WorldWideScience

Sample records for proapoptotic gene bnip3

  1. Down-regulation of transcription of the proapoptotic gene BNip3 in cultured astrocytes by murine coronavirus infection

    International Nuclear Information System (INIS)

    Cai Yingyun; Liu Yin; Yu Dongdong; Zhang Xuming

    2003-01-01

    Murine coronavirus mouse hepatitis virus (MHV) causes encephalitis and demyelination in the central nervous system of susceptible rodents. Astrocytes are the major target for MHV persistence. However, the mechanisms by which astrocytes survive MHV infection and permit viral persistence are not known. Here we performed DNA microarray analysis on differential gene expression in astrocyte DBT cells by MHV infection and found that the mRNA of the proapoptotic gene BNip3 was significantly decreased following MHV infection. This finding was further confirmed by quantitative reverse transcription-polymerase chain reaction, Western blot analysis, and BNip3-promoter-luciferase reporter system. Interestingly, infection with live and ultraviolet light-inactivated viruses equally repressed BNip3 expression, indicating that the down-regulation of BNip3 expression does not require virus replication and is mediated during cell entry. Furthermore, treatment of cells with chloroquine, which blocks the acidification of endosomes, significantly inhibited the repression of the BNip3 promoter activity induced by the acidic pH-dependent MHV mutant OBLV60, which enters cells via endocytosis, indicating that the down-regulation of BNip3 expression is mediated by fusion between viral envelope and cell membranes during entry. Deletion analysis showed that the sequence between nucleotides 262 and 550 of the 588-base-pair BNip3 promoter is necessary and sufficient for driving the BNip3 expression and that it contains signals that are responsible for MHV-induced down-regulation of BNip3 expression in DBT cells. These results may provide insights into the mechanisms by which MHV evades host antiviral defense and promotes cell survival, thereby allowing its persistence in the host astrocytes

  2. Hypoxia-Induced Autophagy Is Mediated through Hypoxia-Inducible Factor Induction of BNIP3 and BNIP3L via Their BH3 Domains▿ †

    OpenAIRE

    Bellot, Grégory; Garcia-Medina, Raquel; Gounon, Pierre; Chiche, Johanna; Roux, Danièle; Pouysségur, Jacques; Mazure, Nathalie M.

    2009-01-01

    While hypoxia-inducible factor (HIF) is a major actor in the cell survival response to hypoxia, HIF also is associated with cell death. Several studies implicate the HIF-induced putative BH3-only proapoptotic genes bnip3 and bnip3l in hypoxia-mediated cell death. We, like others, do not support this assertion. Here, we clearly demonstrate that the hypoxic microenvironment contributes to survival rather than cell death by inducing autophagy. The ablation of Beclin1, a major actor of autophagy,...

  3. Expression of apoptosis-related genes in the mouse skin during the first postnatal catagen stage, focused on localization of Bnip3L and caspase-12

    Czech Academy of Sciences Publication Activity Database

    Veselá, Barbora; Matalová, Eva

    2015-01-01

    Roč. 56, č. 4 (2015), s. 326-335 ISSN 0300-8207 Grant - others:GA ČR(CZ) GAP502/12/1285 Program:GA Institutional support: RVO:67985904 Keywords : apoptosis * Bnip3L * caspase-12 Subject RIV: ED - Physiology Impact factor: 1.411, year: 2015

  4. Regulation of the mTOR Pathway by a Novel Rheb Binding Protein BNIP3

    National Research Council Canada - National Science Library

    Guan, Kun-Liang

    2008-01-01

    .... We demonstrate that BNIP3 plays a critical role in hypoxia-induced mTOR inhibition. Furthermore we found that BNIP3 itself has a growth inhibitory activity and inactivation of BNIP3 promotes cell growth...

  5. Autophagy capacity and sub-mitochondrial heterogeneity shape Bnip3-induced mitophagy regulation of apoptosis.

    Science.gov (United States)

    Choe, Sehyo Charley; Hamacher-Brady, Anne; Brady, Nathan Ryan

    2015-08-08

    Mitochondria are key regulators of apoptosis. In response to stress, BH3-only proteins activate pro-apoptotic Bcl2 family proteins Bax and Bak, which induce mitochondrial outer membrane permeabilization (MOMP). While the large-scale mitochondrial release of pro-apoptotic proteins activates caspase-dependent cell death, a limited release results in sub-lethal caspase activation which promotes tumorigenesis. Mitochondrial autophagy (mitophagy) targets dysfunctional mitochondria for degradation by lysosomes, and undergoes extensive crosstalk with apoptosis signaling, but its influence on apoptosis remains undetermined. The BH3-only protein Bnip3 integrates apoptosis and mitophagy signaling at different signaling domains. Bnip3 inhibits pro-survival Bcl2 members via its BH3 domain and activates mitophagy through its LC3 Interacting Region (LIR), which is responsible for binding to autophagosomes. Previously, we have shown that Bnip3-activated mitophagy prior to apoptosis induction can reduce mitochondrial activation of caspases, suggesting that a reduction to mitochondrial levels may be pro-survival. An outstanding question is whether organelle dynamics and/or recently discovered subcellular variations of protein levels responsible for both MOMP sensitivity and crosstalk between apoptosis and mitophagy can influence the cellular apoptosis decision event. To that end, here we undertook a systems biology analysis of mitophagy-apoptosis crosstalk at the level of cellular mitochondrial populations. Based on experimental findings, we developed a multi-scale, hybrid model with an individually adaptive mitochondrial population, whose actions are determined by protein levels, embedded in an agent-based model (ABM) for simulating subcellular dynamics and local feedback via reactive oxygen species signaling. Our model, supported by experimental evidence, identified an emergent regulatory structure within canonical apoptosis signaling. We show that the extent of mitophagy is

  6. MiR-30c regulates cisplatin-induced apoptosis of renal tubular epithelial cells by targeting Bnip3L and Hspa5.

    Science.gov (United States)

    Du, Bin; Dai, Xiao-Meng; Li, Shuang; Qi, Guo-Long; Cao, Guang-Xu; Zhong, Ying; Yin, Pei-di; Yang, Xue-Song

    2017-08-10

    As a common anticancer drug, cisplatin has been widely used for treating tumors in the clinic. However, its side effects, especially its nephrotoxicity, noticeably restrict the application of cisplatin. Therefore, it is imperative to investigate the mechanism of renal injury and explore the corresponding remedies. In this study, we showed the phenotypes of the renal tubules and epithelial cell death as well as elevated cleaved-caspase3- and TUNEL-positive cells in rats intraperitoneally injected with cisplatin. Similar cisplatin-induced cell apoptosis was found in HK-2 and NRK-52E cells exposed to cisplatin as well. In both models of cisplatin-induced apoptosis in vivo and in vitro, quantitative PCR data displayed reductions in miR-30a-e expression levels, indicating that miR-30 might be involved in regulating cisplatin-induced cell apoptosis. This was further confirmed when the effects of cisplatin-induced cell apoptosis were found to be closely correlated with alterations in miR-30c expression, which were manipulated by transfection of either the miR-30c mimic or miR-30c inhibitor in HK-2 and NRK-52E cells. Using bioinformatics tools, including TargetScan and a gene expression database (Gene Expression Omnibus), Adrb1, Bnip3L, Hspa5 and MAP3K12 were predicted to be putative target genes of miR-30c in cisplatin-induced apoptosis. Subsequently, Bnip3L and Hspa5 were confirmed to be the target genes after determining the expression of these putative genes following manipulation of miR-30c expression levels in HK-2 cells. Taken together, our current experiments reveal that miR-30c is certainly involved in regulating the renal tubular cell apoptosis induced by cisplatin, which might supply a new strategy to minimize cisplatin-induced nephrotoxicity.

  7. Epigallocatechin-3-gallate attenuates apoptosis and autophagy in concanavalin A-induced hepatitis by inhibiting BNIP3

    Directory of Open Access Journals (Sweden)

    Li S

    2016-02-01

    Full Text Available Sainan Li, Yujing Xia, Kan Chen, Jingjing Li, Tong Liu, Fan Wang, Jie Lu, Yingqun Zhou, Chuanyong Guo Department of Gastroenterology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai, People’s Republic of China Background: Epigallocatechin-3-gallate (EGCG is the most effective compound in green tea, and possesses a wide range of beneficial effects, including anti-inflammatory, antioxidant, antiobesity, and anticancer effects. In this study, we investigated the protective effects of EGCG in concanavalin A (ConA-induced hepatitis in mice and explored the possible mechanisms involved in these effects.Methods: Balb/C mice were injected with ConA (25 mg/kg to induce acute autoimmune hepatitis, and EGCG (10 or 30 mg/kg was administered orally twice daily for 10 days before ConA injection. Serum liver enzymes, proinflammatory cytokines, and other marker proteins were determined 2, 8, and 24 hours after the ConA administration.Results: BNIP3 mediated cell apoptosis and autophagy in ConA-induced hepatitis. EGCG decreased the immunoreaction and pathological damage by reducing inflammatory factors, such as TNF-α, IL-6, IFN-γ, and IL-1β. EGCG also exhibited an antiapoptotic and antiautophagic effect by inhibiting BNIP3 via the IL-6/JAKs/STAT3 pathway.Conclusion: EGCG attenuated liver injury in ConA-induced hepatitis by downregulating IL-6/JAKs/STAT3/BNIP3-mediated apoptosis and autophagy. Keywords: concanavalin A, hepatitis, EGCG, autophagy, apoptosis, BNIP3, STAT3, JAKs, IL-6

  8. FGF-2 Transcriptionally Down-Regulates the Expression of BNIP3L via PI3K/Akt/FoxO3a Signaling and Inhibits Necrosis and Mitochondrial Dysfunction Induced by High Concentrations of Hydrogen Peroxide in H9c2 Cells

    Directory of Open Access Journals (Sweden)

    Qian Chen

    2016-12-01

    Full Text Available Background/Aims: Cardiovascular disease is a growing major global public health problem. Necrosis is one of the main forms of cardiomyocyte death in heart disease. Oxidative stress is regarded as one of the key regulators of cardiac necrosis, which eventually leads to cardiovascular disease. Many pharmacological and in vitro studies have suggested that FGF-2 can act directly on cardiomyocytes to maintain the integrity and function of the myocardium and prevent damage during oxidative stress. However, the mechanisms by which FGF-2 rescues the myocardium from oxidative stress damage in cardiovascular disease remain unclear. The present study explored the protective effects of FGF-2 in the H2O2-induced necrosis of H9C2 cardiomyocytes as well as the possible signaling pathways involved. Methods: Necrosis of H9c2 cardiomyocytes was induced by H2O2 and assessed using a Cell Counting Kit-8 (CCK8 assay and flow cytometry analysis. The cells were pretreated with the PI3K/Akt inhibitor Wortmannin to investigate the possible involvement of the PI3K/Akt pathway in the protection by FGF-2. The levels of Akt, p-Akt, FoxO3a, p-FoxO3a, and BNIP3L were detected by Western blot. Chromatin immuno-precipitation (ChIP analysis was used to test whether FoxO3a binds directly to the BNIP3L promoter region. A luciferase assay was used to study the effects of FoxO3a on BNIP3L gene promoter activity. Mitochondrial ΔΨM was quantified using tetramethylrhodamine methyl ester perchlorate (TMRM. The mitochondrial oxygen consumption rate (OCR was assessed with a Seahorse XF24 Analyzer. Results: Treatment with H2O2 decreased the phosphorylation of Akt and FoxO3a, and it induced the nuclear localization of FoxO3a and the necrosis of H9c2 cells. These effects of H2O2 were abrogated by pretreatment with FGF-2. Furthermore, the protective effects of FGF-2 were abolished by the PI3K/Akt inhibitor Wortmannin. ChIP analyses indicated that FoxO3a binds directly to the BNIP3L promoter

  9. Thiamine deficiency activates hypoxia inducible factor-1α to facilitate pro-apoptotic responses in mouse primary astrocytes.

    Directory of Open Access Journals (Sweden)

    Kristy Zera

    Full Text Available Thiamine is an essential enzyme cofactor required for proper metabolic function and maintenance of metabolism and energy production in the brain. In developed countries, thiamine deficiency (TD is most often manifested following chronic alcohol consumption leading to impaired mitochondrial function, oxidative stress, inflammation and excitotoxicity. These biochemical lesions result in apoptotic cell death in both neurons and astrocytes. Comparable histological injuries in patients with hypoxia/ischemia and TD have been described in the thalamus and mammillary bodies, suggesting a congruency between the cellular responses to these stresses. Consistent with hypoxia/ischemia, TD stabilizes and activates Hypoxia Inducible Factor-1α (HIF-1α under physiological oxygen levels. However, the role of TD-induced HIF-1α in neurological injury is currently unknown. Using Western blot analysis and RT-PCR, we have demonstrated that TD induces HIF-1α expression and activity in primary mouse astrocytes. We observed a time-dependent increase in mRNA and protein expression of the pro-apoptotic and pro-inflammatory HIF-1α target genes MCP1, BNIP3, Nix and Noxa during TD. We also observed apoptotic cell death in TD as demonstrated by PI/Annexin V staining, TUNEL assay, and Cell Death ELISA. Pharmacological inhibition of HIF-1α activity using YC1 and thiamine repletion both reduced expression of pro-apoptotic HIF-1α target genes and apoptotic cell death in TD. These results demonstrate that induction of HIF-1α mediated transcriptional up-regulation of pro-apoptotic/inflammatory signaling contributes to astrocyte cell death during thiamine deficiency.

  10. Effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue

    Directory of Open Access Journals (Sweden)

    Min-Er Tang

    2016-09-01

    Full Text Available Objective: To study the effect of hrHPV infection on anti-apoptotic gene and pro-apoptotic gene expression in cervical cancer tissue. Methods: A total of 56 patients with cervical cancer, 94 cases of patients with cervical intraepithelial neoplasia and 48 cases of patients with chronic cervicitis who were treated in our hospital from May 2013 to December 2015 were selected for study and included in malignant group, precancerous lesion group and benign group respectively. hrHPV infection as well as the expression of anti-apoptotic genes and proapoptotic genes in cervical tissue were detected. Results: hrHPV infection rate and viral load in cervical tissue of malignant group were significantly higher than those of precancerous lesion group and benign group; P27 and p16 levels in cervical tissue of malignant group were significantly lower than those of precancerous lesion group and benign group, and K-ras, c-myc, Prdx4 and TNFAIP8 levels were significantly higher than those of precancerous lesion group and benign group; the greater the HPV virus load, the lower the p27 and p16 levels and the higher the K-ras, c-myc, Prdx4 and TNFAIP8 levels in cervical tissue. Conclusions: hrHPV infection can result in tumor suppressor genes p27 and p16 expression deletion and increase the expression of proto-oncogene and apoptosis-inhibiting genes, and it is associated with the occurrence and development of cervical cancer.

  11. Ebi/AP-1 suppresses pro-apoptotic genes expression and permits long-term survival of Drosophila sensory neurons.

    Directory of Open Access Journals (Sweden)

    Young-Mi Lim

    Full Text Available Sensory organs are constantly exposed to physical and chemical stresses that collectively threaten the survival of sensory neurons. Failure to protect stressed neurons leads to age-related loss of neurons and sensory dysfunction in organs in which the supply of new sensory neurons is limited, such as the human auditory system. Transducin β-like protein 1 (TBL1 is a candidate gene for ocular albinism with late-onset sensorineural deafness, a form of X-linked age-related hearing loss. TBL1 encodes an evolutionarily conserved F-box-like and WD40 repeats-containing subunit of the nuclear receptor co-repressor/silencing mediator for retinoid and thyroid hormone receptor and other transcriptional co-repressor complexes. Here we report that a Drosophila homologue of TBL1, Ebi, is required for maintenance of photoreceptor neurons. Loss of ebi function caused late-onset neuronal apoptosis in the retina and increased sensitivity to oxidative stress. Ebi formed a complex with activator protein 1 (AP-1 and was required for repression of Drosophila pro-apoptotic and anti-apoptotic genes expression. These results suggest that Ebi/AP-1 suppresses basal transcription levels of apoptotic genes and thereby protects sensory neurons from degeneration.

  12. A novel proapoptotic gene PANO encodes a post-translational modulator of the tumor suppressor p14ARF

    Energy Technology Data Exchange (ETDEWEB)

    Watari, Akihiro; Li, Yang; Higashiyama, Shinji; Yutsudo, Masuo, E-mail: yutsudo@biken.osaka-u.ac.jp

    2012-02-01

    The protein p14ARF is a known tumor suppressor protein controlling cell proliferation and survival, which mainly localizes in nucleoli. However, the regulatory mechanisms that govern its activity or expression remain unclear. Here, we report that a novel proapoptotic nucleolar protein, PANO, modulates the expression and activity of p14ARF in HeLa cells. Overexpression of PANO enhances the stability of p14ARF protein by protecting it from degradation, resulting in an increase in p14ARF expression levels. Overexpression of PANO also induces apoptosis under low serum conditions. This effect is dependent on the nucleolar localization of PANO and inhibited by knocking-down p14ARF. Alternatively, PANO siRNA treated cells exhibit a reduction in p14ARF protein levels. In addition, ectopic expression of PANO suppresses the tumorigenicity of HeLa cells in nude mice. These results indicate that PANO is a new apoptosis-inducing gene by modulating the tumor suppressor protein, p14ARF, and may itself be a new candidate tumor suppressor gene.

  13. Association of Pro-apoptotic Bad Gene Expression Changes with Benign Thyroid Nodules.

    Science.gov (United States)

    Gül, Nurdan; Temel, Berna; Ustek, Duran; Sirma-Ekmekçi, Sema; Kapran, Yersu; Tunca, Fatih; Giles-Şenyürek, Yasemin; Özbek, Uğur; Alagöl, Faruk

    2018-01-01

    This study aimed to investigate the role of the mitochondrial apoptotic pathway in benign thyroid nodules. Paired samples of nodular and normal tissues were collected from 26 patients with nodular goiters undergoing thyroidectomy. Variable expression of Bcl-2, Bax and Bad genes were evaluated by quantitative PCR. Expression level of Bad gene in nodules was found to be significantly decreased compared to normal tissues (p=0.049). A positive correlation was observed between nodule size and Bad expression levels (correlation coefficient=0.563, p=0.004); and this correlation was stronger in hot nodules (n=18, correlation coefficient=0.689, p=0.003). No significant difference was observed between nodular and normal tissue expressions of Bax and Bcl-2. These results suggest that Bad expression correlates with the size of benign thyroid nodules and also its relatively lower expression in nodules, warrant further investigation. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  14. Enhanced proapoptotic gene expression of XAF1, CASP8 and TNFSF10 in the bovine endometrium during early pregnancy is not correlated with augmented apoptosis.

    Science.gov (United States)

    Groebner, A E; Schulke, K; Unterseer, S; Reichenbach, H D; Reichenbach, M; Büttner, M; Wolf, E; Meyer, H H D; Ulbrich, S E

    2010-03-01

    Bovine trophoblast cells release interferon-tau (IFNT), a type I IFN, as the pregnancy recognition signal. Since type I IFNs exert growth inhibitory and proapoptotic actions, the effect of the conceptus on components of the apoptosis pathways was determined in the bovine endometrium during the periimplantation period. Uteri of Simmental heifers were flushed post mortem at days 12, 15, and 18 of cycle or pregnancy for the recovery of conceptuses and the sampling of ipsilateral endometrial tissue at slaughter for quantitative RT-PCR, immunohistochemistry, caspase activity and TUNEL assays. Endometrium samples of pregnant animals revealed increased transcript levels for the proapoptotic genes XAF1 (day 15: 2.9-fold; day 18: 15.1-fold; p=0.005) and CASP8 (day 18: 2.4-fold; p=0.007). The mRNA expression increased significantly with the day of the cycle for the proapoptotic genes FASLG, TNFSF10, TNF and TNFSF1A (p=0.004, p=0.006, p=0.001 and p=0.007) and the antiapoptotic gene BIRC4 (p=0.03). We detected high amounts of FASLG transcripts in day 18 conceptuses (16-fold higher than day 18 endometria). This finding was validated at the protein level by immunohistochemistry. To further analyse the endometrial activation of the caspase cascade, the activities of initiator caspase 8 and effector caspases 3/7 were determined luminometrically. No difference between pregnant and cyclic animals was found for either caspase activity. Additionally, a TUNEL assay showed no increase of apoptotic cells in the pregnant endometrium. In conclusion, although the bovine conceptus induces the expression of proapoptotic genes, neither an activation of a caspase cascade nor an increase of apoptotic cells was noticed. These results suggest inhibitory mechanisms preventing endometrial cells from programmed cell death. Copyright 2009 Elsevier Ltd. All rights reserved.

  15. The co-repressor SMRT delays DNA damage-induced caspase activation by repressing pro-apoptotic genes and modulating the dynamics of checkpoint kinase 2 activation.

    Directory of Open Access Journals (Sweden)

    Claudio Scafoglio

    Full Text Available Checkpoint kinase 2 (Chk2 is a major regulator of DNA damage response and can induce alternative cellular responses: cell cycle arrest and DNA repair or programmed cell death. Here, we report the identification of a new role of Chk2 in transcriptional regulation that also contributes to modulating the balance between survival and apoptosis following DNA damage. We found that Chk2 interacts with members of the NCoR/SMRT transcriptional co-regulator complexes and serves as a functional component of the repressor complex, being required for recruitment of SMRT on the promoter of pro-apoptotic genes upon DNA damage. Thus, the co-repressor SMRT exerts a critical protective action against genotoxic stress-induced caspase activation, repressing a functionally important cohort of pro-apoptotic genes. Amongst them, SMRT is responsible for basal repression of Wip1, a phosphatase that de-phosphorylates and inactivates Chk2, thus affecting a feedback loop responsible for licensing the correct timing of Chk2 activation and the proper execution of the DNA repair process.

  16. miR-148a is upregulated by Twist1 and T-bet and promotes Th1-cell survival by regulating the proapoptotic gene Bim.

    Science.gov (United States)

    Haftmann, Claudia; Stittrich, Anna-Barbara; Zimmermann, Jakob; Fang, Zhuo; Hradilkova, Kristyna; Bardua, Markus; Westendorf, Kerstin; Heinz, Gitta A; Riedel, René; Siede, Julia; Lehmann, Katrin; Weinberger, Esther E; Zimmel, David; Lauer, Uta; Häupl, Thomas; Sieper, Joachim; Backhaus, Marina; Neumann, Christian; Hoffmann, Ute; Porstner, Martina; Chen, Wei; Grün, Joachim R; Baumgrass, Ria; Matz, Mareen; Löhning, Max; Scheffold, Alexander; Wittmann, Jürgen; Chang, Hyun-Dong; Rajewsky, Nikolaus; Jäck, Hans-Martin; Radbruch, Andreas; Mashreghi, Mir-Farzin

    2015-04-01

    Repeatedly activated T helper 1 (Th1) cells present during chronic inflammation can efficiently adapt to the inflammatory milieu, for example, by expressing the transcription factor Twist1, which limits the immunopathology caused by Th1 cells. Here, we show that in repeatedly activated murine Th1 cells, Twist1 and T-bet induce expression of microRNA-148a (miR-148a). miR-148a regulates expression of the proapoptotic gene Bim, resulting in a decreased Bim/Bcl2 ratio. Inhibition of miR-148a by antagomirs in repeatedly activated Th1 cells increases the expression of Bim, leading to enhanced apoptosis. Knockdown of Bim expression by siRNA in miR-148a antagomir-treated cells restores viability of the Th1 cells, demonstrating that miR-148a controls survival by regulating Bim expression. Thus, Twist1 and T-bet not only control the differentiation and function of Th1 cells, but also their persistence in chronic inflammation. © 2014 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Human Thyroid Cancer-1 (TC-1 is a vertebrate specific oncogenic protein that protects against copper and pro-apoptotic genes in yeast

    Directory of Open Access Journals (Sweden)

    Natalie K. Jones

    2015-07-01

    Full Text Available The human Thyroid Cancer-1 (hTC-1 protein, also known as C8orf4 was initially identified as a gene that was up-regulated in human thyroid cancer. Here we show that hTC-1 is a peptide that prevents the effects of over-expressing Bax in yeast. Analysis of the 106 residues of hTC-1 in available protein databases revealed direct orthologues in jawed-vertebrates, including mammals, frogs, fish and sharks. No TC-1 orthologue was detected in lower organisms, including yeast. Here we show that TC-1 is a general pro-survival peptide since it prevents the growth- and cell death-inducing effects of copper in yeast. Human TC-1 also prevented the deleterious effects that occur due to the over-expression of a number of key pro-apoptotic peptides, including YCA1, YBH3, NUC1, and AIF1. Even though the protective effects were more pronounced with the over-expression of YBH3 and YCA1, hTC-1 could still protect yeast mutants lacking YBH3 and YCA1 from the effects of copper sulfate. This suggests that the protective effects of TC-1 are not limited to specific pathways or processes. Taken together, our results indicate that hTC-1 is a pro-survival protein that retains its function when heterologously expressed in yeast. Thus yeast is a useful model to characterize the potential roles in cell death and survival of cancer related genes.

  18. Pro-Apoptotic Role of the Human YPEL5 Gene Identified by Functional Complementation of a Yeast moh1Δ Mutation.

    Science.gov (United States)

    Lee, Ji Young; Jun, Do Youn; Park, Ju Eun; Kwon, Gi Hyun; Kim, Jong-Sik; Kim, Young Ho

    2017-03-28

    To examine the pro-apoptotic role of the human ortholog (YPEL5) of the Drosophila Yippee protein, the cell viability of Saccharomyces cerevisiae mutant strain with deleted MOH1 , the yeast ortholog, was compared with that of the wild-type (WT)- MOH1 strain after exposure to different apoptogenic stimulants, including UV irradiation, methyl methanesulfonate (MMS), camptothecin (CPT), heat shock, and hyperosmotic shock. The moh1 Δ mutant exhibited enhanced cell viability compared with the WT- MOH1 strain when treated with lethal UV irradiation, 1.8 mM MMS, 100 µ CPT, heat shock at 50°C, or 1.2 M KCl. At the same time, the level of Moh1 protein was commonly up-regulated in the WT- MOH1 strain as was that of Ynk1 protein, which is known as a marker for DNA damage. Although the enhanced UV resistance of the moh1 Δ mutant largely disappeared following transformation with the yeast MOH1 gene or one of the human YPEL1-YPEL5 genes, the transformant bearing pYES2- YPEL5 was more sensitive to lethal UV irradiation and its UV sensitivity was similar to that of the WT- MOH1 strain. Under these conditions, the UV irradiation-induced apoptotic events, such as FITC-Annexin V stainability, mitochondrial membrane potential (ΔΨm) loss, and metacaspase activation, occurred to a much lesser extent in the moh1 Δ mutant compared with the WT- MOH1 strain and the mutant strain bearing pYES2- MOH1 or pYES2- YPEL5 . These results demonstrate the functional conservation between yeast Moh1 and human YPEL5, and their involvement in mitochondria-dependent apoptosis induced by DNA damage.

  19. Hilar granule cells of the mouse dentate gyrus: effects of age, septotemporal location, strain, and selective deletion of the proapoptotic gene BAX.

    Science.gov (United States)

    Bermudez-Hernandez, Keria; Lu, Yi-Ling; Moretto, Jillian; Jain, Swati; LaFrancois, John J; Duffy, Aine M; Scharfman, Helen E

    2017-09-01

    The dentate gyrus (DG) principal cells are glutamatergic granule cells (GCs), and they are located in a compact cell layer. However, GCs are also present in the adjacent hilar region, but have been described in only a few studies. Therefore, we used the transcription factor prospero homeobox 1 (Prox1) to quantify GCs at postnatal day (PND) 16, 30, and 60 in a common mouse strain, C57BL/6J mice. At PND16, there was a large population of Prox1-immunoreactive (ir) hilar cells, with more in the septal than temporal hippocampus. At PND30 and 60, the size of the hilar Prox1-ir cell population was reduced. Similar numbers of hilar Prox1-expressing cells were observed in PND30 and 60 Swiss Webster mice. Prox1 is usually considered to be a marker of postmitotic GCs. However, many Prox1-ir hilar cells, especially at PND16, were not double-labeled with NeuN, a marker typically found in mature neurons. Most hilar Prox1-positive cells at PND16 co-expressed doublecortin (DCX) and calretinin, markers of immature GCs. Double-labeling with a marker of actively dividing cells, Ki67, was not detected. These results suggest that, surprisingly, a large population of cells in the hilus at PND16 are immature GCs (Type 2b and Type 3 cells). We also asked whether hilar Prox1-ir cell numbers are modifiable. To examine this issue, we conditionally deleted the proapoptotic gene BAX in Nestin-expressing cells at a time when there are numerous immature GCs in the hilus, PND2-8. When these mice were examined at PND60, the numbers of Prox1-ir hilar cells were significantly increased compared to control mice. However, deletion of BAX did not appear to change the proportion that co-expressed NeuN, suggesting that the size of the hilar Prox1-expressing population is modifiable. However, deleting BAX, a major developmental disruption, does not appear to change the proportion that ultimately becomes neurons.

  20. Gene expression profiles in BCL11B-siRNA treated malignant T cells

    Directory of Open Access Journals (Sweden)

    Grabarczyk Piotr

    2011-05-01

    Full Text Available Abstract Background Downregulation of the B-cell chronic lymphocytic leukemia (CLL/lymphoma11B (BCL11B gene by small interfering RNA (siRNA leads to growth inhibition and apoptosis of the human T-cell acute lymphoblastic leukemia (T-ALL cell line Molt-4. To further characterize the molecular mechanism, a global gene expression profile of BCL11B-siRNA -treated Molt-4 cells was established. The expression profiles of several genes were further validated in the BCL11B-siRNA -treated Molt-4 cells and primary T-ALL cells. Results 142 genes were found to be upregulated and 109 genes downregulated in the BCL11B-siRNA -treated Molt-4 cells by microarray analysis. Among apoptosis-related genes, three pro-apoptotic genes, TNFSF10, BIK, BNIP3, were upregulated and one anti-apoptotic gene, BCL2L1 was downregulated. Moreover, the expression of SPP1 and CREBBP genes involved in the transforming growth factor (TGF-β pathway was down 16-fold. Expression levels of TNFSF10, BCL2L1, SPP1, and CREBBP were also examined by real-time PCR. A similar expression pattern of TNFSF10, BCL2L1, and SPP1 was identified. However, CREBBP was not downregulated in the BLC11B-siRNA -treated Molt-4 cells. Conclusion BCL11B-siRNA treatment altered expression profiles of TNFSF10, BCL2L1, and SPP1 in both Molt-4 T cell line and primary T-ALL cells.

