as analyzed on the level of nuclear γH2AX foci and employing the alkaline comet assay. Lovastatin protected NRK-52E cells from the cytotoxicity of high CisPt doses as shown by measuring cell viability, cellular impedance and flow cytometry-based analyses of cell death. Importantly, the statin also reduced the level of kidney DNA damage and apoptosis triggered by CisPt treatment of mice. The data show that the lipid-lowering drug lovastatin extensively counteracts pro-apoptotic signal mechanisms of the DDR of tubular epithelial cells following CisPt injury. - Highlights: • Lovastatin blocks ATM/ATR-regulated DDR of tubular cells following CisPt treatment. • Lovastatin attenuates CisPt-induced activation of protein kinase ATM in vitro. • Statin-mediated DDR inhibition is independent of initial DNA damage formation. • Statin-mediated blockage of Cis

ZCURVE 3.0: identify prokaryotic genes with higher accuracy as well as automatically and accurately select essential genes.

Science.gov (United States)

Hua, Zhi-Gang; Lin, Yan; Yuan, Ya-Zhou; Yang, De-Chang; Wei, Wen; Guo, Feng-Biao

2015-07-01

In 2003, we developed an ab initio program, ZCURVE 1.0, to find genes in bacterial and archaeal genomes. In this work, we present the updated version (i.e. ZCURVE 3.0). Using 422 prokaryotic genomes, the average accuracy was 93.7% with the updated version, compared with 88.7% with the original version. Such results also demonstrate that ZCURVE 3.0 is comparable with Glimmer 3.02 and may provide complementary predictions to it. In fact, the joint application of the two programs generated better results by correctly finding more annotated genes while also containing fewer false-positive predictions. As the exclusive function, ZCURVE 3.0 contains one post-processing program that can identify essential genes with high accuracy (generally >90%). We hope ZCURVE 3.0 will receive wide use with the web-based running mode. The updated ZCURVE can be freely accessed from http://cefg.uestc.edu.cn/zcurve/ or http://tubic.tju.edu.cn/zcurveb/ without any restrictions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Combination of targeting gene-viro therapy with recombinant Fowl-pox viruses with HN and VP3 genes on mouse osteosarcoma.

Science.gov (United States)

Zhang, Z-Y; Wang, L-Q; Fu, C-F; Li, X; Cui, Z-L; Zhang, J-Y; Xue, S-H; Sun, N; Xu, F

2013-03-01

Osteosarcoma is an aggressive cancerous neoplasm arising from primitive transformed cells of mesenchymal origin that exhibit osteoblastic differentiation and produce malignant osteoid. With the rapid development of tumor molecular biology, gene and viral therapy, a highly promising strategy for the treatment, has shown some therapeutic effects. To study the strategy of cooperative cancer gene therapy, previously, we explored the antitumor effects of recombinant Fowl-pox viruses (FPVs) with both HN (hemagglutinin-neuramidinase) and VP3 genes on mouse osteosarcoma. We constructed vFV-HN, vFV-VP3 and vFV-HN-VP3 inserting CAV VP3 gene, NDV HN gene into fowlpox virus. S180 osteosarcoma were transfected with Recombinant Fowl-pox viruses (FPVs). These cell lines stably expressing tagged proteins were selected by culturing in medium containing puromycin (2 µg/ml) and confirmed by immunoblotting and immunostaining. S180 osteosarcoma model with BALB/c mice and nude mice were established and the vFPV viruses as control, vFV-HN, vFV-VP3, vFV-HN-VP3 were injected into the tumor directly. The rate of tumor growth, tumor suppression and the sialic acid levels in serum were examined and the tumor tissues were analyzed by the method of immunohistochemistry. Flow cytometric analysis was performed using a FACSCalibur flow cytometer. A total of 100,000 events were analyzed for each sample and the experiment was repeated at least twice. Our data indicated that vFV-HN, vFV-VP3 and vFV-HN-VP3 all had growth inhibition effects, the inhibition rate of vFV-HN-VP3 group was 51.7%, which was higher than that of vFV-HN, vFV-VP3 group and control group (p genes into mouse osteosarcoma cancer cells can cause cell a specificity anti-tumor immune activity, suppress tumor growth, and increase the survival rate of the tumor within host.

Aberrant activity of NKL homeobox gene NKX3-2 in a T-ALL subset

Science.gov (United States)

Meyer, Corinna; Kaufmann, Maren; Zaborski, Margarete; MacLeod, Roderick A. F.; Drexler, Hans G.

2018-01-01

T-cell acute lymphoblastic leukemia (T-ALL) is a hematopoietic malignancy originating from T-cell progenitors in which differentiation is blocked at early stages. Physiological expression of specific NKL homeobox genes obeys a hematopoietic NKL-code implicated in the process of lymphopoiesis while in differentiated T-cells these genes are silenced. We propose that this developmental expression pattern underlies the observation that NKL homeobox genes are the most ubiquitous group of transcription factors deregulated in T-ALL, including TLX1, TLX3, NKX2-5 and NKX3-1. Here, we describe a novel member of the NKL homeobox gene subclass, NKX3-2 (BAPX1), which is aberrantly activated in 18% of pediatric T-ALL patients analyzed while being normally expressed in developing spleen. Identification of NKX3-2 expression in T-ALL cell line CCRF-CEM qualified these cells to model its deregulation and function in a leukemic context. Genomic and chromosomal analyses demonstrated normal configuration of the NKX3-2 locus at chromosome 4p15, thus excluding cytogenetic dysregulation. Comparative expression profiling analysis of NKX3-2 patient data revealed deregulated activity of BMP- and MAPK-signalling. These candidate pathways were experimentally confirmed to mediate aberrant NKX3-2 expression. We also show that homeobox gene SIX6, plus MIR17HG and GATA3 are downstream targets of NKX3-2 and plausibly contribute to the pathogenesis of this malignancy by suppressing T-cell differentiation. Finally, NKL homeobox gene NKX2-5 was activated by NKX3-2 in CCRF-CEM and by FOXG1 in PEER, representing mutually inhibitory activators of this translocated oncogene. Together, our findings reveal a novel oncogenic NKL homeobox gene subclass member which is aberrantly expressed in a large subset of T-ALL patients and participates in a deregulated gene network likely to arise in developing spleen. PMID:29746601

Polycomb Group Protein Displacement and Gene Activation through MSK-Dependent H3K27me3S28 Phosphorylation

DEFF Research Database (Denmark)

Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj

2010-01-01

Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...

A PCA3 gene-based transcriptional amplification system targeting primary prostate cancer

OpenAIRE

Neveu, Bertrand; Jain, Pallavi; T?tu, Bernard; Wu, Lily; Fradet, Yves; Pouliot, Fr?d?ric

2015-01-01

Targeting specifically primary prostate cancer (PCa) cells for immune therapy, gene therapy or molecular imaging is of high importance. The PCA3 long non-coding RNA is a unique PCa biomarker and oncogene that has been widely studied. This gene has been mainly exploited as an accurate diagnostic urine biomarker for PCa detection. In this study, the PCA3 promoter was introduced into a new transcriptional amplification system named the 3-Step Transcriptional Amplification System (PCA3-3STA) and ...

Potential gene regulatory role for cyclin D3 in muscle cells

Indian Academy of Sciences (India)

2015-06-27

Jun 27, 2015 ... D3-expressing cells on induction of differentiation. 2. Materials and .... 2 –ΔΔCt method was used for quantification and each gene ..... of pluripotency genes known to be silenced by deposition of ..... embryonic stem cells.

Variant in GALNT3 Gene Linked with Reduced Coronary Artery Disease Risk in Chinese Population.

Science.gov (United States)

Guo, Liwei; Li, Duan; Li, Mengting; Li, Lin; Huang, Yanmei

2017-07-01

Our previous study found expression of GALNT3 gene was reduced in coronary artery disease (CAD) patients, and it contributed to endothelial injury by regulating apoptosis and matrix metalloproteinase (MMP) expression. GALNT3 gene may be a potential target for future therapeutic intervention of CAD. However, none reports linking the GALNT3 gene to susceptibility of CAD. This study investigated the variant associations of GALNT3 gene and CAD. Thirteen single nucleotide polymorphism (SNP) in and around the GALNT3 gene were tagged and analyzed in CAD patients (n = 1515) and control individuals (n = 5019), and the SNPs with CAD were tested with multiple logistic regression analysis in an additive genetic model (with one degree of freedom) after adjusting for age and sex. Expression of GALNT3 gene was detected by real-time PCR and Western blot. Luciferase reporter assays were used to detect the allele-specific effect of rs4621175 on transcriptional activity. Two GALNT3 markers, rs13427924 and rs4621175, were significantly associated with CAD (odds ratio [OR] = 0.87, p = 1.01 × 10 -3 and OR = 0.75, p = 2.51 × 10 -4 , respectively), and the risk A allele of rs4621175 was associated with lower GALNT3 expression in both mRNA and protein level; also, A allele showed decreased reporter activity. In addition, we found the level of GALNT3 negatively correlated with MMP-2 gene expression. This study identified GALNT3 as a novel gene that rendered patients susceptible to CAD, and the A allele of a disease-associated variant rs4621175 linked reduced CAD risk through decreased GALNT3 expression. These results confirmed the role of GALNT3 gene in CAD and provided new insights into the genetic regulation of the GALNT3 gene with respect to the pathogenesis of CAD.

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

Science.gov (United States)

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

Science.gov (United States)

Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

2011-11-01

The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

Science.gov (United States)

Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam

2015-01-21

Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however

dynGENIE3: dynamical GENIE3 for the inference of gene networks from time series expression data.

Science.gov (United States)

Huynh-Thu, Vân Anh; Geurts, Pierre

2018-02-21

The elucidation of gene regulatory networks is one of the major challenges of systems biology. Measurements about genes that are exploited by network inference methods are typically available either in the form of steady-state expression vectors or time series expression data. In our previous work, we proposed the GENIE3 method that exploits variable importance scores derived from Random forests to identify the regulators of each target gene. This method provided state-of-the-art performance on several benchmark datasets, but it could however not specifically be applied to time series expression data. We propose here an adaptation of the GENIE3 method, called dynamical GENIE3 (dynGENIE3), for handling both time series and steady-state expression data. The proposed method is evaluated extensively on the artificial DREAM4 benchmarks and on three real time series expression datasets. Although dynGENIE3 does not systematically yield the best performance on each and every network, it is competitive with diverse methods from the literature, while preserving the main advantages of GENIE3 in terms of scalability.

CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

Science.gov (United States)

Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

2013-10-15

The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

Directory of Open Access Journals (Sweden)

Gabriel Forn-Cuní

Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

Expression and imprinting of DIO3 and DIO3OS genes in Holstein ...

Indian Academy of Sciences (India)

Navya

2016-10-18

Oct 18, 2016 ... expressed from the paternal allele, while the DIO3OS transcript is ..... interactions, or via transcriptional occlusion mechanisms (e.g. Kanduri ... The IG-DMR is associated with proper imprinting of linked genes on the maternal.

Polysaccharide peptide isolated from grass-cultured Ganoderma lucidum induces anti-proliferative and pro-apoptotic effects in the human U251 glioma cell line.

Science.gov (United States)

Wang, Chunhua; Lin, Dongmei; Chen, Quan; Lin, Shuqian; Shi, Songsheng; Chen, Chunmei

2018-04-01

The Ganoderma lucidum ( G. lucidum ) mushroom is one of the most extensively studied functional foods, known for its numerous health benefits, including the inhibition of tumor cell growth. The present study assessed the anti-proliferative and pro-apoptotic activity of a novel G. lucidum polysaccharide peptide (GL-PP) in human glioma U251 cells, which was purified from grass-cultured G. lucidum . GL-PP is a glycopeptide with an average molecular weight of 42,635 Da and a polysaccharide-to-peptide ratio of 88.70:11.30. The polysaccharides were composed of l-arabinose, d-mannose and d-glucose at a molar ratio of 1.329:0.372:2.953 and a total of 17 amino acids were detected. The results of the current study demonstrated that GL-PP significantly inhibited U251 cellular proliferation. The proportion of G 0 /G 1 phase cells and sub-G 1 phase cells significantly increased as the concentration of GL-PP increased, as did the activity of caspase-3. These results indicate that GL-PP directly inhibited human glioma U251 proliferation by inducing cell cycle arrest and promoting apoptosis.

Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC)

International Nuclear Information System (INIS)

Glaysher, Sharon; Modi, Paul; Rahamim, Joe; Smith, Mark E; Amer, Khalid; Addis, Bruce; Poole, Matthew; Narayanan, Ajit; Gulliford, Tim J; Andreotti, Peter E; Cree, Ian A; Yiannakis, Dennis; Gabriel, Francis G; Johnson, Penny; Polak, Marta E; Knight, Louise A; Goldthorpe, Zoe; Peregrin, Katharine; Gyi, Mya

2009-01-01

NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA) and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE) tissue. There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer

Opposing roles of STAT4 and Dnmt3a in Th1 gene regulation

Science.gov (United States)

Pham, Duy; Yu, Qing; Walline, Crystal C.; Muthukrishnan, Rajarajeswari; Blum, Janice S.; Kaplan, Mark H.

2013-01-01

The Signal Transducer and Activator of Transcription factor STAT4 is a critical regulator of Th1 differentiation and inflammatory disease. Yet, how STAT4 regulates gene expression is still unclear. In this report, we define a STAT4-dependent sequence of events including H3K4 methylation, Jmjd3 association with STAT4 target loci, and a Jmjd3-dependent decrease in H3K27 trimethylation and DNA methyltransferase (Dnmt) 3a association with STAT4 target loci. Dnmt3a has an obligate role in repressing Th1 gene expression, and in Th1 cultures deficient in both STAT4 and Dnmt3a, there is recovery in the expression of a subset of Th1 genes that is sufficient to increase IFNγ production. Moreover, although STAT4-deficient mice are protected from the development of EAE, mice deficient in STAT4 and conditionally-deficient in Dnmt3a in T cells develop paralysis. Th1 genes that are de-repressed in the absence of Dnmt3a have greater induction following the ectopic expression of the Th1-associated transcription factors T-bet and Hlx1. Together, these data demonstrate that STAT4 and Dnmt3a play opposing roles in regulating Th1 gene expression, and that one mechanism for STAT4-dependent gene programming is in establishing a de-repressed genetic state susceptible to transactivation by additional fate-determining transcription factors. PMID:23772023

Mutational analysis of the HLA-DQ3.2 insulin-dependent diabetes mellitus susceptibility gene

International Nuclear Information System (INIS)

Kwok, W.W.; Lotshaw, C.; Milner, E.C.B.; Knitter-Jack, N.; Nepom, G.T.

1989-01-01

The human major histocompatibility complex includes approximately 14 class II HLA genes within the HLA-D region, most of which exist in multiple allelic forms. One of these genes, the DQ3.2β gene, accounts for the well-documented association of HLA-DR4 with insulin-dependent diabetes mellitus and is the single allele most highly correlated with this disease. The authors analyzed the amino acid substitutions that lead to the structural differences distinguishing DQ3.2β from its nondiabetogenic, but closely related allele, DQ3.1β. Site-directed mutagenesis of the DQ3.2β gene was used to convert key nucleotides into DQ3.2β codons. Subsequent expression studies of these mutated DQ3.2β clones using retroviral vectors defined amino acid 45 as critical for generating serologic epitopes characterizing the DQw3.1β and DQw3.2β molecules

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression.

Directory of Open Access Journals (Sweden)

Yufei Xue

Full Text Available Omega-3 fatty acid desaturase (ω-3 FAD, D15D is a key enzyme for α-linolenic acid (ALA biosynthesis. Both chia (Salvia hispanica and perilla (Perilla frutescens contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A tailing sites, and 7 introns. The 5'UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5'UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops.

Omega-3 fatty acid desaturase gene family from two ω-3 sources, Salvia hispanica and Perilla frutescens: Cloning, characterization and expression

Science.gov (United States)

Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui

2018-01-01

Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555

EFP1 is an ER stress-induced glycoprotein which interacts with the pro-apoptotic protein Par-4

Directory of Open Access Journals (Sweden)

Sarah Appel

2009-05-01

Full Text Available Sarah Appel1,2,6, Susanne Vetterkind1,2,6, Ansgar Koplin1,3, Barbara Maertens1,4, Meike Boosen1,5, Ute Preuss11The Institute of Genetics, University of Bonn, Bonn, Germany; 2Department of Health Sciences, Sargent College of Health and Rehabilitation Sciences, Boston University, Boston, MA, USA; 3Center for Molecular Biology Heidelberg (ZMBH, Heidelberg, Germany; 4Institute of Biochemistry II, University of Cologne, Cologne, Germany; 5Institute of Pharmacology and Toxicology, University Hospital of Johann Wolfgang Goethe-University Frankfurt am Main, Frankfurt am Main, Germany; 6These authors contributed equally to this work.Abstract: We have isolated the rat ortholog of EFP1 (EF-hand binding protein 1 as a novel interaction partner of the pro-apoptotic protein Par-4 (prostate apoptosis response-4. Rat EFP1 contains two thioredoxin domains, the COOH-terminal one harboring a CGFC motif, and has a similar protein domain structure as members of the protein disulfide isomerase (PDI family. In REF52.2 and CHO cells, EFP1 colocalized with the endoplasmic reticulum (ER marker PDI. Furthermore, EFP1 possesses catalytic activity as demonstrated by an insulin disulfide reduction assay. Western blot analysis revealed two EFP1 protein bands of approximately 136 and 155 kDa, representing different glycosylation states of the protein. Complex formation between EFP1 and Par-4 was confirmed in vitro and in vivo by co-immunoprecipitation, dot blot overlay and pull-down experiments. In CHO cells, coexpression of EFP1 and Par-4 resulted in enhanced Par-4-mediated apoptosis, which required the catalytic activity of EFP1. Interestingly, EFP1 was specifically upregulated in NIH3T3 cells after induction of ER stress by thapsigargin, tunicamycin, and brefeldin A, but not by agents that induce oxidative stress or ER-independent apoptosis. Furthermore, we could show that the induction of apoptosis by Ca2+ stress-inducing agents was significantly decreased after si

Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

KAUST Repository

Othoum, Ghofran K

2013-05-01

Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

Identifying Regulatory Patterns at the 3'end Regions of Over-expressed and Under-expressed Genes

KAUST Repository

Othoum, Ghofran K

2013-01-01

Promoters, neighboring regulatory regions and those extending further upstream of the 5’end of genes, are considered one of the main components affecting the expression status of genes in a specific phenotype. More recently research by Chen et al. (2006, 2012) and Mapendano et al. (2010) demonstrated that the 3’end regulatory regions of genes also influence gene expression. However, the association between the regulatory regions surrounding 3’end of genes and their over- or under-expression status in a particular phenotype has not been systematically studied. The aim of this study is to ascertain if regulatory regions surrounding the 3’end of genes contain sufficient regulatory information to correlate genes with their expression status in a particular phenotype. Over- and under-expressed ovarian cancer (OC) genes were used as a model. Exploratory analysis of the 3’end regions were performed by transforming the annotated regions using principal component analysis (PCA), followed by clustering the transformed data thereby achieving a clear separation of genes with different expression status. Additionally, several classification algorithms such as Naïve Bayes, Random Forest and Support Vector Machine (SVM) were tested with different parameter settings to analyze the discriminatory capacity of the 3’end regions of genes related to their gene expression status. The best performance was achieved using the SVM classification model with 10-fold cross-validation that yielded an accuracy of 98.4%, sensitivity of 99.5% and specificity of 92.5%. For gene expression status for newly available instances, based on information derived from the 3’end regions, an SVM predictive model was developed with 10-fold cross-validation that yielded an accuracy of 67.0%, sensitivity of 73.2% and specificity of 61.0%. Moreover, building an SVM with polynomial kernel model to PCA transformed data yielded an accuracy of 83.1%, sensitivity of 92.5% and specificity of 74.8% using

Expression of Nanog gene promotes NIH3T3 cell proliferation

International Nuclear Information System (INIS)

Zhang Jingyu; Wang Xia; Chen Bing; Suo Guangli; Zhao Yanhong; Duan Ziyuan; Dai Jianwu

2005-01-01

Cells are the functional elements in tissue engineering and regenerative medicine. A large number of cells are usually needed for these purposes. However, there are numbers of limitations for in vitro cell proliferation. Nanog is an important self-renewal determinant in embryonic stem cells. However, it remains unknown whether Nanog will influence the cell cycle and cell proliferation of mature cells. In this study, we expressed Nanog in NIH3T3 cells and showed that expression of Nanog in NIH3T3 promoted cells to enter into S phase and enhanced cell proliferation. This suggests that Nanog gene might function in a similar fashion in mature cells as in ES cells. In addition, it may provide an approach for in vitro cell expansion

Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines

International Nuclear Information System (INIS)

Wang Hongmei; Wu Xinyao; Xia Yunfei

2002-01-01

Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations

Mutational Analysis of TAC3 and TACR3 Genes in Patients with Idiopathic Central Pubertal Disorders

Science.gov (United States)

Tusset, Cintia; Noel, Sekoni D.; Trarbach, Ericka B.; Silveira, Letícia F. G.; Jorge, Alexander A. L.; Brito, Vinicius N.; Cukier, Priscila; Seminara, Stephanie B.; de Mendonça, Berenice B.; Kaiser, Ursula B.; Latronico, Ana Claudia

2013-01-01

Aim To investigate the presence of variants in the TAC3 and TACR3 genes, which encode NKB and its receptor (NK3R), respectively, in a large cohort of patients with idiopathic central pubertal disorders. Patients and Methods Two hundred and thirty seven patients were studied: 114 with central precocious puberty (CPP), 73 with normosmic isolated hypogonadotropic hypogonadism (IHH) and 50 with constitutional delay of growth and puberty (CDGP). The control group consisted of 150 Brazilian individuals with normal pubertal development. Genomic DNA was extracted from peripheral blood and the entire coding region of both TAC3 and TACR3 genes were amplified and automatically sequenced. Results We identified one variant (p.A63P) in NKB and four variants, p.G18D, p.L58L (c.172C>T), p.W275* and p.A449S in NK3R, which were absent in the control group. The p.A63P variant was identified in a girl with CPP, and p.A449S in a girl with CDGP. The known p.G18D, p.L58L and p.W275* variants were identified in three unrelated males with normosmic IHH. Conclusion Rare variants in the TAC3 and TACR3 genes were identified in patients with central pubertal disorders. Loss-of-function variants of TACR3 were associated with the normosmic IHH phenotype. PMID:23329188

In Vitro Pro-apoptotic and Anti-migratory Effects of Ficus deltoidea L. Plant Extracts on the Human Prostate Cancer Cell Lines PC3

Science.gov (United States)

Hanafi, Mohd M. M.; Afzan, Adlin; Yaakob, Harisun; Aziz, Ramlan; Sarmidi, Mohamad R.; Wolfender, Jean-Luc; Prieto, Jose M.

2017-01-01

This study aims to evaluate the in vitro cytotoxic and anti-migratory effects of Ficus deltoidea L. on prostate cancer cells, identify the active compound/s and characterize their mechanism of actions. Two farmed varieties were studied, var. angustifolia (FD1) and var. deltoidea (FD2). Their crude methanolic extracts were partitioned into n-hexane (FD1h, FD2h) chloroform (FD1c, FD2c) and aqueous extracts (FD1a, FD2a). Antiproliferative fractions (IC50 < 30 μg/mL, SRB staining of PC3 cells) were further fractionated. Active compound/s were dereplicated using spectroscopic methods. In vitro mechanistic studies on PC3 and/or LNCaP cells included: annexin V-FITC staining, MMP depolarization measurements, activity of caspases 3 and 7, nuclear DNA fragmentation and cell cycle analysis, modulation of Bax, Bcl-2, Smac/Diablo, and Alox-5 mRNA gene expression by RT-PCR. Effects of cytotoxic fractions on 2D migration and 3D invasion were tested by exclusion assays and modified Boyden chamber, respectively. Their mechanisms of action on these tests were further studied by measuring the expression VEGF-A, CXCR4, and CXCL12 in PC3 cells by RT-PCR. FD1c and FD2c extracts induced cell death (P < 0.05) via apoptosis as evidenced by nuclear DNA fragmentation. This was accompanied by an increase in MMP depolarization (P < 0.05), activation of caspases 3 and 7 (P < 0.05) in both PC3 and LNCaP cell lines. All active plant extracts up-regulated Bax and Smac/DIABLO, down-regulated Bcl-2 (P < 0.05). Both FD1c and FD2c were not cytotoxic against normal human fibroblast cells (HDFa) at the tested concentrations. Both plant extracts inhibited both migration and invasion of PC3 cells (P < 0.05). These effects were accompanied by down-regulation of both VEGF-A and CXCL-12 gene expressions (P < 0.001). LC–MS dereplication using taxonomy filters and molecular networking databases identified isovitexin in FD1c; and oleanolic acid, moretenol, betulin, lupenone, and lupeol in FD2c. In conclusion

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism

Science.gov (United States)

Young, Alejandra; Sader, Avery; Farber, Debora B.

2016-01-01

Ocular albinism type 1 (OA), caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE). This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain’s optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS) on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3’ untranslated region (UTR), 6 in the 5’ UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism. PMID:27607449

GNAI3: Another Candidate Gene to Screen in Persons with Ocular Albinism.

Directory of Open Access Journals (Sweden)

Alejandra Young

Full Text Available Ocular albinism type 1 (OA, caused by mutations in the OA1 gene, encodes a G-protein coupled receptor, OA1, localized in melanosomal membranes of the retinal pigment epithelium (RPE. This disorder is characterized by both RPE macro-melanosomes and abnormal decussation of ganglion cell axons at the brain's optic chiasm. We demonstrated previously that Oa1 specifically activates Gαi3, which also signals in the Oa1 transduction pathway that regulates melanosomal biogenesis. In this study, we screened the human Gαi3 gene, GNAI3, in DNA samples from 26 patients who had all clinical characteristics of OA but in whom a specific mutation in the OA1 gene had not been found, and in 6 normal control individuals. Using the Agilent HaloPlex Target Enrichment System and next-generation sequencing (NGS on the Illumina MiSeq platform, we identified 518 variants after rigorous filtering. Many of these variants were corroborated by Sanger sequencing. Overall, 98.8% coverage of the GNAI3 gene was obtained by the HaloPlex amplicons. Of all variants, 6 non-synonymous and 3 synonymous were in exons, 41 in a non-coding exon embedded in the 3' untranslated region (UTR, 6 in the 5' UTR, and 462 in introns. These variants included novel SNVs, insertions, deletions, and a frameshift mutation. All were found in at least one patient but none in control samples. Using computational methods, we modeled the GNAI3 protein and its non-synonymous exonic mutations and determined that several of these may be the cause of disease in the patients studied. Thus, we have identified GNAI3 as a second gene possibly responsible for X-linked ocular albinism.

Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

Science.gov (United States)

2011-01-01

Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599

Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

Directory of Open Access Journals (Sweden)

Lisowska Katarzyna Marta

2011-06-01

Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.

HSD3B and gene-gene interactions in a pathway-based analysis of genetic susceptibility to bladder cancer.

Directory of Open Access Journals (Sweden)

Angeline S Andrew

Full Text Available Bladder cancer is the 4(th most common cancer among men in the U.S. We analyzed variant genotypes hypothesized to modify major biological processes involved in bladder carcinogenesis, including hormone regulation, apoptosis, DNA repair, immune surveillance, metabolism, proliferation, and telomere maintenance. Logistic regression was used to assess the relationship between genetic variation affecting these processes and susceptibility in 563 genotyped urothelial cell carcinoma cases and 863 controls enrolled in a case-control study of incident bladder cancer conducted in New Hampshire, U.S. We evaluated gene-gene interactions using Multifactor Dimensionality Reduction (MDR and Statistical Epistasis Network analysis. The 3'UTR flanking variant form of the hormone regulation gene HSD3B2 was associated with increased bladder cancer risk in the New Hampshire population (adjusted OR 1.85 95%CI 1.31-2.62. This finding was successfully replicated in the Texas Bladder Cancer Study with 957 controls, 497 cases (adjusted OR 3.66 95%CI 1.06-12.63. The effect of this prevalent SNP was stronger among males (OR 2.13 95%CI 1.40-3.25 than females (OR 1.56 95%CI 0.83-2.95, (SNP-gender interaction P = 0.048. We also identified a SNP-SNP interaction between T-cell activation related genes GATA3 and CD81 (interaction P = 0.0003. The fact that bladder cancer incidence is 3-4 times higher in males suggests the involvement of hormone levels. This biologic process-based analysis suggests candidate susceptibility markers and supports the theory that disrupted hormone regulation plays a role in bladder carcinogenesis.

Role of LOX3 Gene in Alleviating Adverse Effects of Drought and Pathogens in Rice

Institute of Scientific and Technical Information of China (English)

LIU Nan-nan; JIANG Ling; ZHANG Wen-wei; LIU Ling-long; ZHAI Hu-qu; WAN Jian-min

2008-01-01

Lipoxygenase 3 (LOX3) is a major component of the LOX isozymes in mature rice seeds. To investigate the role of LOX3 gene under stresses, a plant expression vector containing antisense cDNA of LOX3 was constructed. Rice varieties Wuyunjing 7 and Kasalath were transformed by the Agrobacterium-mediated method and transgenic rice plants were generated. PCR and Southern blot results showed that the antisense LOX3 gene was integrated into the rice genome. Analyses of embryo LOX3 deletion and semi-quantitative RT-PCR confirmed the antisense suppression of LOX3 gene in transgenic plants. The T2 antisense plants of LOX3 were sensitive to drought stress, rice blast and bacterial blight compared with non-transgenic plants. These results suggest that the LOX3 gene might function in response to stresses.

Identification and expression analysis of four 14-3-3 genes during fruit ripening in banana (Musa acuminata L. AAA group, cv. Brazilian).

Science.gov (United States)

Li, Mei-Ying; Xu, Bi-Yu; Liu, Ju-Hua; Yang, Xiao-Liang; Zhang, Jian-Bin; Jia, Cai-Hong; Ren, Li-Cheng; Jin, Zhi-Qiang

2012-02-01

To investigate the regulation of 14-3-3 proteins in banana (Musa acuminata L. AAA group, cv. Brazilian) fruit postharvest ripening, four cDNAs encoding 14-3-3 proteins were isolated from banana and designated as Ma-14-3-3a, Ma-14-3-3c, Ma-14-3-3e, and Ma-14-3-3i, respectively. Amino acid sequence alignment showed that the four 14-3-3 proteins shared a highly conserved core structure and variable C-terminal as well as N-terminal regions with 14-3-3 proteins from other plant species. Phylogenetic analysis revealed that the four 14-3-3 genes belong to the non-ε groups. They were differentially and specifically expressed in various tissues. Real-time RT-PCR analysis indicated that these four genes function differentially during banana fruit postharvest ripening. Three genes, Ma-14-3-3a, Ma-14-3-3c, and Ma-14-3-3e, were significantly induced by exogenous ethylene treatment. However, gene function differed in naturally ripened fruits. Ethylene could induce Ma-14-3-3c expression during postharvest ripening, but expression patterns of Ma-14-3-3a and Ma-14-3-3e suggest that these two genes appear to be involved in regulating ethylene biosynthesis during fruit ripening. No obvious relationship emerged between Ma-14-3-3i expression in naturally ripened and 1-MCP (1-methylcyclopropene)-treated fruit groups during fruit ripening. These results indicate that the 14-3-3 proteins might be involved in various regulatory processes of banana fruit ripening. Further studies will mainly focus on revealing the detailed biological mechanisms of these four 14-3-3 genes in regulating banana fruit postharvest ripening.

Apoptosis Induction by Polygonum minus is related to antioxidant capacity, alterations in expression of apoptotic-related genes, and S-phase cell cycle arrest in HepG2 cell line.

Science.gov (United States)

Mohd Ghazali, Mohd Alfazari; Al-Naqeb, Ghanya; Krishnan Selvarajan, Kesavanarayanan; Hazizul Hasan, Mizaton; Adam, Aishah

2014-01-01

Polygonum minus (Polygonaceae) is a medicinal herb distributed throughout eastern Asia. The present study investigated antiproliferative effect of P. minus and its possible mechanisms. Four extracts (petroleum ether, methanol, ethyl acetate, and water) were prepared by cold maceration. Extracts were subjected to phytochemical screening, antioxidant, and antiproliferative assays; the most bioactive was fractionated using vacuum liquid chromatography into seven fractions (F1-F7). Antioxidant activity was measured via total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH), and ferric reducing antioxidant power (FRAP) assays. Antiproliferative activity was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Most active fraction was tested for apoptosis induction and cell cycle arrest in HepG2 cells using flow cytometry and confocal microscopy. Apoptotic-related gene expression was studied by RT-PCR. Ethyl acetate extract was bioactive in initial assays. Its fraction, F7, exhibited highest antioxidant capacity (TPC; 113.16 ± 6.2 mg GAE/g extract, DPPH; EC50: 30.5 ± 3.2 μg/mL, FRAP; 1169 ± 20.3 μmol Fe (II)/mg extract) and selective antiproliferative effect (IC50: 25.75 ± 1.5 μg/mL). F7 induced apoptosis in concentration- and time-dependent manner and caused cell cycle arrest at S-phase. Upregulation of proapoptotic genes (Bax, p53, and caspase-3) and downregulation of antiapoptotic gene, Bcl-2, were observed. In conclusion, F7 was antiproliferative to HepG2 cells by inducing apoptosis, cell cycle arrest, and via antioxidative effects.

Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants

International Nuclear Information System (INIS)

Kelly, R.; Miller, S.M.; Kurtz, M.B.; Kirsch, D.R.

1987-01-01

A method for introducing specific mutations into the diploid Candida albicans by one-step gene disruption and subsequent UV-induced recombination was developed. The cloned C. albicans URA3 gene was disrupted with the C. albicans ADE2 gene, and the linearized DNA was used for transformation of two ade2 mutants, SGY-129 and A81-Pu. Both an insertional inactivation of the URA3 gene and a disruption which results in a 4.0-kilobase deletion were made. Southern hybridization analyses demonstrated that the URA3 gene was disrupted on one of the chromosomal homologs in 15 of the 18 transformants analyzed. These analyses also revealed restriction site dimorphism of EcoRI at the URA3 locus which provides a unique marker to distinguish between chromosomal homologs. This enabled us to show that either homolog could be disrupted and that disrupted transformants of SGY-129 contained more than two copies of the URA3 locus. The A81-Pu transformants heterozygous for the ura3 mutations were rendered homozygous and Ura- by UV-induced recombination. The homozygosity of a deletion mutant and an insertion mutant was confirmed by Southern hybridization. Both mutants were transformed to Ura+ with plasmids containing the URA3 gene and in addition, were resistant to 5-fluoro-orotic acid, a characteristic of Saccharomyces cerevisiae ura3 mutants as well as of orotidine-5'-phosphate decarboxylase mutants of other organisms

ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

Science.gov (United States)

Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

2016-09-01

ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Urban air pollution produces up-regulation of myocardial inflammatory genes and dark chocolate provides cardioprotection.

Science.gov (United States)

Villarreal-Calderon, Rodolfo; Reed, William; Palacios-Moreno, Juan; Keefe, Sheyla; Herritt, Lou; Brooks, Diane; Torres-Jardón, Ricardo; Calderón-Garcidueñas, Lilian

2012-05-01

Air pollution is a serious environmental problem. Elderly subjects show increased cardiac morbidity and mortality associated with air pollution exposure. Mexico City (MC) residents are chronically exposed to high concentrations of fine particulate matter (PM(2.5)) and PM-associated lipopolysaccharides (PM-LPS). To test the hypothesis that chronic exposure to urban pollution produces myocardial inflammation, female Balb-c mice age 4 weeks were exposed for 16 months to two distinctly different polluted areas within MC: southwest (SW) and northwest (NW). SW mice were given either no treatment or chocolate 2g/9.5 mg polyphenols/3 times per week. Results were compared to mice kept in clean air. Key inflammatory mediator genes: cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), and the LPS receptor CD14 (cluster of differentiation antigen 14) were measured by real-time polymerase chain reaction. Also explored were target NFκB (nuclear factor κB), oxidative stress and antioxidant defense genes. TNF-α, IL-6, and COX-2 were significantly increased in both NW and SWMC mice (p=0.0001). CD14 was up-regulated in SW mice in keeping with the high exposures to particulate matter associated endotoxin. Chocolate administration resulted in a significant down-regulation of TNF-α (p<0.0001), IL-6 (p=0.01), and IL-1β (p=0.02). The up-regulation of antioxidant enzymes and the down-regulation of potent oxidases, toll-like receptors, and pro-apoptotic signaling genes completed the protective profile. Exposure to air pollution produces up-regulation of inflammatory myocardial genes and endotoxin plays a key role in the inflammatory response. Regular consumption of dark chocolate may reduce myocardial inflammation and have cardioprotective properties in the setting of air pollution exposures. Copyright © 2010 Elsevier GmbH. All rights reserved.

Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

International Nuclear Information System (INIS)

Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

2003-01-01

Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

Expression of AQP3 gene in chronic atrophic and chronic superficial gastritis patients

Directory of Open Access Journals (Sweden)

Shijun Zhang

2007-12-01

Full Text Available BACKGROUND: Most studies about aquaporin 3 (AQP3 in the gastrointestinal tract were carried out on both in vivo and in vitro. The role of AQP3-mediated water transport in human gastrointestinal tract is still unclear. Our aim in this study was to explore the expression of AQP3 gene in chronic atrophic gastritis (CAG and chronic superficial gastritis (CSG atients and to determine its possible function in the development of gastritis.
METHODS: Twenty-two outpatients diagnosed as CSG and 12 outpatients diagnosed as CAG were selected randomly. Ten cases of healthy individuals were selected as normal control group. In all cases, AQP3 gene expression of gastric mucosa was detected by fluorescence quantitative polymerase chain reaction (FQ-PCR.
RESULTS: The AQP3 gene expression was significantly higher in gastric mucosa of CSG and healthy individuals than that in CAG (P<0.01. However, there was no significant difference in the AQP3 gene expression between helicobacter pylori positive patients and helicobacter pylori negative patients (P>0.05.
CONCLUSIONS: AQP3 expression might play certain role in the occurrence and development of gastritis.
KEY WORDS: Aquaporin 3, chronic superficial gastritis, chronic atrophic gastritis.

Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

Science.gov (United States)

Zhang, Zhichun; Tian, Hua; Lv, Ping; Wang, Weiping; Jia, Zhuqing; Wang, Sainan; Zhou, Chunyan; Gao, Xuejun

2015-01-01

Mutation of distal-less homeobox 3 (DLX3) is responsible for human tricho-dento-osseous syndrome (TDO) with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP) genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO) inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

Vicrostatin - an anti-invasive multi-integrin targeting chimeric disintegrin with tumor anti-angiogenic and pro-apoptotic activities.

Directory of Open Access Journals (Sweden)

Radu O Minea

2010-06-01

Full Text Available Similar to other integrin-targeting strategies, disintegrins have previously shown good efficacy in animal cancer models with favorable pharmacological attributes and translational potential. Nonetheless, these polypeptides are notoriously difficult to produce recombinantly due to their particular structure requiring the correct pairing of multiple disulfide bonds for biological activity. Here, we show that a sequence-engineered disintegrin (called vicrostatin or VCN can be reliably produced in large scale amounts directly in the oxidative cytoplasm of Origami B E. coli. Through multiple integrin ligation (i.e., alphavbeta3, alphavbeta5, and alpha5beta1, VCN targets both endothelial and cancer cells significantly inhibiting their motility through a reconstituted basement membrane. Interestingly, in a manner distinct from other integrin ligands but reminiscent of some ECM-derived endogenous anti-angiogenic fragments previously described in the literature, VCN profoundly disrupts the actin cytoskeleton of endothelial cells (EC inducing a rapid disassembly of stress fibers and actin reorganization, ultimately interfering with EC's ability to invade and form tubes (tubulogenesis. Moreover, here we show for the first time that the addition of a disintegrin to tubulogenic EC sandwiched in vitro between two Matrigel layers negatively impacts their survival despite the presence of abundant haptotactic cues. A liposomal formulation of VCN (LVCN was further evaluated in vivo in two animal cancer models with different growth characteristics. Our data demonstrate that LVCN is well tolerated while exerting a significant delay in tumor growth and an increase in the survival of treated animals. These results can be partially explained by potent tumor anti-angiogenic and pro-apoptotic effects induced by LVCN.

1,25-Dihydroxyvitamin D3 regulates genes responsible for detoxification in intestine

International Nuclear Information System (INIS)

Kutuzova, Galina D.; DeLuca, Hector F.

2007-01-01

1α,25-Dihydroxyvitamin D 3 (1,25-(OH) 2 D 3 ), the biologically active form of vitamin D 3 , not only plays a major role in mammalian calcium and phosphorous homeostasis but also exerts pleiotropic effects on cell proliferation, differentiation and the immune system. Further, vitamin D is believed to play a significant role in the prevention of colon, prostate, and breast cancer and in reducing the risk of autoimmune diseases. To gain insight into the mechanism whereby vitamin D can have such diverse actions, we have employed microarray technology. We studied the effect of a single dose of 1,25-(OH) 2 D 3 on gene expression in the intestine of vitamin D-deficient rats. Within 6 h, 1,25-(OH) 2 D 3 stimulates the expression of several phase I and phase II biotransformation genes. There is also an increased expression of antioxidant genes. These results support the idea that vitamin D is a significant factor in detoxification and protection against environmental toxins

Analysis of Complement C3 Gene Reveals Susceptibility to Severe Preeclampsia

Directory of Open Access Journals (Sweden)

A. Inkeri Lokki

2017-05-01

Full Text Available Preeclampsia (PE is a common vascular disease of pregnancy with genetic predisposition. Dysregulation of the complement system has been implicated, but molecular mechanisms are incompletely understood. In this study, we determined the potential linkage of severe PE to the most central complement gene, C3. Three cohorts of Finnish patients and controls were recruited for a genetic case-control study. Participants were genotyped using Sequenom genotyping and Sanger sequencing. Initially, we studied 259 Finnish patients with severe PE and 426 controls from the Southern Finland PE and the Finnish population-based PE cohorts. We used a custom-made single nucleotide polymorphism (SNP genotyping assay consisting of 98 SNPs in 18 genes that encode components of the complement system. Following the primary screening, C3 was selected as the candidate gene and consequently Sanger sequenced. Fourteen SNPs from C3 were also genotyped by a Sequenom panel in 960 patients with severe PE and 705 controls, including already sequenced individuals. Three of the 43 SNPs observed within C3 were associated with severe PE: rs2287845 (p = 0.038, OR = 1.158, rs366510 (p = 0.039, OR = 1.158, and rs2287848 (p = 0.041, OR = 1.155. We also discovered 16 SNP haplotypes with extreme linkage disequilibrium in the middle of the gene with a protective (p = 0.044, OR = 0.628 or a predisposing (p = 0.011, OR = 2.110 effect to severe PE depending on the allele combination. Genetic variants associated with PE are located in key domains of C3 and could thereby influence the function of C3. This is, as far as we are aware, the first candidate gene in the complement system with an association to a clinically relevant PE subphenotype, severe PE. The result highlights a potential role for the complement system in the pathogenesis of PE and may help in defining prognostic and therapeutic subgroups of preeclamptic women.

Reg Gene Expression in Periosteum after Fracture and Its In Vitro Induction Triggered by IL-6

Directory of Open Access Journals (Sweden)

Yasuaki Tohma

2017-10-01

Full Text Available The periosteum is a thin membrane that surrounds the outer surface of bones and participates in fracture healing. However, the molecular signals that trigger/initiate the periosteal reaction are not well established. We fractured the rat femoral bone at the diaphysis and fixed it with an intramedullary inserted wire, and the expression of regenerating gene (Reg I, which encodes a tissue regeneration/growth factor, was analyzed. Neither bone/marrow nor muscle showed Reg I gene expression before or after the fracture. By contrast, the periosteum showed an elevated expression after the fracture, thereby confirming the localization of Reg I expression exclusively in the periosteum around the fractured areas. Expression of the Reg family increased after the fracture, followed by a decrease to basal levels by six weeks, when the fracture had almost healed. In vitro cultures of periosteal cells showed no Reg I expression, but the addition of IL-6 significantly induced Reg I gene expression. The addition of IL-6 also increased the cell number and reduced pro-apoptotic gene expression of Bim. The increased cell proliferation and reduction in Bim gene expression were abolished by transfection with Reg I siRNA, indicating that these IL-6-dependent effects require the Reg I gene expression. These results indicate the involvement of the IL-6/Reg pathway in the osteogenic response of the periosteum, which leads to fracture repair.

Next-generation sequencing identifies transportin 3 as the causative gene for LGMD1F.

Directory of Open Access Journals (Sweden)

Annalaura Torella

Full Text Available Limb-girdle muscular dystrophies (LGMD are genetically and clinically heterogeneous conditions. We investigated a large family with autosomal dominant transmission pattern, previously classified as LGMD1F and mapped to chromosome 7q32. Affected members are characterized by muscle weakness affecting earlier the pelvic girdle and the ileopsoas muscles. We sequenced the whole exome of four family members and identified a shared heterozygous frame-shift variant in the Transportin 3 (TNPO3 gene, encoding a member of the importin-β super-family. The TNPO3 gene is mapped within the LGMD1F critical interval and its 923-amino acid human gene product is also expressed in skeletal muscle. In addition, we identified an isolated case of LGMD with a new missense mutation in the same gene. We localized the mutant TNPO3 around the nucleus, but not inside. The involvement of gene related to the nuclear transport suggests a novel disease mechanism leading to muscular dystrophy.

rSNPBase 3.0: an updated database of SNP-related regulatory elements, element-gene pairs and SNP-based gene regulatory networks.

Science.gov (United States)

Guo, Liyuan; Wang, Jing

2018-01-04

Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Association of HS6ST3 gene polymorphisms with obesity and ...

Indian Academy of Sciences (India)

Supplementary data: Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene × gender interaction. Ke-Sheng Wang, Liang Wang, Xuefeng Liu and Min Zeng. J. Genet. 92, 395–402. Table 1. Associations of 117 SNPs with obesity in the Health ABC and Marshfield samples. Minor. OR Health.

Effects of nickel treatment on H3K4 trimethylation and gene expression.

Directory of Open Access Journals (Sweden)

Kam-Meng Tchou-Wong

Full Text Available Occupational exposure to nickel compounds has been associated with lung and nasal cancers. We have previously shown that exposure of the human lung adenocarcinoma A549 cells to NiCl(2 for 24 hr significantly increased global levels of trimethylated H3K4 (H3K4me3, a transcriptional activating mark that maps to the promoters of transcribed genes. To further understand the potential epigenetic mechanism(s underlying nickel carcinogenesis, we performed genome-wide mapping of H3K4me3 by chromatin immunoprecipitation and direct genome sequencing (ChIP-seq and correlated with transcriptome genome-wide mapping of RNA transcripts by massive parallel sequencing of cDNA (RNA-seq. The effect of NiCl(2 treatment on H3K4me3 peaks within 5,000 bp of transcription start sites (TSSs on a set of genes highly induced by nickel in both A549 cells and human peripheral blood mononuclear cells were analyzed. Nickel exposure increased the level of H3K4 trimethylation in both the promoters and coding regions of several genes including CA9 and NDRG1 that were increased in expression in A549 cells. We have also compared the extent of the H3K4 trimethylation in the absence and presence of formaldehyde crosslinking and observed that crosslinking of chromatin was required to observe H3K4 trimethylation in the coding regions immediately downstream of TSSs of some nickel-induced genes including ADM and IGFBP3. This is the first genome-wide mapping of trimethylated H3K4 in the promoter and coding regions of genes induced after exposure to NiCl(2. This study may provide insights into the epigenetic mechanism(s underlying the carcinogenicity of nickel compounds.

FOXO3a Provides a Quickstep from Autophagy Inhibition to Apoptosis in Cancer Therapy.

Science.gov (United States)

Codogno, Patrice; Morel, Etienne

2018-03-12

FOXO3a, a member of the Forkhead transcription factor family, has roles in apoptosis and autophagy. In this issue of Developmental Cell, Fitzwalter et al. (2018) describe how the blockade of FOXO3a turnover, which normally occurs through autophagy, sensitizes cancer cells to apoptosis through FOXO3a-mediated stimulation of pro-apoptotic PUMA/BBC3 expression. Copyright © 2018 Elsevier Inc. All rights reserved.

Altholactone Inhibits NF-κB and STAT3 Activation and Induces Reactive Oxygen Species-Mediated Apoptosis in Prostate Cancer DU145 Cells

Directory of Open Access Journals (Sweden)

Chunwa Jiang

2017-02-01

Full Text Available Altholactone, a natural compound isolated from Goniothalamus spp., has demonstrated anti-inflammatory and anticancer activities, but its molecular mechanisms are still not fully defined. Nuclear factor kappa B (NF-κB and signal transducer and activator of transcription 3 (STAT3 play pivotal roles in the cell survival of many human tumors. The objective of this study was to elucidate the mechanism of action of altholactone against prostate cancer DU145 cells and to evaluate whether its effects are mediated by inhibition of NF-κB and STAT3 activity. Altholactone inhibited proliferation of DU145 cells and induced cell cycle arrest in S phase and triggered apoptosis. Reporter assays revealed that altholactone repressed p65- and TNF-α-enhanced NF-κB transcriptional activity and also inhibited both constitutive and IL-6-induced transcriptional activity of STAT3. Consistent with this, altholactone down-regulated phosphorylation of STAT3 and moreover, decreased constitutively active mutant of STAT3 (STAT3C-induced transcriptional activity. Altholactone treatment also results in down-regulation of STAT3 target genes such as survivin, and Bcl-2 followed by up regulation of pro-apoptotic Bax protein. However, pre-treatment with the antioxidant N-acetylcysteine (NAC significantly inhibited the activation of Bax and prevented down-regulation of STAT3 target genes. Collectively, our findings suggest that altholactone induces DU145 cells death through inhibition of NF-κB and STAT3 activity.

Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.

Science.gov (United States)

Van Bel, Michiel; Coppens, Frederik

2017-01-01

Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .

Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis

OpenAIRE

Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

2014-01-01

Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...

Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

International Nuclear Information System (INIS)

Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

2008-01-01

Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

Mutation update of transcription factor genes FOXE3, HSF4, MAF, and PITX3 causing cataracts and other developmental ocular defects.

Science.gov (United States)

Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A

2018-04-01

Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at https://www.LOVD.nl/FOXE3, https://www.LOVD.nl/HSF4, https://www.LOVD.nl/MAF, and https://www.LOVD.nl/PITX3. Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.

Isolation and characterization of PEP3, a gene required for vacuolar biogenesis in Saccharomyces cerevisiae.

OpenAIRE

Preston, R A; Manolson, M F; Becherer, K; Weidenhammer, E; Kirkpatrick, D; Wright, R; Jones, E W

1991-01-01

The Saccharomyces cerevisiae PEP3 gene was cloned from a wild-type genomic library by complementation of the carboxypeptidase Y deficiency in a pep3-12 strain. Subclone complementation results localized the PEP3 gene to a 3.8-kb DNA fragment. The DNA sequence of the fragment was determined; a 2,754-bp open reading frame predicts that the PEP3 gene product is a hydrophilic, 107-kDa protein that has no significant similarity to any known protein. The PEP3 predicted protein has a zinc finger (CX...

Transcriptional factor DLX3 promotes the gene expression of enamel matrix proteins during amelogenesis.

Directory of Open Access Journals (Sweden)

Zhichun Zhang

Full Text Available Mutation of distal-less homeobox 3 (DLX3 is responsible for human tricho-dento-osseous syndrome (TDO with amelogenesis imperfecta, indicating a crucial role of DLX3 in amelogenesis. However, the expression pattern of DLX3 and its specific function in amelogenesis remain largely unknown. The aim of this study was to investigate the effects of DLX3 on enamel matrix protein (EMP genes. By immunohistochemistry assays of mouse tooth germs, stronger immunostaining of DLX3 protein was identified in ameloblasts in the secretory stage than in the pre-secretory and maturation stages, and the same pattern was found for Dlx3 mRNA using Realtime PCR. In a mouse ameloblast cell lineage, forced expression of DLX3 up-regulated the expression of the EMP genes Amelx, Enam, Klk4, and Odam, whereas knockdown of DLX3 down-regulated these four EMP genes. Further, bioinformatics, chromatin immunoprecipitation, and luciferase assays revealed that DLX3 transactivated Enam, Amelx, and Odam through direct binding to their enhancer regions. Particularly, over-expression of mutant-DLX3 (c.571_574delGGGG, responsible for TDO inhibited the activation function of DLX3 on expression levels and promoter activities of the Enam, Amelx, and Odam genes. Together, our data show that DLX3 promotes the expression of the EMP genes Amelx, Enam, Klk4, and Odam in amelogenesis, while mutant-DLX3 disrupts this regulatory function, thus providing insights into the molecular mechanisms underlying the enamel defects of TDO disease.

SHANK3 as an autism spectrum disorder-associated gene.

Science.gov (United States)

Uchino, Shigeo; Waga, Chikako

2013-02-01

SHANK3 is a synaptic scaffolding protein enriched in the postsynaptic density of excitatory synapses, and plays important roles in the formation, maturation, and maintenance of synapses. Haploinsufficiency of the SHANK3 gene causes a developmental disorder, 22q13.3 deletion syndrome (known as Phelan-McDermid syndrome), that is characterized by severe expressive language and speech delay, hypotonia, global developmental delay, and autistic behavior. Since several SHANK3 mutations have been identified in a particular phenotypic group in patients with autism spectrum disorder (ASD), the SHANK3 is strongly suspected of being involved in the pathogenesis and neuropathology of ASD. Five CpG-islands have been identified in the SHANK3 gene, and tissue-specific expression of SHANK3 is regulated by DNA methylation in an epigenetic manner. Cumulative evidence has shown that several SHANK3 variants are expressed in the developing rodent brain and that their expression is regulated by DNA methylation of intragenic promoters. We identified novel SHANK3 transcripts whose transcription started at the vicinity of the CpG-island 2 in the mouse brain. Shank3 mutant mice exhibit autistic-like behaviors, including impaired social interaction and repetitive behaviors. In this article we review recent findings in regard to higher brain functions of SHANK3, epigenetic regulation of SHANK3 expression, and SHANK3-related ASD that were obtained from genetic analyses in ASD patients, molecular biological studies using developing mouse brains, and studies of Shank3 mutant mice. Copyright © 2012 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

Institute of Scientific and Technical Information of China (English)

Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

2007-01-01

The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

An original SERPINA3 gene cluster: Elucidation of genomic organization and gene expression in the Bos taurus 21q24 region

Directory of Open Access Journals (Sweden)

Ouali Ahmed

2008-04-01

Full Text Available Abstract Background The superfamily of serine proteinase inhibitors (serpins is involved in numerous fundamental biological processes as inflammation, blood coagulation and apoptosis. Our interest is focused on the SERPINA3 sub-family. The major human plasma protease inhibitor, α1-antichymotrypsin, encoded by the SERPINA3 gene, is homologous to genes organized in clusters in several mammalian species. However, although there is a similar genic organization with a high degree of sequence conservation, the reactive-centre-loop domains, which are responsible for the protease specificity, show significant divergences. Results We provide additional information by analyzing the situation of SERPINA3 in the bovine genome. A cluster of eight genes and one pseudogene sharing a high degree of identity and the same structural organization was characterized. Bovine SERPINA3 genes were localized by radiation hybrid mapping on 21q24 and only spanned over 235 Kilobases. For all these genes, we propose a new nomenclature from SERPINA3-1 to SERPINA3-8. They share approximately 70% of identity with the human SERPINA3 homologue. In the cluster, we described an original sub-group of six members with an unexpected high degree of conservation for the reactive-centre-loop domain, suggesting a similar peptidase inhibitory pattern. Preliminary expression analyses of these bovSERPINA3s showed different tissue-specific patterns and diverse states of glycosylation and phosphorylation. Finally, in the context of phylogenetic analyses, we improved our knowledge on mammalian SERPINAs evolution. Conclusion Our experimental results update data of the bovine genome sequencing, substantially increase the bovSERPINA3 sub-family and enrich the phylogenetic tree of serpins. We provide new opportunities for future investigations to approach the biological functions of this unusual subset of serine proteinase inhibitors.

Identification of coagulation gene 3′UTR variants that are potentially regulated by microRNAs

NARCIS (Netherlands)

Vossen, Carla Y.; van Hylckama Vlieg, Astrid; Teruel-Montoya, Raúl; Salloum-Asfar, Salam; de Haan, Hugoline G.; Corral, Javier; Reitsma, Pieter H.; Koeleman, Bobby P.C.; Martínez, Constantino

2017-01-01

MicroRNAs have been recognized as critical regulators of gene expression and might affect the risk of venous thrombosis. We aimed to identify 3′ untranslated region (UTR) variants in coagulation genes that influence coagulation factor levels and venous thrombosis risk. The 3′UTR of coagulation genes

Structural influence of gene networks on their inference: analysis of C3NET

Directory of Open Access Journals (Sweden)

Emmert-Streib Frank

2011-06-01

Full Text Available Abstract Background The availability of large-scale high-throughput data possesses considerable challenges toward their functional analysis. For this reason gene network inference methods gained considerable interest. However, our current knowledge, especially about the influence of the structure of a gene network on its inference, is limited. Results In this paper we present a comprehensive investigation of the structural influence of gene networks on the inferential characteristics of C3NET - a recently introduced gene network inference algorithm. We employ local as well as global performance metrics in combination with an ensemble approach. The results from our numerical study for various biological and synthetic network structures and simulation conditions, also comparing C3NET with other inference algorithms, lead a multitude of theoretical and practical insights into the working behavior of C3NET. In addition, in order to facilitate the practical usage of C3NET we provide an user-friendly R package, called c3net, and describe its functionality. It is available from https://r-forge.r-project.org/projects/c3net and from the CRAN package repository. Conclusions The availability of gene network inference algorithms with known inferential properties opens a new era of large-scale screening experiments that could be equally beneficial for basic biological and biomedical research with auspicious prospects. The availability of our easy to use software package c3net may contribute to the popularization of such methods. Reviewers This article was reviewed by Lev Klebanov, Joel Bader and Yuriy Gusev.

Tumor necrosis factor related apoptosis inducing ligand triggers apoptosis in dividing but not in differentiating human epidermal keratinocytes

NARCIS (Netherlands)

Jansen, Bastiaan J. H.; van Ruissen, Fred; Cerneus, Stefanie; Cloin, Wendy; Bergers, Mieke; van Erp, Piet E. J.; Schalkwijk, Joost

2003-01-01

Using serial analysis of gene expression we have previously identified the expression of several pro-apoptotic and anti-apoptotic genes in cultured human primary epidermal keratinocytes, including tumor necrosis factor related apoptosis inducing ligand (TRAIL). TRAIL is a potent inducer of apoptosis

Evolutionary and polymorphism analyses reveal the central role of BTN3A2 in the concerted evolution of the BTN3 gene family.

Science.gov (United States)

Afrache, Hassnae; Pontarotti, Pierre; Abi-Rached, Laurent; Olive, Daniel

2017-06-01

The butyrophilin 3 (BTN3) receptors are implicated in the T lymphocytes regulation and present a wide plasticity in mammals. In order to understand how these genes have been diversified, we studied their evolution and show that the three human BTN3 are the result of two successive duplications in Primates and that the three genes are present in Hominoids and the Old World Monkey groups. A thorough phylogenetic analysis reveals a concerted evolution of BTN3 characterized by a strong and recurrent homogenization of the region encoding the signal peptide and the immunoglobulin variable (IgV) domain in Hominoids, where the sequences of BTN3A1 or BTN3A3 are replaced by BTN3A2 sequence. In human, the analysis of the diversity of these genes in 1683 individuals representing 26 worldwide populations shows that the three genes are polymorphic, with more than 46 alleles for each gene, and marked by extreme homogenization of the IgV sequences. The same analysis performed for the BTN2 genes shows also a concerted evolution; however, it is not as strong and recurrent as for BTN3. This study shows that BTN3 receptors are marked by extreme concerted evolution at the IgV domain and that BTN3A2 plays a central role in this evolution.

A renal epithelioid angiomyolipoma/perivascular epithelioid cell tumor with TFE3 gene break visualized by FISH.

Science.gov (United States)

Ohe, Chisato; Kuroda, Naoto; Hes, Ondrej; Michal, Michal; Vanecek, Tomas; Grossmann, Petr; Tanaka, Yukichi; Tanaka, Mio; Inui, Hidekazu; Komai, Yoshihiro; Matsuda, Tadashi; Uemura, Yoshiko

2012-12-01

We present a case of renal epithelioid angiomyolipoma (eAML)/perivascular epithelioid cell tumor (PEComa) with a TFE3 gene break visible by fluorescence in situ hybridization (FISH). Histologically, the tumor was composed of mainly epithelioid cells forming solid arrangements with small foci of spindle cells. In a small portion of the tumor, neoplastic cells displayed nuclear pleomorphism, such as polygonal and enlarged vesicular nuclei with prominent nucleoli. Marked vascularity was noticeable in the background, and perivascular hyaline sclerosis was also seen. Immunohistochemically, neoplastic cells were diffusely positive for α-smooth muscle actin and melanosome in the cytoplasm. Nuclei of many neoplastic cells were positive for TFE3. FISH analysis of the TFE3 gene break using the Poseidon TFE3 (Xp11) Break probe revealed positive results. Reverse transcriptase-polymerase chain reactions (RT-PCR) for ASPL/TFE3, PRCC/TFE3, CLTC/TFE3, PSF/TFE3, and NonO/TFE3 gene fusions all revealed negative results. This is the first reported case of renal eAML/PEComa with a TFE3 gene break, and it has unique histological findings as compared to previously reported TFE3 gene fusion-positive PEComas. Pathologists should recognize that PEComa with TFE3 gene fusion can arise even in the kidney.

EGR3 Immediate Early Gene and the Brain-Derived Neurotrophic Factor in Bipolar Disorder

Directory of Open Access Journals (Sweden)

Bianca Pfaffenseller

2018-02-01

Full Text Available Bipolar disorder (BD is a severe psychiatric illness with a consistent genetic influence, involving complex interactions between numerous genes and environmental factors. Immediate early genes (IEGs are activated in the brain in response to environmental stimuli, such as stress. The potential to translate environmental stimuli into long-term changes in brain has led to increased interest in a potential role for these genes influencing risk for psychiatric disorders. Our recent finding using network-based approach has shown that the regulatory unit of early growth response gene 3 (EGR3 of IEGs family was robustly repressed in postmortem prefrontal cortex of BD patients. As a central transcription factor, EGR3 regulates an array of target genes that mediate critical neurobiological processes such as synaptic plasticity, memory and cognition. Considering that EGR3 expression is induced by brain-derived neurotrophic factor (BDNF that has been consistently related to BD pathophysiology, we suggest a link between BDNF and EGR3 and their potential role in BD. A growing body of data from our group and others has shown that peripheral BDNF levels are reduced during mood episodes and also with illness progression. In this same vein, BDNF has been proposed as an important growth factor in the impaired cellular resilience related to BD. Taken together with the fact that EGR3 regulates the expression of the neurotrophin receptor p75NTR and may also indirectly induce BDNF expression, here we propose a feed-forward gene regulatory network involving EGR3 and BDNF and its potential role in BD.

Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

Energy Technology Data Exchange (ETDEWEB)

Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

2013-10-11

Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

Inhibition of histone deacetylases prevents cytokine-induced toxicity in beta cells

DEFF Research Database (Denmark)

Larsen, L; Tonnesen, M; Ronn, S G

2007-01-01

B (NFkappaB) is a critical signalling molecule in inflammation and is required for expression of the gene encoding inducible NO synthase (iNOS) and of pro-apoptotic genes. NFkappaB has recently been shown to associate with chromatin-modifying enzymes histone acetyltransferases and histone...... by immunoblotting and by immunoblotting combined with electrophoretic mobility shift assay, respectively. Viability was analysed by 3-(4,5-dimethyldiazol-2-yl)-2,5-diphenyl-tetrazolium bromide and apoptosis by terminal deoxynucleotidyl transferase mediated dUTP nick end labeling (TUNEL) assay and histone...

Maximal killing of lymphoma cells by DNA damage–inducing therapy requires not only the p53 targets Puma and Noxa, but also Bim

OpenAIRE

Happo, Lina; Cragg, Mark S.; Phipson, Belinda; Haga, Jon M.; Jansen, Elisa S.; Herold, Marco J.; Dewson, Grant; Michalak, Ewa M.; Vandenberg, Cassandra J.; Smyth, Gordon K.; Strasser, Andreas; Cory, Suzanne; Scott, Clare L.

2010-01-01

DNA-damaging chemotherapy is the backbone of cancer treatment, although it is not clear how such treatments kill tumor cells. In nontransformed lymphoid cells, the combined loss of 2 proapoptotic p53 target genes, Puma and Noxa, induces as much resistance to DNA damage as loss of p53 itself. In Eμ-Myc lymphomas, however, lack of both Puma and Noxa resulted in no greater drug resistance than lack of Puma alone. A third B-cell lymphoma-2 homology domain (BH)3-only gene, Bim, although not a dire...

Neuroprotective effect of non-viral gene therapy treatment based on tetanus toxin C-fragment in a severe mouse model of Spinal Muscular Atrophy.