  1. Epigenetic Silencing of the Proapoptotic Gene BIM in Anaplastic Large Cell Lymphoma through an MeCP2/SIN3a Deacetylating Complex

    Directory of Open Access Journals (Sweden)

    Rocco Piazza

    2013-05-01

    Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.

  2. The usability of a 15-gene hypoxia classifier as a universal hypoxia profile in various cancer cell types

    DEFF Research Database (Denmark)

    Sørensen, Brita Singers; Knudsen, Anders Bisgård; Wittrup, Catja Foged

    2015-01-01

    genes, with BNIP3 not being upregulated at hypoxic conditions in 3 out of 6 colon cancer cell lines, and ALDOA in OE21 and FAM162A and SLC2A1 in SW116 only showing limited hypoxia induction. Furthermore, in the esophagus cell lines, the normoxic and hypoxic expression levels of LOX and BNIP3 were below...... the tissue type dependency of hypoxia induced genes included in a 15-gene hypoxic profile in carcinoma cell lines from prostate, colon, and esophagus cancer, and demonstrated that in vitro, with minor fluctuations, the genes in the hypoxic profile are hypoxia inducible, and the hypoxia profile may......BACKGROUND AND PURPOSE: A 15-gene hypoxia profile has previously demonstrated to have both prognostic and predictive impact for hypoxic modification in squamous cell carcinoma of the head and neck. This gene expression profile may also have a prognostic value in other histological cancer types...

  3. Deregulated expression of A1, Bcl-2, Bcl-xL, and Mcl-1 antiapoptotic proteins and Bid, Bad, and Bax proapoptotic genes in polycythemia vera patients

    Directory of Open Access Journals (Sweden)

    Elainy Patricia Lino Gasparotto

    2011-12-01

    Full Text Available Apoptosis deregulation might have a role in the pathophysiology of polycythemia vera (PV. This study evaluated Bcl-2 molecule expression in CD34+ cells and leukocytes in 12 PV patients. Gene expression was investigated by real time PCR using SybrGreen Quantitect kit and protein expression was evaluated by western-blotting. JAK2 V617F mutation was detected according to Baxter et al (2005. CD34+ cells from PV patients presented higher levels of A1 and Mcl-1 expression (median: 22.6 and 5.2, respectively in comparison with controls (0.9 and 0.5, p=0.004 and p=0.020; while Bcl-2 and Bcl-xL expression decreased in PV patients (0.18 and 1.19 compared with controls (1.39 and 2.01, p=0.006 and p=0.020. CD34+ cells in PV patients showed an elevated Bid expression (14.4 in comparison with healthy subjects (1.0; p=0.002. Patients' leukocytes showed an A1 augmentation (7.41, p=0.001 and a reduced expression of Bax (0.19; p=0.040 and Bad (0.2; p=0.030. There was no correlation between JAK2 V617F allele burden and molecular expression. PV patients showed alterations in Bcl-2 members' expression, which may interfere with control of apoptotic machinery and contribute to disease pathogenesis.A desregulação da apoptose parece participar da fisiopatologia da policitemia vera (PV. Este estudo avaliou a expressão das moléculas da família Bcl-2 em células hematopoéticas CD34 + e leucócitos de 12 pacientes com PV. Foram realizados: a quantificação da expressão gênica por PCR em tempo real utilizando kit Sybrgreen Quantitect, avaliação da expressão de proteínas por western-blot e detecção da mutação JAK2 V617F segundo Baxter et al. (2005. Células CD34 + dos pacientes com PV apresentaram maior expressão de A1 e Mcl-1 (mediana: 22,6 e 5,2, respectivamente em comparação com controles (0,9 e 0,5, p = 0,004 e p = 0,020 e expressão de Bcl-2 e Bcl-xL diminuída nestes pacientes (0,18 e 1,19 em relação aos controles (1,39 e 2,01, p = 0,006 e p = 0

  4. Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells

    Science.gov (United States)

    Rivera, Mariela; Ramos, Yanilda; Rodríguez-Valentín, Madeline; López-Acevedo, Sheila; Cubano, Luis A.; Zou, Jin; Zhang, Qiang; Wang, Guangdi

    2017-01-01

    Curcumin, an extract from the turmeric rhizome (Curcuma longa), is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12) and Poly (ADP-ribose) polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses. PMID:28628644

  5. Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Mariela Rivera

    Full Text Available Curcumin, an extract from the turmeric rhizome (Curcuma longa, is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12 and Poly (ADP-ribose polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses.

  6. WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zeilstra, Jurrit; Joosten, Sander P.J. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Wensveen, Felix M. [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Dessing, Mark C.; Schuetze, Denise M. [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Eldering, Eric [Department of Experimental Immunology, Academic Medical Center, Amsterdam (Netherlands); Spaargaren, Marcel [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands); Pals, Steven T., E-mail: s.t.pals@amc.uva.nl [Department of Pathology, Academic Medical Center, University of Amsterdam (Netherlands)

    2011-03-04

    Research highlights: {yields} Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. {yields} Expression profiling of apoptosis-related genes in Apc{sup Min/+} mice revealed the differential expression of pro-apoptotic Bok and Bax. {yields} APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. {yields} Blocking of {beta}-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or {beta}-catenin causes constitutively active {beta}-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc{sup Min/+} mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of {beta}-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which

  7. WNT signaling controls expression of pro-apoptotic BOK and BAX in intestinal cancer

    International Nuclear Information System (INIS)

    Zeilstra, Jurrit; Joosten, Sander P.J.; Wensveen, Felix M.; Dessing, Mark C.; Schuetze, Denise M.; Eldering, Eric; Spaargaren, Marcel; Pals, Steven T.

    2011-01-01

    Research highlights: → Intestinal adenomas initiated by aberrant activation of the WNT pathway displayed an increased sensitivity to apoptosis. → Expression profiling of apoptosis-related genes in Apc Min/+ mice revealed the differential expression of pro-apoptotic Bok and Bax. → APC-mutant adenomatous crypts in FAP patients showed strongly increased BAX immunoreactivity. → Blocking of β-catenin/TCF-4-mediated signaling in colon cancer cells reduced the expression of BOK and BAX. -- Abstract: In a majority of cases, colorectal cancer is initiated by aberrant activation of the WNT signaling pathway. Mutation of the genes encoding the WNT signaling components adenomatous polyposis coli or β-catenin causes constitutively active β-catenin/TCF-mediated transcription, driving the transformation of intestinal crypts to cancer precursor lesions, called dysplastic aberrant crypt foci. Deregulated apoptosis is a hallmark of adenomatous colon tissue. However, the contribution of WNT signaling to this process is not fully understood. We addressed this role by analyzing the rate of epithelial apoptosis in aberrant crypts and adenomas of the Apc Min/+ mouse model. In comparison with normal crypts and adenomas, aberrant crypts displayed a dramatically increased rate of apoptotic cell death. Expression profiling of apoptosis-related genes along the crypt-villus axis and in Apc mutant adenomas revealed increased expression of two pro-apoptotic Bcl-2 family members in intestinal adenomas, Bok and Bax. Analysis of the colon of familial adenomatous polyposis (FAP) patients along the crypt-to-surface axis, and of dysplastic crypts, corroborated this expression pattern. Disruption of β-catenin/TCF-4-mediated signaling in the colorectal cancer cell line Ls174T significantly decreased BOK and BAX expression, confirming WNT-dependent regulation in intestinal epithelial cells. Our results suggest a feedback mechanism by which uncontrolled epithelial cell proliferation in the

  8. RACK1 downregulates levels of the pro-apoptotic protein Fem1b in apoptosis-resistant colon cancer cells.

    Science.gov (United States)

    Subauste, M Cecilia; Ventura-Holman, Tereza; Du, Liqin; Subauste, Jose S; Chan, Shing-Leng; Yu, Victor C; Maher, Joseph F

    2009-12-01

    Evasion of apoptosis plays an important role in colon cancer progression. Following loss of the Apc tumor suppressor gene in mice, the gene encoding Fem1b is upregulated early in neoplastic intestinal epithelium. Fem1b is a pro-apoptotic protein that interacts with Fas, TNFR1 and Apaf-1, and increased expression of Fem1b induces apoptosis of cancer cells. Fem1b is a homolog of FEM-1, a protein in Caenorhabditis elegans that is negatively regulated by ubiquitination and proteasomal degradation. To study Fem1b regulation in colon cancer progression, we used apoptotis-sensitive SW480 cells, derived from a primary colon cancer, and their isogenic, apoptosis-resistant counterparts SW620 cells, derived from a subsequent metastatic lesion in the same patient. Treatment with proteasome inhibitor increased Fem1b protein levels in SW620 cells, but not in SW480 cells. In SW620 cells we found that endogenous Fem1b co-immunoprecipitates in complexes with RACK1, a protein known to mediate ubiquitination and proteasomal degradation of other pro-apoptotic proteins and to be upregulated in colon cancer. Full-length Fem1b, or the N-terminal region of Fem1b, associated with RACK1 when co-expressed in HEK293T cells, and RACK1 stimulated ubiquitination of Fem1b. RACK1 overexpression in SW620 cells led to downregulation of Fem1b protein levels. Conversely, downregulation of RACK1 led to upregulation of Fem1b protein levels, associated with induction of apoptosis, and this apoptosis was inhibited by blocking Fem1b protein upregulation. In conclusion, RACK1 downregulates levels of the pro-apoptotic protein Fem1b in metastatic, apoptosis-resistant colon cancer cells, which may promote apoptosis-resistance during progression of colon cancer.

  9. Fem1b, a proapoptotic protein, mediates proteasome inhibitor-induced apoptosis of human colon cancer cells.

    Science.gov (United States)

    Subauste, M Cecilia; Sansom, Owen J; Porecha, Nehal; Raich, Natacha; Du, Liqin; Maher, Joseph F

    2010-02-01

    In the treatment of colon cancer, the development of resistance to apoptosis is a major factor in resistance to therapy. New molecular approaches to overcome apoptosis resistance, such as selectively upregulating proapoptotic proteins, are needed in colon cancer therapy. In a mouse model with inactivation of the adenomatous polyposis coli (Apc) tumor suppressor gene, reflecting the pathogenesis of most human colon cancers, the gene encoding feminization-1 homolog b (Fem1b) is upregulated in intestinal epithelium following Apc inactivation. Fem1b is a proapoptotic protein that interacts with apoptosis-inducing proteins Fas, tumor necrosis factor receptor-1 (TNFR1), and apoptotic protease activating factor-1 (Apaf-1). Increasing Fem1b expression induces apoptosis of cancer cells, but effects on colon cancer cells have not been reported. Fem1b is a homolog of feminization-1 (FEM-1), a protein in Caenorhabditis elegans that is regulated by proteasomal degradation, but whether Fem1b is likewise regulated by proteasomal degradation is unknown. Herein, we found that Fem1b protein is expressed in primary human colon cancer specimens, and in malignant SW620, HCT-116, and DLD-1 colon cancer cells. Increasing Fem1b expression, by transfection of a Fem1b expression construct, induced apoptosis of these cells. We found that proteasome inhibitor treatment of SW620, HCT-116, and DLD-1 cells caused upregulation of Fem1b protein levels, associated with induction of apoptosis. Blockade of Fem1b upregulation with morpholino antisense oligonucleotide suppressed the proteasome inhibitor-induced apoptosis of these cells. In conclusion, the proapoptotic protein Fem1b is downregulated by the proteasome in malignant colon cancer cells and mediates proteasome inhibitor-induced apoptosis of these cells. Therefore, Fem1b could represent a novel molecular target to overcome apoptosis resistance in therapy of colon cancer.

  10. BmICE-2 is a novel pro-apoptotic caspase involved in apoptosis in the silkworm, Bombyx mori.

    Science.gov (United States)

    Yi, Hua-Shan; Pan, Cai-Xia; Pan, Chun; Song, Juan; Hu, Yan-Fen; Wang, La; Pan, Min-Hui; Lu, Cheng

    2014-02-28

    In this study we identified a potential pro-apoptotic caspase gene, Bombyx mori(B. mori)ICE-2 (BmICE-2) which encoded a polypeptide of 284 amino acid residues, including a (169)QACRG(173) sequence which surrounded the catalytic site and contained a p20 and a p10 domain. BmICE-2 expressed in Escherichia coli (E. coli) exhibited high proteolytic activity for the synthetic human initiator caspase-9 substrates Ac-LEHD-pNA, but little activity towards the effector caspase-3 substrates Ac-DEVD-pNA. When BmICE-2 was transiently expressed in BmN-SWU1 silkworm B. mori cells, we found that the high proteolytic activity for Ac-LEHD-pNA triggered caspase-3-like protease activity resulting in spontaneous cleavage and apoptosis in these cells. This effect was not replicated in Spodoptera frugiperda 9 cells. In addition, spontaneous cleavage of endogenous BmICE-2 in BmN-SWU1 cells could be induced by actinomycin D. These results suggest that BmICE-2 may be a novel pro-apoptotic gene with caspase-9 activity which is involved apoptotic processes in BmN-SWU1 silkworm B. mori cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Chronic social isolation suppresses proplastic response and promotes proapoptotic signalling in prefrontal cortex of Wistar rats.

    Science.gov (United States)

    Djordjevic, Ana; Adzic, Miroslav; Djordjevic, Jelena; Radojcic, Marija B

    2010-08-15

    Successful adaptation to stress involves synergized actions of glucocorticoids and catecholamines at several levels of the CNS, including the prefrontal cortex (PFC). Inside the PFC, hormonal signals trigger concerted actions of transcriptional factors, such as glucocorticoid receptor (GR) and nuclear factor kappa B (NFkappaB), culminating in a balanced, proadaptive expression of their common genes, such as proplastic NCAM and/or apoptotic Bax and Bcl-2. In the present study, we hypothesized that chronic stress may compromise the balance between GR and NFkappaB signals and lead to an altered/maladaptive expression of their cognate genes in the PFC. Our results obtained with Wistar rats exposed to chronic social isolation indicated alterations of the GR relative to the NFkappaB, in favor of the GR, in both the cytoplasmic and the nuclear compartments of the PFC. Although these alterations did not affect the induction of proplastic NCAM gene, they decreased the NCAM sialylation necessary for plastic response and caused marked relocation of the mitochondrial membrane antiapoptotic Bcl-2 protein to its cytoplasmic form. Moreover, the compromised PSA-NCAM plastic response found under chronic stress was sustained after exposure of animals to the subsequent acute stress, whereas the proapoptotic signals were further emphasized. It is concluded that chronic social isolation of Wistar animals leads to a maladaptive response of the PFC, considering the diminishment of its plastic potential and potentiating of apoptosis. Such conditions in the PFC are likely to compromise its ability to interact with other CNS structures, such as the hippocampus, which is necessary for successful adaptation to stress. (c) 2010 Wiley-Liss, Inc.

  12. The N-end rule pathway counteracts cell death by destroying proapoptotic protein fragments.

    Science.gov (United States)

    Piatkov, Konstantin I; Brower, Christopher S; Varshavsky, Alexander

    2012-07-03

    In the course of apoptosis, activated caspases cleave ∼500 to ∼1,000 different proteins in a mammalian cell. The dynamics of apoptosis involve a number of previously identified, caspase-generated proapoptotic protein fragments, defined as those that increase the probability of apoptosis. In contrast to activated caspases, which can be counteracted by inhibitor of apoptosis proteins, there is little understanding of antiapoptotic responses to proapoptotic protein fragments. One possibility is the regulation of proapoptotic fragments through their selective degradation. The previously identified proapoptotic fragments Cys-RIPK1, Cys-TRAF1, Asp-BRCA1, Leu-LIMK1, Tyr-NEDD9, Arg-BID, Asp-BCL(XL), Arg-BIM(EL), Asp-EPHA4, and Tyr-MET bear destabilizing N-terminal residues. Tellingly, the destabilizing nature (but not necessarily the actual identity) of N-terminal residues of proapoptotic fragments was invariably conserved in evolution. Here, we show that these proapoptotic fragments are short-lived substrates of the Arg/N-end rule pathway. Metabolic stabilization of at least one such fragment, Cys-RIPK1, greatly augmented the activation of the apoptosis-inducing effector caspase-3. In agreement with this understanding, even a partial ablation of the Arg/N-end rule pathway in two specific N-end rule mutants is shown to sensitize cells to apoptosis. We also found that caspases can inactivate components of the Arg/N-end rule pathway, suggesting a mutual suppression between this pathway and proapoptotic signaling. Together, these results identify a mechanistically specific and functionally broad antiapoptotic role of the Arg/N-end rule pathway. In conjunction with other apoptosis-suppressing circuits, the Arg/N-end rule pathway contributes to thresholds that prevent a transient or otherwise weak proapoptotic signal from reaching the point of commitment to apoptosis.

  13. Inhibition of Hepatocarcinogenesis by ArtinM via Anti-proliferative and Pro-apoptotic Mechanisms.

    Science.gov (United States)

    Braz, Mariana M; Roque-Barreira, Maria Cristina; Ramalho, Fernando S; Oliveira, Carlos A; Augusto, Marlei J; Ramalho, Leandra N Z

    ArtinM is a d-mannose-binding lectin found in the seeds of Artocarpus heterophyllus (jackfruit) that interacts with N-glycans, that is associated with receptors on the surface of phagocytic cells and induces the production of inflammatory mediators. Some of them are especially important because they may be required for antitumor immune response. This study aimed to evaluate the effect of ArtinM on hepatocellular preneoplastic foci. Wistar rats received 50 mg/kg of diethyl-nitrosamine (DEN) intraperitoneal weekly for 12 weeks. From the 14th week, the treated animals received 50 μg/kg of ArtinM subcutaneous every 2 weeks until the 18th week, whereas control animals were injected with vehicle alone. Preneoplastic-related factors were estimated using histological, western blotting and RT-PCR analysis. In comparison to the groups exposed to DEN, the ArtinM-treated rats showed diminution of preneoplastic foci, decreased expression of proliferating cell nuclear antigen (PCNA), increased number of nuclear p21 and p27 stained cells, augmented number of apoptotic cells, increased expression of p53, p42/44 MAPK and p21 proteins, reduced cyclin D1 (CCND1) protein levels and increased expression of TNFα and IFNγ genes. No difference was observed in interleukin 12 (IL12) protein levels. These findings indicate that ArtinM may provide protection against hepatocarcinogenesis as a result of the induction of cell-cycle blockage and pro-apoptotic mechanisms. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  14. Gene expression profiling in response to the histone deacetylase inhibitor BL1521 in neuroblastoma

    International Nuclear Information System (INIS)

    Ruijter, Annemieke J.M. de; Meinsma, Rutger J.; Bosma, Peter; Kemp, Stephan; Caron, Huib N.; Kuilenburg, Andre B.P. van

    2005-01-01

    Neuroblastoma is a childhood tumor with a poor survival in advanced stage disease despite intensive chemotherapeutic regimes. The new histone deacetylase (HDAC) inhibitor BL1521 has shown promising results in neuroblastoma. Inhibition of HDAC resulted in a decrease in proliferation and metabolic activity, induction of apoptosis and differentiation of neuroblastoma cells. In order to elucidate the mechanism mediating the effects of BL1521 on neuroblastoma cells, we investigated the gene expression profile of an MYCN single copy (SKNAS) and an MYCN amplified (IMR32) neuroblastoma cell line after treatment with BL1521 using the Affymetrix oligonucleotide array U133A. An altered expression of 255 genes was observed in both neuroblastoma cell lines. The majority of these genes were involved in gene expression, cellular metabolism, and cell signaling. We observed changes in the expression of vital genes belonging to the cell cycle (cyclin D1 and CDK4) and apoptosis (BNIP3, BID, and BCL2) pathway in response to BL1521. The expression of 37 genes was altered by both BL1521 and Trichostatin A, which could indicate a common gene set regulated by different HDAC inhibitors. BL1521 treatment changed the expression of a number of MYCN-associated genes. Several genes in the Wnt and the Delta/Notch pathways were changed in response to BL1521 treatment, suggesting that BL1521 is able to induce the differentiation of neuroblastoma cells into a more mature phenotype

  15. Pro-apoptotic effect of a Mycoplasma hyopneumoniae putative type I signal peptidase on PK(15) swine cells.

    Science.gov (United States)

    Paes, Jéssica A; Virginio, Veridiana G; Cancela, Martín; Leal, Fernanda M A; Borges, Thiago J; Jaeger, Natália; Bonorino, Cristina; Schrank, Irene S; Ferreira, Henrique B

    2017-03-01

    Mycoplasma hyopneumoniae is an economically significant swine pathogen that causes porcine enzootic pneumonia (PEP). Important processes for swine infection by M. hyopneumoniae depend on cell surface proteins, many of which are secreted by secretion pathways not completely elucidated so far. A putative type I signal peptidase (SPase I), a possible component of a putative Sec-dependent pathway, was annotated as a product of the sipS gene in the pathogenic M. hyopneumoniae 7448 genome. This M. hyopneumoniae putative SPase I (MhSPase I) displays only 14% and 23% of sequence identity/similarity to Escherichia coli bona fide SPase I, and, in complementation assays performed with a conditional E. coli SPase I mutant, only a partial restoration of growth was achieved with the heterologous expression of a recombinant MhSPase I (rMhSPase I). Considering the putative surface location of MhSPase I and its previously demonstrated capacity to induce a strong humoral response, we then assessed its potential to elicit a cellular and possible immunomodulatory response. In assays for immunogenicity assessment, rMhSPase I unexpectedly showed a cytotoxic effect on murine splenocytes. This cytotoxic effect was further confirmed using the swine epithelial PK(15) cell line in MTT and annexin V-flow cytometry assays, which showed that rMhSPase I induces apoptosis in a dose dependent-way. It was also demonstrated that this pro-apoptotic effect of rMhSPase I involves activation of a caspase-3 cascade. The potential relevance of the rMhSPase I pro-apoptotic effect for M. hyopneumoniae-host interactions in the context of PEP is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Anti-proliferative and pro-apoptotic activity of whole extract and isolated indicaxanthin from Opuntia ficus-indica associated with re-activation of the onco-suppressor p16{sup INK4a} gene in human colorectal carcinoma (Caco-2) cells

    Energy Technology Data Exchange (ETDEWEB)

    Naselli, Flores; Tesoriere, Luisa; Caradonna, Fabio; Bellavia, Daniele; Attanzio, Alessandro; Gentile, Carla; Livrea, Maria A., E-mail: maria.livrea@unipa.it

    2014-07-18

    Highlights: • Cactus pear fruit extract and indicaxanthin cause apoptosis of colon cancer cells. • Indicaxanthin does not cause ROS formation, but affects epigenoma in Caco-2 cells. • Indicaxanthin reverses methylation of oncosuppressor p16{sup INK4a} gene in Caco-2 cells. • Indicaxanthin reactivates retinoblastoma in Caco-2 cells. • Bioavailable indicaxanthin may have chemopreventive activity in colon cancer. - Abstract: Phytochemicals may exert chemo-preventive effects on cells of the gastro-intestinal tract by modulating epigenome-regulated gene expression. The effect of the aqueous extract from the edible fruit of Opuntia ficus-indica (OFI extract), and of its betalain pigment indicaxanthin (Ind), on proliferation of human colon cancer Caco-2 cells has been investigated. Whole extract and Ind caused a dose-dependent apoptosis of proliferating cells at nutritionally relevant amounts, with IC{sub 50} 400 ± 25 mg fresh pulp equivalents/mL, and 115 ± 15 μM (n = 9), respectively, without toxicity for post-confluent differentiated cells. Ind accounted for ∼80% of the effect of the whole extract. Ind did not cause oxidative stress in proliferating Caco-2 cells. Epigenomic activity of Ind was evident as de-methylation of the tumor suppressor p16{sup INK4a} gene promoter, reactivation of the silenced mRNA expression and accumulation of p16{sup INK4a}, a major controller of cell cycle. As a consequence, decrease of hyper-phosphorylated, in favor of the hypo-phosphorylated retinoblastoma was observed, with unaltered level of the cycline-dependent kinase CDK4. Cell cycle showed arrest in the G2/M-phase. Dietary cactus pear fruit and Ind may have chemo-preventive potential in intestinal cells.

  17. Anti-proliferative and pro-apoptotic activity of whole extract and isolated indicaxanthin from Opuntia ficus-indica associated with re-activation of the onco-suppressor p16INK4a gene in human colorectal carcinoma (Caco-2) cells

    International Nuclear Information System (INIS)

    Naselli, Flores; Tesoriere, Luisa; Caradonna, Fabio; Bellavia, Daniele; Attanzio, Alessandro; Gentile, Carla; Livrea, Maria A.

    2014-01-01

    Highlights: • Cactus pear fruit extract and indicaxanthin cause apoptosis of colon cancer cells. • Indicaxanthin does not cause ROS formation, but affects epigenoma in Caco-2 cells. • Indicaxanthin reverses methylation of oncosuppressor p16 INK4a gene in Caco-2 cells. • Indicaxanthin reactivates retinoblastoma in Caco-2 cells. • Bioavailable indicaxanthin may have chemopreventive activity in colon cancer. - Abstract: Phytochemicals may exert chemo-preventive effects on cells of the gastro-intestinal tract by modulating epigenome-regulated gene expression. The effect of the aqueous extract from the edible fruit of Opuntia ficus-indica (OFI extract), and of its betalain pigment indicaxanthin (Ind), on proliferation of human colon cancer Caco-2 cells has been investigated. Whole extract and Ind caused a dose-dependent apoptosis of proliferating cells at nutritionally relevant amounts, with IC 50 400 ± 25 mg fresh pulp equivalents/mL, and 115 ± 15 μM (n = 9), respectively, without toxicity for post-confluent differentiated cells. Ind accounted for ∼80% of the effect of the whole extract. Ind did not cause oxidative stress in proliferating Caco-2 cells. Epigenomic activity of Ind was evident as de-methylation of the tumor suppressor p16 INK4a gene promoter, reactivation of the silenced mRNA expression and accumulation of p16 INK4a , a major controller of cell cycle. As a consequence, decrease of hyper-phosphorylated, in favor of the hypo-phosphorylated retinoblastoma was observed, with unaltered level of the cycline-dependent kinase CDK4. Cell cycle showed arrest in the G2/M-phase. Dietary cactus pear fruit and Ind may have chemo-preventive potential in intestinal cells

  18. Anti-proliferative and pro-apoptotic activity of whole extract and isolated indicaxanthin from Opuntia ficus-indica associated with re-activation of the onco-suppressor p16(INK4a) gene in human colorectal carcinoma (Caco-2) cells.

    Science.gov (United States)

    Naselli, Flores; Tesoriere, Luisa; Caradonna, Fabio; Bellavia, Daniele; Attanzio, Alessandro; Gentile, Carla; Livrea, Maria A

    2014-07-18

    Phytochemicals may exert chemo-preventive effects on cells of the gastro-intestinal tract by modulating epigenome-regulated gene expression. The effect of the aqueous extract from the edible fruit of Opuntia ficus-indica (OFI extract), and of its betalain pigment indicaxanthin (Ind), on proliferation of human colon cancer Caco-2 cells has been investigated. Whole extract and Ind caused a dose-dependent apoptosis of proliferating cells at nutritionally relevant amounts, with IC50 400±25 mg fresh pulp equivalents/mL, and 115±15 μM (n=9), respectively, without toxicity for post-confluent differentiated cells. Ind accounted for ∼80% of the effect of the whole extract. Ind did not cause oxidative stress in proliferating Caco-2 cells. Epigenomic activity of Ind was evident as de-methylation of the tumor suppressor p16(INK4a) gene promoter, reactivation of the silenced mRNA expression and accumulation of p16(INK4a), a major controller of cell cycle. As a consequence, decrease of hyper-phosphorylated, in favor of the hypo-phosphorylated retinoblastoma was observed, with unaltered level of the cycline-dependent kinase CDK4. Cell cycle showed arrest in the G2/M-phase. Dietary cactus pear fruit and Ind may have chemo-preventive potential in intestinal cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Dual role of proapoptotic BAD in insulin secretion and beta cell survival

    OpenAIRE

    Danial, Nika N.; Walensky, Loren D.; Zhang, Chen-Yu; Choi, Cheol Soo; Fisher, Jill K.; Molina, Anthony J. A.; Datta, Sandeep Robert; Pitter, Kenneth L.; Bird, Gregory H.; Wikstrom, Jakob D.; Deeney, Jude T.; Robertson, Kirsten; Morash, Joel; Kulkarni, Ameya; Neschen, Susanne

    2008-01-01

    The proapoptotic BCL-2 family member BAD resides in a glucokinase-containing complex that regulates glucose-driven mitochondrial respiration. Here, we present genetic evidence of a physiologic role for BAD in glucose-stimulated insulin secretion by beta cells. This novel function of BAD is specifically dependent upon the phosphorylation of its BH3 sequence, previously defined as an essential death domain. We highlight the pharmacologic relevance of phosphorylated BAD BH3 by using cell-permeab...

  20. Induction of Pro-Apoptotic Endoplasmic Reticulum Stress in Multiple Myeloma Cells by NEO214, Perillyl Alcohol Conjugated to Rolipram.

    Science.gov (United States)

    Chen, Thomas C; Chan, Nymph; Labib, Shirin; Yu, Jiali; Cho, Hee-Yeon; Hofman, Florence M; Schönthal, Axel H

    2018-01-17

    Despite the introduction of new therapies for multiple myeloma (MM), many patients are still dying from this disease and novel treatments are urgently needed. We have designed a novel hybrid molecule, called NEO214, that was generated by covalent conjugation of the natural monoterpene perillyl alcohol (POH), an inducer of endoplasmic reticulum (ER) stress, to rolipram (Rp), an inhibitor of phosphodiesterase-4 (PDE4). Its potential anticancer effects were investigated in a panel of MM cell lines. We found that NEO214 effectively killed MM cells in vitro with a potency that was over an order of magnitude stronger than that of its individual components, either alone or in combination. The cytotoxic mechanism of NEO214 involved severe ER stress and prolonged induction of CCAAT/enhancer-binding protein homologous protein (CHOP), a key pro-apoptotic component of the ER stress response. These effects were prevented by salubrinal, a pharmacologic inhibitor of ER stress, and by CHOP gene knockout. Conversely, combination of NEO214 with bortezomib, a drug in clinical use for patients with MM, resulted in synergistic enhancement of MM cell death. Combination with the adenylate cyclase stimulant forskolin did not enhance NEO214 impact, indicating that cyclic adenosine 3',5'-monophosphate (AMP) pathways might play a lesser role. Our study introduces the novel agent NEO214 as a potent inducer of ER stress with significant anti-MM activity in vitro. It should be further investigated as a potential MM therapy aimed at exploiting this tumor's distinct sensitivity to ER stress.

  1. Temporal activation of anti- and pro-apoptotic factors in human gingival fibroblasts infected with the periodontal pathogen, Porphyromonas gingivalis: potential role of bacterial proteases in host signalling

    Directory of Open Access Journals (Sweden)

    Takehara Tadamichi

    2006-03-01

    Full Text Available Abstract Background Porphyromonas gingivalis is the foremost oral pathogen of adult periodontitis in humans. However, the mechanisms of bacterial invasion and the resultant destruction of the gingival tissue remain largely undefined. Results We report host-P. gingivalis interactions in primary human gingival fibroblast (HGF cells. Quantitative immunostaining revealed the need for a high multiplicity of infection for optimal infection. Early in infection (2–12 h, P. gingivalis activated the proinflammatory transcription factor NF-kappa B, partly via the PI3 kinase/AKT pathway. This was accompanied by the induction of cellular anti-apoptotic genes, including Bfl-1, Boo, Bcl-XL, Bcl2, Mcl-1, Bcl-w and Survivin. Late in infection (24–36 h the anti-apoptotic genes largely shut down and the pro-apoptotic genes, including Nip3, Hrk, Bak, Bik, Bok, Bax, Bad, Bim and Moap-1, were activated. Apoptosis was characterized by nuclear DNA degradation and activation of caspases-3, -6, -7 and -9 via the intrinsic mitochondrial pathway. Use of inhibitors revealed an anti-apoptotic function of NF-kappa B and PI3 kinase in P. gingivalis-infected HGF cells. Use of a triple protease mutant P. gingivalis lacking three major gingipains (rgpA rgpB kgp suggested a role of some or all these proteases in myriad aspects of bacteria-gingival interaction. Conclusion The pathology of the gingival fibroblast in P. gingivalis infection is affected by a temporal shift from cellular survival response to apoptosis, regulated by a number of anti- and pro-apoptotic molecules. The gingipain group of proteases affects bacteria-host interactions and may directly promote apoptosis by intracellular proteolytic activation of caspase-3.

  2. CEBPA exerts a specific and biologically important proapoptotic role in pancreatic β cells through its downstream network targets

    Science.gov (United States)

    Barbagallo, Davide; Condorelli, Angelo Giuseppe; Piro, Salvatore; Parrinello, Nunziatina; Fløyel, Tina; Ragusa, Marco; Rabuazzo, Agata Maria; Størling, Joachim; Purrello, Francesco; Di Pietro, Cinzia; Purrello, Michele

    2014-01-01

    Transcription factor CEBPA has been widely studied for its involvement in hematopoietic cell differentiation and causal role in hematological malignancies. We demonstrate here that it also performs a causal role in cytokine-induced apoptosis of pancreas β cells. Treatment of two mouse pancreatic α and β cell lines (αTC1-6 and βTC1) with proinflammatory cytokines IL-1β, IFN-γ, and TNF-α at doses that specifically induce apoptosis of βTC1 significantly increased the amount of mRNA and protein encoded by Cebpa and its proapoptotic targets, Arl6ip5 and Tnfrsf10b, in βTC1 but not in αTC1-6. Cebpa knockdown in βTC1 significantly decreased cytokine-induced apoptosis, together with the amount of Arl6ip5 and Tnfrsf10b. Analysis of the network comprising CEBPA, its targets, their first interactants, and proteins encoded by genes known to regulate cytokine-induced apoptosis in pancreatic β cells (genes from the apoptotic machinery and from MAPK and NFkB pathways) revealed that CEBPA, ARL6IP5, TNFRSF10B, TRAF2, and UBC are the top five central nodes. In silico analysis further suggests TRAF2 as trait d'union node between CEBPA and the NFkB pathway. Our results strongly suggest that Cebpa is a key regulator within the apoptotic network activated in pancreatic β cells during insulitis, and Arl6ip5, Tnfrsf10b, Traf2, and Ubc are key executioners of this program. PMID:24943845

  3. The proapoptotic activity of C-terminal domain of apoptosis-inducing factor (AIF is separated from its N-terminal

    Directory of Open Access Journals (Sweden)

    YONG ZHANG

    2009-01-01

    Full Text Available Apoptosis-inducing factor (AIF is a mitochondrial flavoprotein that mediates both NADH-oxidizing and caspase-independent apoptosis. Further, the proapoptotic activity of AIF is located in the C-terminus of AIF, although the precise minimum sequence responsible for apoptosis induction remains to be investigated. In the present study, we generated two truncated AIFs, AIFΔ1-480-FLAG, which is a FLAG-tagged C-terminal peptide comprising amino acids from 481 to 613, and AIF360-480 containing amino acids from 360 to 480 of AIF. We used confocal microscopy to demonstrate that both the truncated proteins are expressed and located in the cytoplasm of transfected cells. AIFΔ1-480 but not AIF360-480 induces apoptosis in transfected cells. We also found that the expression of AIFΔ1-480 could initiate the release of cytochrome c from the mitochondria. The suppression of caspase-9 via siRNA blocked the proapoptotic activity of AIFΔ1-480. Therefore, AIFΔ 1-480 is sufficient for inducing caspase-9-dependent apoptotic signaling, probably by promoting the release of cytochrome c. At last, we generated a chimeric immuno-AIFΔ 1-480 protein, which comprised an HER2 antibody, a Pseudomonas exotoxin A translocation domain and AIFΔ 1-480. Human Jurkat cells transfected with the immuno-AIFΔl-480 gene could express and secrete the chimeric protein, which selectively recognize and kill HER2-overexpressing tumor cells. Our study demonstrates the feasibility of the immuno-AIFΔl-480 gene as a novel approach to treating HER2-overexpressing cancers.

  4. Blockade of epidermal growth factor receptors chemosensitizes breast cancer cells through up-regulation of Bnip3L

    NARCIS (Netherlands)

    Real, PJ; Benito, A; Cuevas, J; Berciano, MT; de Juan, A; Coffer, P; Gomez-Roman, J; Lafarga, M; Lopez-Vega, JM; Fernandez-Luna, JL

    2005-01-01

    Epidermal growth factor receptor-1 (EGFR) and EGFR-2 (HER2) have become major targets for cancer treatment. Blocking antibodies and small-molecule inhibitors are being used to silence the activity of these receptors in different tumors with varying efficacy. Thus, a better knowledge on the signaling

  5. IFNB1/interferon-ß-induced autophagy in MCF-7 breast cancer cells counteracts its proapoptotic function

    DEFF Research Database (Denmark)

    Ambjørn, Malene; Ejlerskov, Patrick; Liu, Yawei

    2013-01-01

    IFNB1/interferon (IFN)-ß belongs to the type I IFNs and exerts potent antiproliferative, proapoptotic, antiangiogenic and immunemodulatory functions. Despite the beneficial effects of IFNB1 in experimental breast cancers, clinical translation has been disappointing, possibly due to induction of s...

  6. Gene expression profiles in asbestos-exposed epithelial and mesothelial lung cell lines

    Directory of Open Access Journals (Sweden)

    Kaski Samuel

    2007-03-01

    Full Text Available Abstract Background Asbestos has been shown to cause chromosomal damage and DNA aberrations. Exposure to asbestos causes many lung diseases e.g. asbestosis, malignant mesothelioma, and lung cancer, but the disease-related processes are still largely unknown. We exposed the human cell lines A549, Beas-2B and Met5A to crocidolite asbestos and determined time-dependent gene expression profiles by using Affymetrix arrays. The hybridization data was analyzed by using an algorithm specifically designed for clustering of short time series expression data. A canonical correlation analysis was applied to identify correlations between the cell lines, and a Gene Ontology analysis method for the identification of enriched, differentially expressed biological processes. Results We recognized a large number of previously known as well as new potential asbestos-associated genes and biological processes, and identified chromosomal regions enriched with genes potentially contributing to common responses to asbestos in these cell lines. These include genes such as the thioredoxin domain containing gene (TXNDC and the potential tumor suppressor, BCL2/adenovirus E1B 19kD-interacting protein gene (BNIP3L, GO-terms such as "positive regulation of I-kappaB kinase/NF-kappaB cascade" and "positive regulation of transcription, DNA-dependent", and chromosomal regions such as 2p22, 9p13, and 14q21. We present the complete data sets as Additional files. Conclusion This study identifies several interesting targets for further investigation in relation to asbestos-associated diseases.

  7. Lovastatin prevents cisplatin-induced activation of pro-apoptotic DNA damage response (DDR) of renal tubular epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Krüger, Katharina; Ziegler, Verena; Hartmann, Christina; Henninger, Christian [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany); Thomale, Jürgen [Institute of Cell Biology, University Duisburg-Essen, 45122 Essen (Germany); Schupp, Nicole [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany); Fritz, Gerhard, E-mail: fritz@uni-duesseldorf.de [Institute of Toxicology, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf (Germany)

    2016-02-01

    The platinating agent cisplatin (CisPt) is commonly used in the therapy of various types of solid tumors. The anticancer efficacy of CisPt largely depends on the formation of bivalent DNA intrastrand crosslinks, which stimulate mechanisms of the DNA damage response (DDR), thereby triggering checkpoint activation, gene expression and cell death. The clinically most relevant adverse effect associated with CisPt treatment is nephrotoxicity that results from damage to renal tubular epithelial cells. Here, we addressed the question whether the HMG-CoA-reductase inhibitor lovastatin affects the DDR of renal cells by employing rat renal proximal tubular epithelial (NRK-52E) cells as in vitro model. The data show that lovastatin has extensive inhibitory effects on CisPt-stimulated DDR of NRK-52E cells as reflected on the levels of phosphorylated ATM, Chk1, Chk2, p53 and Kap1. Mitigation of CisPt-induced DDR by lovastatin was independent of the formation of DNA damage as demonstrated by (i) the analysis of Pt-(GpG) intrastrand crosslink formation by Southwestern blot analyses and (ii) the generation of DNA strand breaks as analyzed on the level of nuclear γH2AX foci and employing the alkaline comet assay. Lovastatin protected NRK-52E cells from the cytotoxicity of high CisPt doses as shown by measuring cell viability, cellular impedance and flow cytometry-based analyses of cell death. Importantly, the statin also reduced the level of kidney DNA damage and apoptosis triggered by CisPt treatment of mice. The data show that the lipid-lowering drug lovastatin extensively counteracts pro-apoptotic signal mechanisms of the DDR of tubular epithelial cells following CisPt injury. - Highlights: • Lovastatin blocks ATM/ATR-regulated DDR of tubular cells following CisPt treatment. • Lovastatin attenuates CisPt-induced activation of protein kinase ATM in vitro. • Statin-mediated DDR inhibition is independent of initial DNA damage formation. • Statin-mediated blockage of Cis

  8. Lovastatin prevents cisplatin-induced activation of pro-apoptotic DNA damage response (DDR) of renal tubular epithelial cells

    International Nuclear Information System (INIS)

    Krüger, Katharina; Ziegler, Verena; Hartmann, Christina; Henninger, Christian; Thomale, Jürgen; Schupp, Nicole; Fritz, Gerhard

    2016-01-01

    The platinating agent cisplatin (CisPt) is commonly used in the therapy of various types of solid tumors. The anticancer efficacy of CisPt largely depends on the formation of bivalent DNA intrastrand crosslinks, which stimulate mechanisms of the DNA damage response (DDR), thereby triggering checkpoint activation, gene expression and cell death. The clinically most relevant adverse effect associated with CisPt treatment is nephrotoxicity that results from damage to renal tubular epithelial cells. Here, we addressed the question whether the HMG-CoA-reductase inhibitor lovastatin affects the DDR of renal cells by employing rat renal proximal tubular epithelial (NRK-52E) cells as in vitro model. The data show that lovastatin has extensive inhibitory effects on CisPt-stimulated DDR of NRK-52E cells as reflected on the levels of phosphorylated ATM, Chk1, Chk2, p53 and Kap1. Mitigation of CisPt-induced DDR by lovastatin was independent of the formation of DNA damage as demonstrated by (i) the analysis of Pt-(GpG) intrastrand crosslink formation by Southwestern blot analyses and (ii) the generation of DNA strand breaks as analyzed on the level of nuclear γH2AX foci and employing the alkaline comet assay. Lovastatin protected NRK-52E cells from the cytotoxicity of high CisPt doses as shown by measuring cell viability, cellular impedance and flow cytometry-based analyses of cell death. Importantly, the statin also reduced the level of kidney DNA damage and apoptosis triggered by CisPt treatment of mice. The data show that the lipid-lowering drug lovastatin extensively counteracts pro-apoptotic signal mechanisms of the DDR of tubular epithelial cells following CisPt injury. - Highlights: • Lovastatin blocks ATM/ATR-regulated DDR of tubular cells following CisPt treatment. • Lovastatin attenuates CisPt-induced activation of protein kinase ATM in vitro. • Statin-mediated DDR inhibition is independent of initial DNA damage formation. • Statin-mediated blockage of Cis

  9. Proapoptotic Bak and Bax guard against fatal systemic and organ-specific autoimmune disease

    Science.gov (United States)

    Mason, Kylie D.; Lin, Ann; Robb, Lorraine; Josefsson, Emma C.; Henley, Katya J.; Gray, Daniel H. D.; Kile, Benjamin T.; Roberts, Andrew W.; Strasser, Andreas; Huang, David C. S.; Waring, Paul; O’Reilly, Lorraine A.

    2013-01-01

    Dysregulation of the “intrinsic” apoptotic pathway is associated with the development of cancer and autoimmune disease. Bak and Bax are two proapoptotic members of the Bcl-2 protein family with overlapping, essential roles in the intrinsic apoptotic pathway. Their activity is critical for the control of cell survival during lymphocyte development and homeostasis, best demonstrated by defects in thymic T-cell differentiation and peripheral lymphoid homeostasis caused by their combined loss. Because most bak−/−bax−/− mice die perinatally, the roles of Bax and Bak in immunological tolerance and prevention of autoimmune disease remain unclear. We show that mice reconstituted with a Bak/Bax doubly deficient hematopoietic compartment develop a fatal systemic lupus erythematosus-like autoimmune disease characterized by hypergammaglobulinemia, autoantibodies, lymphadenopathy, glomerulonephritis, and vasculitis. Importantly, these mice also develop a multiorgan autoimmune disease with autoantibodies against most solid glandular structures and evidence of glandular atrophy and necrotizing vasculitis. Interestingly, similar albeit less severe pathology was observed in mice containing a hematopoietic compartment deficient for only Bak, a phenotype reminiscent of the disease seen in patients with point mutations in BAK. These studies demonstrate a critical role for Bak and an ancillary role for Bax in safeguarding immunological tolerance and prevention of autoimmune disease. This suggests that direct activators of the intrinsic apoptotic pathway, such as BH3 mimetics, may be useful for treatment of diverse autoimmune diseases. PMID:23349374

  10. Dual role of proapoptotic BAD in insulin secretion and beta cell survival.

    Science.gov (United States)

    Danial, Nika N; Walensky, Loren D; Zhang, Chen-Yu; Choi, Cheol Soo; Fisher, Jill K; Molina, Anthony J A; Datta, Sandeep Robert; Pitter, Kenneth L; Bird, Gregory H; Wikstrom, Jakob D; Deeney, Jude T; Robertson, Kirsten; Morash, Joel; Kulkarni, Ameya; Neschen, Susanne; Kim, Sheene; Greenberg, Michael E; Corkey, Barbara E; Shirihai, Orian S; Shulman, Gerald I; Lowell, Bradford B; Korsmeyer, Stanley J

    2008-02-01

    The proapoptotic BCL-2 family member BAD resides in a glucokinase-containing complex that regulates glucose-driven mitochondrial respiration. Here, we present genetic evidence of a physiologic role for BAD in glucose-stimulated insulin secretion by beta cells. This novel function of BAD is specifically dependent upon the phosphorylation of its BH3 sequence, previously defined as an essential death domain. We highlight the pharmacologic relevance of phosphorylated BAD BH3 by using cell-permeable, hydrocarbon-stapled BAD BH3 helices that target glucokinase, restore glucose-driven mitochondrial respiration and correct the insulin secretory response in Bad-deficient islets. Our studies uncover an alternative target and function for the BAD BH3 domain and emphasize the therapeutic potential of phosphorylated BAD BH3 mimetics in selectively restoring beta cell function. Furthermore, we show that BAD regulates the physiologic adaptation of beta cell mass during high-fat feeding. Our findings provide genetic proof of the bifunctional activities of BAD in both beta cell survival and insulin secretion.

  11. The pro-apoptotic action of the peptide hormone Neb-colloostatin on insect haemocytes.

    Science.gov (United States)

    Czarniewska, E; Mrówczynska, L; Kuczer, M; Rosinski, G

    2012-12-15

    The gonadoinhibitory peptide hormone Neb-colloostatin was first isolated from ovaries of the flesh fly Neobellieria bullata. This 19-mer peptide is thought to be a cleaved product of a collagen-like precursor molecule that is formed during remodelling of the extracellular matrix. In this study, we report that upon injection of picomolar and nanomolar doses, this peptide exerts a pro-apoptotic action on haemocytes of Tenebrio molitor adults, as visualized by changes in morphology and viability. The F-actin cytoskeleton was found to aggregate into distinctive patches. This may be responsible for the observed inhibition of adhesion of haemocytes and for the stimulation of filopodia formation. However, Neb-colloostatin injection did not induce the formation of autophagic vacuoles. Our results suggest that physiological concentrations of Neb-colloostatin play an important role in controlling the quantity and activity of haemocytes in insect haemolymph. They also suggest that during periods in which Neb-colloostatin is released, this peptide may cause a weakening of the insects' immune system. This is the first report that exposure to a peptide hormone causes apoptosis in insect haemocytes.

  12. Intrinsic, pro-apoptotic effects of IGFBP-3 on breast cancer cells are reversible: Involvement of PKA, Rho and ceramide.

    Directory of Open Access Journals (Sweden)

    Claire M Perks

    2011-05-01

    Full Text Available We established previously that IGFBP-3 could exert positive or negative effects on cell function depending upon the extracellular matrix composition and by interacting with integrin signalling. To elicit its pro-apoptotic effects IGFBP-3 bound to caveolin-1 and the beta 1 integrin receptor and increased their association culminating in MAPK activation. Disruption of these complexes or blocking the beta 1 integrin receptor reversed these intrinsic actions of IGFBP-3. In this study we have examined the signalling pathway between integrin receptor binding and MAPK activation that mediates the intrinsic, pro-apoptotic actions of IGFBP-3. We found on inhibiting protein kinase A(PKA, Rho associated kinase (ROCK and ceramide, the accentuating effects of IGFBP-3 on apoptotic triggers were reversed, such that IGFBP-3 then conferred cell survival. We established that IGFBP-3 activated Rho, the upstream regulator of ROCK and that beta1 integrin and PKA were upstream of Rho activation, whereas the involvement of ceramide was downstream. The beta 1 integrin, PKA, Rho and ceramide were all upstream of MAPK activation. These data highlight key components involved in the pro-apoptotic effects of IGFBP-3 and that inhibiting them leads to a reversal in the action of IGFBP-3.

  13. A supermolecular curcumin for enhanced antiproliferative and proapoptotic activities: molecular characteristics, computer modeling and in vivo pharmacokinetics

    International Nuclear Information System (INIS)

    Tan Qunyou; Wu Jianyong; Li Yi; Zhang Jingqing; Mei Hu; Zhao Chunjing

    2013-01-01

    The supermolecular curcumin (SMCCM) exhibiting remarkably improved solubility and release characteristics was fabricated to increase the oral bioavailability in rat as well as the antiproliferative and proapoptotic activities of curcumin (CCM) against human lung adenocarcinoma cell A549. SMCCM was characterized by differential scanning calorimetry, Fourier transform infrared spectroscopy, morphology and structure, aqueous solubility, and release behavior in vitro. Computer modeling of the supermolecular structure was performed. The pharmacokinetics, antiproliferative and proapoptotic activities of SMCCM were evaluated. The mechanisms by which SMCCM inhibited proliferation and induced apoptosis were identified. The formation of SMCCM was testified and the supermolecular structure was studied by a computer modeling technique. Compared to free CCM, SMCCM with much higher aqueous solubility exhibited obviously enhanced release and more favorable pharmacokinetic profiles, and, furthermore, SMCCM showed higher anticancer efficacy, enhanced induction of G2/M-phase arrest and apoptosis in A549 cells, which might be involved with the increases in reactive oxygen species production and intracellular Ca 2+ accumulation, and a decrease in mitochondrial membrane potential. SMCCM remarkably enhanced not only the oral bioavailability but also the antiproliferative and proapoptotic activities of CCM along with improved solubility and release characteristics of CCM. (paper)

  14. A supermolecular curcumin for enhanced antiproliferative and proapoptotic activities: molecular characteristics, computer modeling and in vivo pharmacokinetics

    Science.gov (United States)

    Tan, Qunyou; Wu, Jianyong; Li, Yi; Mei, Hu; Zhao, Chunjing; Zhang, Jingqing

    2013-01-01

    The supermolecular curcumin (SMCCM) exhibiting remarkably improved solubility and release characteristics was fabricated to increase the oral bioavailability in rat as well as the antiproliferative and proapoptotic activities of curcumin (CCM) against human lung adenocarcinoma cell A549. SMCCM was characterized by differential scanning calorimetry, Fourier transform infrared spectroscopy, morphology and structure, aqueous solubility, and release behavior in vitro. Computer modeling of the supermolecular structure was performed. The pharmacokinetics, antiproliferative and proapoptotic activities of SMCCM were evaluated. The mechanisms by which SMCCM inhibited proliferation and induced apoptosis were identified. The formation of SMCCM was testified and the supermolecular structure was studied by a computer modeling technique. Compared to free CCM, SMCCM with much higher aqueous solubility exhibited obviously enhanced release and more favorable pharmacokinetic profiles, and, furthermore, SMCCM showed higher anticancer efficacy, enhanced induction of G2/M-phase arrest and apoptosis in A549 cells, which might be involved with the increases in reactive oxygen species production and intracellular Ca2+ accumulation, and a decrease in mitochondrial membrane potential. SMCCM remarkably enhanced not only the oral bioavailability but also the antiproliferative and proapoptotic activities of CCM along with improved solubility and release characteristics of CCM.

  15. Triterpenoidal saponins from the fruits of Gleditsia caspica with proapoptotic properties.

    Science.gov (United States)

    Shaheen, Usama; Ragab, Ehab A; Abdalla, Ashraf N; Bader, Ammar

    2018-01-01

    Three previously undescribed oleanane-type triterpenoidal saponins named caspicaosides L-N were isolated from the fruits of Gleditsia caspica Desf. The aglycons of these saponins were echinocystic acid, erythrodiol and 12-oleanene-3,28,30-triol. Caspicaoside L is a bisdesmosidic saponin acylated with two monoterpenic acids. It has a disaccharide moiety made up of glucose and arabinose attached to C-3 and pentasaccharide moiety linked to C-28 made up of one glucose, 2 xyloses, one inner rhamnose and one terminal rhamnose which was acylated with two identical monoterpenic acids. Caspicaoside M is a monodesmosidic saponin with a trisaccharide moiety at C-3 made up of glucose, xylose and arabinose, while caspicaoside N has a disaccharide moiety at C-3 made up of glucose and arabinose. Their structures were determined by extensive 1D and 2D (DQF-COSY, HSQC, TOCSY, 1 H- 13 C-HSQC-TOCSY, HMBC, ROESY, NOESY) NMR, HRESIMS analyses and chemical degradation. The cytotoxicity MTT-based assay showed that caspicaosides M, N and L, respectively, exhibited high cytotoxic activity with IC 50  ≤ 10 μM (72 h) at least against one of the three used cancer cell lines, MCF 7, A2780 and HT 29; and were 2-34 folds selective against the normal fibroblasts (MRC 5). All compounds also induced apoptosis and caused G 2 /M arrest in MCF 7 cells (24 h); thus showing pro-apoptotic properties. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Biochemical and biophysical investigations of the interaction between human glucokinase and pro-apoptotic BAD.

    Science.gov (United States)

    Rexford, Alix; Zorio, Diego A R; Miller, Brian G

    2017-01-01

    The glycolytic enzyme glucokinase (GCK) and the pro-apoptotic protein BAD reportedly reside within a five-membered complex that localizes to the mitochondria of mammalian hepatocytes and pancreatic β-cells. Photochemical crosslinking studies using a synthetic analog of BAD's BH3 domain and in vitro transcription/translation experiments support a direct interaction between BAD and GCK. To investigate the biochemical and biophysical consequences of the BAD:GCK interaction, we developed a method for the production of recombinant human BAD. Consistent with published reports, recombinant BAD displays high affinity for Bcl-xL (KD = 7 nM), and phosphorylation of BAD at S118, within the BH3 domain, abolishes this interaction. Unexpectedly, we do not detect association of recombinant, full-length BAD with recombinant human pancreatic GCK over a range of protein concentrations using various biochemical methods including size-exclusion chromatography, chemical cross-linking, analytical ultracentrifugation, and isothermal titration calorimetry. Furthermore, fluorescence polarization assays and isothermal titration calorimetry detect no direct interaction between GCK and BAD BH3 peptides. Kinetic characterization of GCK in the presence of high concentrations of recombinant BAD show modest (BAD BH3 peptides. These results raise questions as to the mechanism of action of stapled peptide analogs modeled after the BAD BH3 domain, which reportedly enhance the Vmax value of GCK and stimulate insulin release in BAD-deficient islets. Based on our results, we postulate that the BAD:GCK interaction, and any resultant regulatory effect(s) upon GCK activity, requires the participation of additional members of the mitochondrial complex.

  17. Targeting proapoptotic protein BAD inhibits survival and self-renewal of cancer stem cells.

    Science.gov (United States)

    Sastry, K S R; Al-Muftah, M A; Li, Pu; Al-Kowari, M K; Wang, E; Ismail Chouchane, A; Kizhakayil, D; Kulik, G; Marincola, F M; Haoudi, A; Chouchane, L

    2014-12-01

    Emerging evidence suggests that the resistance of cancer stem cells (CSC) to many conventional therapies is one of the major limiting factors of cancer therapy efficacy. Identification of mechanisms responsible for survival and self-renewal of CSC will help design new therapeutic strategies that target and eliminate both differentiated cancer cells and CSC. Here we demonstrated the potential role of proapoptotic protein BAD in the biology of CSC in melanoma, prostate and breast cancers. We enriched CD44(+)/CD24(-) cells (CSC) by tumorosphere formation and purified this population by FACS. Both spheres and CSC exhibited increased potential for proliferation, migration, invasion, sphere formation, anchorage-independent growth, as well as upregulation of several stem cell-associated markers. We showed that the phosphorylation of BAD is essential for the survival of CSC. Conversely, ectopic expression of a phosphorylation-deficient mutant BAD induced apoptosis in CSC. This effect was enhanced by treatment with a BH3-mimetic, ABT-737. Both pharmacological agents that inhibit survival kinases and growth factors that are involved in drug resistance delivered their respective cytotoxic and protective effects by modulating the BAD phosphorylation in CSC. Furthermore, the frequency and self-renewal capacity of CSC was significantly reduced by knocking down the BAD expression. Consistent with our in vitro results, significant phosphorylation of BAD was found in CD44(+) CSC of 83% breast tumor specimens. In addition, we also identified a positive correlation between BAD expression and disease stage in prostate cancer, suggesting a role of BAD in tumor advancement. Our studies unveil the role of BAD in the survival and self-renewal of CSC and propose BAD not only as an attractive target for cancer therapy but also as a marker of tumor progression.

  18. Antiproliferative and proapoptotic effects of topotecan in combination with thymoquinone on acute myelogenous leukemia.

    Science.gov (United States)

    Khalife, Rana; El-Hayek, Stephany; Stephany, El-Hayek; Tarras, Omayr; Hodroj, Mohammad Hassan; Rizk, Sandra

    2014-09-01

    Topotecan has shown promising antineoplastic activity in solid tumors and acute leukemia. Because of the primary dose-limiting toxicity of topotecan, it is necessary to identify other agents that can work synergistically with topotecan, potentially increasing its efficacy while limiting its toxicity. Many studies showed synergism in combination of topotecan with gemcitabine and bortezomib. Other studies report the increase in growth inhibition of gemcitabine or oxaliplatin when cells were preexposed to naturally occurring drugs such as thymoquinone. The aim of this project was to study the mode of action of topotecan along with thymoquinone, on survival and apoptosis pathways in acute myelogenous leukemia (AML) cell lines, and to investigate the potential synergistic effect of thymoquinone on topotecan. U937 cells were incubated with different topotecan and thymoquinone concentrations for 24 and 48 hours, separately and in combination. Cell proliferation was determined using WST-1 (Roche) reagent. The effect of the compounds on protein expression of Bax, Bcl2, p53, caspase-9, -8, and -3 was determined using Western blot analysis. Cell cycle analysis was performed in addition to annexin/propidium iodide staining. Thymoquinone and topotecan exhibited antiproliferative effects on U937 cells when applied separately. In combination, the reduction in proliferation was extremely significant with a major increase in the expression levels of Bax/Bcl2, p53, and caspase-3 and -9. Preexposure with thymoquinone resulted in an increase in cell growth inhibition compared with topotecan treatment. Thymoquinone, when combined with topotecan in noncytotoxic doses, produced synergistic antiproliferative and proapoptotic effects in AML cells. Preexposure to thymoquinone seems to be more effective than simultaneous application with topotecan. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Irigenin sensitizes TRAIL-induced apoptosis via enhancing pro-apoptotic molecules in gastric cancer cells.