Directory of Open Access Journals (Sweden)

Sara Olivan Garcia

2016-08-01

Full Text Available Spinal muscular atrophy (SMA is a hereditary childhood disease that causes paralysis and progressive degeneration of skeletal muscles and spinal motor neurons. SMA is associated with reduced levels of full-length Survival of Motor Neuron (SMN protein, due to mutations in the Survival of Motor Neuron 1 gene. Nowadays there are no effective therapies available to treat patients with SMA, so our aim was to test whether the non-toxic carboxy-terminal fragment of tetanus toxin heavy chain (TTC, which exhibits neurotrophic properties, might have a therapeutic role or benefit in SMA. In this manuscript, we have demonstrated that TTC enhance the SMN expression in motor neurons in vitro and evaluated the effect of intramuscular injection of TTC-encoding plasmid in the spinal cord and the skeletal muscle of SMNdelta7 mice. For this purpose, we studied the weight and the survival time, as well as, the survival and cell death pathways and muscular atrophy. Our results showed that TTC treatment reduced the expression of autophagy markers (Becn1, Atg5, Lc3 and p62 and pro-apoptotic genes such as Bax and Casp3 in spinal cord. In skeletal muscle, TTC was able to downregulate the expression of the main marker of autophagy, Lc3, to wild type levels and the expression of the apoptosis effector protein, Casp3. Regarding the genes related to muscular atrophy (Ankrd1, Calm1, Col19a1, Fbox32, Mt2, Myod1, NogoA, Pax7, Rrad, and Sln, TTC suggest a compensatory effect for muscle damage response, diminished oxidative stress and modulated calcium homeostasis. These preliminary findings suggest the need for further experiments to depth study the effect of TTC in SMA disease.

Charactering the ZFAND3 gene mapped in the sex-determining locus in hybrid tilapia (Oreochromis spp.)

Science.gov (United States)

Ma, Keyi; Liao, Minghui; Liu, Feng; Ye, Baoqing; Sun, Fei; Yue, Gen Hua

2016-01-01

Zinc finger AN1-type domain 3 (ZFAND3) is essential for spermatogenesis in mice. However, its function in teleosts remains unclear. In this study, we characterized the ZFAND3 gene (termed as OsZFAND3) in an important food fish, tilapia. The OsZFAND3 cDNA sequence is 1,050 bp in length, containing an ORF of 615 bp, which encodes a putative peptide of 204 amino acid residues. Quantitative real-time PCR revealed that the OsZFAND3 transcripts were exclusively expressed in the testis and ovary. In situ hybridization showed that the high expression of OsZFAND3 transcripts was predominantly localized in the spermatocyte and spermatid. These results suggest that OsZFAND3 is involved in male germ cell maturation. Three single nucleotide polymorphisms (SNPs) were detected in the introns of OsZFAND3. The OsZFAND3 gene was mapped in the sex-determining locus on linkage group 1 (LG1). The three SNPs in the OsZFAND3 gene were strictly associated with sex phenotype, suggesting that the OsZFAND3 gene is tightly linked to the sex-determining locus. Our study provides new insights into the functions of the OsZFAND3 gene in tilapia and a foundation for further detailed analysis of the OsZFAND3 gene in sex determination and differentiation. PMID:27137111

Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC

Directory of Open Access Journals (Sweden)

Amer Khalid

2009-08-01

Full Text Available Abstract Background NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. Methods The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE tissue. Results There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Conclusion Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer.

DNMT1 and DNMT3b silencing sensitizes human hepatoma cells to TRAIL-mediated apoptosis via up-regulation of TRAIL-R2/DR5 and caspase-8.

Science.gov (United States)

Kurita, Satoshi; Higuchi, Hajime; Saito, Yoshimasa; Nakamoto, Nobuhiro; Takaishi, Hiromasa; Tada, Shinichiro; Saito, Hidetsugu; Gores, Gregory J; Hibi, Toshifumi

2010-06-01

DNA methylation plays a critical role in chromatin remodeling and gene expression. DNA methyltransferases (DNMTs) are hypothesized to mediate cellular DNA methylation status and gene expression during mammalian development and in malignant diseases. In this study, we examined the role of DNA methyltransferase 1 (DNMT1) and DNMT3b in cell proliferation and survival of hepatocellular carcinoma (HCC) cells. Gene silencing of both DNMT1 and DNMT3b by targeted siRNA knockdown reduces cell proliferation and sensitizes the cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated cell death. The proapoptotic protein caspase-8 demonstrated promoter hypermethylation in HCC cells and was up-regulated by knockdown of DNMT1 and DNMT3b both at mRNA and protein levels. In addition, death receptor TRAIL-R2/DR5 (TRAIL receptor 2/death receptor 5) did not exhibit promoter hypermethylation in HCC cells but was also up-regulated by knockdown of DNMT1 and DNMT3b both at mRNA and protein levels. Consistent with this observation, the combined transfection of DNMT1-siRNA plus DNMT3b-siRNA enhanced formation of the TRAIL-death-inducing signaling complex formation in HCC cells. In conclusion, our data suggest that DNA methylation of specific genomic regions maintained by DNMT1 and DNMT3b plays a critical role in survival of HCC cells, and a simultaneous knockdown of both DNMT1 and DNMT3b may be a novel anticancer strategy for the treatment of HCC.

Interleukin-17 retinotoxicity is prevented by gene transfer of a soluble interleukin-17 receptor acting as a cytokine blocker: implications for age-related macular degeneration.

Directory of Open Access Journals (Sweden)

Daniel Ardeljan

Full Text Available Age-related macular degeneration (AMD is a common yet complex retinal degeneration that causes irreversible central blindness in the elderly. Pathology is widely believed to follow loss of retinal pigment epithelium (RPE and photoreceptor degeneration. Here we report aberrant expression of interleukin-17A (IL17A and the receptor IL17RC in the macula of AMD patients. In vitro, IL17A induces RPE cell death characterized by the accumulation of cytoplasmic lipids and autophagosomes with subsequent activation of pro-apoptotic Caspase-3 and Caspase-9. This pathology is reduced by siRNA knockdown of IL17RC. IL17-dependent retinal degeneration in a mouse model of focal retinal degeneration can be prevented by gene therapy with adeno-associated virus vector encoding soluble IL17 receptor. This intervention rescues RPE and photoreceptors in a MAPK-dependent process. The IL17 pathway plays a key role in RPE and photoreceptor degeneration and could hold therapeutic potential in AMD.

Engineering low-cadmium rice through stress-inducible expression of OXS3-family member genes.

Science.gov (United States)

Wang, Changhu; Guo, Weili; Cai, Xingzhe; Li, Ruyu; Ow, David W

2018-04-21

Cadmium (Cd) as a carcinogen poses a great threat to food security and public health through plant-derived foods such as rice, the staple for nearly half of the world's population. We have previously reported that overexpression of truncated gene fragments derived from the rice genes OsO3L2 and OsO3L3 could reduce Cd accumulation in transgenic rice. However, we did not test the full length genes due to prior work in Arabidopsis where overexpression of these genes caused seedling lethality. Here, we report on limiting the overexpression of OsO3L2 and OsO3L3 through the use of the stress- inducible promoter RD29B. However, despite generating 625 putative transformants, only 7 lines survived as T1 seedlings and only 1 line of each overexpressed OsO3L2 or OsO3L3-produced T2 progeny. The T2 homozygotes from these 2 lines showed the same effect of reducing accumulation of Cd in root and shoot as well as in T3 grain. As importantly, the concentrations of essential metals copper (Cu), iron (Fe), manganese (Mn) and zinc (Zn) were unaffected. Analysis of the expression profile suggested that low Cd accumulation may be due to high expression of OsO3L2 and OsO3L3 in the root tip region. Cellular localization of OsO3L2 and OsO3L3 indicate that they are histone H2A interacting nuclear proteins in vascular cells and especially in the root tip region. It is possible that interaction with histone H2A modifies chromatin to regulate downstream gene expression. Copyright © 2018. Published by Elsevier B.V.

The rose (Rosa hybrida) NAC transcription factor 3 gene, RhNAC3, involved in ABA signaling pathway both in rose and Arabidopsis.

Science.gov (United States)

Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing

2014-01-01

Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein

The rose (Rosa hybrida NAC transcription factor 3 gene, RhNAC3, involved in ABA signaling pathway both in rose and Arabidopsis.

Directory of Open Access Journals (Sweden)

Guimei Jiang

Full Text Available Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida, RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose Rh

[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

Science.gov (United States)

Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

2011-12-01

To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

Science.gov (United States)

Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

2014-10-10

The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

Identifying polymorphisms in the Rattus norvegicus D3 dopamine receptor gene and regulatory region

NARCIS (Netherlands)

Smits, B.M.; D'Souza, U.M.; Berezikov, E.; Cuppen, E.; Sluyter, F.

2004-01-01

The D(3) dopamine receptor has been implicated in several neuropsychiatric disorders, including schizophrenia, Parkinson's disease and addiction. Sequence variation in the D(3) gene can lead to subtle alteration in receptor structure or gene expression and thus to a different phenotype. In this

Pestov spark counter prototype development for the CERN-LHC ALICE experiment

International Nuclear Information System (INIS)

Badura, E.; Eschke, J.; Gaiser, H.; Gutbrod, H.H.; Kopf, U.; Neyer, C.; Roters, B.; Schmidt, H.R.; Schulze, R.; Steinhaeuser, P.; Stelzer, H.; Frolov, A.R.

1995-11-01

A prototype Pestov Spark Counter with 2-dimensional position resolution has been developed. The position resolution is 0.32 mm and <2 mm in transverse and longitudinal direction, respectively. Beam tests yielded both the time resolution and the efficiency in accordance with earlier results obtained at BNIP Novosibirsk. A longterm stability test has been performed and stable behaviour for more then 3 months was observed. (orig.)

PLEIOTROPIC EFFECT OF Rht3 DWARFING GENE ON SOME TRAITS OF WHEAT (Tr. aestivum L. em Thell

Directory of Open Access Journals (Sweden)

M. Jošt

2001-06-01

Full Text Available True-isogenic lines, differing only in the semi-dominant Rht3 dwarfing gene, were developed from the cross 'Tom Thumb x Bankuty 1201' during 17 years of continuous selection on heterozygous semi-dwarf plant. The effect of double (Rht3 Rht3 = full-dwarf, single (Rht3 rht3 =semi-dwarf, or no dwarfing gene (rht3 rht3 = tall dosage on some plant, seed, and flour quality traits were observed in the isogenic lines during two years field experiment, planted by 'honey-comb design' at Kri`evci, Croatia. Significant main effect of Rht3 gene was in shortening of plant height by 54% and 28% in double and single gene dosage respectively. Full-dwarf genotype (Rht3 Rht3 had by 12% more heads/plant, but the other yield components as number of grains/head, and grain weight/head were lower by 25 and 28% respectively, resulting in significantly lower grain yield/plant (-27%. However, this also could be a secondary side effect of prolonged vegetation influenced by doubled Rht3 gene. There was no significant effect on flour protein content. Double gene effect was strong and significant for maximum dough viscosity measured by amylograph in BU (101%. In our environment full dwarf (Rht3 Rht3 has no agronomic value, but single gene dosage could be of commercial interest in hybrid wheat breeding.

A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo.

Science.gov (United States)

Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian

2005-12-01

The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.

Genome-Wide Identification and Comparative Analysis of the 3-Hydroxy-3-methylglutaryl Coenzyme A Reductase (HMGR Gene Family in Gossypium

Directory of Open Access Journals (Sweden)

Wei Liu

2018-01-01

Full Text Available Terpenes are the largest and most diverse class of secondary metabolites in plants and play a very important role in plant adaptation to environment. 3-Hydroxy-3-methylglutaryl coenzyme A reductase (HMGR is a rate-limiting enzyme in the process of terpene biosynthesis in the cytosol. Previous study found the HMGR genes underwent gene expansion in Gossypium raimondii, but the characteristics and evolution of the HMGR gene family in Gossypium genus are unclear. In this study, genome-wide identification and comparative study of HMGR gene family were carried out in three Gossypium species with genome sequences, i.e., G. raimondii, Gossypium arboreum, and Gossypium hirsutum. In total, nine, nine and 18 HMGR genes were identified in G. raimondii, G. arboreum, and G. hirsutum, respectively. The results indicated that the HMGR genes underwent gene expansion and a unique gene cluster containing four HMGR genes was found in all the three Gossypium species. The phylogenetic analysis suggested that the expansion of HMGR genes had occurred in their common ancestor. There was a pseudogene that had a 10-bp deletion resulting in a frameshift mutation and could not be translated into functional proteins in G. arboreum and the A-subgenome of G. hirsutum. The expression profiles of the two pseudogenes showed that they had tissue-specific expression. Additionally, the expression pattern of the pseudogene in the A-subgenome of G. hirsutum was similar to its paralogous gene in the D-subgenome of G. hirsutum. Our results provide useful information for understanding cytosolic terpene biosynthesis in Gossypium species.

Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice

Directory of Open Access Journals (Sweden)

Postina Rolf

2009-02-01

Full Text Available Abstract Background In a transgenic mouse model of Alzheimer disease (AD, cleavage of the amyloid precursor protein (APP by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn of this enzyme. As compared to non-transgenic wild-type mice, in ADAM10 transgenic mice 355 genes, and in dnADAM10 mice 143 genes were found to be differentially expressed. A higher number of genes was differentially regulated in double-transgenic mouse strains additionally expressing the human APP[V717I] mutant. Overexpression of proteolytically active ADAM10 affected several physiological pathways, such as cell communication, nervous system development, neuron projection as well as synaptic transmission. Although ADAM10 has been implicated in Notch and β-catenin signaling, no significant changes in the respective target genes were observed in adult ADAM10 transgenic mice. Real-time RT-PCR confirmed a downregulation of genes coding for the inflammation-associated proteins S100a8 and S100a9 induced by moderate ADAM10 overexpression. Overexpression of the dominant-negative form dnADAM10 led to a significant increase in the expression of the fatty acid-binding protein Fabp7, which also has been found in higher amounts in brains of Down syndrome patients. Conclusion In general, there was only a moderate alteration of gene expression in ADAM10 overexpressing mice. Genes coding for pro-inflammatory or pro-apoptotic proteins were not over-represented among differentially regulated genes. Even a decrease of

Osteogenic gene expression of murine osteoblastic (MC3T3-E1) cells under cyclic tension

International Nuclear Information System (INIS)

Kao, C T; Chen, C C; Cheong, U-I; Liu, S L; Huang, T H

2014-01-01

Low-level laser therapy (LLLT) can promote cell proliferation. The remodeling ability of the tension side of orthodontic teeth affects post-orthodontic stability. The purpose of the present study was to investigate the osteogenic effects of LLLT on osteoblast-like cells treated with a simulated tension system that provides a mechanical tension regimen. Murine osteoblastic (MC3T3-E1) cells were cultured in a Flexcell strain unit with programmed loads of 12% elongation at a frequency of 0.5 Hz for 24 and 48 h. The cultured cells were treated with a low-level diode laser using powers of 5 J and 10 J. The proliferation of MC3T3-E1 cells was determined using the Alamar Blue assay. The expression of osteogenic genes (type I collagen (Col-1), osteopontin (OPN), osteocalcin (OC), osteoprotegerin (OPG), receptor activator of nuclear factor kappa B ligand (RANKL), bone morphologic protein (BMP-2), and bone morphologic protein (BMP-4)) in MC3T3-E1 cells was analyzed using reverse transcription polymerase chain reaction (RT-PCR). The data were analyzed using one-way analysis of variance. The proliferation rate of tension-cultured MC3T3-E1 cells under 5 J and 10 J LLLT increased compared with that of the control group (p < 0.05). Prominent mineralization of the MC3T3-E1 cells was visible using a von Kossa stain in the 5 J LLLT group. Osteogenic genes (Col-1, OC, OPG and BMP-2) were significantly expressed in the MC3T3-E1 cells treated with 5 J and 10 J LLLT (p < 0.05). LLLT in tension-cultured MC3T3-E1 cells showed synergistic osteogenic effects, including increases in cell proliferation and Col-1, OPN, OC, OPG and BMP-2 gene expression. LLLT might be beneficial for bone remodeling on the tension side of orthodontics. (paper)

DGIdb 3.0: a redesign and expansion of the drug-gene interaction database.

Science.gov (United States)

Cotto, Kelsy C; Wagner, Alex H; Feng, Yang-Yang; Kiwala, Susanna; Coffman, Adam C; Spies, Gregory; Wollam, Alex; Spies, Nicholas C; Griffith, Obi L; Griffith, Malachi

2018-01-04

The drug-gene interaction database (DGIdb, www.dgidb.org) consolidates, organizes and presents drug-gene interactions and gene druggability information from papers, databases and web resources. DGIdb normalizes content from 30 disparate sources and allows for user-friendly advanced browsing, searching and filtering for ease of access through an intuitive web user interface, application programming interface (API) and public cloud-based server image. DGIdb v3.0 represents a major update of the database. Nine of the previously included 24 sources were updated. Six new resources were added, bringing the total number of sources to 30. These updates and additions of sources have cumulatively resulted in 56 309 interaction claims. This has also substantially expanded the comprehensive catalogue of druggable genes and anti-neoplastic drug-gene interactions included in the DGIdb. Along with these content updates, v3.0 has received a major overhaul of its codebase, including an updated user interface, preset interaction search filters, consolidation of interaction information into interaction groups, greatly improved search response times and upgrading the underlying web application framework. In addition, the expanded API features new endpoints which allow users to extract more detailed information about queried drugs, genes and drug-gene interactions, including listings of PubMed IDs, interaction type and other interaction metadata.