    Science.gov (United States)

    Xu, Ying; Gao, Cheng-Cheng; Pan, Zhen-Guo; Zhou, Chuan-Wen

    2018-02-12

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) holds promising value for cancer therapy due to its capacity to induce apoptosis in cancer cells. Nevertheless, TRAIL therapy is greatly hampered by its resistance. Irigenin (Iri), isoflavonoids, can be isolated from the rhizome of Belamcanda chinensis, and has been shown anti-cancer properties. In this study, we explored if Iri could enhance TRAIL-regulated apoptosis in TRAIL resistant gastric cancer cells. Iri significantly potentiated TRAIL-triggered cytotoxicity. Iri alone and TRAIL alone showed no effective role in apoptosis induction, whereas combined treatment with Iri and TRAIL markedly induced apoptosis in cancer cells, as evidenced by the up-regulation of cleaved Caspase-8/-9/-3 and PARP. Additionally, the sensitization to TRAIL was along with the enhancement of pro-apoptotic proteins, including FAS-associated protein with death domain (FADD), death receptor 5 (DR5) and Bax. And suppressing FADD, DR5 and Bax by si RNA significantly reduced the apoptosis and enhanced the cell viability induced by the co-application of Iri and TRAIL. Moreover, the sensitization to TRAIL was accompanied by the decrease of Cellular-FLICE inhibitory protein (c-FLIP), Bcl-2 and Survivin. Additionally, Iri could sensitize TRAIL to produce reactive oxygen species (ROS). Pre-treatment of N-acetyl-cysteine (NAC), ROS scavenger, attenuated Iri plus TRAIL-induced apoptosis and improved cell viability. Finally, combination of Iri and TRAIL inhibited tumor growth in the xenograft model. Collectively, our present study gave new insights into the effects of Iri on potentiating TRAIL-sensitivity, and suggested that Iri could be a potential candidate for sensitizer of TRAIL-resistant cancer cell treatment. Copyright © 2018. Published by Elsevier Inc.

  20. The proapoptotic influenza A virus protein PB1-F2 forms a nonselective ion channel.

    Directory of Open Access Journals (Sweden)

    Michael Henkel

    2010-06-01

    Full Text Available PB1-F2 is a proapoptotic influenza A virus protein of approximately 90 amino acids in length that is located in the nucleus, cytosol and in the mitochondria membrane of infected cells. Previous studies indicated that the molecule destabilizes planar lipid bilayers and has a strong inherent tendency for multimerization. This may be correlate with its capacity to induce mitochondrial membrane depolarization.Here, we investigated whether PB1-F2 is able to form ion channels within planar lipid bilayers and microsomes. For that purpose, a set of biologically active synthetic versions of PB1-F2 (sPB1-F2 derived from the IAV isolates A/Puerto Rico/8/34(H1N1 (IAV(PR8, from A/Brevig Mission/1/1918(H1N1 (IAV(SF2 or the H5N1 consensus sequence (IAV(BF2 were used. Electrical and fluorimetric measurements show that all three peptides generate in planar lipid bilayers or in liposomes, respectively, a barely selective conductance that is associated with stochastic channel type fluctuations between a closed state and at least two defined open states. Unitary channel fluctuations were also generated when a truncated protein comprising only the 37 c-terminal amino acids of sPB1-F2 was reconstituted in bilayers. Experiments were complemented by extensive molecular dynamics simulations of the truncated fragment in a lipid bilayer. The results indicate that the c-terminal region exhibits a slightly bent helical fold, which is stable and remains embedded in the bilayer for over 180 ns.The data support the idea that PB1-F2 is able to form protein channel pores with no appreciable selectivity in membranes and that the c-terminus is important for this function. This information could be important for drug development.

  1. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  2. Homozygous Deletions and Recurrent Amplifications Implicate New Genes Involved in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Wennuan Liu

    2008-08-01

    Full Text Available Prostate cancer cell lines provide ideal in vitro systems for the identification and analysis of prostate tumor suppressors and oncogenes. A detailed characterization of the architecture of prostate cancer cell line genomes would facilitate the study of precise roles of various genes in prostate tumorigenesis in general. To contribute to such a characterization, we used the GeneChip 500K single nucleotide polymorphic (SNP array for analysis of genotypes and relative DNA copy number changes across the genome of 11 cell lines derived from both normal and cancerous prostate tissues. For comparison purposes, we also examined the alterations observed in the cell lines in tumor/normal pairs of clinical samples from 72 patients. Along with genome-wide maps of DNA copy number changes and loss of heterozygosity for these cell lines, we report previously unreported homozygous deletions and recurrent amplifications in prostate cancers in this study. The homozygous deletions affected a number of biologically important genes, including PPP2R2A and BNIP3L identified in this study and CDKN2A/CDKN2B reported previously. Although most amplified genomic regions tended to be large, amplifications at 8q24.21 were of particular interest because the affected regions are relatively small, are found in multiple cell lines, are located near MYC, an oncogene strongly implicated in prostate tumorigenesis, and are known to harbor SNPs that are associated with inherited susceptibility for prostate cancer. The genomic alterations revealed in this study provide an important catalog of positional information relevant to efforts aimed at deciphering the molecular genetic basis of prostate cancer.

  3. Design and synthesis of thienopyrimidine urea derivatives with potential cytotoxic and pro-apoptotic activity against breast cancer cell line MCF-7.

    Science.gov (United States)

    Abdelhaleem, Eman F; Abdelhameid, Mohammed K; Kassab, Asmaa E; Kandeel, Manal M

    2018-01-01

    A series of novel tetrahydrobenzothieno[2,3-d]pyrimidine urea derivatives was synthesized according to fragment-based design strategy. They were evaluated for their anticancer activity against MCF-7 cell line. Three compounds 9c, 9d and 11b showed 1.5-1.03 folds more potent anticancer activity than doxorubicin. In this study, a promising multi-sited enzyme small molecule inhibitor 9c, which showed the most potent anti-proliferative activity, was identified. The anti-proliferative activity of this compound appears to correlate well with its ability to inhibit topoisomerase II (IC 50  = 9.29 μM). Moreover, compound 9c showed excellent VEGFR-2 inhibitory activity, at the sub-micromolar level with IC 50 value 0.2 μM, which is 2.1 folds more potent than sorafenib. Moreover, activation of damage response pathway of the DNA leads to cell cycle arrest at G2/M phase, accumulation of cells in pre-G1 phase and annexin-V and propidium iodide staining, indicating that cell death proceeds through an apoptotic mechanism. Compound 9c showed potent pro-apoptotic effect through induction of the intrinsic mitochondrial pathway of apoptosis. This mechanistic pathway was confirmed by a significant increase in the expression of the tumor suppressor gene p53, elevation in Bax/BCL-2 ratio and a significant increase in the level of active caspase-3. Quantitative structure-activity relationship (QSAR) studies delivered equations of five 3D descriptors with R 2  = 0.814. This QSAR model provides an effective technique for understanding the observed antitumor properties and thus could be adopted for developing effective lead structures. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. The effect of octreotide and bromocriptine on expression of a pro-apoptotic Bax protein in rat prolactinoma.

    Directory of Open Access Journals (Sweden)

    Jolanta Kunert-Radek

    2004-03-01

    Full Text Available It is well established that disruption of apoptosis may lead to tumor initiation, progression or metastasis. It is also well documented that many anticancer drugs induce apoptosis. In the earlier studies, the dopamine D2 receptor agonist bromocriptine (BC and somatostatin analog octreotide (OCT were found to inhibit the growth of the estrogen-induced rat prolactinoma. Our previous investigations, applying the TUNEL method showed the involvement of the pro-apoptotic effect in the action of BC, and to a lesser degree, in the action of OCT. The aim of the present study was to investigate whether the pro-apoptotic action of these drugs involves the increased expression of Bax--a member of Bcl-2 protein family which is known to play an important role in the regulation of apoptosis. Male four-week Fisher 344 rats were used in the experiment. Capsules containing diethylstilboestrol (DES were implanted subcutaneously. Six weeks after the implantation the rats were given OCT (2 x 25 microg/animal/24, BC (3 mg/kg b.w./24 h or OCT and BC at the above doses for 10 days. Bax expression was detected by immunohistochemistry. Prolactin (PRL in blood serum was measured by radioimmunoassay (RIA. It has been found that both OCT and BC, alone or in combination, significantly reduce the tumor weight. Both OCT and BC suppressed PRL levels, but the inhibitory effect of BC was stronger than that of OCT. It has been found that the treatment with OCT and BC, alone or in combination, causes a significant increase in Bax expression in the rat prolactinoma cells. Our findings indicate that anti-tumoral action of bromocriptine and to some extent the action of octreotide in the experimental rat prolactinoma is connected with the induction of apoptosis and is associated with increased Bax expression.

  5. Gene expression in mdx mouse muscle in relation to age and exercise: aberrant mechanical-metabolic coupling and implications for pre-clinical studies in Duchenne muscular dystrophy.

    Science.gov (United States)

    Camerino, Giulia Maria; Cannone, Maria; Giustino, Arcangela; Massari, Ada Maria; Capogrosso, Roberta Francesca; Cozzoli, Anna; De Luca, Annamaria

    2014-11-01

    Weakness and fatigability are typical features of Duchenne muscular dystrophy patients and are aggravated in dystrophic mdx mice by chronic treadmill exercise. Mechanical activity modulates gene expression and muscle plasticity. Here, we investigated the outcome of 4 (T4, 8 weeks of age) and 12 (T12, 16 weeks of age) weeks of either exercise or cage-based activity on a large set of genes in the gastrocnemius muscle of mdx and wild-type (WT) mice using quantitative real-time PCR. Basal expression of the exercise-sensitive genes peroxisome-proliferator receptor γ coactivator 1α (Pgc-1α) and Sirtuin1 (Sirt1) was higher in mdx versus WT mice at both ages. Exercise increased Pgc-1α expression in WT mice; Pgc-1α was downregulated by T12 exercise in mdx muscles, along with Sirt1, Pparγ and the autophagy marker Bnip3. Sixteen weeks old mdx mice showed a basal overexpression of the slow Mhc1 isoform and Serca2; T12 exercise fully contrasted this basal adaptation as well as the high expression of follistatin and myogenin. Conversely, T12 exercise was ineffective in WT mice. Damage-related genes such as gp91-phox (NADPH-oxidase2), Tgfβ, Tnfα and c-Src tyrosine kinase were overexpressed in mdx muscles and not affected by exercise. Likewise, the anti-inflammatory adiponectin was lower in T12-exercised mdx muscles. Chronic exercise with minor adaptive effects in WT muscles leads to maladaptation in mdx muscles with a disequilibrium between protective and damaging signals. Increased understanding of the pathways involved in the altered mechanical-metabolic coupling may help guide appropriate physical therapies while better addressing pharmacological interventions in translational research. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Endoplasmic Reticulum Stress Induces the Early Appearance of Pro-apoptotic and Anti-apoptotic Proteins in Neurons of Five Familial Alzheimer′s Disease Mice

    Directory of Open Access Journals (Sweden)

    Hui Shen

    2016-01-01

    Conclusions: These findings suggest that compared with those of age-matched WT mice, ERS-associated pro-apoptotic and anti-apoptotic proteins are upregulated in 2-month-old 5×FAD mice, consistent with intracellular Aβ aggregation in neurons.

  7. Pro-apoptotic Effect of Pifithrin-α on Preimplantation Porcine Fertilized Embryo Development

    Directory of Open Access Journals (Sweden)

    Brendan Mulligan

    2012-12-01

    Full Text Available The aim of this study was to investigate the impact of a reported p53 inhibitor, pifithrin-α (PFT-α, on preimplantation porcine in vitro fertilized (IVF embryo development in culture. Treatment of PFT-α was administered at both early (0 to 48 hpi, and later stages (48 to 168 hpi of preimplantation development, and its impact upon the expression of five genes related to apoptosis (p53, bak, bcl-xL, p66Shc and caspase3, was assessed in resulting d 7 blastocysts, using real-time quantitative PCR. Total cell numbers, along with the number of apoptotic nuclei, as detected by the in situ cell death detection assay, were also calculated on d 7 in treated and non-treated control embryos. The results indicate that PFT-α, when administered at both early and later stages of porcine IVF embryo development, increases the incidence of apoptosis in resulting blastocysts. When administered at early cleavage stages, PFT-α treatment was shown to reduce the developmental competence of porcine IVF embryos, as well as reducing the quality of resulting blastocysts in terms of overall cell numbers. In contrast, at later stages, PFT-α administration resulted in marginally increased blastocyst development rates amongst treated embryos, but did not affect cell numbers. However, PFT-α treatment induced apoptosis and apoptotic related gene expression, in all treated embryos, irrespective of the timing of treatment. Our results indicate that PFT-α may severely compromise the developmental potential of porcine IVF embryos, and is a potent apoptotic agent when placed into porcine embryo culture media. Thus, caution should be exercised when using PFT-α as a specific inhibitor of p53 mediated apoptosis, in the context of porcine IVF embryo culture systems.

  8. P53-dependent antiproliferative and pro-apoptotic effects of trichostatin A (TSA) in glioblastoma cells.

    Science.gov (United States)

    Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R

    2012-05-01

    Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.

  9. Bioactives in cactus (Opuntia ficus-indica) stems possess potent antioxidant and pro-apoptotic activities through COX-2 involvement.

    Science.gov (United States)

    Kim, Jinhee; Soh, Soon Yil; Shin, Juha; Cho, Chi-Woung; Choi, Young Hee; Nam, Sang-Yong

    2015-10-01

    Bioactives extracted from cactus (Opuntia ficus-indica) stems were investigated for their chemopreventive activities using human cancer cells in vitro. The bioactives present in crude extracts were detected and quantified using high-performance liquid chromatography. Among all the extracts, such as hexane, ethyl acetate (EtOAc), acetone, methanol (MeOH), and MeOH:water (80:20), the MeOH extract had the highest amount of polyphenolic compounds and the acetone extract exhibited the most potent effect at scavenging the 2,2,-diphenyl-1-picrylhydrazyl (DPPH) and 2,2'-azino-di-(3-ethylbenzothiazoline)-6-sulfonic acid (ABTS(•+) ) radical. In addition, most of the extracts, with the exception of hexane, exhibited significant cytotoxicity in human SW480 colon and MCF7 breast cancer cells. Overall, the SW480 cells were more sensitive than the MCF7 cells to the cytotoxic effect of the O. ficus-indica extracts (OFEs). Cell death by OFE treatment caused significant inhibition of cyclooxygenase-2 and increased the Bax/Bcl2 ratio in both SW480 and MCF7 cell lines. However, degradation of poly (ADP-ribose) polymerase was significantly increased by OFE only in the MCF7 cells, thereby inducing apoptosis. These findings demonstrate the health-benefit roles, including anti-oxidative and anti-proliferative activities as well as pro-apoptotic effects, of bioactive compounds in OFEs, suggesting a chemopreventive role in human cancer cells. © 2014 Society of Chemical Industry.

  10. Antiproliferative and Pro-Apoptotic Effect of Novel Nitro-Substituted Hydroxynaphthanilides on Human Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Tereza Kauerova

    2016-07-01

    Full Text Available Ring-substituted hydroxynaphthanilides are considered as cyclic analogues of salicylanilides, compounds possessing a wide range of pharmacological activities, including promising anticancer properties. The aim of this study was to evaluate the potential anticancer effect of novel nitro-substituted hydroxynaphthanilides with a special focus on structure-activity relationships. The antiproliferative effect was assessed by Water Soluble Tetrazolium Salts-1 (WST-1 assay, and cytotoxicity was evaluated via dye exclusion test. Flow cytometry was used for cell cycle analysis and detection of apoptosis using Annexin V-FITC/PI assay. Protein expression was estimated by Western blotting. Our data indicate that the potential to cause the antiproliferative effect increases with the shift of the nitro substituent from the ortho- to the para-position. The most potent compounds, 3-hydroxy-N-(3-nitrophenylnaphthalene-2-carboxamide (2, and 2-hydroxy-N-(4-nitrophenyl-naphthalene-1-carboxamide (6 showed antiproliferative activity against THP-1 and MCF-7 cancer cells without affecting the proliferation of 3T3-L1 non-tumour cells. Compounds 2 and 6 induced the accumulation of THP-1 and MCF-7 cells in G1 phase associated with the downregulation of cyclin E1 protein levels, while the levels of cyclin B1 were not affected. Moreover, compound 2 was found to exert the pro-apoptotic effect on the THP-1 cells. These results suggest that hydroxynaphthanilides might represent a potential model structure for the development of novel anticancer agents.

  11. Immunohistochemical expression study of proapoptotic BH3-only protein bad in canine nonneoplastic tissues and canine lymphomas.

    Science.gov (United States)

    Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F

    2013-09-01

    The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.

  12. Quantitative analysis of receptor-mediated uptake and pro-apoptotic activity of mistletoe lectin-1 by high content imaging.

    Science.gov (United States)

    Beztsinna, N; de Matos, M B C; Walther, J; Heyder, C; Hildebrandt, E; Leneweit, G; Mastrobattista, E; Kok, R J

    2018-02-09

    Ribosome inactivating proteins (RIPs) are highly potent cytotoxins that have potential as anticancer therapeutics. Mistletoe lectin 1 (ML1) is a heterodimeric cytotoxic protein isolated from European Mistletoe and belongs to RIP class II. The aim of this project was to systematically study ML1 cell binding, endocytosis pathway(s), subcellular processing and apoptosis activation. For this purpose, state of the art cell imaging equipment and automated image analysis algorithms were used. ML1 displayed very fast binding to sugar residues on the membrane and energy-dependent uptake in CT26 cells. The co-staining with specific antibodies and uptake blocking experiments revealed involvement of both clathrin-dependent and -independent pathways in ML1 endocytosis. Co-localization studies demonstrated the toxin transport from early endocytic vesicles to Golgi network; a retrograde road to the endoplasmic reticulum. The pro-apoptotic and antiproliferative activity of ML1 were shown in time lapse movies and subsequently quantified. ML1 cytotoxicity was less affected in multidrug resistant tumor cell line 4T1 in contrast to commonly used chemotherapeutic drug (ML1 resistance index 6.9 vs 13.4 for doxorubicin; IC 50 : ML1 1.4 ng/ml vs doxorubicin 24000 ng/ml). This opens new opportunities for the use of ML1 as an alternative treatment in multidrug resistant cancers.

  13. Butyrate-induced proapoptotic and antiangiogenic pathways in EAT cells require activation of CAD and downregulation of VEGF

    International Nuclear Information System (INIS)

    Belakavadi, Madesh; Prabhakar, B.T.; Salimath, Bharathi P.

    2005-01-01

    Butyrate, a short-chain fatty acid produced in the colon, induces cell cycle arrest, differentiation, and apoptosis in transformed cell lines. In this report, we study the effects of butyrate (BuA) on the growth of Ehrlich ascites tumor (EAT) cells in vivo. BuA, when injected intraperitoneally (i.p) into mice, inhibited proliferation of EAT cells. Further, induction of apoptosis in EAT cells was monitored by nuclear condensation, annexin-V staining, DNA fragmentation, and translocation of caspase-activated DNase into nucleus upon BuA-treatment. Ac-DEVD-CHO, a caspase-3 inhibitor, completely inhibited BuA-induced apoptosis, indicating that activation of caspase-3 mediates the apoptotic pathway in EAT cells. The proapoptotic effect of BuA also reflects on the antiangiogenic pathway in EAT cells. The antiangiogenic effect of BuA in vivo was demonstrated by the downregulation of the secretion of VEGF in EAT cells. CD31 immunohistochemical staining of peritoneum sections clearly indicated a potential angioinhibitory effect of BuA in EAT cells. These results suggest that BuA, besides regulating other fundamental cellular processes, is able to modulate the expression/secretion of the key angiogenic growth factor VEGF in EAT cells

  14. A novel assay for discovery and characterization of pro-apoptotic drugs and for monitoring apoptosis in patient sera.

    Science.gov (United States)

    Bivén, K; Erdal, H; Hägg, M; Ueno, T; Zhou, R; Lynch, M; Rowley, B; Wood, J; Zhang, C; Toi, M; Shoshan, M C; Linder, S

    2003-06-01

    We have developed an apoptosis assay based on measurement of a neoepitope of cytokeratin-18 (CK18-Asp396) exposed after caspase-cleavage and detected by the monoclonal antibody M30. The total amount of caspase-cleaved CK18 which has accumulated in cells and tissue culture media during apoptosis is measured by ELISA. The sensitivity is sufficient for use in the 96-well format to allow high-through-put screening of drug libraries. We here describe strategies allowing classification of pro-apoptotic compounds according to their profiles of induction of apoptosis in the presence of pharmacological inhibitors. The time course of induction of CK18 cleavage can furthermore be used to distinguish structurally similar compounds. We propose that compounds that induce rapid CK18 cleavage have mechanisms of actions distinct from conventional genotoxic and microtubuli-targeting agents, and we present one example of an agent that induces almost immediate mitochondrial depolarization and cytochrome c release. Finally, CK18-Asp396 cleavage products are released from cells in tissue culture, and presumably from tumor cells in vivo. These products can be measured in sera from cancer patients. We present evidence suggesting that it will be possible to use the M30-ELISA assay for measuring chemotherapy-induced apoptosis in patient sera, opening possibilities for monitoring therapy.

  15. Meningococcal adhesion suppresses proapoptotic gene expression and promotes expression of genes supporting early embryonic and cytoprotective signaling of human endothelial cells

    Czech Academy of Sciences Publication Activity Database

    Linhartová, Irena; Basler, Marek; Ichikawa, J.; Pelicic, V.; Osička, Radim; Lory, S.; Nassif, X.; Šebo, Peter

    2006-01-01

    Roč. 263, - (2006), s. 109-118 ISSN 0378-1097 R&D Projects: GA ČR GA310/06/0720 Institutional research plan: CEZ:AV0Z50200510 Keywords : neisseria meningitidis * adherence * signaling Subject RIV: EE - Microbiology, Virology Impact factor: 2.068, year: 2006

  16. Cambogin exerts anti-proliferative and pro-apoptotic effects on breast adenocarcinoma through the induction of NADPH oxidase 1 and the alteration of mitochondrial morphology and dynamics.

    Science.gov (United States)

    Shen, Kaikai; Lu, Fangfang; Xie, Jianling; Wu, Minfeng; Cai, Bo; Liu, Yurong; Zhang, Hong; Tan, Hongsheng; Pan, Yingyi; Xu, Hongxi

    2016-08-02

    Cambogin, a bioactive polycyclic polyprenylated acylphoroglucinol (PPAP) derived from the Garcinia genus, possesses proapoptotic effect in medulloblastoma and breast cancer cells. We have previously demonstrated that the proapoptotic effect of cambogin is driven by the production of reactive oxygen species (ROS). Here we have shown that the inhibitory effect of cambogin on cell proliferation is associated with the loss of mitochondrial transmembrane potential (ΔΨm) and mitochondrial fragmentation. Cambogin also promotes the mutual complex formation of the membrane-bound subunit p22phox of NADPH oxidase 1 (NOX1), as well as the phosphorylation of the cytosolic subunit p47phox, subsequently enhancing membrane-bound NOX1 activity, which leads to increases in intracellular and mitochondrial levels of O2.- and H2O2. Pharmacological inhibition of NOX1 using apocynin (pan-NOX inhibitor), ML171 (NOX1 inhibitor) or siRNA against NOX1 prevents the increases in O2.- and H2O2 levels and the anti-proliferative effect of cambogin. Antioxidants, including SOD (superoxide dismutase), CAT (catalase) and EUK-8, are also able to restore cell viability in the presence of cambogin. Besides, cambogin increases the dissociation of thioredoxin-1 (Trx1) from ASK1, switching the inactive form of ASK1 to the active kinase, subsequently leads to the phosphorylation of JNK/SAPK, which is abolished upon ML171 treatment. The proapoptotic effect of cambogin in breast cancer cells is also aggravated upon knocking down Trx1 in MCF-7 cells. Taken in conjunction, these data indicate that the anti-proliferative and pro-apoptotic effect of cambogin is mediated via inducing NOX1-dependent ROS production and the dissociation of ASK1 and Trx1.

  17. Cytotoxic, Antiproliferative and Pro-Apoptotic Effects of 5-Hydroxyl-6,7,3′,4′,5′-Pentamethoxyflavone Isolated from Lantana ukambensis

    Directory of Open Access Journals (Sweden)

    Wamtinga Richard Sawadogo

    2015-12-01

    Full Text Available Lantana ukambensis (Vatke Verdc. is an African food and medicinal plant. Its red fruits are eaten and highly appreciated by the rural population. This plant was extensively used in African folk medicinal traditions to treat chronic wounds but also as anti-leishmanial or cytotoxic remedies, especially in Burkina Faso, Tanzania, Kenya, or Ethiopia. This study investigates the in vitro bioactivity of polymethoxyflavones extracted from a L. ukambensis as anti-proliferative and pro-apoptotic agents. We isolated two known polymethoxyflavones, 5,6,7,3′,4′,5′-hexamethoxyflavone (1 and 5-hydroxy-6,7,3′,4′,5′-pentamethoxyflavone (2 from the whole plant of L. ukambensis. Their chemical structures were determined by spectroscopic analysis and comparison with published data. These molecules were tested for the anti-proliferative, cytotoxic and pro-apoptotic effects on human cancer cells. Among them, 5-hydroxy-6,7,3′,4′,5′-pentamethoxyflavone (2 was selectively cytotoxic against monocytic lymphoma (U937, acute T cell leukemia (Jurkat, and chronic myelogenous leukemia (K562 cell lines, but not against peripheral blood mononuclear cells (PBMCs from healthy donors, at all tested concentrations. Moreover, this compound exhibited significant anti-proliferative and pro-apoptotic effects against U937 acute myelogenous leukemia cells. This study highlights the anti-proliferative and pro-apoptotic effects of 5-hydroxy-6,7,3′,4′,5′-pentamethoxyflavone (2 and provides a scientific basis of traditional use of L. ukambensis.

  18. Downregulation of the proapoptotic protein MOAP-1 by the UBR5 ubiquitin ligase and its role in ovarian cancer resistance to cisplatin

    OpenAIRE

    Matsuura, K; Huang, N-J; Cocce, K; Zhang, L; Kornbluth, S

    2016-01-01

    Evasion of apoptosis allows many cancers to resist chemotherapy. Apoptosis is mediated by the serial activation of caspase family proteins. These proteases are often activated upon the release of cytochrome c from the mitochondria, which is promoted by the proapoptotic Bcl-2 family protein, Bax. This function of Bax is enhanced by the MOAP-1 (modulator of apoptosis protein 1) protein in response to DNA damage. Previously, we reported that MOAP-1 is targeted for ubiquitylation and degradation ...

  19. Cytotoxic and Pro-Apoptotic Effects of Honey Bee Venom and Chrysin on Human Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Elaheh Amini

    2015-06-01

    Full Text Available Background: The anti-cancer effects of honey bee venom (BV and chrysin might open a new window for treatment of chemo-resistant cancers. This study was designed to evaluate cytotoxic and pro-apoptotic effects of BV and chrysin on A2780cp cistplatin- resistant human ovarian cancer cells. Methods: As per the study objectives, A2780cp cells were categorized to 4 groups: 3 experiment groups (treated either with BV or chrysin or BV + chrysin and 1 control group (untreated cells.  Experiment group cells were cultured and treated by different concentrations of BV and chrysin for 24 hours. Then, experiment and control cells were studied with MTT assay, Annexin V-FITC, DAPI and Acridine Orange / Propidium Iodide statining, flow cytometry, caspase-3 and -9 assay, measurement of intracellular level of reactive oxygen species (ROS and RT-PCR. Results: MTT assay showed that 8 μg/mL BV, 40 µg/ml chrysin and 6 + 15 μg/mL BV + chrysin co-treatment induced 50% cell death on A2780cp cells compared with controls (P < 0.001. Morphological observations by inverted and fluorescent microscopy revealed ROS generation and apoptotic cell death under exposure to BV or chrysin or BV + chrysin co-treatment. Caspase-3 and -9 assay demonstrated that BV and chrysin triggered apoptosis through intrinsic pathway and RT-PCR demonstrated down-regulation of Bcl-2. Conclusion: Honey bee venom and chrysin are effective for destroying chemoresistant ovarian cancer cells through activation of intrinsic apoptosis, which propose them as potential candidates to be used in development of improved chemotherapeutic agents in the future.

  20. Non-THC cannabinoids inhibit prostate carcinoma growth in vitro and in vivo: pro-apoptotic effects and underlying mechanisms.