Chromosomal locations of three human nuclear genes (RPSM12, TUFM, and AFG3L1) specifying putative components of the mitochondrial gene expression apparatus.

Science.gov (United States)

Shah, Z H; Migliosi, V; Miller, S C; Wang, A; Friedman, T B; Jacobs, H T

1998-03-15

We have mapped the chromosomal locations of three human nuclear genes for putative components of the apparatus of mitochondrial gene expression, using a combination of in situ hybridization and interspecies hybrid mapping. The genes RPMS12 (mitoribosomal protein S12, a conserved protein component of the mitoribosomal accuracy center), TUFM (mitochondrial elongation factor EF-Tu), and AFG3L1 (similar to the yeast genes Afg3 and Rca1 involved in the turnover of mistranslated or misfolded mtDNA-encoded polypeptides) were initially characterized by a combination of database sequence analysis, PCR, cloning, and DNA sequencing. RPMS12 maps to chromosome 19q13.1, close to the previously mapped gene for autosomal dominant hearing loss DFNA4. The TUFM gene is located on chromosome 16p11.2, with a putative pseudogene or variant (TUFML) located very close to the centromere of chromosome 17. AFG3L1 is located on chromosome 16q24, very close to the telomere. By virtue of their inferred functions in mitochondria, these genes should be regarded as candidates of disorders sharing features with mitochondrial disease syndromes, such as sensorineural deafness, diabetes, and retinopathy.

Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

Directory of Open Access Journals (Sweden)

Marquez Rodolfo

2004-09-01

Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

International Nuclear Information System (INIS)

Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

2000-01-01

Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

Science.gov (United States)

Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

2016-05-01

To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

Over-expression of histone H3K4 demethylase gene JMJ15 enhances salt tolerance in Arabidopsis

Directory of Open Access Journals (Sweden)

Yuan eShen

2014-06-01

Full Text Available Histone H3 lysine 4 trimethylation (H3K4me3 has been shown to be involved in stress-responsive gene expression and gene priming in plants. However, the role of H3K4me3 resetting in the processes is not clear. In this work we studied the expression and function of Arabidopsis H3K4 demethylase gene JMJ15. We show that the expression of JMJ15 was relatively low and was limited to a number of tissues during vegetative growth but was higher in young floral organs. Over-expression of the gene in gain-of-function mutants reduced the plant height with accumulation of lignin in stems, while the loss-of-function mutation did not produce any visible phenotype. The gain-of-function mutants showed enhanced salt tolerance, whereas the loss-of-function mutant was more sensitive to salt compared to the wild type. Transcriptomic analysis revealed that over-expression of JMJ15 down-regulated many genes which are preferentially marked by H3K4me3 and H3K4me2. Many of the down-regulated genes encode transcription regulators involved in stress responses. The data suggest that increased JMJ15 levels may regulate the gene expression program that enhances stress tolerance.

The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

Science.gov (United States)

Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

2014-01-01

Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The CDK inhibitor p21 is a novel target gene of ATF4 and contributes to cell survival under ER stress.

Science.gov (United States)

Inoue, Yasumichi; Kawachi, Shiori; Ohkubo, Tsubasa; Nagasaka, Mai; Ito, Shogo; Fukuura, Keishi; Itoh, Yuka; Ohoka, Nobumichi; Morishita, Daisuke; Hayashi, Hidetoshi

2017-11-01

Activating transcription factor 4 (ATF4) is well known for its role in the endoplasmic reticulum (ER) stress response. ATF4 also transcriptionally induces multiple effectors that determine cell fate depending on cellular context. In addition, ATF4 can communicate both pro-apoptotic and pro-survival signals. How ATF4 mediates its prosurvival roles, however, requires further investigation. Here, we report that the CDK inhibitor p21 is a novel target gene of ATF4. We identified two ATF4-responsive elements, one of which directly binds ATF4, within the first intron of the p21 gene. Importantly, overexpression of p21 enhances cell survival following ER stress induction, while p21 knockdown increases cell death. These results suggest that p21 induction plays a vital role in the cellular response to ER stress and indicate that p21 is a prosurvival effector of ATF4. © 2017 Federation of European Biochemical Societies.

Positive relationship between p42.3 gene and inflammation in chronic non-atrophic gastritis.

Science.gov (United States)

Chen, Ping; Cui, Yun; Fu, Qing Yan; Lu, You Yong; Fang, Jing Yuan; Chen, Xiao Yu

2015-10-01

Gastric cancer (GC) is a typical type of inflammation-related tumor. The p42.3 gene is shown to be highly expressed in GC, but its association with gastritis remains unknown. We aimed to explore the relationship between gastric inflammation and p42.3 gene in vitro and in vivo. Normal gastric epithelial cells (GES-1) were treated with Helicobacter pylori (H. pylori) and tumor necrosis factor (TNF)-α. Total cell mRNA and protein were extracted and collected, and polymerase chain reaction and Western blot were performed to determine the relative expression of p42.3 gene. In total, 291 biopsy samples from patients with chronic non-atrophic gastritis were collected and immunohistochemistry was used to measure the p42.3 protein expression. The association between p42.3 protein expression and the clinicopathological characteristics of these patients were analyzed. Both H. pylori and TNF-α significantly enhanced the p42.3 protein expression in GES-1 cells in a time and dose-dependent manner. In addition, p42.3 gene expression was positively associated with the severity of gastric mucosal inflammation and H. pylori infection (P = 0.000). Its expression was significantly more common in severe gastric inflammation and in H. pylori-infected cases. p42.3 gene expression is associated with gastric mucosal inflammation that can be upregulated by TNF-α and H. pylori infection. © 2015 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

The CUP-SHAPED COTYLEDON3 gene is required for boundary and shoot meristem formation in Arabidopsis

DEFF Research Database (Denmark)

Vroemen, Casper W; Mordhorst, Andreas P; Albrecht, Cathy

2003-01-01

From an enhancer trap screen for genes expressed in Arabidopsis embryos, we identified a gene expressed from the octant stage onward in the boundary between the two presumptive cotyledons and in a variety of postembryonic organ and meristem boundaries. This gene, CUP-SHAPED COTYLEDON3 (CUC3...

[Polymorphism of CD209 and TLR3 genes in populations of North Eurasia].

Science.gov (United States)

Barkhash, A V; Babenko, V N; Voevoda, M I; Romaschenko, A G

2016-06-01

The DC-SIGN (dendritic cell-specific intercellular adhesion molecule (ICAM)-3-grabbing non-integrin) and TLR3 (toll-like receptor 3) proteins are key effectors of the innate immunity and particularly play an important role in the organism’s antiviral defense as pattern-recognition receptors. Previously, we demonstrated that certain genotypes and alleles of single nucleotide polymorphisms (SNPs) rs2287886 (G/A) in the promoter region of the CD209 gene (encoding DC-SIGN) and rs3775291 (G/A, Leu412Phe) in the exon 4 of the TLR3 gene are associated with human predisposition to tick-borne encephalitis in the Russian population. In the present work, the distribution of genotype and allele frequencies for these SNPs was studied in seven populations of North Eurasia, including Caucasians (Russians and Germans (from Altai region)), Central Asian Mongoloids (Altaians, Khakass, Tuvinians, and Shorians), and Arctic Mongoloids (Chukchi). It was found that the CD209 gene rs2287886 SNP A/A genotype and A allele, as well as the TLR3 gene rs3775291 SNP G/G genotype and G allele (the frequencies of which in our previous studies were increased in tick-borne encephalitis patients as compared with the population control (Russian citizens of Novosibirsk)), are preserved with a high frequency in Central Asian Mongoloids (who for a long time regularly came in contact with tick-borne encephalitis virus in places of their habitation). We suggested that predisposition to tick-borne encephalitis in Central Asian Mongoloid populations can be predetermined by a different set of genes and their polymorphisms than in the Russian population.

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

Science.gov (United States)

González, Ana M; Godoy, Luís; Santalla, Marta

2017-11-23

Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

Methotrexate induces poly(ADP-ribose) polymerase-dependent, caspase 3-independent apoptosis in subsets of proliferating CD4+ T cells

DEFF Research Database (Denmark)

Nielsen, C H; Albertsen, L; Bendtzen, K

2007-01-01

The mechanism of action of methotrexate (MTX) in autoimmune diseases (AID) is unclear. A pro-apoptotic effect has been demonstrated in mitogen-stimulated peripheral blood mononuclear cells (PBMC), but studies employing conventional antigens have disputed a pro-apoptotic effect. CD4+ T helper (Th)...

Disruption of the petal identity gene APETALA3-3 is highly correlated with loss of petals within the buttercup family (Ranunculaceae).

Science.gov (United States)

Zhang, Rui; Guo, Chunce; Zhang, Wengen; Wang, Peipei; Li, Lin; Duan, Xiaoshan; Du, Qinggao; Zhao, Liang; Shan, Hongyan; Hodges, Scott A; Kramer, Elena M; Ren, Yi; Kong, Hongzhi

2013-03-26

Absence of petals, or being apetalous, is usually one of the most important features that characterizes a group of flowering plants at high taxonomic ranks (i.e., family and above). The apetalous condition, however, appears to be the result of parallel or convergent evolution with unknown genetic causes. Here we show that within the buttercup family (Ranunculaceae), apetalous genera in at least seven different lineages were all derived from petalous ancestors, indicative of parallel petal losses. We also show that independent petal losses within this family were strongly associated with decreased or eliminated expression of a single floral organ identity gene, APETALA3-3 (AP3-3), apparently owing to species-specific molecular lesions. In an apetalous mutant of Nigella, insertion of a transposable element into the second intron has led to silencing of the gene and transformation of petals into sepals. In several naturally occurring apetalous genera, such as Thalictrum, Beesia, and Enemion, the gene has either been lost altogether or disrupted by deletions in coding or regulatory regions. In Clematis, a large genus in which petalous species evolved secondarily from apetalous ones, the gene exhibits hallmarks of a pseudogene. These results suggest that, as a petal identity gene, AP3-3 has been silenced or down-regulated by different mechanisms in different evolutionary lineages. This also suggests that petal identity did not evolve many times independently across the Ranunculaceae but was lost in numerous instances. The genetic mechanisms underlying the independent petal losses, however, may be complex, with disruption of AP3-3 being either cause or effect.

Identification and functional analysis of pheromone and receptor genes in the B3 mating locus of Pleurotus eryngii.

Science.gov (United States)

Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

2014-01-01

Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency.

Rare codons effect on expression of recombinant gene cassette in Escherichia coli BL21(DE3

Directory of Open Access Journals (Sweden)

Aghil Esmaeili-Bandboni

2017-11-01

Full Text Available Objective: To demonstrate the sensitivity of expression of fusion genes to existence of a large number of rare codons in recombinant gene sequenced. Methods: Primers for amplification of cholera toxin B, Shiga toxin B and gfp genes were designed by Primer3 software and synthesized. All of these 3 genes were cloned. Then the genes were fused together by restriction sites and enzymatic method. Two linkers were used as a flexible bridge in connection of these genes. Results: Cloning and fusion of cholera toxin B, Shiga toxin B and gfp genes were done correctly. After that, expression of the recombinant gene construction was surveyed. Conclusions: According to what was seen, because of the accumulation of 12 rare codons of Shiga toxin B and 19 rare codons of cholera toxin B in this gene cassette, the expression of the recombinant gene cassette, in Escherichia coli BL21, failed.

Integrating Data Clustering and Visualization for the Analysis of 3D Gene Expression Data

Energy Technology Data Exchange (ETDEWEB)

Data Analysis and Visualization (IDAV) and the Department of Computer Science, University of California, Davis, One Shields Avenue, Davis CA 95616, USA,; nternational Research Training Group ``Visualization of Large and Unstructured Data Sets,' ' University of Kaiserslautern, Germany; Computational Research Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley, CA 94720, USA; Genomics Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA; Life Sciences Division, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley CA 94720, USA,; Computer Science Division,University of California, Berkeley, CA, USA,; Computer Science Department, University of California, Irvine, CA, USA,; All authors are with the Berkeley Drosophila Transcription Network Project, Lawrence Berkeley National Laboratory,; Rubel, Oliver; Weber, Gunther H.; Huang, Min-Yu; Bethel, E. Wes; Biggin, Mark D.; Fowlkes, Charless C.; Hendriks, Cris L. Luengo; Keranen, Soile V. E.; Eisen, Michael B.; Knowles, David W.; Malik, Jitendra; Hagen, Hans; Hamann, Bernd

2008-05-12

The recent development of methods for extracting precise measurements of spatial gene expression patterns from three-dimensional (3D) image data opens the way for new analyses of the complex gene regulatory networks controlling animal development. We present an integrated visualization and analysis framework that supports user-guided data clustering to aid exploration of these new complex datasets. The interplay of data visualization and clustering-based data classification leads to improved visualization and enables a more detailed analysis than previously possible. We discuss (i) integration of data clustering and visualization into one framework; (ii) application of data clustering to 3D gene expression data; (iii) evaluation of the number of clusters k in the context of 3D gene expression clustering; and (iv) improvement of overall analysis quality via dedicated post-processing of clustering results based on visualization. We discuss the use of this framework to objectively define spatial pattern boundaries and temporal profiles of genes and to analyze how mRNA patterns are controlled by their regulatory transcription factors.

Histone methylation mediates plasticity of human FOXP3(+) regulatory T cells by modulating signature gene expressions.

Science.gov (United States)

He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong

2014-03-01

CD4(+) FOXP3(+) regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4(+) CD25(high) CD127(low/-) Treg cells convert to two subpopulations with distinctive FOXP3(+) and FOXP3(-) phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. © 2013 John Wiley & Sons Ltd.

Histone methylation mediates plasticity of human FOXP3+ regulatory T cells by modulating signature gene expressions

Science.gov (United States)

He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong

2014-01-01

CD4+ FOXP3+ regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4+ CD25high CD127low/− Treg cells convert to two subpopulations with distinctive FOXP3+ and FOXP3− phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. PMID:24152290

Tbx2/3 is an essential mediator within the Brachyury gene network during Ciona notochord development.

Science.gov (United States)

José-Edwards, Diana S; Oda-Ishii, Izumi; Nibu, Yutaka; Di Gregorio, Anna

2013-06-01

T-box genes are potent regulators of mesoderm development in many metazoans. In chordate embryos, the T-box transcription factor Brachyury (Bra) is required for specification and differentiation of the notochord. In some chordates, including the ascidian Ciona, members of the Tbx2 subfamily of T-box genes are also expressed in this tissue; however, their regulatory relationships with Bra and their contributions to the development of the notochord remain uncharacterized. We determined that the notochord expression of Ciona Tbx2/3 (Ci-Tbx2/3) requires Ci-Bra, and identified a Ci-Tbx2/3 notochord CRM that necessitates multiple Ci-Bra binding sites for its activity. Expression of mutant forms of Ci-Tbx2/3 in the developing notochord revealed a role for this transcription factor primarily in convergent extension. Through microarray screens, we uncovered numerous Ci-Tbx2/3 targets, some of which overlap with known Ci-Bra-downstream notochord genes. Among the Ci-Tbx2/3 notochord targets are evolutionarily conserved genes, including caspases, lineage-specific genes, such as Noto4, and newly identified genes, such as MLKL. This work sheds light on a large section of the notochord regulatory circuitry controlled by T-box factors, and reveals new components of the complement of genes required for the proper formation of this structure.

High expression of the circadian gene mPer2 diminishes the radiosensitivity of NIH 3T3 cells

Energy Technology Data Exchange (ETDEWEB)

Chang, L.; Liu, Y.Y.; Zhu, B.; Li, Y.; Hua, H.; Wang, Y.H.; Zhang, J.; Jiang, Z.; Wang, Z.R. [Sichuan University, Chengdu (China). West China Medical Center. Health Ministry Key Lab. of Chronobiology], e-mail: wangzhengrong@126.com

2009-10-15

Period2 is a core circadian gene, which not only maintains the circadian rhythm of cells but also regulates some organic functions. We investigated the effects of mPeriod2 (mPer2) expression on radiosensitivity in normal mouse cells exposed to {sup 60}Co-{gamma}-rays. NIH 3T3 cells were treated with 12-O-tetradecanoyl phorbol-13-acetate (TPA) to induce endogenous mPer2 expression or transfected with pcDNA3.1(+)-mPer2 and irradiated with {sup 6}0Co-{gamma}-rays, and then analyzed by several methods such as flow cytometry, colony formation assay, RT-PCR, and immunohistochemistry. Flow cytometry and colony formation assay revealed that irradiated NIH 3T3 cells expressing high levels of mPer2 showed a lower death rate (TPA: 24 h 4.3% vs 12 h 6.8% and control 9.4%; transfection: pcDNA3.1-mPer2 3.7% vs pcDNA3.1 11.3% and control 8.2%), more proliferation and clonogenic survival (TPA: 121.7 {+-} 6.51 vs 66.0 {+-} 3.51 and 67.7 {+-} 7.37; transfection: 121.7 {+-} 6.50 vs 65.3 {+-} 3.51 and 69.0 {+-} 4.58) both when treated with TPA and transfected with mPer2. RT-PCR analysis showed an increased expression of bax, bcl-2, p53, cmyc, mre11, and nbs1, and an increased proportionality of bcl-2/bax in the irradiated cells at peak mPer2 expression compared with cells at trough mPer2 expression and control cells. However, no significant difference in rad50 expression was observed among the three groups of cells. Immunohistochemistry also showed increased protein levels of P53, BAX and proliferating cell nuclear antigen in irradiated cells with peak mPer2 levels. Thus, high expression of the circadian gene mPer2 may reduce the radiosensitivity of NIH 3T3 cells. For this effect, mPer2 may directly or indirectly regulate the expressions of cell proliferation- and apoptosis-related genes and DNA repair-related genes. (author)

High expression of the circadian gene mPer2 diminishes the radiosensitivity of NIH 3T3 cells

International Nuclear Information System (INIS)

Chang, L.; Liu, Y.Y.; Zhu, B.; Li, Y.; Hua, H.; Wang, Y.H.; Zhang, J.; Jiang, Z.; Wang, Z.R.

2009-01-01

Period2 is a core circadian gene, which not only maintains the circadian rhythm of cells but also regulates some organic functions. We investigated the effects of mPeriod2 (mPer2) expression on radiosensitivity in normal mouse cells exposed to 60 Co-γ-rays. NIH 3T3 cells were treated with 12-O-tetradecanoyl phorbol-13-acetate (TPA) to induce endogenous mPer2 expression or transfected with pcDNA3.1(+)-mPer2 and irradiated with 6 0Co-γ-rays, and then analyzed by several methods such as flow cytometry, colony formation assay, RT-PCR, and immunohistochemistry. Flow cytometry and colony formation assay revealed that irradiated NIH 3T3 cells expressing high levels of mPer2 showed a lower death rate (TPA: 24 h 4.3% vs 12 h 6.8% and control 9.4%; transfection: pcDNA3.1-mPer2 3.7% vs pcDNA3.1 11.3% and control 8.2%), more proliferation and clonogenic survival (TPA: 121.7 ± 6.51 vs 66.0 ± 3.51 and 67.7 ± 7.37; transfection: 121.7 ± 6.50 vs 65.3 ± 3.51 and 69.0 ± 4.58) both when treated with TPA and transfected with mPer2. RT-PCR analysis showed an increased expression of bax, bcl-2, p53, cmyc, mre11, and nbs1, and an increased proportionality of bcl-2/bax in the irradiated cells at peak mPer2 expression compared with cells at trough mPer2 expression and control cells. However, no significant difference in rad50 expression was observed among the three groups of cells. Immunohistochemistry also showed increased protein levels of P53, BAX and proliferating cell nuclear antigen in irradiated cells with peak mPer2 levels. Thus, high expression of the circadian gene mPer2 may reduce the radiosensitivity of NIH 3T3 cells. For this effect, mPer2 may directly or indirectly regulate the expressions of cell proliferation- and apoptosis-related genes and DNA repair-related genes. (author)

MicroRNA genes and their target 3'-untranslated regions are infrequently somatically mutated in ovarian cancers.

Directory of Open Access Journals (Sweden)

Georgina L Ryland

Full Text Available MicroRNAs are key regulators of gene expression and have been shown to have altered expression in a variety of cancer types, including epithelial ovarian cancer. MiRNA function is most often achieved through binding to the 3'-untranslated region of the target protein coding gene. Mutation screening using massively-parallel sequencing of 712 miRNA genes in 86 ovarian cancer cases identified only 5 mutated miRNA genes, each in a different case. One mutation was located in the mature miRNA, and three mutations were predicted to alter the secondary structure of the miRNA transcript. Screening of the 3'-untranslated region of 18 candidate cancer genes identified one mutation in each of AKT2, EGFR, ERRB2 and CTNNB1. The functional effect of these mutations is unclear, as expression data available for AKT2 and EGFR showed no increase in gene transcript. Mutations in miRNA genes and 3'-untranslated regions are thus uncommon in ovarian cancer.

Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

DEFF Research Database (Denmark)

Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

2017-01-01

We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

Association of MC3R gene polymorphisms with body weight in the red fox and comparative gene organization in four canids.

Science.gov (United States)

Skorczyk, A; Flisikowski, K; Szydlowski, M; Cieslak, J; Fries, R; Switonski, M

2011-02-01

There are five genes encoding melanocortin receptors. Among canids, the genes have mainly been studied in the dog (MC1R, MC2R and MC4R). The MC4R gene has also been analysed in the red fox. In this report, we present a study of chromosome localization, comparative sequence analysis and polymorphism of the MC3R gene in the dog, red fox, arctic fox and Chinese raccoon dog. The gene was localized by FISH to the following chromosome: 24q24-25 in the dog, 14p16 in the red fox, 18q13 in the arctic fox and NPP4p15 in the Chinese raccoon dog. A high identity level of the MC3R gene sequences was observed among the species, ranging from 96.0% (red fox--Chinese raccoon dog) to 99.5% (red fox--arctic fox). Altogether, eight polymorphic sites were found in the red fox, six in the Chinese raccoon dog and two in the dog, while the arctic fox appeared to be monomorphic. In addition, association of several polymorphisms with body weight was analysed in red foxes (the number of genotyped animals ranged from 319 to 379). Two polymorphisms in the red fox, i.e. a silent substitution c.957A>C and c.*185C>T in the 3'-flanking sequence, showed a significant association (P < 0.01) with body weight. © 2010 The Authors, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

Localization of the xeroderma pigmentosum group B-correcting gene ERCC-3 to human chromosome 2q21.

NARCIS (Netherlands)

G. Weeda (Geert); J. Wiegant; M. van der Ploeg; A.H.M. Geurts van Kessel (Ad); A.J. van der Eb; J.H.J. Hoeijmakers (Jan)

1991-01-01

textabstractThe human excision-repair gene ERCC3 was cloned after DNA-mediated gene transfer to the uv-sensitive Chinese hamster ovary mutant cell line 27-1, a member of complementation group 3 of the excision-defective rodent cell lines. The ERCC3 gene specifically corrects the DNA repair defect of

Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

Science.gov (United States)

Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

2015-05-01

This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

Directory of Open Access Journals (Sweden)

Ana M. González

2017-11-01

Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

[PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

Science.gov (United States)

Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

2016-12-07

Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte

Energy Technology Data Exchange (ETDEWEB)

Zeng, Yanli [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Li, Hui [The Central Hospital of Wuhan, Tongji Medical College Huazhong University of Science Technology, Wuhan, 430000 (China); Zhang, Xiaoju [Department of Respiratory Medicine, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Shang, Jia [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Kang, Yi, E-mail: kykangyi@163.com [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China)

2016-01-29

Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.

Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte

International Nuclear Information System (INIS)

Zeng, Yanli; Li, Hui; Zhang, Xiaoju; Shang, Jia; Kang, Yi

2016-01-01

Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.

Changes of MODY signal pathway genes in the endoplasmic reticulum stress in INS-1-3 cells.

Directory of Open Access Journals (Sweden)

Yanan Dong

Full Text Available Metabolic disturbances induce endoplasmic reticulum stress (ERS in pancreatic beta cells. This study aims to investigate whether a common pathway exists in the ERS induced by various chemicals, including high levels of glucose and palmitate in INS-1-3 cells.ERS in INS-1-3 cells was induced by exposure cells to thapsigargin (TG, tunicamycin (TM or palmitic acid (PA +high glucose (HG. Digital gene expression (DGE profiling technique was used to detect differentially expressed genes. The profile of gene expression was detected by gene oncology (GO function and pathway enrichment analysis. Nkx6.1 over-expression was established in INS-1-3 cell lines by lentivirus infection to revert the inhibition of Nkx6.1 expression found in the situation of ERS. Real time reverse transcription polymerase chain reaction (RT-PCR was used to verify the expression changes of key genes. Cell viability was measured by 3-(4, 5-dimethylthiazol-2-yl-2, 5-diphenyltetrazolium bromide (MTT assay. The apoptosis was determined by flow cytometry. INS-1-3 cell function was measured by glucose stimulated insulin secretion test(GSIS.As compared to control, DGE demonstrated that there were 135, 57 and 74 differentially expressed genes in TM, TG and HG+PA groups, respectively. Those differentially expressed genes were enriched to ERS, antigen processing and presentation, protein export pathways, and interestingly, the maturity onset diabetes of the young (MODY pathway. Nkx6.1 is one of common down-regulated gene in MODY signaling pathway among TM, TG and HG+PA groups. Over-expression of Nkx6.1 ameliorated glucolipotoxicity induced apoptosis rate by 45.4%, and increased proliferation by 40.9%. At the same time, GSIS increased by 1.82 folds.MODY pathway genes expression was changed in the state of ERS. Over-expression of Nkx6.1 protected the INS-1-3 cells from glucolipotoxicity.

Up-regulation of integrin β3 in radioresistant pancreatic cancer impairs adenovirus-mediated gene therapy

International Nuclear Information System (INIS)

Egami, Takuya; Ohuchida, Kenoki; Yasui, Takaharu; Onimaru, Manabu; Toma, Hiroki; Sato, Norihiro; Tanaka, Masao; Mizumoto, Kazuhiro; Matsumoto, Kunio

2009-01-01

Adenovirus-mediated gene therapy is a promising approach for the treatment of pancreatic cancer. We previously reported that radiation enhanced adenovirus-mediated gene expression in pancreatic cancer, suggesting that adenoviral gene therapy might be more effective in radioresistant pancreatic cancer cells. In the present study, we compared the transduction efficiency of adenovirus-delivered genes in radiosensitive and radioresistant cells, and investigated the underlying mechanisms. We used an adenovirus expressing the hepatocyte growth factor antagonist, NK4 (Ad-NK4), as a representative gene therapy. We established two radioresistant human pancreatic cancer cell lines using fractionated irradiation. Radiosensitive and radioresistant pancreatic cancer cells were infected with Ad-NK4, and NK4 levels in the cells were measured. In order to investigate the mechanisms responsible for the differences in the transduction efficiency between these cells, we measured expression of the genes mediating adenovirus infection and endocytosis. The results revealed that NK4 levels in radioresistant cells were significantly lower (P<0.01) than those in radiosensitive cells, although there were no significant differences in adenovirus uptake between radiosensitive cells and radioresistant cells. Integrin β3 was up-regulated and the Coxsackie virus and adenovirus receptor was down-regulated in radioresistant cells, and inhibition of integrin β3 promoted adenovirus gene transfer. These results suggest that inhibition of integrin β3 in radioresistant pancreatic cancer cells could enhance adenovirus-mediated gene therapy. (author)

Genetic Variation of Goat Interferon Regulatory Factor 3 Gene and Its Implication in Goat Evolution.

Science.gov (United States)

Okpeku, Moses; Esmailizadeh, Ali; Adeola, Adeniyi C; Shu, Liping; Zhang, Yesheng; Wang, Yangzi; Sanni, Timothy M; Imumorin, Ikhide G; Peters, Sunday O; Zhang, Jiajin; Dong, Yang; Wang, Wen

2016-01-01

The immune systems are fundamentally vital for evolution and survival of species; as such, selection patterns in innate immune loci are of special interest in molecular evolutionary research. The interferon regulatory factor (IRF) gene family control many different aspects of the innate and adaptive immune responses in vertebrates. Among these, IRF3 is known to take active part in very many biological processes. We assembled and evaluated 1356 base pairs of the IRF3 gene coding region in domesticated goats from Africa (Nigeria, Ethiopia and South Africa) and Asia (Iran and China) and the wild goat (Capra aegagrus). Five segregating sites with θ value of 0.0009 for this gene demonstrated a low diversity across the goats' populations. Fu and Li tests were significantly positive but Tajima's D test was significantly negative, suggesting its deviation from neutrality. Neighbor joining tree of IRF3 gene in domesticated goats, wild goat and sheep showed that all domesticated goats have a closer relationship than with the wild goat and sheep. Maximum likelihood tree of the gene showed that different domesticated goats share a common ancestor and suggest single origin. Four unique haplotypes were observed across all the sequences, of which, one was particularly common to African goats (MOCH-K14-0425, Poitou and WAD). In assessing the evolution mode of the gene, we found that the codon model dN/dS ratio for all goats was greater than one. Phylogenetic Analysis by Maximum Likelihood (PAML) gave a ω0 (dN/dS) value of 0.067 with LnL value of -6900.3 for the first Model (M1) while ω2 = 1.667 in model M2 with LnL value of -6900.3 with positive selection inferred in 3 codon sites. Mechanistic empirical combination (MEC) model for evaluating adaptive selection pressure on particular codons also confirmed adaptive selection pressure in three codons (207, 358 and 408) in IRF3 gene. Positive diversifying selection inferred with recent evolutionary changes in domesticated goat IRF3

P53-mediated rapid induction of apoptosis conveys resistance to viral infection in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Bo Liu

2013-02-01

Full Text Available Arthropod-borne pathogens account for millions of deaths each year. Understanding the genetic mechanisms controlling vector susceptibility to pathogens has profound implications for developing novel strategies for controlling insect-transmitted infectious diseases. The fact that many viruses carry genes that have anti-apoptotic activity has long led to the hypothesis that induction of apoptosis could be a fundamental innate immune response. However, the cellular mechanisms mediating the induction of apoptosis following viral infection remained enigmatic, which has prevented experimental verification of the functional significance of apoptosis in limiting viral infection in insects. In addition, studies with cultured insect cells have shown that there is sometimes a lack of apoptosis, or the pro-apoptotic response happens relatively late, thus casting doubt on the functional significance of apoptosis as an innate immunity. Using in vivo mosquito models and the native route of infection, we found that there is a rapid induction of reaper-like pro-apoptotic genes within a few hours following exposure to DNA or RNA viruses. Recapitulating a similar response in Drosophila, we found that this rapid induction of apoptosis requires the function of P53 and is mediated by a stress-responsive regulatory region upstream of reaper. More importantly, we showed that the rapid induction of apoptosis is responsible for preventing the expression of viral genes and blocking the infection. Genetic changes influencing this rapid induction of reaper-like pro-apoptotic genes led to significant differences in susceptibility to viral infection.

The human cytochrome P450 3A locus. Gene evolution by capture of downstream exons.

Science.gov (United States)

Finta, C; Zaphiropoulos, P G

2000-12-30

Using a bacterial artificial chromosome (BAC) clone, we have mapped the human cytochrome P450 3A (CYP3A) locus containing the genes encoding for CYP3A4, CYP3A5 and CYP3A7. The genes lie in a head-to-tail orientation in the order of 3A4, 3A7 and 3A5. In both intergenic regions (3A4-3A7 and 3A7-3A5), we have detected several additional cytochrome P450 3A exons, forming two CYP3A pseudogenes. These pseudogenes have the same orientation as the CYP3A genes. To our surprise, a 3A7 mRNA species has been detected in which the exons 2 and 13 of one of the pseudogenes (the one that is downstream of 3A7) are spliced after the 3A7 terminal exon. This results in an mRNA molecule that consists of the 13 3A7 exons and two additional exons at the 3' end. The additional two exons originating from the pseudogene are in an altered reading frame and consequently have the capability to code a completely different amino acid sequence than the canonical CYP3A exons 2 and 13. These findings may represent a generalized evolutionary process with genes having the potential to capture neighboring sequences and use them as functional exons.