    Science.gov (United States)

    De Petrocellis, Luciano; Ligresti, Alessia; Schiano Moriello, Aniello; Iappelli, Mariagrazia; Verde, Roberta; Stott, Colin G; Cristino, Luigia; Orlando, Pierangelo; Di Marzo, Vincenzo

    2013-01-01

    Cannabinoid receptor activation induces prostate carcinoma cell (PCC) apoptosis, but cannabinoids other than Δ(9) -tetrahydrocannabinol (THC), which lack potency at cannabinoid receptors, have not been investigated. Some of these compounds antagonize transient receptor potential melastatin type-8 (TRPM8) channels, the expression of which is necessary for androgen receptor (AR)-dependent PCC survival. We tested pure cannabinoids and extracts from Cannabis strains enriched in particular cannabinoids (BDS), on AR-positive (LNCaP and 22RV1) and -negative (DU-145 and PC-3) cells, by evaluating cell viability (MTT test), cell cycle arrest and apoptosis induction, by FACS scans, caspase 3/7 assays, DNA fragmentation and TUNEL, and size of xenograft tumours induced by LNCaP and DU-145 cells. Cannabidiol (CBD) significantly inhibited cell viability. Other compounds became effective in cells deprived of serum for 24 h. Several BDS were more potent than the pure compounds in the presence of serum. CBD-BDS (i.p.) potentiated the effects of bicalutamide and docetaxel against LNCaP and DU-145 xenograft tumours and, given alone, reduced LNCaP xenograft size. CBD (1-10 µM) induced apoptosis and induced markers of intrinsic apoptotic pathways (PUMA and CHOP expression and intracellular Ca(2+)). In LNCaP cells, the pro-apoptotic effect of CBD was only partly due to TRPM8 antagonism and was accompanied by down-regulation of AR, p53 activation and elevation of reactive oxygen species. LNCaP cells differentiated to androgen-insensitive neuroendocrine-like cells were more sensitive to CBD-induced apoptosis. These data support the clinical testing of CBD against prostate carcinoma. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

  1. EFP1 is an ER stress-induced glycoprotein which interacts with the pro-apoptotic protein Par-4

    Directory of Open Access Journals (Sweden)

    Sarah Appel

    2009-05-01

    Full Text Available Sarah Appel1,2,6, Susanne Vetterkind1,2,6, Ansgar Koplin1,3, Barbara Maertens1,4, Meike Boosen1,5, Ute Preuss11The Institute of Genetics, University of Bonn, Bonn, Germany; 2Department of Health Sciences, Sargent College of Health and Rehabilitation Sciences, Boston University, Boston, MA, USA; 3Center for Molecular Biology Heidelberg (ZMBH, Heidelberg, Germany; 4Institute of Biochemistry II, University of Cologne, Cologne, Germany; 5Institute of Pharmacology and Toxicology, University Hospital of Johann Wolfgang Goethe-University Frankfurt am Main, Frankfurt am Main, Germany; 6These authors contributed equally to this work.Abstract: We have isolated the rat ortholog of EFP1 (EF-hand binding protein 1 as a novel interaction partner of the pro-apoptotic protein Par-4 (prostate apoptosis response-4. Rat EFP1 contains two thioredoxin domains, the COOH-terminal one harboring a CGFC motif, and has a similar protein domain structure as members of the protein disulfide isomerase (PDI family. In REF52.2 and CHO cells, EFP1 colocalized with the endoplasmic reticulum (ER marker PDI. Furthermore, EFP1 possesses catalytic activity as demonstrated by an insulin disulfide reduction assay. Western blot analysis revealed two EFP1 protein bands of approximately 136 and 155 kDa, representing different glycosylation states of the protein. Complex formation between EFP1 and Par-4 was confirmed in vitro and in vivo by co-immunoprecipitation, dot blot overlay and pull-down experiments. In CHO cells, coexpression of EFP1 and Par-4 resulted in enhanced Par-4-mediated apoptosis, which required the catalytic activity of EFP1. Interestingly, EFP1 was specifically upregulated in NIH3T3 cells after induction of ER stress by thapsigargin, tunicamycin, and brefeldin A, but not by agents that induce oxidative stress or ER-independent apoptosis. Furthermore, we could show that the induction of apoptosis by Ca2+ stress-inducing agents was significantly decreased after si

  2. Proapoptotic activity of Ukrain is based on Chelidonium majus L. alkaloids and mediated via a mitochondrial death pathway

    International Nuclear Information System (INIS)

    Habermehl, Daniel; Belka, Claus; Jendrossek, Verena; Kammerer, Bernd; Handrick, René; Eldh, Therese; Gruber, Charlotte; Cordes, Nils; Daniel, Peter T; Plasswilm, Ludwig; Bamberg, Michael

    2006-01-01

    majus L. alkaloids chelidonine, sanguinarine, chelerythrine, protopine and allocryptopine were identified as major components of Ukrain. Apart from sanguinarine and chelerythrine, chelidonine turned out to be a potent inducer of apoptosis triggering cell death at concentrations of 0.001 mM, while protopine and allocryptopine were less effective. Similar to Ukrain, apoptosis signalling of chelidonine involved Bcl-2 controlled mitochondrial alterations and caspase-activation. The potent proapoptotic effects of Ukrain are not due to the suggested 'Ukrain-molecule' but to the cytotoxic efficacy of Chelidonium majus L. alkaloids including chelidonine

  3. β3 integrin promotes chemoresistance to epirubicin in MDA-MB-231 through repression of the pro-apoptotic protein, BAD

    Energy Technology Data Exchange (ETDEWEB)

    Nair, Madhumathy G.; Desai, Krisha; Prabhu, Jyothi S.; Hari, P.S.; Remacle, Jose; Sridhar, T.S., E-mail: tssridhar@sjri.res.in

    2016-08-01

    Resistance to anthracycline based chemotherapy is a major limitation in the treatment of breast cancer, particularly of the triple negative sub-type that lacks targeted therapies. Resistance that arises from tumor-stromal interaction facilitated by integrins provides the possibility of targeted disruption. In the present study, we demonstrate that integrin β3 signaling inhibits apoptosis induced by a DNA-damaging chemotherapeutic agent, epirubicin, in MDA-MB-231 breast cancer cells. Drug efflux based mechanisms do not contribute to this effect. We show that integrin β3 employs the PI3K-Akt and the MAPK pathway for enabling cell survival and proliferation. Further, our results indicate that integrin β3 helps inhibit epirubicin induced cytotoxicity by repression of the pro-apoptotic protein BAD, thus promoting an anti-apoptotic response. Myristoylated RGT peptide and a monoclonal antibody against integrin β3 brought about a reversal of this effect and chemosensitized the cells. These results identify β3 integrin signaling via repression of BAD as an important survival pathway used by breast cancer cells to evade chemotherapy induced stress. - Highlights: • Integrin β3 signaling promotes chemoresistance to epirubicin in breast cancer cells. • Integrin β3 promotes cell survival and proliferation in drug treated cells through the PI3K and MAPK pathways. • Integrin signaling helps evade drug induced cytotoxicity by repression of pro-apoptotic molecule; BAD.

  4. The chemopreventive action of bromelain, from pineapple stem (Ananas comosus L.), on colon carcinogenesis is related to antiproliferative and proapoptotic effects.

    Science.gov (United States)

    Romano, Barbara; Fasolino, Ines; Pagano, Ester; Capasso, Raffaele; Pace, Simona; De Rosa, Giuseppe; Milic, Natasa; Orlando, Pierangelo; Izzo, Angelo A; Borrelli, Francesca

    2014-03-01

    Colorectal cancer is an important health problem across the world. Here, we investigated the possible antiproliferative/proapoptotic effects of bromelain (from the pineapple stem Ananas comosus L., family Bromeliaceae) in a human colorectal carcinoma cell line and its potential chemopreventive effect in a murine model of colon cancer. Proliferation and apoptosis were evaluated in human colon adenocarcinoma (Caco-2) cells by the (3) H-thymidine incorporation assay and caspase 3/7 activity measurement, respectively. Extracellular signal-related kinase (ERK) and Akt expression were evaluated by Western blot analysis, reactive oxygen species production by a fluorimetric method. In vivo, bromelain was evaluated using the azoxymethane murine model of colon carcinogenesis. Bromelain reduced cell proliferation and promoted apoptosis in Caco-2 cells. The effect of bromelain was associated to downregulation of pERK1/2/total, ERK, and pAkt/Akt expression as well as to reduction of reactive oxygen species production. In vivo, bromelain reduced the development of aberrant crypt foci, polyps, and tumors induced by azoxymethane. Bromelain exerts antiproliferative and proapoptotic effects in colorectal carcinoma cells and chemopreventive actions in colon carcinogenesis in vivo. Bromelain-containing foods and/or bromelain itself may represent good candidates for colorectal cancer chemoprevention. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B-Treated Cervical Cancer HeLa Cells.

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2017-09-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H 2 O 2 -induced cell death is via neutralization of reactive oxygen species.

  6. Gene Expression Analysis Reveals the Concurrent Activation of Proapoptotic and Antioxidant-Defensive Mechanisms in Flavokawain B–Treated Cervical Cancer HeLa Cells

    Science.gov (United States)

    Yeap, Swee Keong; Abu, Nadiah; Akthar, Nadeem; Ho, Wan Yong; Ky, Huynh; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Kamarul, Tunku

    2016-01-01

    Flavokawain B (FKB) is known to possess promising anticancer abilities. This is demonstrated in various cancer cell lines including HeLa cells. Cervical cancer is among the most widely diagnosed cancer among women today. Though FKB has been shown to be effective in treating cancer cells, the exact molecular mechanism is still unknown. This study is aimed at understanding the effects of FKB on HeLa cells using a microarray-based mRNA expression profiling and proteome profiling of stress-related proteins. The results of this study suggest that FKB induced cell death through p21-mediated cell cycle arrest and activation of p38. However, concurrent activation of antioxidant-related pathways and iron sequestration pathway followed by activation of ER-resident stress proteins clearly indicate that FKB failed to induce apoptosis in HeLa cells via oxidative stress. This effect implies that the protection of HeLa cells by FKB from H2O2–induced cell death is via neutralization of reactive oxygen species. PMID:27458249

  7. Functional Consequences of Intracellular Proline Levels Manipulation Affecting PRODH/POX-Dependent Pro-Apoptotic Pathways in a Novel in Vitro Cell Culture Model.

    Science.gov (United States)

    Zareba, Ilona; Surazynski, Arkadiusz; Chrusciel, Marcin; Miltyk, Wojciech; Doroszko, Milena; Rahman, Nafis; Palka, Jerzy

    2017-01-01

    The effect of impaired intracellular proline availability for proline dehydrogenase/proline oxidase (PRODH/POX)-dependent apoptosis was studied. We generated a constitutively knocked-down PRODH/POX MCF-7 breast cancer cell line (MCF-7shPRODH/POX) as a model to analyze the functional consequences of impaired intracellular proline levels. We have used inhibitor of proline utilization in collagen biosynthesis, 2-metoxyestradiol (MOE), inhibitor of prolidase that generate proline, rapamycin (Rap) and glycyl-proline (GlyPro), substrate for prolidase. Collagen and DNA biosynthesis were evaluated by radiometric assays. Cell viability was determined using Nucleo-Counter NC-3000. The activity of prolidase was determined by colorimetric assay. Expression of proteins was assessed by Western blot and immunofluorescence bioimaging. Concentration of proline was analyzed by liquid chromatography with mass spectrometry. PRODH/POX knockdown decreased DNA and collagen biosynthesis, whereas increased prolidase activity and intracellular proline level in MCF-7shPRODH/POX cells. All studied compounds decreased cell viability in MCF-7 and MCF-7shPRODH/POX cells. DNA biosynthesis was similarly inhibited by Rap and MOE in both cell lines, but GlyPro inhibited the process only in MCF-7shPRODH/POX and MOE+GlyPro only in MCF-7 cells. All the compounds inhibited collagen biosynthesis, increased prolidase activity and cytoplasmic proline level in MCF-7shPRODH/POX cells and contributed to the induction of pro-survival mode only in MCF-7shPRODH/POX cells. In contrast, all studied compounds upregulated expression of pro-apoptotic protein only in MCF-7 cells. PRODH/POX was confirmed as a driver of apoptosis and proved the eligibility of MCF-7shPRODH/POX cell line as a highly effective model to elucidate the different mechanisms underlying proline utilization or generation in PRODH/POX-dependent pro-apoptotic pathways. © 2017 The Author(s). Published by S. Karger AG, Basel.

  8. Downregulation of the proapoptotic protein MOAP-1 by the UBR5 ubiquitin ligase and its role in ovarian cancer resistance to cisplatin

    Science.gov (United States)

    Matsuura, K; Huang, N-J; Cocce, K; Zhang, L; Kornbluth, S

    2017-01-01

    Evasion of apoptosis allows many cancers to resist chemotherapy. Apoptosis is mediated by the serial activation of caspase family proteins. These proteases are often activated upon the release of cytochrome c from the mitochondria, which is promoted by the proapoptotic Bcl-2 family protein, Bax. This function of Bax is enhanced by the MOAP-1 (modulator of apoptosis protein 1) protein in response to DNA damage. Previously, we reported that MOAP-1 is targeted for ubiquitylation and degradation by the APC/CCdh1 ubiquitin ligase. In this study, we identify the HECT (homologous to the E6-AP carboxyl terminus) family E3 ubiquitin ligase, UBR5, as a novel ubiquitin ligase for MOAP-1. We demonstrate that UBR5 interacts physically with MOAP-1, ubiquitylates MOAP-1 in vitro and inhibits MOAP-1 stability in cultured cells. In addition, we show that Dyrk2 kinase, a reported UBR5 interactor, cooperates with UBR5 in mediating MOAP-1 ubiquitylation. Importantly, we found that cisplatin-resistant ovarian cancer cell lines exhibit lower levels of MOAP-1 accumulation than their sensitive counterparts upon cisplatin treatment, consistent with the previously reported role of MOAP-1 in modulating cisplatin-induced apoptosis. Accordingly, UBR5 knockdown increased MOAP-1 expression, enhanced Bax activation and sensitized otherwise resistant cells to cisplatin-induced apoptosis. Furthermore, UBR5 expression was higher in ovarian cancers from cisplatin-resistant patients than from cisplatin-responsive patients. These results show that UBR5 downregulates proapoptotic MOAP-1 and suggest that UBR5 can confer cisplatin resistance in ovarian cancer. Thus UBR5 may be an attractive therapeutic target for ovarian cancer treatment. PMID:27721409

  9. Pro-apoptotic signaling induced by Retinoic acid and dsRNA is under the control of Interferon Regulatory Factor-3 in breast cancer cells.

    Science.gov (United States)

    Bernardo, Ana R; Cosgaya, José M; Aranda, Ana; Jiménez-Lara, Ana M

    2017-07-01

    Breast cancer is one of the most lethal malignancies for women. Retinoic acid (RA) and double-stranded RNA (dsRNA) are considered signaling molecules with potential anticancer activity. RA, co-administered with the dsRNA mimic polyinosinic-polycytidylic acid (poly(I:C)), synergizes to induce a TRAIL (Tumor-Necrosis-Factor Related Apoptosis-Inducing Ligand)- dependent apoptotic program in breast cancer cells. Here, we report that RA/poly(I:C) co-treatment, synergically, induce the activation of Interferon Regulatory Factor-3 (IRF3) in breast cancer cells. IRF3 activation is mediated by a member of the pathogen recognition receptors, Toll-like receptor-3 (TLR3), since its depletion abrogates IRF3 activation by RA/poly(I:C) co-treatment. Besides induction of TRAIL, apoptosis induced by RA/poly(I:C) correlates with the increased expression of pro-apoptotic TRAIL receptors, TRAIL-R1/2, and the inhibition of the antagonistic receptors TRAIL-R3/4. IRF3 plays an important role in RA/poly(I:C)-induced apoptosis since IRF3 depletion suppresses caspase-8 and caspase-3 activation, TRAIL expression upregulation and apoptosis. Interestingly, RA/poly(I:C) combination synergizes to induce a bioactive autocrine/paracrine loop of type-I Interferons (IFNs) which is ultimately responsible for TRAIL and TRAIL-R1/2 expression upregulation, while inhibition of TRAIL-R3/4 expression is type-I IFN-independent. Our results highlight the importance of IRF3 and type-I IFNs signaling for the pro-apoptotic effects induced by RA and synthetic dsRNA in breast cancer cells.

  10. Exon-skipping strategy by ratio modulation between cytoprotective versus pro-apoptotic clusterin forms increased sensitivity of LNCaP to cell death.

    Directory of Open Access Journals (Sweden)

    Abdellatif Essabbani

    Full Text Available BACKGROUND: In prostate cancer the secreted form of clusterin (sCLU has been described as an anti-apoptotic protein whose expression is increased after therapeutic intervention, whereas, the nuclear protein form nCLU was reported to have pro-apoptotic properties. METHODOLOGY: In order to provide new therapeutic approaches targeting CLU, we developed a strategy based on exon skipping by using a lentiviral construct to preferentially induce the nuclear spliced form of the protein. The molecular construct was transduced in LNCaP cells for testing the modulation of sensitivity of the transduced cells to pro-apoptotic stress. RESULTS AND CONCLUSIONS: We showed an increase of nCLU/sCLU expression ratio in the prostate cancer cell line "LNCaP" after lentiviral vector-U7 nCLU transduction. Moreover, we showed a significant inhibition of cell proliferation in nCLU-U7 LNCaP cells after treatment with cisplatin and after exposure to ionizing radiation compared to control cells. Finally, we showed that nCLU-U7 LNCaP cells exposure to UV-C significantly reduced an increase of cell death compared to control. Finally, we showed that modulating nCLU expression had profound impact on Ku70/Bax interaction as well as Rad17 expression which could be a key mechanism in sensitizing cells to cell death. In conclusion, this is the first report showing that increasing of nCLU/sCLU expression ratio by using an "on demand alternative splicing" strategy successfully increased sensitivity to radiotherapy and chemotherapy of prostate cancer cells.

  11. Regulation of radiation-induced apoptosis by early growth response-1 gene in solid tumors

    International Nuclear Information System (INIS)

    Ahmed, M.

    2003-01-01

    Ionizing radiation exposure is associated with activation of certain immediate-early genes that function as transcription factors. These include members of jun or fos and early growth response (EGR) gene families. In particular, the functional role of EGR-1 in radiation-induced signaling is pivotal since the promoter of EGR-1 contains radiation-inducible CArG DNA sequences. The Egr-1 gene belongs to a family of Egr genes that includes EGR-2, EGR-3, EGR-4, EGR-α and the tumor suppressor, Wilms' tumor gene product, WT1. The Egr-1 gene product, EGR-1, is a nuclear protein that contains three zinc fingers of the C 2 H 2 subtype. The EGR-1 GC-rich consensus target sequence, 5'-GCGT/GGGGCG-3' or 5'-TCCT/ACCTCCTCC-3', has been identified in the promoter regions of transcription factors, growth factors, receptors, cell cycle regulators and pro-apoptotic genes. The gene targets mediated by Egr-1 in response to ionizing radiation include TNF-α , p53, Rb and Bax, all these are effectors of apoptosis. Based on these targets, Egr-1 is a pivotal gene that initiates early signal transduction events in response to ionizing radiation leading to either growth arrest or cell death in tumor cells. There are two potential application of Egr-1 gene in therapy of cancer. First, the Egr-1 promoter contains information for appropriate spatial and temporal expression in-vivo that can be regulated by ionizing radiation to control transcription of genes that have pro-apoptotic and suicidal function. Secondly, EGR-1 protein can eliminate 'induced-radiation resistance' by inhibiting the functions of radiation-induced pro-survival genes (NFκB activity and bcl-2 expression) and activate pro-apoptotic genes (such as bax) to confer a significant radio-sensitizing effect. Together, the reported findings from my laboratory demonstrate clearly that EGR-1 is an early central gene that confers radiation sensitivity and its pro-apoptotic functions are synergized by abrogation of induced radiation

  12. MicroRNA-302/367 Cluster Governs hESC Self-Renewal by Dually Regulating Cell Cycle and Apoptosis Pathways

    Directory of Open Access Journals (Sweden)

    Zhonghui Zhang

    2015-04-01

    Full Text Available miR-302/367 is the most abundant miRNA cluster in human embryonic stem cells (hESCs and can promote somatic cell reprogramming. However, its role in hESCs remains poorly understood. Here, we studied functional roles of the endogenous miR-302/367 cluster in hESCs by employing specific TALE-based transcriptional repressors. We revealed that miR-302/367 cluster dually regulates hESC cell cycle and apoptosis in dose-dependent manner. Gene profiling and functional studies identified key targets of the miR-302/367 cluster in regulating hESC self-renewal and apoptosis. We demonstrate that in addition to its role in cell cycle regulation, miR-302/367 cluster conquers apoptosis by downregulating BNIP3L/Nix (a BH3-only proapoptotic factor and upregulating BCL-xL expression. Furthermore, we show that butyrate, a natural compound, upregulates miR-302/367 cluster expression and alleviates hESCs from apoptosis induced by knockdown of miR-302/367 cluster. In summary, our findings provide new insights in molecular mechanisms of how miR-302/367 cluster regulates hESCs.

  13. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  14. Hypoxia causes IL-8 secretion, Charcot Leyden crystal formation, and suppression of corticosteroid-induced apoptosis in human eosinophils.

    Science.gov (United States)

    Porter, L M; Cowburn, A S; Farahi, N; Deighton, J; Farrow, S N; Fiddler, C A; Juss, J K; Condliffe, A M; Chilvers, E R

    2017-06-01

    Inflamed environments are typically hypercellular, rich in pro-inflammatory cytokines, and profoundly hypoxic. While the effects of hypoxia on neutrophil longevity and function have been widely studied, little is known about the consequences of this stimulus on eosinophils. We sought to investigate the effects of hypoxia on several key aspects of eosinophil biology, namely secretion, survival, and their sensitivity to glucocorticosteroids (GCS), agents that normally induce eosinophil apoptosis. Eosinophils derived from patients with asthma/atopy or healthy controls were incubated under normoxia and hypoxia, with or without glucocorticoids. Activation was measured by flow cytometry, ELISA of cultured supernatants, and F-actin staining; apoptosis and efferocytosis by morphology and flow cytometry; and GCS efficacy by apoptosis assays and qPCR. Hypoxic incubation (3 kPa) caused (i) stabilization of HIF-2α and up-regulation of hypoxia-regulated genes including BNIP3 (BCL2/adenovirus E1B 19-kDa protein-interacting protein 3) and GLUT1 (glucose transporter 1); (ii) secretion of pre-formed IL-8, and Charcot Leyden crystal (CLC) formation, which was most evident in eosinophils derived from atopic and asthmatic donors; (iii) enhanced F-actin formation; (iv) marked prolongation of eosinophil lifespan (via a NF-κB and Class I PI3-kinase-dependent mechanism); and (v) complete abrogation of the normal pro-apoptotic effect of dexamethasone and fluticasone furoate. This latter effect was evident despite preservation of GCS-mediated gene transactivation under hypoxia. These data indicate that hypoxia promotes an eosinophil pro-inflammatory phenotype by enhancing eosinophil secretory function, delaying constitutive apoptosis, and importantly, antagonizing the normal pro-apoptotic effect of GCS. As eosinophils typically accumulate at sites that are relatively hypoxic, particularly during periods of inflammation, these findings may have important implications to understanding the

  15. Evaluation of the antiproliferative, proapoptotic, and antiangiogenic effects of a double-stranded RNA mimic complexed with polycations in an experimental mouse model of leiomyoma.

    Science.gov (United States)

    García-Pascual, Carmen Maria; Ferrero, Hortensia; Juarez, Irene; Martínez, Jessica; Villanueva, Ana; Pozuelo-Rubio, Mercedes; Soengas, Marisol; Tormo, Damiá; Simón, Carlos; Gómez, Raúl; Pellicer, Antonio

    2016-02-01

    To assess the antiproliferative, proapoptotic, and antiangiogenic effects of the double-stranded RNA mimic polyinosine-polycytidylic acid (pIC) complexed with polyethylenimine [pIC(PEI)] in xenografted human leiomyomas. Heterologous leiomyoma mouse model. University-affiliated infertility center. Ovariectomized and hormone-replaced nude mice (n = 16) who received human leiomyoma fragment transplantation. Leiomyoma fragments placed in the peritoneum of 5-week-old nude female mice and treated with the vehicle (n = 8) or 0.6 mg/kg [pIC(PEI)] (n = 8) for 4 weeks. The size of the leiomyoma implants, and cellular proliferation (Ki67), vascularization (PECAM), and apoptosis (OH-ends) assessed by quantitative immunohistochemical/immunofluorescent analysis of the recovered implants. No significant differences were observed in the size of the leiomyoma implants between groups. Vascularization and proliferation were significantly decreased, and apoptosis was increased in the [pIC(PEI)]-treated group versus control. We hypothesize that the antiangiogenic and apoptotic effects exerted by [pIC(PEI)] might lead to a decrease in lesion size in this animal model if the compound is administered for longer periods of time. This study provides promising data on [pIC(PEI)] as a potential novel therapeutic agent against human leiomyoma. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  16. Human colon cancer targeted pro-apoptotic, anti-metastatic and cytostatic effects of binuclear Silver(I)-N-Heterocyclic carbene (NHC) complexes.

    Science.gov (United States)

    Asif, Muhammad; Iqbal, Muhammad Adnan; Hussein, Mouayed A; Oon, Chern Ein; Haque, Rosenani A; Khadeer Ahamed, Mohamed B; Abdul Majid, Aman Shah; Abdul Majid, Amin Malik Shah

    2016-01-27

    The current mechanistic study was conducted to explore the effects of increased lipophilicity of binuclear silver(I)-NHC complexes on cytotoxicity. Two new silver(I)-N-Heterocyclic Carbene (NHC) complexes (3 and 4), having lypophilic terminal alkyl chains (Octyl and Decyl), were derived from meta-xylyl linked bis-benzimidazolium salts (1 and 2). Each of the synthesized compounds was characterized by microanalysis and spectroscopic techniques. The complexes were tested for their cytotoxicity against a panel of human cancer c as well normal cell lines using MTT assay. Based on MTT assay results, complex 4 was found to be selectively toxic towards human colorectal carcinoma cell line (HCT 116). Complex 4 was further studied in detail to explore the mechanism of cell death and findings of the study revealed that complex 4 has promising pro-apoptotic and anti-metastatic activities against HCT 116 cells. Furthermore, it showed pronounced cytostatic effects in HCT 116 multicellular spheroid model. Hence, binuclear silver(I)-NHC complexes with longer terminal aliphatic chains have worth to be further studied against human colon cancer for the purpose of drug development. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  17. Polysaccharide peptide isolated from grass-cultured Ganoderma lucidum induces anti-proliferative and pro-apoptotic effects in the human U251 glioma cell line.

    Science.gov (United States)

    Wang, Chunhua; Lin, Dongmei; Chen, Quan; Lin, Shuqian; Shi, Songsheng; Chen, Chunmei

    2018-04-01

    The Ganoderma lucidum ( G. lucidum ) mushroom is one of the most extensively studied functional foods, known for its numerous health benefits, including the inhibition of tumor cell growth. The present study assessed the anti-proliferative and pro-apoptotic activity of a novel G. lucidum polysaccharide peptide (GL-PP) in human glioma U251 cells, which was purified from grass-cultured G. lucidum . GL-PP is a glycopeptide with an average molecular weight of 42,635 Da and a polysaccharide-to-peptide ratio of 88.70:11.30. The polysaccharides were composed of l-arabinose, d-mannose and d-glucose at a molar ratio of 1.329:0.372:2.953 and a total of 17 amino acids were detected. The results of the current study demonstrated that GL-PP significantly inhibited U251 cellular proliferation. The proportion of G 0 /G 1 phase cells and sub-G 1 phase cells significantly increased as the concentration of GL-PP increased, as did the activity of caspase-3. These results indicate that GL-PP directly inhibited human glioma U251 proliferation by inducing cell cycle arrest and promoting apoptosis.

  18. Proapoptotic and Antiproliferative Effects of Thymus caramanicus on Human Breast Cancer Cell Line (MCF-7 and Its Interaction with Anticancer Drug Vincristine

    Directory of Open Access Journals (Sweden)

    Saeed Esmaeili-Mahani

    2014-01-01

    Full Text Available Thymus caramanicus Jalas is one of the species of thymus that grows in the wild in different regions of Iran. Traditionally, leaves of this plant are used in the treatment of diabetes, arthritis, and cancerous situation. Therefore, the present study was designed to investigate the selective cytotoxic and antiproliferative properties of Thymus caramanicus extract (TCE. MCF-7 human breast cancer cells were used in this study. Cytotoxicity of the extract was determined using MTT and neutral red assays. Biochemical markers of apoptosis (caspase 3, Bax, and Bcl-2 and cell proliferation (cyclin D1 were evaluated by immunoblotting. Vincristine was used as anticancer control drug in extract combination therapy. The data showed that incubation of cells with TCE (200 and 250 μg/mL significantly increased cell damage, activated caspase 3 and Bax/Bcl2 ratio. In addition, cyclin D1 was significantly decreased in TCE-treated cells. Furthermore, concomitant treatment of cells with extract and anticancer drug produced a significant cytotoxic effect as compared to extract or drugs alone. In conclusion, thymus extract has a potential proapoptotic/antiproliferative property against human breast cancer cells and its combination with chemotherapeutic agent vincristine may induce cell death effectively and be a potent modality to treat this type of cancer.

  19. Low-Dose Radiation Induces Genes Promoting Cell Survival

    International Nuclear Information System (INIS)

    Liu, Shu-Zheng; Chen, Dong; Mu, Ying

    1999-01-01

    Apoptosis is an important process controlling homeostasis of the body. It is influenced by stimuli constantly arising from the external and internal environment of the organism. It is well known that radiation could induce apoptosis of cells in vitro and in vivo. However, the dose-effect relationship of apoptosis extending to the low-dose range has scarcely been studied. Here, the molecular basis of the phenomenon is explored by examining the changes in expression of some of the proapoptotic and antiapoptotic genes

  20. Alteration of apoptosis-related genes in postmenopausal women with uterine prolapse.

    Science.gov (United States)

    Saatli, Bahadir; Kizildag, Sefa; Cagliyan, Erkan; Dogan, Erbil; Saygili, Ugur

    2014-07-01

    We aimed to compare expression levels of antiapoptotic and proapoptotic genes in parametrial and vaginal tissues from postmenopausal women with and without pelvic organ prolapse (POP). We hypothesized that the expression of genes that induce apoptosis may be altered in vaginal and parametrial tissues in postmenopausal women with POP. Samples of vaginal and parametrial tissues were obtained from postmenopausal women with (n = 10) and without (n = 10) POP who underwent vaginal or abdominal hysterectomy. Expression levels of antiapoptotic (BCL-2, BCL-XL) and proapoptotic (BAX, BAD) genes were studied by real-time reverse-transcription polymerase chain reaction (RT-PCR). Gene expression levels of BCL-2 (P gene expression levels of BCL-2 (p gene expression levels differed significantly between postmenopausal women with and without POP. Bcl-2 family genes were overexpressed in the parametrium of patients with POP compared with vaginal tissue, suggesting that the processes responsible for POP have a greater effect on parametrial tissue than vaginal tissue during the development of POP.

  1. Downregulation of proapoptotic Bim augments IL-2-independent T-cell transformation by human T-cell leukemia virus type-1 Tax

    International Nuclear Information System (INIS)

    Higuchi, Masaya; Takahashi, Masahiko; Tanaka, Yuetsu; Fujii, Masahiro

    2014-01-01

    Human T-cell leukemia virus type 1 (HTLV-1), an etiological agent of adult T-cell leukemia, immortalizes and transforms primary human T cells in vitro in both an interleukin (IL)-2-dependent and IL-2-independent manner. Expression of the HTLV-1 oncoprotein Tax transforms the growth of the mouse T-cell line CTLL-2 from being IL-2-dependent to IL-2-independent. Withdrawal of IL-2 from normal activated T cells induces apoptosis, which is mediated through the inducible expression of several proapoptotic proteins, including Bim. In this study, we found that Tax protects IL-2-depleted T cells against Bim-induced apoptosis. Withdrawal of IL-2 from CTLL-2 cells induced a prominent increase in the level of Bim protein in CTLL-2 cells, but not in Tax-transformed CTLL-2 cells. This inhibition of Bim in Tax-transformed CTLL-2 cells was mediated by two mechanisms: downregulation of Bim mRNA and posttranscriptional reduction of Bim protein. Transient expression of Tax in CTLL-2 cells also inhibited IL-2 depletion–induced expression of Bim, however, this decrease in Bim protein expression was not due to downregulation of Bim mRNA, thus indicating that Bim mRNA downregulation in Tax-transformed CTLL-2 occurs only after long-term expression of Tax. Transient expression of Tax in CTLL-2 cells also induced Erk activation, however, this was not involved in the reduction of Bim protein. Knockdown of Bim expression in CTLL-2 cells augmented Tax-induced IL-2-independent transformation. HTLV-1 infection of human T cells also reduced their levels of Bim protein, and restoring Bim expression in HTLV-1-infected cells reduced their proliferation by inducing apoptosis. Taken together, these results indicate that Tax-induced downregulation of Bim in HTLV-1-infected T cells promotes their IL-2-independent growth, thereby supporting the persistence of HTLV-1 infection in vivo

  2. Vicrostatin - an anti-invasive multi-integrin targeting chimeric disintegrin with tumor anti-angiogenic and pro-apoptotic activities.

    Directory of Open Access Journals (Sweden)

    Radu O Minea

    2010-06-01

    Full Text Available Similar to other integrin-targeting strategies, disintegrins have previously shown good efficacy in animal cancer models with favorable pharmacological attributes and translational potential. Nonetheless, these polypeptides are notoriously difficult to produce recombinantly due to their particular structure requiring the correct pairing of multiple disulfide bonds for biological activity. Here, we show that a sequence-engineered disintegrin (called vicrostatin or VCN can be reliably produced in large scale amounts directly in the oxidative cytoplasm of Origami B E. coli. Through multiple integrin ligation (i.e., alphavbeta3, alphavbeta5, and alpha5beta1, VCN targets both endothelial and cancer cells significantly inhibiting their motility through a reconstituted basement membrane. Interestingly, in a manner distinct from other integrin ligands but reminiscent of some ECM-derived endogenous anti-angiogenic fragments previously described in the literature, VCN profoundly disrupts the actin cytoskeleton of endothelial cells (EC inducing a rapid disassembly of stress fibers and actin reorganization, ultimately interfering with EC's ability to invade and form tubes (tubulogenesis. Moreover, here we show for the first time that the addition of a disintegrin to tubulogenic EC sandwiched in vitro between two Matrigel layers negatively impacts their survival despite the presence of abundant haptotactic cues. A liposomal formulation of VCN (LVCN was further evaluated in vivo in two animal cancer models with different growth characteristics. Our data demonstrate that LVCN is well tolerated while exerting a significant delay in tumor growth and an increase in the survival of treated animals. These results can be partially explained by potent tumor anti-angiogenic and pro-apoptotic effects induced by LVCN.

  3. Reconstitution of the anti-apoptotic Bcl-2 protein into lipid membranes and biophysical evidence for its detergent-driven association with the pro-apoptotic Bax protein.

    Directory of Open Access Journals (Sweden)

    Marcus Wallgren

    Full Text Available The anti-apoptotic B-cell CLL/lymphoma-2 (Bcl-2 protein and its counterpart, the pro-apoptotic Bcl-2-associated X protein (Bax, are key players in the regulation of the mitochondrial pathway of apoptosis. However, how they interact at the mitochondrial outer membrane (MOM and there determine whether the cell will live or be sentenced to death remains unknown. Competing models have been presented that describe how Bcl-2 inhibits the cell-killing activity of Bax, which is common in treatment-resistant tumors where Bcl-2 is overexpressed. Some studies suggest that Bcl-2 binds directly to and sequesters Bax, while others suggest an indirect process whereby Bcl-2 blocks BH3-only proteins and prevents them from activating Bax. Here we present the results of a biophysical study in which we investigated the putative interaction of solubilized full-length human Bcl-2 with Bax and the scope for incorporating the former into a native-like lipid environment. Far-UV circular dichroism (CD spectroscopy was used to detect direct Bcl-2-Bax-interactions in the presence of polyoxyethylene-(23-lauryl-ether (Brij-35 detergent at a level below its critical micelle concentration (CMC. Additional surface plasmon resonance (SPR measurements confirmed this observation and revealed a high affinity between the Bax and Bcl-2 proteins. Upon formation of this protein-protein complex, Bax also prevented the binding of antimycin A2 (a known inhibitory ligand of Bcl-2 to the Bcl-2 protein, as fluorescence spectroscopy experiments showed. In addition, Bcl-2 was able to form mixed micelles with Triton X-100 solubilized neutral phospholipids in the presence of high concentrations of Brij-35 (above its CMC. Following detergent removal, the integral membrane protein was found to have been fully reconstituted into a native-like membrane environment, as confirmed by ultracentrifugation and subsequent SDS-PAGE experiments.

  4. The pro-apoptotic BH3-only protein Bim interacts with components of the translocase of the outer mitochondrial membrane (TOM).

    Science.gov (United States)

    Frank, Daniel O; Dengjel, Jörn; Wilfling, Florian; Kozjak-Pavlovic, Vera; Häcker, Georg; Weber, Arnim

    2015-01-01

    The pro-apoptotic Bcl-2-family protein Bim belongs to the BH3-only proteins known as initiators of apoptosis. Recent data show that Bim is constitutively inserted in the outer mitochondrial membrane via a C-terminal transmembrane anchor from where it can activate the effector of cytochrome c-release, Bax. To identify regulators of Bim-activity, we conducted a search for proteins interacting with Bim at mitochondria. We found an interaction of Bim with Tom70, Tom20 and more weakly with Tom40, all components of the Translocase of the Outer Membrane (TOM). In vitro import assays performed on tryptically digested yeast mitochondria showed reduced Bim insertion into the outer mitochondrial membrane (OMM) indicating that protein receptors may be involved in the import process. However, RNAi against components of TOM (Tom40, Tom70, Tom22 or Tom20) by siRNA, individually or in combination, did not consistently change the amount of Bim on HeLa mitochondria, either at steady state or upon de novo-induction. In support of this, the individual or combined knock-downs of TOM receptors also failed to alter the susceptibility of HeLa cells to Bim-induced apoptosis. In isolated yeast mitochondria, lack of Tom70 or the TOM-components Tom20 or Tom22 alone did not affect the import of Bim into the outer mitochondrial membrane. In yeast, expression of Bim can sensitize the cells to Bax-dependent killing. This sensitization was unaffected by the absence of Tom70 or by an experimental reduction in Tom40. Although thus the physiological role of the Bim-TOM-interaction remains unclear, TOM complex components do not seem to be essential for Bim insertion into the OMM. Nevertheless, this association should be noted and considered when the regulation of Bim in other cells and situations is investigated.

  5. The pro-apoptotic BH3-only protein Bim interacts with components of the translocase of the outer mitochondrial membrane (TOM.

    Directory of Open Access Journals (Sweden)

    Daniel O Frank

    Full Text Available The pro-apoptotic Bcl-2-family protein Bim belongs to the BH3-only proteins known as initiators of apoptosis. Recent data show that Bim is constitutively inserted in the outer mitochondrial membrane via a C-terminal transmembrane anchor from where it can activate the effector of cytochrome c-release, Bax. To identify regulators of Bim-activity, we conducted a search for proteins interacting with Bim at mitochondria. We found an interaction of Bim with Tom70, Tom20 and more weakly with Tom40, all components of the Translocase of the Outer Membrane (TOM. In vitro import assays performed on tryptically digested yeast mitochondria showed reduced Bim insertion into the outer mitochondrial membrane (OMM indicating that protein receptors may be involved in the import process. However, RNAi against components of TOM (Tom40, Tom70, Tom22 or Tom20 by siRNA, individually or in combination, did not consistently change the amount of Bim on HeLa mitochondria, either at steady state or upon de novo-induction. In support of this, the individual or combined knock-downs of TOM receptors also failed to alter the susceptibility of HeLa cells to Bim-induced apoptosis. In isolated yeast mitochondria, lack of Tom70 or the TOM-components Tom20 or Tom22 alone did not affect the import of Bim into the outer mitochondrial membrane. In yeast, expression of Bim can sensitize the cells to Bax-dependent killing. This sensitization was unaffected by the absence of Tom70 or by an experimental reduction in Tom40. Although thus the physiological role of the Bim-TOM-interaction remains unclear, TOM complex components do not seem to be essential for Bim insertion into the OMM. Nevertheless, this association should be noted and considered when the regulation of Bim in other cells and situations is investigated.

  6. Synthesis and Proapoptotic Activity on Cervical Cancer Cell of Ester Eugenol 1-(3-Methoxy-4-hydroxy)phenyl-2-propylmethanoate

    Science.gov (United States)

    Farid Rahman, Moh.; Nazhif Haykal, Muhammad; Andriani Siagian, Novi; Maiselina Sriepindonnta, Priscilla; Tampubolon, Norman Alexander

    2018-01-01

    Proapoptotic activity of ester eugenol,1-(3-methoxy-4-hydroxy)phenyl-2-propylmethanoat, which synthesized from eugenol is reported. Eugenol as starting material in the synthesis of ester eugenol was obtained from fractional distillation of clove oil with the yield of 70.66%. Synthesis of ester eugenol was camed out by addition-esterification reaction through reaction between eugenol and formic acid with mol ratio of 1:27 and reaction time for11 h. GC-MS analysis showed ester eugenol was afforded purity of 92.42% and the yield in of 93.34%. UV spectra of ester eugenol was observed the formation of carbonyl group at λmax 290 nm and supported by FT-IR analysis at 1714.60 cm-1 (carbonyl group), 1193.65 cm-1 (C-O-C ester group) and the absence of vynil group in eugenol structure at region 914.20 and 995.20 cm-1. Mass spectra showed ion molecule at m/z 210 was accordance with molecular weight of ester eugenol. Afterward, HeLa cell culture media was prepared for cervical cancer antiproliferative test. The result which showed in histogram indicated that LC50 of ester eugenol was reached at concentration below 0.01% while eugenol was up to 0.01% that observed cervical cancer cell apoptotic activity. LC50 value of ester eugenol was obtained at concentration 48.73 ppm. This research reported that natural product modified its structure has potency to cure cervical cancer.

  7. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    Directory of Open Access Journals (Sweden)

    Zodwa Dlamini

    2015-11-01

    Full Text Available Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets.

  8. Downregulation of proapoptotic Bim augments IL-2-independent T-cell transformation by human T-cell leukemia virus type-1 Tax.

    Science.gov (United States)

    Higuchi, Masaya; Takahashi, Masahiko; Tanaka, Yuetsu; Fujii, Masahiro

    2014-12-01

    Human T-cell leukemia virus type 1 (HTLV-1), an etiological agent of adult T-cell leukemia, immortalizes and transforms primary human T cells in vitro in both an interleukin (IL)-2-dependent and IL-2-independent manner. Expression of the HTLV-1 oncoprotein Tax transforms the growth of the mouse T-cell line CTLL-2 from being IL-2-dependent to IL-2-independent. Withdrawal of IL-2 from normal activated T cells induces apoptosis, which is mediated through the inducible expression of several proapoptotic proteins, including Bim. In this study, we found that Tax protects IL-2-depleted T cells against Bim-induced apoptosis. Withdrawal of IL-2 from CTLL-2 cells induced a prominent increase in the level of Bim protein in CTLL-2 cells, but not in Tax-transformed CTLL-2 cells. This inhibition of Bim in Tax-transformed CTLL-2 cells was mediated by two mechanisms: downregulation of Bim mRNA and posttranscriptional reduction of Bim protein. Transient expression of Tax in CTLL-2 cells also inhibited IL-2 depletion-induced expression of Bim, however, this decrease in Bim protein expression was not due to downregulation of Bim mRNA, thus indicating that Bim mRNA downregulation in Tax-transformed CTLL-2 occurs only after long-term expression of Tax. Transient expression of Tax in CTLL-2 cells also induced Erk activation, however, this was not involved in the reduction of Bim protein. Knockdown of Bim expression in CTLL-2 cells augmented Tax-induced IL-2-independent transformation. HTLV-1 infection of human T cells also reduced their levels of Bim protein, and restoring Bim expression in HTLV-1-infected cells reduced their proliferation by inducing apoptosis. Taken together, these results indicate that Tax-induced downregulation of Bim in HTLV-1-infected T cells promotes their IL-2-independent growth, thereby supporting the persistence of HTLV-1 infection in vivo. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  9. Proteolytic activation of proapoptotic kinase protein kinase Cδ by tumor necrosis factor α death receptor signaling in dopaminergic neurons during neuroinflammation

    Directory of Open Access Journals (Sweden)

    Gordon Richard

    2012-04-01

    neuroinflammatory LPS model was also observed. Conclusions Collectively, these results identify proteolytic activation of PKCδ proapoptotic signaling as a key downstream effector of dopaminergic cell death induced by TNF. These findings also provide a rationale for therapeutically targeting PKCδ to mitigate progressive dopaminergic degeneration resulting from chronic neuroinflammatory processes.

  10. Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.

    Science.gov (United States)

    Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

    2017-06-08

    A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.

  11. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  12. Evidence of galectin-1 involvement in glioma chemoresistance

    International Nuclear Information System (INIS)

    Le Mercier, Marie; Lefranc, Florence; Mijatovic, Tatjana; Debeir, Olivier; Haibe-Kains, Benjamin; Bontempi, Gianluca; Decaestecker, Christine; Kiss, Robert; Mathieu, Veronique

    2008-01-01

    Glioblastomas (GBMs) are resistant to apoptosis but less so to autophagy; a fact that may at least partly explain the therapeutic benefits of the pro-autophagic drug temozolomide in the treatment of GBM patients. Galectin-1 (Gal1) whose expression is stimulated by hypoxia is a potent modulator of GBM cell migration and a pro-angiogenic molecule. Hypoxia is also known to confer cancer cells with resistance to chemotherapy and radiotherapy and to modulate the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. The present study investigates whether decreasing Gal1 expression (by means of a siRNA approach) in human Hs683 GBM cells increases their sensitivity to pro-autophagic or pro-apoptotic drugs. The data reveal that temozolomide, the standard treatment for glioma patients, increases Gal1 expression in Hs683 cells both in vitro and in vivo. However, reducing Gal1 expression in these cells by siRNA increases the anti-tumor effects of various chemotherapeutic agents, in particular temozolomide both in vitro and in vivo. This decrease in Gal1 expression in Hs683 cells does not induce apoptotic or autophagic features, but is found to modulate p53 transcriptional activity and decrease p53-targeted gene expression including DDIT3/GADD153/CHOP, DUSP5 ATF3 and GADD45A. The decrease in Gal1 expression also impairs the expression levels of seven other genes implicated in chemoresistance: ORP150, HERP, GRP78/Bip, TRA1, BNIP3L, GADD45B and CYR61, some of which are located in the ER and whose expression is also known to be modified by hypoxia. This novel facet of Gal1 involvement in glioblastoma biology may be amenable to therapeutic manipulation

  13. Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.

    Science.gov (United States)

    Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke

    2011-11-01

    Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.

  14. Gene expression in cortex and hippocampus during acute pneumococcal meningitis

    Directory of Open Access Journals (Sweden)

    Wittwer Matthias

    2006-06-01

    Full Text Available Abstract Background Pneumococcal meningitis is associated with high mortality (~30% and morbidity. Up to 50% of survivors are affected by neurological sequelae due to a wide spectrum of brain injury mainly affecting the cortex and hippocampus. Despite this significant disease burden, the genetic program that regulates the host response leading to brain damage as a consequence of bacterial meningitis is largely unknown. We used an infant rat model of pneumococcal meningitis to assess gene expression profiles in cortex and hippocampus at 22 and 44 hours after infection and in controls at 22 h after mock-infection with saline. To analyze the biological significance of the data generated by Affymetrix DNA microarrays, a bioinformatics pipeline was used combining (i a literature-profiling algorithm to cluster genes based on the vocabulary of abstracts indexed in MEDLINE (NCBI and (ii the self-organizing map (SOM, a clustering technique based on covariance in gene expression kinetics. Results Among 598 genes differentially regulated (change factor ≥ 1.5; p ≤ 0.05, 77% were automatically assigned to one of 11 functional groups with 94% accuracy. SOM disclosed six patterns of expression kinetics. Genes associated with growth control/neuroplasticity, signal transduction, cell death/survival, cytoskeleton, and immunity were generally upregulated. In contrast, genes related to neurotransmission and lipid metabolism were transiently downregulated on the whole. The majority of the genes associated with ionic homeostasis, neurotransmission, signal transduction and lipid metabolism were differentially regulated specifically in the hippocampus. Of the cell death/survival genes found to be continuously upregulated only in hippocampus, the majority are pro-apoptotic, while those continuously upregulated only in cortex are anti-apoptotic. Conclusion Temporal and spatial analysis of gene expression in experimental pneumococcal meningitis identified potential

  15. In Vitro Pro-apoptotic and Anti-migratory Effects of Ficus deltoidea L. Plant Extracts on the Human Prostate Cancer Cell Lines PC3

    Science.gov (United States)

    Hanafi, Mohd M. M.; Afzan, Adlin; Yaakob, Harisun; Aziz, Ramlan; Sarmidi, Mohamad R.; Wolfender, Jean-Luc; Prieto, Jose M.

    2017-01-01

    This study aims to evaluate the in vitro cytotoxic and anti-migratory effects of Ficus deltoidea L. on prostate cancer cells, identify the active compound/s and characterize their mechanism of actions. Two farmed varieties were studied, var. angustifolia (FD1) and var. deltoidea (FD2). Their crude methanolic extracts were partitioned into n-hexane (FD1h, FD2h) chloroform (FD1c, FD2c) and aqueous extracts (FD1a, FD2a). Antiproliferative fractions (IC50 < 30 μg/mL, SRB staining of PC3 cells) were further fractionated. Active compound/s were dereplicated using spectroscopic methods. In vitro mechanistic studies on PC3 and/or LNCaP cells included: annexin V-FITC staining, MMP depolarization measurements, activity of caspases 3 and 7, nuclear DNA fragmentation and cell cycle analysis, modulation of Bax, Bcl-2, Smac/Diablo, and Alox-5 mRNA gene expression by RT-PCR. Effects of cytotoxic fractions on 2D migration and 3D invasion were tested by exclusion assays and modified Boyden chamber, respectively. Their mechanisms of action on these tests were further studied by measuring the expression VEGF-A, CXCR4, and CXCL12 in PC3 cells by RT-PCR. FD1c and FD2c extracts induced cell death (P < 0.05) via apoptosis as evidenced by nuclear DNA fragmentation. This was accompanied by an increase in MMP depolarization (P < 0.05), activation of caspases 3 and 7 (P < 0.05) in both PC3 and LNCaP cell lines. All active plant extracts up-regulated Bax and Smac/DIABLO, down-regulated Bcl-2 (P < 0.05). Both FD1c and FD2c were not cytotoxic against normal human fibroblast cells (HDFa) at the tested concentrations. Both plant extracts inhibited both migration and invasion of PC3 cells (P < 0.05). These effects were accompanied by down-regulation of both VEGF-A and CXCL-12 gene expressions (P < 0.001). LC–MS dereplication using taxonomy filters and molecular networking databases identified isovitexin in FD1c; and oleanolic acid, moretenol, betulin, lupenone, and lupeol in FD2c. In conclusion

  16. A comparison of the effects of tributyltin chloride and triphenyltin chloride on cell proliferation, proapoptotic p53, Bax, and antiapoptotic Bcl-2 protein levels in human breast cancer MCF-7 cell line.

    Science.gov (United States)

    Fickova, Maria; Macho, Ladislav; Brtko, Julius

    2015-06-01

    In recent years it was disclosed, that numerous organotin(IV) derivatives have remarkable cytotoxicity against several types of cancer cells. The property to inhibit cell growth makes these compounds promising for antitumor therapy, as the clinical effectiveness of cisplatin is limited by drug resistance and significant side effects. Tributyltin and triphenyltin are known as endocrine disruptors. Moreover, the compounds exert their toxicity in mammals predominantly through nuclear receptor signaling. Here we present the effects of tributyltin chloride (TBT-Cl) and triphenyltin chloride (TPT-Cl) on cell proliferation, expression of proapoptotic p53, Bax, and antiapoptotic Bcl-2 proteins in human breast cancer MCF-7 cell line. Dose and time dependent (24, 48 and 72 h) cell expositions have demonstrated TBT-Cl as more effective in inhibiting MCF-7 cell proliferation than TPT-Cl. Short time treatment with TBT-Cl displayed marked stimulation of p53 protein expression when compared to TPT-Cl. Both organotin compounds displayed similar mild enhancement of Bax protein expression. The 24h exposition of TPT-Cl induced substantial diminution of Bcl-2 protein expression in comparison with both, untreated cells and TBT-Cl treated cells. Our observations indicate that TBT-Cl and TPT-Cl have different antiproliferative potency and distinct impact on expression of apoptosis marker proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. 4-IBP, a σ1 Receptor Agonist, Decreases the Migration of Human Cancer Cells, Including Glioblastoma Cells, In Vitro and Sensitizes Them In Vitro and In Vivo to Cytotoxic Insults of Proapoptotic and Proautophagic Drugs

    Directory of Open Access Journals (Sweden)

    Veronique Mégalizzi

    2007-05-01

    Full Text Available Although the molecular function of cr receptors has not been fully defined and the natural ligand(s is still not known, there is increasing evidence that these receptors and their ligands might play a significant role in cancer biology. 4-(N-tibenzylpiperidin-4-yl-4iodobenzamide (4-IBP, a selective σ1, agonist, has been used to investigate whether this compound is able to modify: 1 in vitro the migration and proliferation of human cancer cells; 2 in vitro the sensitivity of human glioblastoma cells to cytotoxic drugs; and 3 in vivo in orthotopic glioblastoma and non-small cell lung carcinoma (NSCLC models the survival of mice coadministered cytotoxic agents. 4-IBP has revealed weak anti proliferative effects on human U373-MG glioblastoma and C32 melanoma cells but induced marked concentration-dependent decreases in the growth of human A549 NSCLC and PC3 prostate cancer cells. The compound was also significantly antimigratory in all four cancer cell lines. This may result, at least in U373-MG cells, from modifications to the actin cytoskeleton. 4-IBP modified the sensitivity of U373-MG cells in vitro to proapoptotic lomustin and proautophagic temozolomide, and markedly decreased the expression of two proteins involved in drug resistance: glucosylceramide synthase and Rho guanine nucleotide dissociation inhibitor. In vivo, 4-IBP increased the antitumor effects of temozolomide and irinotecan in immunodeficient mice that were orthotopically grafted with invasive cancer cells.

  18. Ethyl acetate extract of Chinese medicinal herb Sarcandra glabra induces growth inhibition on human leukemic HL-60 cells, associated with cell cycle arrest and up-regulation of pro-apoptotic Bax/Bcl-2 ratio.

    Science.gov (United States)

    Li, W Y; Chiu, Lawrence C M; Lam, W S; Wong, W Y; Chan, Y T; Ho, Y P; Wong, Elaine Y L; Wong, Y S; Ooi, Vincent E C

    2007-02-01

    Sarcandra glabra (Thunb.) Nakai, colloquially known as Caoshanhu, is a Chinese medicinal herb with reported anti-tumor, anti-inflammatory, anti-viral and non-specific immunoenhancing properties. Although the plant has been clinically used for treating a variety of diseases, its bioactive ingredients are largely unknown and its mode of action has never been investigated. In this study, the anti-tumor property of ethyl acetate (EA) extract of S. glabra was investigated by determining its in vitro growth-inhibitory effects on a panel of human cancer cell lines of different histotypes. Growth inhibition of the EA extract on the cancer cells seemed to be selective, and the leukemic HL-60 was found to be the most responsive after 48 h of treatment (IC50=58 microg/ml). Flow cytometric studies further illustrated that the extract might interfere with DNA replication and thus arrested the cell cycle at S phase in the leukemic cells, followed by DNA fragmentation and loss of phospholipid asymmetry in the plasma membrane after 72 h of treatment. Concurrently, the pro-apoptotic Bax/Bcl-2 ratio was also up-regulated by more than 178% of the control level. All these findings suggested that the extract had initiated apoptosis to kill the leukemic cells. Results from this pioneer study help to establish a scientific foundation for future research and development of the bioactive ingredients in EA extract of S. glabra as efficacious anti-cancer agents.

  19. Altered gene expression in blood and sputum in COPD frequent exacerbators in the ECLIPSE cohort.

    Directory of Open Access Journals (Sweden)

    Dave Singh

    Full Text Available Patients with chronic obstructive pulmonary disease (COPD who are defined as frequent exacerbators suffer with 2 or more exacerbations every year. The molecular mechanisms responsible for this phenotype are poorly understood. We investigated gene expression profile patterns associated with frequent exacerbations in sputum and blood cells in a well-characterised cohort. Samples from subjects from the ECLIPSE COPD cohort were used; sputum and blood samples from 138 subjects were used for microarray gene expression analysis, while blood samples from 438 subjects were used for polymerase chain reaction (PCR testing. Using microarray, 150 genes were differentially expressed in blood (>±1.5 fold change, p≤0.01 between frequent compared to non-exacerbators. In sputum cells, only 6 genes were differentially expressed. The differentially regulated genes in blood included downregulation of those involved in lymphocyte signalling and upregulation of pro-apoptotic signalling genes. Multivariate analysis of the microarray data followed by confirmatory PCR analysis identified 3 genes that predicted frequent exacerbations; B3GNT, LAF4 and ARHGEF10. The sensitivity and specificity of these 3 genes to predict the frequent exacerbator phenotype was 88% and 33% respectively. There are alterations in systemic immune function associated with frequent exacerbations; down-regulation of lymphocyte function and a shift towards pro-apoptosis mechanisms are apparent in patients with frequent exacerbations.

  20. Possible mechanism of PNS protection against cisplatin-induced nephrotoxicity in rat models.

    Science.gov (United States)

    Liu, Xinwen; Huang, Zhenguang; Zou, Xiaoqin; Yang, Yufang; Qiu, Yue; Wen, Yan

    2015-01-01

    This study investigates the mechanism of the protective effect of Panax notoginsenosides (PNS) against cisplatin-induced nephrotoxicity via the hypoxia inducible factor 1 (HIF-1)/Bcl-2/adenovirus E1B 19 kDa-interacting protein 3 (BNIP3) pathway of autophagy. The rats underwent intraperitoneal injection with a single dose of cisplatin and a subset of rats were also intraperitoneally injected with 31.35 mg/kg PNS once a day. After 24 h exposure to cisplatin, the concentrations of urinary N-acetyl-β-D-glucosaminidase (NAG), blood urea nitrogen (BUN) and serum creatinine (Scr) were determined. The rat renal tissue was examined using H&E-staining, and the mitochondria of renal tubular epithelial cells were observed using transmission electron microscopy. The expressions of microtubule-associated protein-1 light chain (LC)3, autophagy-related gene (Atg)5, Beclin-1 and BNIP3 in rat renal tissue were detected using western blotting. The expression of HIF-1 was detected by immunohistochemistry. The results showed that PNS significantly protected against cisplatin-induced nephrotoxicity, as evidenced by decreasing the concentration of blood BUN and Scr, the attenuation of renal histopathological changes and the mitochondrial damages of renal cells, and the increase of mitochondria autophagosome in renal tubular epithelial cells. Additionally, PNS significantly increased the expression of LC3 and the ratio of LC3II/LC3I in rat renal tissue. Moreover, PNS significantly increased the expression of HIF-1α, BNIP3, Atg5 and Beclin-1 in rat renal tissue. In conclusion, the protective effect of PNS on cisplatin-induced nephrotoxicity was mainly due to its ability to enhancing the mitochondrial autophagy of renal tissue via the HIF-1α/BNIP3 pathway, and here is the first demonstration about it.

  1. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  2. AMP-activated protein kinase couples 3-bromopyruvate-induced energy depletion to apoptosis via activation of FoxO3a and upregulation of proapoptotic Bcl-2 proteins.