Simultaneous Expression of Cancer Stem Cell-Like Properties and Cancer-Associated Fibroblast-Like Properties in a Primary Culture of Breast Cancer Cells

Energy Technology Data Exchange (ETDEWEB)

Ishikawa, Mami; Inoue, Takahiro; Shirai, Takuma; Takamatsu, Kazuhiko; Kunihiro, Shiori; Ishii, Hirokazu [Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, Kobe 650-0047 (Japan); Nishikata, Takahito, E-mail: nisikata@konan-u.ac.jp [Frontiers of Innovative Research in Science and Technology (FIRST), Konan University, Kobe 650-0047 (Japan); Frontier Institute for Biomolecular Engineering Research (FIBER), Konan University, Kobe 650-0047 (Japan)

2014-07-31

The importance of cancer-associated fibroblasts (CAFs) in cancer biology has been recently highlighted owing to their critical roles in cancer growth, progression, metastasis, and therapeutic resistance. We have previously established a primary culture of breast cancer cells, which showed epithelial-mesenchymal transition and cancer stem cell-like properties. In this study, we found that the primary culture also showed CAF-like properties. For example, hypoxia inducible factor 1α (HIF1A) and its downstream genes, nuclear factor-kappa B2 (NF-κB2) and BCL2/adenovirus E1B 19 kd-interacting protein 3 (BNIP3), and many enzymes involved in glycolysis, such as GAPDH, LDH, PGAM1, and PKM2, were highly overexpressed in the primary culture. Moreover, media conditioned with the primary culture cells enhanced the growth of breast cancer cells. Similar to previous CAF studies, this enhancement suggested to be occurred through fibroblast growth factor signaling. This MCKH primary culture cell, which showed simultaneous expression of tumorigenic and CAF properties, offers a unique experimental system for studying the biology of CAFs.

Evidence for natural selection at the melanocortin-3 receptor gene in European and African populations.

Science.gov (United States)

Yoshiuchi, Issei

2016-08-01

Obesity is increasing steadily in worldwide prevalence and is known to cause serious health problems in association with type 2 diabetes mellitus (T2DM), including hypertension, stroke, and cardiovascular diseases. According to the thrifty gene hypothesis, the natural selection of obesity-related genes is important during feast and famine because they control body weight and fat levels. Past human adaptations to environmental changes in food supply, lifestyle, and geography may have influenced the selection of genes associated with the metabolism of glucose, lipids, and energy. The melanocortin-3 receptor gene (MC3R) is associated with obesity, with MC3R-deficient mice showing increased fat mass. MC3R variations are also linked with childhood obesity and insulin resistance. Here, we aimed to uncover evidence of selection at MC3R. We performed a three-step method to detect selection at MC3R using HapMap population data. We used Wright's F statistics as a measure of population differentiation, the long-range haplotype test to identify extended haplotypes, and the integrated haplotype score (iHS) to detect selection at MC3R. We observed high population differentiation between European and African populations at two MC3R childhood obesity- and insulin resistance-associated single-nucleotide polymorphisms (rs3746619 and rs3827103) using Wright's F statistics. The iHS revealed evidence of natural selection at MC3R. These findings provide evidence for natural selection at MC3R. Further investigation is warranted into adaptive evolution at T2DM- and obesity-associated genes.

The characterization of six auxin-induced tomato GH3 genes uncovers a member, SlGH3.4, strongly responsive to arbuscular mycorrhizal symbiosis.

Science.gov (United States)

Liao, Dehua; Chen, Xiao; Chen, Aiqun; Wang, Huimin; Liu, Jianjian; Liu, Junli; Gu, Mian; Sun, Shubin; Xu, Guohua

2015-04-01

In plants, the GH3 gene family is widely considered to be involved in a broad range of plant physiological processes, through modulation of hormonal homeostasis. Multiple GH3 genes have been functionally characterized in several plant species; however, to date, limited works to study the GH3 genes in tomato have been reported. Here, we characterize the expression and regulatory profiles of six tomato GH3 genes, SlGH3.2, SlGH3.3, SlGH3.4, SlGH3.7, SlGH3.9 and SlGH3.15, in response to different phytohormone applications and arbuscular mycorrhizal (AM) fungal colonization. All six GH3 genes showed inducible responses to external IAA, and three members were significantly up-regulated in response to AM symbiosis. In particular, SlGH3.4, the transcripts of which were barely detectable under normal growth conditions, was strongly activated in the IAA-treated and AM fungal-colonized roots. A comparison of the SlGH3.4 expression in wild-type plants and M161, a mutant with a defect in AM symbiosis, confirmed that SlGH3.4 expression is highly correlated to mycorrhizal colonization. Histochemical staining demonstrated that a 2,258 bp SlGH3.4 promoter fragment could drive β-glucuronidase (GUS) expression strongly in root tips, steles and cortical cells of IAA-treated roots, but predominantly in the fungal-colonized cells of mycorrhizal roots. A truncated 654 bp promoter failed to direct GUS expression in IAA-treated roots, but maintained the symbiosis-induced activity in mycorrhizal roots. In summary, our results suggest that a mycorrhizal signaling pathway that is at least partially independent of the auxin signaling pathway has evolved for the co-regulation of the auxin- and mycorrhiza-activated GH3 genes in plants. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

Energy Technology Data Exchange (ETDEWEB)

Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

1995-01-02

Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

Molecular cloning and biological characterization of the human excision repair gene ERCC-3

International Nuclear Information System (INIS)

Weeda, G.; van Ham, R.C.; Masurel, R.; Westerveld, A.; Odijk, H.; de Wit, J.; Bootsma, D.; van der Eb, A.J.; Hoeijmakers, J.H.

1990-01-01

In this report we present the cloning, partial characterization, and preliminary studies of the biological activity of a human gene, designated ERCC-3, involved in early steps of the nucleotide excision repair pathway. The gene was cloned after genomic DNA transfection of human (HeLa) chromosomal DNA together with dominant marker pSV3gptH to the UV-sensitive, incision-defective Chinese hamster ovary (CHO) mutant 27-1. This mutant belongs to complementation group 3 of repair-deficient rodent mutants. After selection of UV-resistant primary and secondary 27-1 transformants, human sequences associated with the induced UV resistance were rescued in cosmids from the DNA of a secondary transformant by using a linked dominant marker copy and human repetitive DNA as probes. From coinheritance analysis of the ERCC-3 region in independent transformants, we deduce that the gene has a size of 35 to 45 kilobases, of which one essential segment has so far been refractory to cloning. Conserved unique human sequences hybridizing to a 3.0-kilobase mRNA were used to isolate apparently full-length cDNA clones. Upon transfection to 27-1 cells, the ERCC-3 cDNA, inserted in a mammalian expression vector, induced specific and (virtually) complete correction of the UV sensitivity and unscheduled DNA synthesis of mutants of complementation group 3 with very high efficiency. Mutant 27-1 is, unlike other mutants of complementation group 3, also very sensitive toward small alkylating agents. This unique property of the mutant is not corrected by introduction of the ERCC-3 cDNA, indicating that it may be caused by an independent second mutation in another repair function. By hybridization to DNA of a human x rodent hybrid cell panel, the ERCC-3 gene was assigned to chromosome 2, in agreement with data based on cell fusion

Novel mutations in the genes TGM1 and ALOXE3 underlying autosomal recessive congenital ichthyosis

Science.gov (United States)

Ullah, Rahim; Ansar, Muhammad; Durrani, Zaka Ullah; Lee, Kwanghyuk; Santos-Cortez, Regie Lyn P.; Muhammad, Dost; Ali, Mahboob; Zia, Muhammad; Ayub, Muhammad; Khan, Suliman; Smith, Josh D.; Nickerson, Deborah A.; Shendure, Jay; Bamshad, Michael; Leal, Suzanne M.; Ahmad, Wasim

2016-01-01

Background Ichthyoses are clinically characterized by scaling or hyperkeratosis of the skin or both. It can be an isolated condition limited to the skin or appear secondarily with involvement of other cutaneous or systemic abnormalities. Methods The present study investigated clinical and molecular characterization of three consanguineous families (A, B, C) segregating two different forms of autosomal recessive congenital ichthyosis (ARCI). Linkage in three consanguineous families (A, B, C) segregating two different forms of ARCI was searched by typing microsatellite and single nucleotide polymorphism marker analysis. Sequencing of the two genes TGM1 and ALOXE3 was performed by the dideoxy chain termination method. Results Genome-wide linkage analysis established linkage in family A to TGM1 gene on chromosome 14q11 and in families B and C to ALOXE3 gene on chromosome 17p13. Subsequently, sequencing of these genes using samples from affected family members led to the identification of three novel mutations: a missense variant p.Trp455Arg in TGM1 (family A); a nonsense variant p.Arg140* in ALOXE3 (family B); and a complex rearrangement in ALOXE3 (family C). Conclusion The present study further extends the spectrum of mutations in the two genes involved in causing ARCI. Characterizing the clinical spectrum resulting from mutations in the TGM1 and ALOXE3 genes will improve diagnosis and may direct clinical care of the family members. PMID:26578203

Retroviral-mediated gene transfer of human phenylalanine hydroxylase into NIH 3T3 and hepatoma cells

Energy Technology Data Exchange (ETDEWEB)

Ledley, F.D.; Grenett, H.E.; McGinnis-Shelnutt, M.; Woo, S.L.C.

1986-01-01

Phenylketonuria (PKU) is caused by deficiency of the hepatic enzyme phenylalanine hydroxylase (PAH). A full-length human PAH cDNA sequence has been inserted into pzip-neoSV(X), which is a retroviral vector containing the bacterial neo gene. The recombinant has been transfected into Psi2 cells, which provide synthesis of the retroviral capsid. Recombinant virus was detected in the culture medium of the transfected Psi2 cells, which is capable of transmitting the human PAH gene into mouse NIH 3T3 cells by infection leading to stable incorporation of the recombinant provirus. Infected cells express PAH mRNA, immunoreactive PAH protein, and exhibit pterin-dependent phenylaline hydroxylase activity. The recombinant virus is also capable of infecting a mouse hepatoma cell line that does not normal synthesize PAH. PAH activity is present in the cellular extracts and the entire hydroxylation system is reconstituted in the hepatoma cells infected with the recombinant viruses. Thus, recombinant viruses containing human PAH cDNA provide a means for introducing functional PAH into mammalian cells of hepatic origin and can potentially be introduced into whole animals as a model for somatic gene therapy for PKU.

Histone H3.3 promotes IgV gene diversification by enhancing formation of AID-accessible single-stranded DNA.

Science.gov (United States)

Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E

2016-07-01

Immunoglobulin diversification is driven by activation-induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single-stranded DNA (ssDNA), the enzymatic substrate of AID Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID to access the IgV genes due to reduced formation of ssDNA during IgV transcription. Loss of H3.3 also diminishes IgV R-loop formation. However, reducing IgV R-loops by RNase HI overexpression in wild-type cells does not affect IgV diversification, showing that these structures are not necessary intermediates for AID access. Importantly, the reduction in the formation of AID-accessible ssDNA in cells lacking H3.3 is independent of any effect on the level of transcription or the kinetics of RNAPII elongation, suggesting the presence of H3.3 in the nucleosomes of the IgV genes increases the chances of the IgV DNA becoming single-stranded, thereby creating an effective AID substrate. © 2016 MRC Laboratory of Molecular Biology. Published under the terms of the CC BY 4.0 license.

Opposite roles of the Arabidopsis cytokinin receptors AHK2 and AHK3 in the expression of plastid genes and genes for the plastid transcriptional machinery during senescence.

Science.gov (United States)

Danilova, Maria N; Kudryakova, Natalia V; Doroshenko, Anastasia S; Zabrodin, Dmitry A; Rakhmankulova, Zulfira F; Oelmüller, Ralf; Kusnetsov, Victor V

2017-03-01

Cytokinin membrane receptors of the Arabidopsis thaliana AHK2 and AHK3 play opposite roles in the expression of plastid genes and genes for the plastid transcriptional machinery during leaf senescence Loss-of-function mutants of Arabidopsis thaliana were used to study the role of cytokinin receptors in the expression of chloroplast genes during leaf senescence. Accumulation of transcripts of several plastid-encoded genes is dependent on the АНК2/АНК3 receptor combination. АНК2 is particularly important at the final stage of plant development and, unlike АНК3, a positive regulator of leaf senescence. Cytokinin-dependent up-regulation of the nuclear encoded genes for chloroplast RNA polymerases RPOTp and RPOTmp suggests that the hormone controls plastid gene expression, at least in part, via the expression of nuclear genes for the plastid transcription machinery. This is further supported by cytokinin dependent regulation of genes for the nuclear encoded plastid σ-factors, SIG1-6, which code for components of the transcriptional apparatus in chloroplasts.

An Investigation of the Relationship between PPP1R3 Gene Polymorphism and Type 2 Diabetes

Directory of Open Access Journals (Sweden)

Soyar Sari

2017-07-01

Full Text Available Background and Objectives: PPP1R3 is one of the genes confirmed to be associated with type 2 diabetes. This gene is located on the long arm of chromosome 7 and encodes protein phosphatase 1 (PP1, which has serine/threonine phosphatase activity. There is a polymorphic region in the 3'UTR region of this gene, which creates ARE1 and ARE2 alleles. The aim of this study was to determine the relationship between PPP1R3 gene polymorphism and type 2 diabetes. Methods: In this case-control study, 100 patients with type 2 diabetes and 100 healthy individuals, were randomly selected from the study population. PPP1R3 gene polymorphism was analyzed using PCR-RFLP method. Comparison of variables between healthy and patient groups, was performed by t-test, allele frequency by counting, and calculation of their ratio by chi-square test, and the population was confirmed to be in Hardy-Weinberg equilibrium. Distribution of genotypes and alleles was compared between healthy and patient groups. Results: In this study, there was no significant difference between the frequency of genotypes and frequency of alleles in subjects with type 2 diabetes and healthy control subjects. Conclusion: The findings of this study indicated that polymorphisms in the 3'UTR region of PPP1R3 gene is not associated with type 2 diabetes.

Synthesis of bacteriophage-coded gene products during infection of Escherichia coli with amber mutants of T3 and T7 defective in gene 1

DEFF Research Database (Denmark)

Issinger, O G; Hausmann, R

1973-01-01

During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...

Identification of late O{sub 3}-responsive genes in Arabidopsis thaliana by cDNA microarray analysis

Energy Technology Data Exchange (ETDEWEB)

D' Haese, D. [Univ. of Antwerp, Dept. of Biology, Antwerp (BE) and Univ. of Newcastle, School of Biology and Psychology, Div. of Biology, Newcastle-Upon-Tyne (United Kingdom); Horemans, N.; Coen, W. De; Guisez, Y. [Univ. of Antwerp, Dept. of Biology, Antwerp (Belgium)

2006-09-15

To better understand the response of a plant to 0{sub 3} stress, an integrated microarray analysis was performed on Arabidopsis plants exposed during 2 days to purified air or 150 nl l{sup -1} O{sub 3}, 8 h day-l. Agilent Arabidopsis 2 Oligo Microarrays were used of which the reliability was confirmed by quantitative real-time PCR of nine randomly selected genes. We confirmed the O{sub 3} responsiveness of heat shock proteins (HSPs), glutathione-S-tranferases and genes involved in cell wall stiffening and microbial defence. Whereas, a previous study revealed that during an early stage of the O{sub 3} stress response, gene expression was strongly dependent on jasmonic acid and ethylene, we report that at a later stage (48 h) synthesis of jasrnonic acid and ethylene was downregulated. In addition, we observed the simultaneous induction of salicylic acid synthesis and genes involved in programmed cell death and senescence. Also typically, the later stage of the response to O{sub 3} appeared to be the induction of the complete pathway leading to the biosynthesis of anthocyanin diglucosides and the induction of thioredoxin-based redox control. Surprisingly absent in the list of induced genes were genes involved in ASC-dependent antioxidation, few of which were found to be induced after 12 h of 0{sub 3} exposure in another study. We discuss these and other particular results of the microarray analysis and provide a map depicting significantly affected genes and their pathways highlighting their interrelationships and subcellular localization. (au)

Muscle Contraction Induces Acute Hydroxymethylation of the Exercise-Responsive Gene Nr4a3

DEFF Research Database (Denmark)

Pattamaprapanont, Pattarawan; Garde, Christian; Fabre, Odile

2016-01-01

stimulated over time is required to determine whether contraction-induced demethylation is preceded by changes in the hydroxymethylcytosine level. Here, we established an acute skeletal muscle contraction model to mimic the effects of acute exercise on gene expression. We used this model to investigate...... promoters. Exercise induces dynamic DNA demethylation at gene promoters; however, the contribution of the demethylation precursor hydroxymethylcytosine is unknown. Given the evanescent nature of hydroxymethylcytosine, a muscle contraction model that allows for the collection of samples that are repeatedly...... the effect of muscle contraction on DNA demethylation and hydroxymethylation. First, we performed an acute exercise study in healthy humans to identify an exercise-responsive gene that we could study in culture. We identified the nuclear receptor subfamily 4 group A member 3 (Nr4a3) gene with the highest...

A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

Science.gov (United States)

Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P