    Science.gov (United States)

    Bodur, Cagri; Karakas, Bahriye; Timucin, Ahmet Can; Tezil, Tugsan; Basaga, Huveyda

    2016-11-01

    Most tumors primarily rely on glycolysis rather than mitochondrial respiration for ATP production. This phenomenon, also known as Warburg effect, renders tumors more sensitive to glycolytic disturbances compared to normal cells. 3-bromopyruvate is a potent inhibitor of glycolysis that shows promise as an anticancer drug candidate. Although investigations revealed that 3-BP triggers apoptosis through ATP depletion and subsequent AMPK activation, the underlying molecular mechanisms coupling AMPK to apoptosis are poorly understood. We showed that 3-BP leads to a rapid ATP depletion which was followed by growth inhibition and Bax-dependent apoptosis in HCT116 cells. Apoptosis was accompanied with activation of caspase-9 and -3 while pretreatment with a general caspase inhibitor attenuated cell death. AMPK, p38, JNK, and Akt were phosphorylated immediately upon treatment. Pharmacological inhibition and silencing of AMPK largely inhibited 3-BP-induced apoptosis and reversed phosphorylation of JNK. Transcriptional activity of FoxO3a was dramatically increased subsequent to AMPK-mediated phosphorylation of FoxO3a at Ser413. Cell death analysis of cells transiently transfected with wt or AMPK-phosphorylation-deficient FoxO3 expression plasmids verified the contributory role of AMPK-FoxO3a axis in 3-BP-induced apoptosis. In addition, expression of proapoptotic Bcl-2 proteins Bim and Bax were upregulated in an AMPK-dependent manner. Bim was transcriptionally activated in association with FoxO3a activity, while Bax upregulation was abolished in p53-null cells. Together, these data suggest that AMPK couples 3-BP-induced metabolic disruption to intrinsic apoptosis via modulation of FoxO3a-Bim axis and Bax expression. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  3. Identification of residues within the African swine fever virus DP71L protein required for dephosphorylation of translation initiation factor eIF2α and inhibiting activation of pro-apoptotic CHOP

    Energy Technology Data Exchange (ETDEWEB)

    Barber, Claire; Netherton, Chris; Goatley, Lynnette [The Pirbright Institute, Ash Road, Pirbright, Woking, Surrey GU24 0NF (United Kingdom); Moon, Alice; Goodbourn, Steve [Institute for Infection and Immunity, St. George' s, University of London, London SW17 0RE (United Kingdom); Dixon, Linda, E-mail: linda.dixon@pirbright.ac.uk [The Pirbright Institute, Ash Road, Pirbright, Woking, Surrey GU24 0NF (United Kingdom)

    2017-04-15

    The African swine fever virus DP71L protein recruits protein phosphatase 1 (PP1) to dephosphorylate the translation initiation factor 2α (eIF2α) and avoid shut-off of global protein synthesis and downstream activation of the pro-apoptotic factor CHOP. Residues V16 and F18A were critical for binding of DP71L to PP1. Mutation of this PP1 binding motif or deletion of residues between 52 and 66 reduced the ability of DP71L to cause dephosphorylation of eIF2α and inhibit CHOP induction. The residues LSAVL, between 57 and 61, were also required. PP1 was co-precipitated with wild type DP71L and the mutant lacking residues 52- 66 or the LSAVL motif, but not with the PP1 binding motif mutant. The residues in the LSAVL motif play a critical role in DP71L function but do not interfere with binding to PP1. Instead we propose these residues are important for DP71L binding to eIF2α. - Highlights: •The African swine fever virus DP71L protein recruits protein phosphatase 1 (PP1) to dephosphorylate translation initiation factor eIF2α (eIF2α). •The residues V{sup 16}, F{sup 18} of DP71L are required for binding to the α, β and γ isoforms of PP1 and for DP71L function. •The sequence LSAVL downstream from the PP1 binding site (residues 57–61) are also important for DP71L function. •DP71L mutants of the LSAVL sequence retain ability to co-precipitate with PP1 showing these sequences have a different role to PP1 binding.

  4. An Involvement of PI3-K/Akt Activation and Inhibition of AIF Translocation in Neuroprotective Effects of Undecylenic Acid (UDA) Against Pro-Apoptotic Factors-Induced Cell Death in Human Neuroblastoma SH-SY5Y Cells.

    Science.gov (United States)

    Jantas, Danuta; Piotrowski, Marek; Lason, Wladyslaw

    2015-12-01

    Undecylenic acid (UDA), a naturally occurring 11-carbon unsaturated fatty acid, has been used for several years as an economical antifungal agent and a nutritional supplement. Recently, the potential usefulness of UDA as a neuroprotective drug has been suggested based on the ability of this agent to inhibit μ-calpain activity. In order to verify neuroprotective potential of UDA, we tested protective efficacy of this compound against cell damage evoked by pro-apoptotic factors (staurosporine and doxorubicin) and oxidative stress (hydrogen peroxide) in human neuroblastoma SH-SY5Y cells. We showed that UDA partially protected SH-SY5Y cells against the staurosporine- and doxorubicin-evoked cell death; however, this effect was not connected with its influence on caspase-3 activity. UDA decreased the St-induced changes in mitochondrial and cytosolic AIF level, whereas in Dox-model it affected only the cytosolic AIF content. Moreover, UDA (1-40 μM) decreased the hydrogen peroxide-induced cell damage which was connected with attenuation of hydrogen peroxide-mediated necrotic (PI staining, ADP/ATP ratio) and apoptotic (mitochondrial membrane potential, caspase-3 activation, AIF translocation) changes. Finally, we demonstrated that an inhibitor of PI3-K/Akt (LY294002) but not MAPK/ERK1/2 (U0126) pathway blocked the protection mediated by UDA in all tested models of SH-SY5Y cell injury. These in vitro data point to UDA as potentially effective neuroprotectant the utility of which should be further validated in animal studies. © 2015 Wiley Periodicals, Inc.

  5. Kaempferol increases apoptosis in human acute promyelocytic leukemia cells and inhibits multidrug resistance genes.

    Science.gov (United States)

    Moradzadeh, Maliheh; Tabarraei, Alijan; Sadeghnia, Hamid Reza; Ghorbani, Ahmad; Mohamadkhani, Ashraf; Erfanian, Saiedeh; Sahebkar, Amirhossein

    2018-02-01

    Acute promyelocytic leukemia (APL) is one of the most life-threatening hematological malignancies. Defects in the cell growth and apoptotic pathways are responsible for both disease pathogenesis and treatment resistance. Therefore, pro-apoptotic agents are potential candidates for APL treatment. Kaempferol is a flavonoid with antioxidant and anti-tumor properties. This study was designed to investigate the cytotoxic, pro-apoptotic, and differentiation-inducing effects of kaempferol on HL-60 and NB4 leukemia cells. Resazurin assay was used to determine cell viability following treatment with kaempferol (12.5-100 μM) and all-trans retinoic acid (ATRA; 10 μM; used as a positive control). Apoptosis and differentiation were also detected using propidium iodide and NBT staining techniques, respectively. Furthermore, the expression levels of genes involved in apoptosis (PI3 K, AKT, BCL2, BAX, p53, p21, PTEN, CASP3, CASP8, and CASP9), differentiation (PML-RAR and HDAC1), and multi-drug resistance (ABCB1 and ABCC1) were determined using quantitative real-time PCR. The protein expressions of Bax/Bcl2 and casp3 were confirmed using Western blot. The results showed that kaempferol decreased cell viability and increased subG1 population in the tested leukemic cells. This effect was associated with decreased expression of Akt, BCL2, ABCB1, and ABCC1 genes, while the expression of CASP3 and BAX/BCL-2 ratio were significantly increased at both gene and protein levels. Kaempferol promoted apoptosis and inhibited multidrug resistance in a concentration-dependent manner, without any differential effect on leukemic cells. In conclusion, this study suggested that kaempferol may be utilized as an appropriate alternative for ATRA in APL patients. © 2017 Wiley Periodicals, Inc.

  6. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  7. Cholesterol and phytosterols differentially regulate the expression of caveolin 1 and a downstream prostate cell growth-suppressor gene

    Science.gov (United States)

    Ifere, Godwin O.; Equan, Anita; Gordon, Kereen; Nagappan, Peri; Igietseme, Joseph U.; Ananaba, Godwin A.

    2010-01-01

    Background The purpose of our study was to show the distinction between the apoptotic and anti-proliferative signaling of phytosterols and cholesterol enrichment in prostate cancer cell lines, mediated by the differential transcription of caveolin-1, and N-myc downstream regulated gene1 (NDRG1), a pro-apoptotic androgen-regulated tumor suppressor. Methods PC-3 and DU145 cells were treated with sterols (cholesterol and phytosterols) for 72 h, followed by trypan blue dye exclusion measurement of necrosis and cell growth measured with a Coulter counter. Sterol induction of cell growth-suppressor gene expression was evaluated by mRNA transcription using RT-PCR, while cell cycle analysis was performed by FACS analysis. Altered expression of Ndrg1 protein was confirmed by Western blot analysis. Apoptosis was evaluated by real time RT-PCR amplification of P53, Bcl-2 gene and its related pro- and anti-apoptotic family members. Results Physiological doses (16 µM) of cholesterol and phytosterols were not cytotoxic in these cells. Cholesterol enrichment promoted cell growth (Pphytosterols significantly induced growth-suppression (Pphytosterols decreased mitotic subpopulations. We demonstrated for the first time that cholesterols concertedly attenuated the expression of caveolin-1(cav-1) and NDRG1 genes in both prostate cancer cell lines. Phytosterols had the opposite effect by inducing overexpression of cav-1, a known mediator of androgen-dependent signals that presumably control cell growth or apoptosis. Conclusions Cholesterol and phytosterol treatment differentially regulated the growth of prostate cancer cells and the expression of p53 and cav-1, a gene that regulates androgen-regulated signals. These sterols also differentially regulated cell cycle arrest, downstream pro-apoptotic androgen-regulated tumor-suppressor, NDRG1 suggesting that cav-1 may mediate pro-apoptotic NDRG1 signals. Elucidation of the mechanism for sterol modulation of growth and apoptosis signaling

  8. Reg Gene Expression in Periosteum after Fracture and Its In Vitro Induction Triggered by IL-6

    Directory of Open Access Journals (Sweden)

    Yasuaki Tohma

    2017-10-01

    Full Text Available The periosteum is a thin membrane that surrounds the outer surface of bones and participates in fracture healing. However, the molecular signals that trigger/initiate the periosteal reaction are not well established. We fractured the rat femoral bone at the diaphysis and fixed it with an intramedullary inserted wire, and the expression of regenerating gene (Reg I, which encodes a tissue regeneration/growth factor, was analyzed. Neither bone/marrow nor muscle showed Reg I gene expression before or after the fracture. By contrast, the periosteum showed an elevated expression after the fracture, thereby confirming the localization of Reg I expression exclusively in the periosteum around the fractured areas. Expression of the Reg family increased after the fracture, followed by a decrease to basal levels by six weeks, when the fracture had almost healed. In vitro cultures of periosteal cells showed no Reg I expression, but the addition of IL-6 significantly induced Reg I gene expression. The addition of IL-6 also increased the cell number and reduced pro-apoptotic gene expression of Bim. The increased cell proliferation and reduction in Bim gene expression were abolished by transfection with Reg I siRNA, indicating that these IL-6-dependent effects require the Reg I gene expression. These results indicate the involvement of the IL-6/Reg pathway in the osteogenic response of the periosteum, which leads to fracture repair.

  9. Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC)

    International Nuclear Information System (INIS)

    Glaysher, Sharon; Modi, Paul; Rahamim, Joe; Smith, Mark E; Amer, Khalid; Addis, Bruce; Poole, Matthew; Narayanan, Ajit; Gulliford, Tim J; Andreotti, Peter E; Cree, Ian A; Yiannakis, Dennis; Gabriel, Francis G; Johnson, Penny; Polak, Marta E; Knight, Louise A; Goldthorpe, Zoe; Peregrin, Katharine; Gyi, Mya

    2009-01-01

    NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA) and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE) tissue. There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer

  10. Resistance gene expression determines the in vitro chemosensitivity of non-small cell lung cancer (NSCLC

    Directory of Open Access Journals (Sweden)

    Amer Khalid

    2009-08-01

    Full Text Available Abstract Background NSCLC exhibits considerable heterogeneity in its sensitivity to chemotherapy and similar heterogeneity is noted in vitro in a variety of model systems. This study has tested the hypothesis that the molecular basis of the observed in vitro chemosensitivity of NSCLC lies within the known resistance mechanisms inherent to these patients' tumors. Methods The chemosensitivity of a series of 49 NSCLC tumors was assessed using the ATP-based tumor chemosensitivity assay (ATP-TCA and compared with quantitative expression of resistance genes measured by RT-PCR in a Taqman Array™ following extraction of RNA from formalin-fixed paraffin-embedded (FFPE tissue. Results There was considerable heterogeneity between tumors within the ATP-TCA, and while this showed no direct correlation with individual gene expression, there was strong correlation of multi-gene signatures for many of the single agents and combinations tested. For instance, docetaxel activity showed some dependence on the expression of drug pumps, while cisplatin activity showed some dependence on DNA repair enzyme expression. Activity of both drugs was influenced more strongly still by the expression of anti- and pro-apoptotic genes by the tumor for both docetaxel and cisplatin. The doublet combinations of cisplatin with gemcitabine and cisplatin with docetaxel showed gene expression signatures incorporating resistance mechanisms for both agents. Conclusion Genes predicted to be involved in known mechanisms drug sensitivity and resistance correlate well with in vitro chemosensitivity and may allow the definition of predictive signatures to guide individualized chemotherapy in lung cancer.

  11. Pro-Apoptotic Breast Cancer Nanotherapeutics

    Science.gov (United States)

    2013-07-01

    R.; Hagooly, A.; Chen, Z.; Welch, M. J.; Wooley, K. L. Folate -Mediated Cell Uptake of Shell-Cross- linked Spheres and Cylinders. J. Polym. Sci. Part...Cancer Res. 1995, 55, 3825–3834. 44. Masson, C.; Scherman, D.; Bessodes, M. 2,2,6,6-Tetra- methyl -1-Piperidinyl-Oxyl/[Bis(Acetoxy)-Iodo]Benzene

  12. Ageing genes

    DEFF Research Database (Denmark)

    Rattan, Suresh

    2018-01-01

    The idea of gerontogenes is in line with the evolutionary explanation of ageing as being an emergent phenomenon as a result of the imperfect maintenance and repair systems. Although evolutionary processes did not select for any specific ageing genes that restrict and determine the lifespan...... of an individual, the term ‘gerontogenes’ primarily refers to any genes that may seem to influence ageing and longevity, without being specifically selected for that role. Such genes can also be called ‘virtual gerontogenes’ by virtue of their indirect influence on the rate and process of ageing. More than 1000...... virtual gerontogenes have been associated with ageing and longevity in model organisms and humans. The ‘real’ genes, which do influence the essential lifespan of a species, and have been selected for in accordance with the evolutionary life history of the species, are known as the longevity assurance...

  13. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    Science.gov (United States)

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  14. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  15. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  16. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    Science.gov (United States)

    2011-01-01

    Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1) gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA), Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i) some cationic liposomes may not be suitable for functional studies on hsp promoters, ii) lipofection may cause unintended changes in global gene expression in the transfected cells. PMID:21663599

  17. Liposome-based DNA carriers may induce cellular stress response and change gene expression pattern in transfected cells

    Directory of Open Access Journals (Sweden)

    Lisowska Katarzyna Marta

    2011-06-01

    Full Text Available Abstract Background During functional studies on the rat stress-inducible Hspa1b (hsp70.1 gene we noticed that some liposome-based DNA carriers, which are used for transfection, induce its promoter activity. This observation concerned commercial liposome formulations (LA, Lipofectin and Lipofectamine 2000. This work was aimed to understand better the mechanism of this phenomenon and its potential biological and practical consequences. Results We found that a reporter gene driven by Hspa1b promoter is activated both in the case of transient transfections and in the stably transfected cells treated with LA. Using several deletion clones containing different fragments of Hspa1b promoter, we found that the regulatory elements responsible for most efficient LA-driven inducibility were located between nucleotides -269 and +85, relative to the transcription start site. Further studies showed that the induction mechanism was independent of the classical HSE-HSF interaction that is responsible for gene activation during heat stress. Using DNA microarrays we also detected significant activation of the endogenous Hspa1b gene in cells treated with Lipofectamine 2000. Several other stress genes were also induced, along with numerous genes involved in cellular metabolism, cell cycle control and pro-apoptotic pathways. Conclusions Our observations suggest that i some cationic liposomes may not be suitable for functional studies on hsp promoters, ii lipofection may cause unintended changes in global gene expression in the transfected cells.

  18. Gene doping.

    Science.gov (United States)

    Haisma, H J; de Hon, O

    2006-04-01

    Together with the rapidly increasing knowledge on genetic therapies as a promising new branch of regular medicine, the issue has arisen whether these techniques might be abused in the field of sports. Previous experiences have shown that drugs that are still in the experimental phases of research may find their way into the athletic world. Both the World Anti-Doping Agency (WADA) and the International Olympic Committee (IOC) have expressed concerns about this possibility. As a result, the method of gene doping has been included in the list of prohibited classes of substances and prohibited methods. This review addresses the possible ways in which knowledge gained in the field of genetic therapies may be misused in elite sports. Many genes are readily available which may potentially have an effect on athletic performance. The sporting world will eventually be faced with the phenomena of gene doping to improve athletic performance. A combination of developing detection methods based on gene arrays or proteomics and a clear education program on the associated risks seems to be the most promising preventive method to counteract the possible application of gene doping.

  19. Gene Locater

    DEFF Research Database (Denmark)

    Anwar, Muhammad Zohaib; Sehar, Anoosha; Rehman, Inayat-Ur

    2012-01-01

    software's for calculating recombination frequency is mostly limited to the range and flexibility of this type of analysis. GENE LOCATER is a fully customizable program for calculating recombination frequency, written in JAVA. Through an easy-to-use interface, GENE LOCATOR allows users a high degree...... of flexibility in calculating genetic linkage and displaying linkage group. Among other features, this software enables user to identify linkage groups with output visualized graphically. The program calculates interference and coefficient of coincidence with elevated accuracy in sample datasets. AVAILABILITY...

  20. Gene expression analysis of cell death induction by Taurolidine in different malignant cell lines

    International Nuclear Information System (INIS)

    Chromik, Ansgar M; Weyhe, Dirk; Mittelkötter, Ulrich; Uhl, Waldemar; Hahn, Stephan A; Daigeler, Adrien; Flier, Annegret; Bulut, Daniel; May, Christina; Harati, Kamran; Roschinsky, Jan; Sülberg, Dominique

    2010-01-01

    The anti-infective agent Taurolidine (TRD) has been shown to have cell death inducing properties, but the mechanism of its action is largely unknown. The aim of this study was to identify potential common target genes modulated at the transcriptional level following TRD treatment in tumour cell lines originating from different cancer types. Five different malignant cell lines (HT29, Chang Liver, HT1080, AsPC-1 and BxPC-3) were incubated with TRD (100 μM, 250 μM and 1000 μM). Proliferation after 8 h and cell viability after 24 h were analyzed by BrdU assay and FACS analysis, respectively. Gene expression analyses were carried out using the Agilent -microarray platform to indentify genes which displayed conjoint regulation following the addition of TRD in all cell lines. Candidate genes were subjected to Ingenuity Pathways Analysis and selected genes were validated by qRT-PCR and Western Blot. TRD 250 μM caused a significant inhibition of proliferation as well as apoptotic cell death in all cell lines. Among cell death associated genes with the strongest regulation in gene expression, we identified pro-apoptotic transcription factors (EGR1, ATF3) as well as genes involved in the ER stress response (PPP1R15A), in ubiquitination (TRAF6) and mitochondrial apoptotic pathways (PMAIP1). This is the first conjoint analysis of potential target genes of TRD which was performed simultaneously in different malignant cell lines. The results indicate that TRD might be involved in different signal transduction pathways leading to apoptosis

  1. Vaccine-induced modulation of gene expression in turbot peritoneal cells. A microarray approach.

    Science.gov (United States)

    Fontenla, Francisco; Blanco-Abad, Verónica; Pardo, Belén G; Folgueira, Iria; Noia, Manuel; Gómez-Tato, Antonio; Martínez, Paulino; Leiro, José M; Lamas, Jesús

    2016-07-01

    We used a microarray approach to examine changes in gene expression in turbot peritoneal cells after injection of the fish with vaccines containing the ciliate parasite Philasterides dicentrarchi as antigen and one of the following adjuvants: chitosan-PVMMA microspheres, Freund́s complete adjuvant, aluminium hydroxide gel or Matrix-Q (Isconova, Sweden). We identified 374 genes that were differentially expressed in all groups of fish. Forty-two genes related to tight junctions and focal adhesions and/or actin cytoskeleton were differentially expressed in free peritoneal cells. The profound changes in gene expression related to cell adherence and cytoskeleton may be associated with cell migration and also with the formation of cell-vaccine masses and their attachment to the peritoneal wall. Thirty-five genes related to apoptosis were differentially expressed. Although most of the proteins coded by these genes have a proapoptotic effect, others are antiapoptotic, indicating that both types of signals occur in peritoneal leukocytes of vaccinated fish. Interestingly, many of the genes related to lymphocytes and lymphocyte activity were downregulated in the groups injected with vaccine. We also observed decreased expression of genes related to antigen presentation, suggesting that macrophages (which were abundant in the peritoneal cavity after vaccination) did not express these during the early inflammatory response in the peritoneal cavity. Finally, several genes that participate in the inflammatory response were differentially expressed, and most participated in resolution of inflammation, indicating that an M2 macrophage response is generated in the peritoneal cavity of fish one day post vaccination. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Genes of cell-cell interactions, chemotherapy detoxification and apoptosis are induced during chemotherapy of acute myeloid leukemia

    International Nuclear Information System (INIS)

    Øyan, Anne Margrete; Ånensen, Nina; Bø, Trond Hellem; Stordrange, Laila; Jonassen, Inge; Bruserud, Øystein; Kalland, Karl-Henning; Gjertsen, Bjørn Tore

    2009-01-01

    The molecular changes in vivo in acute myeloid leukemia cells early after start of conventional genotoxic chemotherapy are incompletely understood, and it is not known if early molecular modulations reflect clinical response. The gene expression was examined by whole genome 44 k oligo microarrays and 12 k cDNA microarrays in peripheral blood leukocytes collected from seven leukemia patients before treatment, 2–4 h and 18–24 h after start of chemotherapy and validated by real-time quantitative PCR. Statistically significantly upregulated genes were classified using gene ontology (GO) terms. Parallel samples were examined by flow cytometry for apoptosis by annexin V-binding and the expression of selected proteins were confirmed by immunoblotting. Significant differential modulation of 151 genes were found at 4 h after start of induction therapy with cytarabine and anthracycline, including significant overexpression of 31 genes associated with p53 regulation. Within 4 h of chemotherapy the BCL2/BAX and BCL2/PUMA ratio were attenuated in proapoptotic direction. FLT3 mutations indicated that non-responders (5/7 patients, 8 versus 49 months survival) are characterized by a unique gene response profile before and at 4 h. At 18–24 h after chemotherapy, the gene expression of p53 target genes was attenuated, while genes involved in chemoresistance, cytarabine detoxification, chemokine networks and T cell receptor were prominent. No signs of apoptosis were observed in the collected cells, suggesting the treated patients as a physiological source of pre-apoptotic cells. Pre-apoptotic gene expression can be monitored within hours after start of chemotherapy in patients with acute myeloid leukemia, and may be useful in future determination of therapy responders. The low number of patients and the heterogeneity of acute myeloid leukemia limited the identification of gene expression predictive of therapy response. Therapy-induced gene expression reflects the complex

  3. Vitrification affects nuclear maturation and gene expression of immature human oocytes

    Directory of Open Access Journals (Sweden)

    Abbas Shahedi

    2017-02-01

    Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro  (fIVM , and  (II GV oocytes (n=107 that initially vitrified, then matured in  in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile. 

  4. Gene Ontology

    Directory of Open Access Journals (Sweden)

    Gaston K. Mazandu

    2012-01-01

    Full Text Available The wide coverage and biological relevance of the Gene Ontology (GO, confirmed through its successful use in protein function prediction, have led to the growth in its popularity. In order to exploit the extent of biological knowledge that GO offers in describing genes or groups of genes, there is a need for an efficient, scalable similarity measure for GO terms and GO-annotated proteins. While several GO similarity measures exist, none adequately addresses all issues surrounding the design and usage of the ontology. We introduce a new metric for measuring the distance between two GO terms using the intrinsic topology of the GO-DAG, thus enabling the measurement of functional similarities between proteins based on their GO annotations. We assess the performance of this metric using a ROC analysis on human protein-protein interaction datasets and correlation coefficient analysis on the selected set of protein pairs from the CESSM online tool. This metric achieves good performance compared to the existing annotation-based GO measures. We used this new metric to assess functional similarity between orthologues, and show that it is effective at determining whether orthologues are annotated with similar functions and identifying cases where annotation is inconsistent between orthologues.

  5. The CDK inhibitor p21 is a novel target gene of ATF4 and contributes to cell survival under ER stress.

    Science.gov (United States)

    Inoue, Yasumichi; Kawachi, Shiori; Ohkubo, Tsubasa; Nagasaka, Mai; Ito, Shogo; Fukuura, Keishi; Itoh, Yuka; Ohoka, Nobumichi; Morishita, Daisuke; Hayashi, Hidetoshi

    2017-11-01

    Activating transcription factor 4 (ATF4) is well known for its role in the endoplasmic reticulum (ER) stress response. ATF4 also transcriptionally induces multiple effectors that determine cell fate depending on cellular context. In addition, ATF4 can communicate both pro-apoptotic and pro-survival signals. How ATF4 mediates its prosurvival roles, however, requires further investigation. Here, we report that the CDK inhibitor p21 is a novel target gene of ATF4. We identified two ATF4-responsive elements, one of which directly binds ATF4, within the first intron of the p21 gene. Importantly, overexpression of p21 enhances cell survival following ER stress induction, while p21 knockdown increases cell death. These results suggest that p21 induction plays a vital role in the cellular response to ER stress and indicate that p21 is a prosurvival effector of ATF4. © 2017 Federation of European Biochemical Societies.

  6. Gene doping: gene delivery for olympic victory

    OpenAIRE

    Gould, David

    2012-01-01

    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called ‘gene doping’. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted...

  7. Systematic Analysis of Time-Series Gene Expression Data on Tumor Cell-Selective Apoptotic Responses to HDAC Inhibitors

    Directory of Open Access Journals (Sweden)

    Yun-feng Qi

    2014-01-01

    Full Text Available SAHA (suberoylanilide hydroxamic acid or vorinostat is the first nonselective histone deacetylase (HDAC inhibitor approved by the US Food and Drug Administration (FDA. SAHA affects histone acetylation in chromatin and a variety of nonhistone substrates, thus influencing many cellular processes. In particularly, SAHA induces selective apoptosis of tumor cells, although the mechanism is not well understood. A series of microarray experiments was recently conducted to investigate tumor cell-selective proapoptotic transcriptional responses induced by SAHA. Based on that gene expression time series, we propose a novel framework for detailed analysis of the mechanism of tumor cell apoptosis selectively induced by SAHA. Our analyses indicated that SAHA selectively disrupted the DNA damage response, cell cycle, p53 expression, and mitochondrial integrity of tumor samples to induce selective tumor cell apoptosis. Our results suggest a possible regulation network. Our research extends the existing research.

  8. Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

    Science.gov (United States)

    Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

    2002-02-05

    Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

  9. Genes and Hearing Loss

    Science.gov (United States)

    ... ENTCareers Marketplace Find an ENT Doctor Near You Genes and Hearing Loss Genes and Hearing Loss Patient ... mutation may only have dystopia canthorum. How Do Genes Work? Genes are a road map for the ...

  10. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  11. Imaging reporter gene for monitoring gene therapy

    International Nuclear Information System (INIS)

    Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

    2002-01-01

    Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

  12. Analysis of gene expression in fetal and adult cells infected with rubella virus

    International Nuclear Information System (INIS)

    Adamo, Maria Pilar; Zapata, Marta; Frey, Teryl K.

    2008-01-01

    Congenital infection with rubella virus (RUB) leads to persistent infection and congenital defects and we showed previously that primary human fetal fibroblasts did not undergo apoptosis when infected with RUB, which could promote fetal virus persistence [Adamo, P., Asis, L., Silveyra, P., Cuffini, C., Pedranti, M., Zapata, M., 2004. Rubella virus does not induce apoptosis in primary human embryo fibroblasts cultures: a possible way of viral persistence in congenital infection. Viral Immunol. 17, 87-100]. To extend this observation, gene chip analysis was performed on a line of primary human fetal fibroblasts (10 weeks gestation) and a line of human adult lung fibroblasts (which underwent apoptosis in response to RUB infection) to compare gene expression in infected and uninfected cells. A total of 632 and 516 genes were upregulated or downregulated in the infected fetal and adult cells respectively in comparison to uninfected cells, however only 52 genes were regulated in both cell types. Although the regulated genes were different, across functional gene categories the patterns of gene regulation were similar. In general, regulation of pro- and anti-apoptotic genes following infection appeared to favor apoptosis in the adult cells and lack of apoptosis in the fetal cells, however there was a greater relative expression of anti-apoptotic genes and reduced expression of pro-apoptotic genes in uninfected fetal cells versus uninfected adult cells and thus the lack of apoptosis in fetal cells following RUB infection was also due to the prevailing background of gene expression that is antagonistic to apoptosis. In support of this hypothesis, it was found that of a battery of five chemicals known to induce apoptosis, two induced apoptosis in the adult cells, but not in fetal cells, and two induced apoptosis more rapidly in the adult cells than in fetal cells (the fifth did not induce apoptosis in either). A robust interferon-stimulated gene response was induced

  13. Cardioprotection by gene therapy: A review paper on behalf of the Working Group on Drug Cardiotoxicity and Cardioprotection of the Italian Society of Cardiology.

    Science.gov (United States)

    Madonna, Rosalinda; Cadeddu, Christian; Deidda, Martino; Giricz, Zoltán; Madeddu, Clelia; Mele, Donato; Monte, Ines; Novo, Giuseppina; Pagliaro, Pasquale; Pepe, Alessia; Spallarossa, Paolo; Tocchetti, Carlo Gabriele; Varga, Zoltán V; Zito, Concetta; Geng, Yong-Jian; Mercuro, Giuseppe; Ferdinandy, Peter

    2015-07-15

    Ischemic heart disease remains the leading cause of death worldwide. Ischemic pre-, post-, and remote conditionings trigger endogenous cardioprotection that renders the heart resistant to ischemic-reperfusion injury (IRI). Mimicking endogenous cardioprotection by modulating genes involved in cardioprotective signal transduction provides an opportunity to reproduce endogenous cardioprotection with better possibilities of translation into the clinical setting. Genes and signaling pathways by which conditioning maneuvers exert their effects on the heart are partially understood. This is due to the targeted approach that allowed identifying one or a few genes associated with IRI and cardioprotection. Genes critical for signaling pathways in cardioprotection include protectomiRs (e.g., microRNA 125b*), ZAC1 transcription factor, pro-inflammatory genes such as cycloxygenase (COX)-2 and inducible nitric oxide synthase (iNOS), antioxidant enzymes such as hemoxygenase (HO)-1, extracellular and manganese superoxidase dismutases (ec-SOD and Mg-SOD), heat shock proteins (HSPs), growth factors such as insulin like growth factor (IGF)-1 and hepatocyte growth factor (HGF), antiapoptotic proteins such as Bcl-2 and Bcl-xL, pro-apoptotic proteins such as FasL, Bcl-2, Bax, caspase-3 and p53, and proangiogenic genes such as TGFbeta, sphingosine kinase 1 (SPK1), and PI3K-Akt. By identifying the gene expression profiles of IRI and ischemic conditioning, one may reveal potential gene targets responsible for cardioprotection. In this manuscript, we review the current state of the art of gene therapy in cardioprotection and propose that gene expression analysis facilitates the identification of individual genes associated with cardioprotection. We discuss signaling pathways associated with cardioprotection that can be targeted by gene therapy to achieve cardioprotection. Copyright © 2015. Published by Elsevier Ireland Ltd.

  14. Comprehensive identification of genes driven by ERV9-LTRs reveals TNFRSF10B as a re-activatable mediator of testicular cancer cell death

    Science.gov (United States)

    Beyer, U; Krönung, S K; Leha, A; Walter, L; Dobbelstein, M

    2016-01-01

    The long terminal repeat (LTR) of human endogenous retrovirus type 9 (ERV9) acts as a germline-specific promoter that induces the expression of a proapoptotic isoform of the tumor suppressor homologue p63, GTAp63, in male germline cells. Testicular cancer cells silence this promoter, but inhibitors of histone deacetylases (HDACs) restore GTAp63 expression and give rise to apoptosis. We show here that numerous additional transcripts throughout the genome are driven by related ERV9-LTRs. 3' Rapid amplification of cDNA ends (3'RACE) was combined with next-generation sequencing to establish a large set of such mRNAs. HDAC inhibitors induce these ERV9-LTR-driven genes but not the LTRs from other ERVs. In particular, a transcript encoding the death receptor DR5 originates from an ERV9-LTR inserted upstream of the protein coding regions of the TNFRSF10B gene, and it shows an expression pattern similar to GTAp63. When treating testicular cancer cells with HDAC inhibitors as well as the death ligand TNF-related apoptosis-inducing ligand (TRAIL), rapid cell death was observed, which depended on TNFRSF10B expression. HDAC inhibitors also cooperate with cisplatin (cDDP) to promote apoptosis in testicular cancer cells. ERV9-LTRs not only drive a large set of human transcripts, but a subset of them acts in a proapoptotic manner. We propose that this avoids the survival of damaged germ cells. HDAC inhibition represents a strategy of restoring the expression of a class of ERV9-LTR-mediated genes in testicular cancer cells, thereby re-enabling tumor suppression. PMID:26024393

  15. Deregulation of apoptosis-related genes is associated with PRV1 overexpression and JAK2 V617F allele burden in Essential Thrombocythemia and Myelofibrosis

    Directory of Open Access Journals (Sweden)

    Tognon Raquel

    2012-02-01

    Full Text Available Abstract Background Essential Thrombocythemia (ET and Primary Myelofibrosis (PMF are Chronic Myeloproliferative Neoplasms (MPN characterized by clonal myeloproliferation/myeloaccumulation without cell maturation impairment. The JAK2 V617F mutation and PRV1 gene overexpression may contribute to MPN physiopathology. We hypothesized that deregulation of the apoptotic machinery may also play a role in the pathogenesis of ET and PMF. In this study we evaluated the apoptosis-related gene and protein expression of BCL2 family members in bone marrow CD34+ hematopoietic stem cells (HSC and peripheral blood leukocytes from ET and PMF patients. We also tested whether the gene expression results were correlated with JAK2 V617F allele burden percentage, PRV1 overexpression, and clinical and laboratory parameters. Results By real time PCR assay, we observed that A1, MCL1, BIK and BID, as well as A1, BCLW and BAK gene expression were increased in ET and PMF CD34+ cells respectively, while pro-apoptotic BAX and anti-apoptotic BCL2 mRNA levels were found to be lower in ET and PMF CD34+ cells respectively, in relation to controls. In patients' leukocytes, we detected an upregulation of anti-apoptotic genes A1, BCL2, BCL-XL and BCLW. In contrast, pro-apoptotic BID and BIMEL expression were downregulated in ET leukocytes. Increased BCL-XL protein expression in PMF leukocytes and decreased BID protein expression in ET leukocytes were observed by Western Blot. In ET leukocytes, we found a correlation between JAK2 V617F allele burden and BAX, BIK and BAD gene expression and between A1, BAX and BIK and PRV1 gene expression. A negative correlation between PRV1 gene expression and platelet count was observed, as well as a positive correlation between PRV1 gene expression and splenomegaly. Conclusions Our results suggest the participation of intrinsic apoptosis pathway in the MPN physiopathology. In addition, PRV1 and JAK2 V617F allele burden were linked to deregulation

  16. Onconase responsive genes in human mesothelioma cells: implications for an RNA damaging therapeutic agent

    International Nuclear Information System (INIS)

    Altomare, Deborah A; Rybak, Susanna M; Pei, Jianming; Maizel, Jacob V; Cheung, Mitchell; Testa, Joseph R; Shogen, Kuslima

    2010-01-01

    Onconase represents a new class of RNA-damaging drugs. Mechanistically, Onconase is thought to internalize, where it degrades intracellular RNAs such as tRNA and double-stranded RNA, and thereby suppresses protein synthesis. However, there may be additional or alternative mechanism(s) of action. In this study, microarray analysis was used to compare gene expression profiles in untreated human malignant mesothelioma (MM) cell lines and cells exposed to 5 μg/ml Onconase for 24 h. A total of 155 genes were found to be regulated by Onconase that were common to both epithelial and biphasic MM cell lines. Some of these genes are known to significantly affect apoptosis (IL-24, TNFAIP3), transcription (ATF3, DDIT3, MAFF, HDAC9, SNAPC1) or inflammation and the immune response (IL-6, COX-2). RT-PCR analysis of selected up- or down-regulated genes treated with varying doses and times of Onconase generally confirmed the expression array findings in four MM cell lines. Onconase treatment consistently resulted in up-regulation of IL-24, previously shown to have tumor suppressive activity, as well as ATF3 and IL-6. Induction of ATF3 and the pro-apoptotic factor IL-24 by Onconase was highest in the two most responsive MM cell lines, as defined by DNA fragmentation analysis. In addition to apoptosis, gene ontology analysis indicated that pathways impacted by Onconase include MAPK signaling, cytokine-cytokine-receptor interactions, and Jak-STAT signaling. These results provide a broad picture of gene activity after treatment with a drug that targets small non-coding RNAs and contribute to our overall understanding of MM cell response to Onconase as a therapeutic strategy. The findings provide insights regarding mechanisms that may contribute to the efficacy of this novel drug in clinical trials of MM patients who have failed first line chemotherapy or radiation treatment

  17. ato-Gal4 fly lines for gene function analysis: Eya is required in late progenitors for eye morphogenesis.

    Science.gov (United States)

    Yu, Linlin; Zhou, Qingxiang; Pignoni, Francesca

    2015-06-01

    The Gal4/UAS system is one of the most powerful tools for the study of cellular and developmental processes in Drosophila. Gal4 drivers can be used to induce targeted expression of dominant-negative and dominant-active proteins, histological markers, activity sensors, gene-specific dsRNAs, modulators of cell survival or proliferation, and other reagents. Here, we describe novel atonal-Gal4 lines that contain regions of the regulatory DNA of atonal, the proneural gene for photoreceptors, stretch receptors, auditory organ, and some olfactory sensilla. During neurogenesis, the atonal gene is expressed at a critical juncture, a time of transition from progenitor cell to developing neuron. Thus, these lines are particularly well suited for the study of the transcription factors and signaling molecules orchestrating this critical transition. To demonstrate their usefulness, we focus on two visual organs, the eye and the Bolwig. We demonstrate the induction of predicted eye phenotypes when expressing the dominant-negative EGF receptor or a dsRNA against Notch in the developing eye disc. In another example, we show the deletion of the Bolwig's organ using the proapoptotic factor Hid. Finally, we investigate the function of the eye specification factor Eyes absent or Eya in late retinal progenitors, shortly before they begin morphogenesis. We show that Eya is still required in these late progenitors to promote eye formation, and show failure to induce the target gene atonal and consequent lack of neuron formation. © 2015 Wiley Periodicals, Inc.

  18. Induction of Bim and Bid gene expression during accelerated apoptosis in severe sepsis.

    Science.gov (United States)

    Weber, Stefan U; Schewe, Jens-Christian; Lehmann, Lutz E; Müller, Stefan; Book, Malte; Klaschik, Sven; Hoeft, Andreas; Stüber, Frank

    2008-01-01

    In transgenic animal models of sepsis, members of the Bcl-2 family of proteins regulate lymphocyte apoptosis and survival of sepsis. This study investigates the gene regulation of pro-apoptotic and anti-apoptotic members of the Bcl-2 family of proteins in patients with early stage severe sepsis. In this prospective case-control study, patients were recruited from three intensive care units (ICUs) in a university hospital. Sixteen patients were enrolled when they fulfilled the criteria of severe sepsis. Ten critically ill but non-septic patients and 11 healthy volunteers served as controls. Blood samples were immediately obtained at inclusion. To confirm the presence of accelerated apoptosis in the patient groups, caspase-3 activation and phosphatidylserine externalisation in CD4+, CD8+ and CD19+ lymphocyte subsets were assessed using flow cytometry. Specific mRNAs of Bcl-2 family members were quantified from whole blood by real-time PCR. To test for statistical significance, Kruskal-Wallis testing with Dunn's multiple comparison test for post hoc analysis was performed. In all lymphocyte populations caspase-3 (p < 0.05) was activated, which was reflected in an increased phosphatidylserine externalisation (p < 0.05). Accordingly, lymphocyte counts were decreased in early severe sepsis. In CD4+ T-cells (p < 0.05) and B-cells (p < 0.001) the Bcl-2 protein was decreased in severe sepsis. Gene expression of the BH3-only Bim was massively upregulated as compared with critically ill patients (p < 0.001) and 51.6-fold as compared with healthy controls (p < 0.05). Bid was increased 12.9-fold compared with critically ill patients (p < 0.001). In the group of mitochondrial apoptosis inducers, Bak was upregulated 5.6-fold, while the expression of Bax showed no significant variations. By contrast, the pro-survival members Bcl-2 and Bcl-xl were both downregulated in severe sepsis (p < 0.001 and p < 0.05, respectively). In early severe sepsis a gene expression pattern with

  19. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  20. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  1. In silico identification of NF-kappaB-regulated genes in pancreatic beta-cells

    Directory of Open Access Journals (Sweden)

    Eizirik Decio L

    2007-02-01

    Full Text Available Abstract Background Pancreatic beta-cells are the target of an autoimmune attack in type 1 diabetes mellitus (T1DM. This is mediated in part by cytokines, such as interleukin (IL-1β and interferon (IFN-γ. These cytokines modify the expression of hundreds of genes, leading to beta-cell dysfunction and death by apoptosis. Several of these cytokine-induced genes are potentially regulated by the IL-1β-activated transcription factor (TF nuclear factor (NF-κB, and previous studies by our group have shown that cytokine-induced NF-κB activation is pro-apoptotic in beta-cells. To identify NF-κB-regulated gene networks in beta-cells we presently used a discriminant analysis-based approach to predict NF-κB responding genes on the basis of putative regulatory elements. Results The performance of linear and quadratic discriminant analysis (LDA, QDA in identifying NF-κB-responding genes was examined on a dataset of 240 positive and negative examples of NF-κB regulation, using stratified cross-validation with an internal leave-one-out cross-validation (LOOCV loop for automated feature selection and noise reduction. LDA performed slightly better than QDA, achieving 61% sensitivity, 91% specificity and 87% positive predictive value, and allowing the identification of 231, 251 and 580 NF-κB putative target genes in insulin-producing INS-1E cells, primary rat beta-cells and human pancreatic islets, respectively. Predicted NF-κB targets had a significant enrichment in genes regulated by cytokines (IL-1β or IL-1β + IFN-γ and double stranded RNA (dsRNA, as compared to genes not regulated by these NF-κB-dependent stimuli. We increased the confidence of the predictions by selecting only evolutionary stable genes, i.e. genes with homologs predicted as NF-κB targets in rat, mouse, human and chimpanzee. Conclusion The present in silico analysis allowed us to identify novel regulatory targets of NF-κB using a supervised classification method based on

  2. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  3. Gene doping: gene delivery for olympic victory.

    Science.gov (United States)

    Gould, David

    2013-08-01

    With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called 'gene doping'. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted from the engineered cells or is retained locally to, or inside engineered cells will, to some extent, determine the likelihood of detection. It is clear that effective gene delivery technologies now exist and it is important that detection and prevention plans are in place. © 2012 The Author. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

  4. New gene targets for glucagon-like peptide-1 during embryonic development and in undifferentiated pluripotent cells.

    Science.gov (United States)

    Sanz, Carmen; Blázquez, Enrique

    2011-09-01

    In humans, glucagon-like peptide (GLP-1) functions during adult life as an incretin hormone with anorexigenic and antidiabetogenic properties. Also, the therapeutic potential of GLP-1 in preventing the adipocyte hyperplasia associated with obesity and in bolstering the maintenance of human mesenchymal stem cell (hMSC) stores by promoting the proliferation and cytoprotection of hMSC seems to be relevant. Since these observations suggest a role for GLP-1 during developmental processes, the aim of the present work was to characterize GLP-1 in early development as well as its gene targets in mouse embryonic stem (mES) cells. Mouse embryos E6, E8, and E10.5 and pluripotent mES were used for the inmunodetection of GLP-1 and GLP-1 receptor. Quantitative real-time PCR was used to determine the expression levels of GLP-1R in several tissues from E12.5 mouse embryos. Additionally, GLP-1 gene targets were studied in mES by multiple gene expression analyses. GLP-1 and its receptors were identified in mES and during embryonic development. In pluripotent mES, GLP-1 modified the expression of endodermal, ectodermal, and mesodermal gene markers as well as sonic hedgehog, noggin, members of the fibroblast and hepatic growth factor families, and others involved in pancreatic development. Additionally, GLP-1 promoted the expression of the antiapoptotic gene bcl2 and at the same time reduced proapoptotic caspase genes. Our results indicate that apart from the effects and therapeutic benefits of GLP-1 in adulthood, it may have additional gene targets in mES cells during embryonic life. Furthermore, the pathophysiological implications of GLP-1 imbalance in adulthood may have a counterpart during development.

  5. Evolution of homeobox genes.

    Science.gov (United States)

    Holland, Peter W H

    2013-01-01

    Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.

  6. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  7. Carboxylesterase 1 genes

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk

    2018-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase that metabolizes commonly used drugs. The CES1-related pseudogene, carboxylesterase 1 pseudogene 1 (CES1P1), has been implicated in gene exchange with CES1 and in the formation of hybrid genes including the carboxylesterase 1A2 gene (CES1A2...

  8. Urban air pollution produces up-regulation of myocardial inflammatory genes and dark chocolate provides cardioprotection.

    Science.gov (United States)

    Villarreal-Calderon, Rodolfo; Reed, William; Palacios-Moreno, Juan; Keefe, Sheyla; Herritt, Lou; Brooks, Diane; Torres-Jardón, Ricardo; Calderón-Garcidueñas, Lilian

    2012-05-01

    Air pollution is a serious environmental problem. Elderly subjects show increased cardiac morbidity and mortality associated with air pollution exposure. Mexico City (MC) residents are chronically exposed to high concentrations of fine particulate matter (PM(2.5)) and PM-associated lipopolysaccharides (PM-LPS). To test the hypothesis that chronic exposure to urban pollution produces myocardial inflammation, female Balb-c mice age 4 weeks were exposed for 16 months to two distinctly different polluted areas within MC: southwest (SW) and northwest (NW). SW mice were given either no treatment or chocolate 2g/9.5 mg polyphenols/3 times per week. Results were compared to mice kept in clean air. Key inflammatory mediator genes: cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), and the LPS receptor CD14 (cluster of differentiation antigen 14) were measured by real-time polymerase chain reaction. Also explored were target NFκB (nuclear factor κB), oxidative stress and antioxidant defense genes. TNF-α, IL-6, and COX-2 were significantly increased in both NW and SWMC mice (p=0.0001). CD14 was up-regulated in SW mice in keeping with the high exposures to particulate matter associated endotoxin. Chocolate administration resulted in a significant down-regulation of TNF-α (p<0.0001), IL-6 (p=0.01), and IL-1β (p=0.02). The up-regulation of antioxidant enzymes and the down-regulation of potent oxidases, toll-like receptors, and pro-apoptotic signaling genes completed the protective profile. Exposure to air pollution produces up-regulation of inflammatory myocardial genes and endotoxin plays a key role in the inflammatory response. Regular consumption of dark chocolate may reduce myocardial inflammation and have cardioprotective properties in the setting of air pollution exposures. Copyright © 2010 Elsevier GmbH. All rights reserved.

  9. The dual role of cyclin C connects stress regulated gene expression to mitochondrial dynamics

    Directory of Open Access Journals (Sweden)

    Randy Strich

    2014-09-01

    Full Text Available Following exposure to cytotoxic agents, cellular damage is first recognized by a variety of sensor mechanisms. Thenceforth, the damage signal is transduced to the nucleus to install the correct gene expression program including the induction of genes whose products either detoxify destructive compounds or repair the damage they cause. Next, the stress signal is disseminated throughout the cell to effect the appropriate changes at organelles including the mitochondria. The mitochondria represent an important signaling platform for the stress response. An initial stress response of the mitochondria is extensive fragmentation. If the damage is prodigious, the mitochondria fragment (fission and lose their outer membrane integrity leading to the release of pro-apoptotic factors necessary for programmed cell death (PCD execution. As this complex biological process contains many moving parts, it must be exquisitely coordinated as the ultimate decision is life or death. The conserved C-type cyclin plays an important role in executing this molecular Rubicon by coupling changes in gene expression to mitochondrial fission and PCD. Cyclin C, along with its cyclin dependent kinase partner Cdk8, associates with the RNA polymerase holoenzyme to regulate transcription. In particular, cyclin C-Cdk8 repress many stress responsive genes. To relieve this repression, cyclin C is destroyed in cells exposed to pro-oxidants and other stressors. However, prior to its destruction, cyclin C, but not Cdk8, is released from its nuclear anchor (Med13, translocates from the nucleus to the cytoplasm where it interacts with the fission machinery and is both necessary and sufficient to induce extensive mitochondria fragmentation. Furthermore, cytoplasmic cyclin C promotes PCD indicating that it mediates both mitochondrial fission and cell death pathways. This review will summarize the role cyclin C plays in regulating stress-responsive transcription. In addition, we will detail

  10. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  11. A high-throughput quantitative expression analysis of cancer-related genes in human HepG2 cells in response to limonene, a potential anticancer agent.

    Science.gov (United States)

    Hafidh, Rand R; Hussein, Saba Z; MalAllah, Mohammed Q; Abdulamir, Ahmed S; Abu Bakar, Fatimah

    2017-11-14

    Citrus bioactive compounds, as active anticancer agent, have been under focus by several studies worldwide. However, the underlying genes responsible for the anticancer potential have not been sufficiently highlighted. The current study investigated the gene expression profile of hepatocellular carcinoma, HepG2, cells after treatment with Limonene. The concentration that killed 50% of HepG2 cells was used to elucidate the genetic mechanisms of limonene anticancer activity. The apoptotic induction was detected by flow cytometry and confocal fluorescence microscope. Two of pro-apoptotic events, caspase-3 activation and phosphatidylserine translocation were manifested by confocal fluorescence microscopy. High-throughput real-time PCR was used to profile 1023 cancer-related genes in 16 different gene families related to the cancer development. In comparison to untreated cells, limonene increased the percentage of apoptotic cells up to 89.61%, by flow cytometry, and 48.2% by fluorescence microscopy. There was a significant limonene-driven differential gene expression of HepG2 cells in 15 different gene families. Limonene was shown to significantly (>2log) up-regulate and down-regulate 14 and 59 genes, respectively. The affected gene families, from most to least affected, were apoptosis induction, signal transduction, cancer genes augmentation, alteration in kinases expression, inflammation, DNA damage repair, and cell cycle proteins. The current study reveals that limonene could be a promising, cheap, and effective anticancer compound. The broad spectrum of limonene anticancer activity is interesting for anticancer drug development. Further research is needed to confirm the current findings and to examine the anticancer potential of limonene along with underlying mechanisms on different cell lines. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice

    Directory of Open Access Journals (Sweden)

    Postina Rolf

    2009-02-01

    Full Text Available Abstract Background In a transgenic mouse model of Alzheimer disease (AD, cleavage of the amyloid precursor protein (APP by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn of this enzyme. As compared to non-transgenic wild-type mice, in ADAM10 transgenic mice 355 genes, and in dnADAM10 mice 143 genes were found to be differentially expressed. A higher number of genes was differentially regulated in double-transgenic mouse strains additionally expressing the human APP[V717I] mutant. Overexpression of proteolytically active ADAM10 affected several physiological pathways, such as cell communication, nervous system development, neuron projection as well as synaptic transmission. Although ADAM10 has been implicated in Notch and β-catenin signaling, no significant changes in the respective target genes were observed in adult ADAM10 transgenic mice. Real-time RT-PCR confirmed a downregulation of genes coding for the inflammation-associated proteins S100a8 and S100a9 induced by moderate ADAM10 overexpression. Overexpression of the dominant-negative form dnADAM10 led to a significant increase in the expression of the fatty acid-binding protein Fabp7, which also has been found in higher amounts in brains of Down syndrome patients. Conclusion In general, there was only a moderate alteration of gene expression in ADAM10 overexpressing mice. Genes coding for pro-inflammatory or pro-apoptotic proteins were not over-represented among differentially regulated genes. Even a decrease of

  13. Gene doping in sports.

    Science.gov (United States)

    Unal, Mehmet; Ozer Unal, Durisehvar

    2004-01-01

    Gene or cell doping is defined by the World Anti-Doping Agency (WADA) as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". New research in genetics and genomics will be used not only to diagnose and treat disease, but also to attempt to enhance human performance. In recent years, gene therapy has shown progress and positive results that have highlighted the potential misuse of this technology and the debate of 'gene doping'. Gene therapies developed for the treatment of diseases such as anaemia (the gene for erythropoietin), muscular dystrophy (the gene for insulin-like growth factor-1) and peripheral vascular diseases (the gene for vascular endothelial growth factor) are potential doping methods. With progress in gene technology, many other genes with this potential will be discovered. For this reason, it is important to develop timely legal regulations and to research the field of gene doping in order to develop methods of detection. To protect the health of athletes and to ensure equal competitive conditions, the International Olympic Committee, WADA and International Sports Federations have accepted performance-enhancing substances and methods as being doping, and have forbidden them. Nevertheless, the desire to win causes athletes to misuse these drugs and methods. This paper reviews the current status of gene doping and candidate performance enhancement genes, and also the use of gene therapy in sports medicine and ethics of genetic enhancement. Copyright 2004 Adis Data Information BV

  14. Depletion of pro-oncogenic RUNX2 enhances gemcitabine (GEM) sensitivity of p53-mutated pancreatic cancer Panc-1 cells through the induction of pro-apoptotic TAp63.

    Science.gov (United States)

    Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu

    2016-11-01

    Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations.

  15. Transcriptomic analysis identifies gene networks regulated by estrogen receptor α (ERα) and ERβ that control distinct effects of different botanical estrogens

    Science.gov (United States)

    Gong, Ping; Madak-Erdogan, Zeynep; Li, Jilong; Cheng, Jianlin; Greenlief, C. Michael; Helferich, William G.; Katzenellenbogen, John A.

    2014-01-01

    The estrogen receptors (ERs) ERα and ERβ mediate the actions of endogenous estrogens as well as those of botanical estrogens (BEs) present in plants. BEs are ingested in the diet and also widely consumed by postmenopausal women as dietary supplements, often as a substitute for the loss of endogenous estrogens at menopause. However, their activities and efficacies, and similarities and differences in gene expression programs with respect to endogenous estrogens such as estradiol (E2) are not fully understood. Because gene expression patterns underlie and control the broad physiological effects of estrogens, we have investigated and compared the gene networks that are regulated by different BEs and by E2. Our aim was to determine if the soy and licorice BEs control similar or different gene expression programs and to compare their gene regulations with that of E2. Gene expression was examined by RNA-Seq in human breast cancer (MCF7) cells treated with control vehicle, BE or E2. These cells contained three different complements of ERs, ERα only, ERα+ERβ, or ERβ only, reflecting the different ratios of these two receptors in different human breast cancers and in different estrogen target cells. Using principal component, hierarchical clustering, and gene ontology and interactome analyses, we found that BEs regulated many of the same genes as did E2. The genes regulated by each BE, however, were somewhat different from one another, with some genes being regulated uniquely by each compound. The overlap with E2 in regulated genes was greatest for the soy isoflavones genistein and S-equol, while the greatest difference from E2 in gene expression pattern was observed for the licorice root BE liquiritigenin. The gene expression pattern of each ligand depended greatly on the cell background of ERs present. Despite similarities in gene expression pattern with E2, the BEs were generally less stimulatory of genes promoting proliferation and were more pro-apoptotic in their

  16. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  17. Lithium-Induced Neuroprotection is Associated with Epigenetic Modification of Specific BDNF Gene Promoter and Altered Expression of Apoptotic-Regulatory Proteins

    Directory of Open Access Journals (Sweden)

    Tushar eDwivedi

    2015-01-01

    Full Text Available Bipolar disorder (BD, one of the most debilitating mental disorders, is associated with increased morbidity and mortality. Lithium is the first line of treatment option for BD and is often used for maintenance therapy. Recently, the neuroprotective action of lithium has gained tremendous attention, given that BD is associated with structural and functional abnormalities of the brain. However, the precise molecular mechanism by which lithium exerts its neuroprotective action is not clearly understood. In hippocampal neurons, the effects of lithium on neuronal viability against glutamate-induced cytotoxicity, dendritic length and number, and expression and methylation of BDNF promoter exons and expression of apoptotic regulatory genes were studied. In rat hippocampal neurons, lithium not only increased dendritic length and number, but also neuronal viability against glutamate-induced cytotoxicity. While lithium increased the expression of BDNF as well as genes associated with neuroprotection such as Bcl2 and Bcl-XL, it decreased the expression of pro-apoptotic genes Bax, Bad, and caspases 3. Interestingly, lithium activated transcription of specific exon IV to induce BDNF gene expression. This was accompanied by hypomethylation of BDNF exon IV promoter. This study delineates mechanisms by which lithium mediates its effects in protecting neurons.

  18. Post-transcriptional gene expression control by NANOS is up-regulated and functionally important in pRb-deficient cells.

    Science.gov (United States)

    Miles, Wayne O; Korenjak, Michael; Griffiths, Lyra M; Dyer, Michael A; Provero, Paolo; Dyson, Nicholas J

    2014-10-01

    Inactivation of the retinoblastoma tumor suppressor (pRb) is a common oncogenic event that alters the expression of genes important for cell cycle progression, senescence, and apoptosis. However, in many contexts, the properties of pRb-deficient cells are similar to wild-type cells suggesting there may be processes that counterbalance the transcriptional changes associated with pRb inactivation. Therefore, we have looked for sets of evolutionary conserved, functionally related genes that are direct targets of pRb/E2F proteins. We show that the expression of NANOS, a key facilitator of the Pumilio (PUM) post-transcriptional repressor complex, is directly repressed by pRb/E2F in flies and humans. In both species, NANOS expression increases following inactivation of pRb/RBF1 and becomes important for tissue homeostasis. By analyzing datasets from normal retinal tissue and pRb-null retinoblastomas, we find a strong enrichment for putative PUM substrates among genes de-regulated in tumors. These include pro-apoptotic genes that are transcriptionally down-regulated upon pRb loss, and we characterize two such candidates, MAP2K3 and MAP3K1, as direct PUM substrates. Our data suggest that NANOS increases in importance in pRb-deficient cells and helps to maintain homeostasis by repressing the translation of transcripts containing PUM Regulatory Elements (PRE). © 2014 The Authors.

  19. Tumor targeted gene therapy

    International Nuclear Information System (INIS)

    Kang, Joo Hyun

    2006-01-01

    Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner

  20. Essential Bacillus subtilis genes

    DEFF Research Database (Denmark)

    Kobayashi, K.; Ehrlich, S.D.; Albertini, A.

    2003-01-01

    To estimate the minimal gene set required to sustain bacterial life in nutritious conditions, we carried out a systematic inactivation of Bacillus subtilis genes. Among approximate to4,100 genes of the organism, only 192 were shown to be indispensable by this or previous work. Another 79 genes were...... predicted to be essential. The vast majority of essential genes were categorized in relatively few domains of cell metabolism, with about half involved in information processing, one-fifth involved in the synthesis of cell envelope and the determination of cell shape and division, and one-tenth related...... to cell energetics. Only 4% of essential genes encode unknown functions. Most essential genes are present throughout a wide range of Bacteria, and almost 70% can also be found in Archaea and Eucarya. However, essential genes related to cell envelope, shape, division, and respiration tend to be lost from...

  1. Radiotechnologies and gene therapy

    International Nuclear Information System (INIS)

    Xia Jinsong

    2001-01-01

    Gene therapy is an exciting frontier in medicine today. Radiologist will make an uniquely contribution to these exciting new technologies at every level by choosing sites for targeting therapy, perfecting and establishing routes of delivery, developing imaging strategies to monitor therapy and assess gene expression, developing radiotherapeutic used of gene therapy

  2. Discovering genes underlying QTL

    Energy Technology Data Exchange (ETDEWEB)

    Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

    2002-02-01

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  3. Gene therapy: An overview

    Directory of Open Access Journals (Sweden)

    Sudip Indu

    2013-01-01

    Full Text Available Gene therapy "the use of genes as medicine" involves the transfer of a therapeutic or working copy of a gene into specific cells of an individual in order to repair a faulty gene copy. The technique may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. The objective of gene therapy is to introduce new genetic material into target cells while causing no damage to the surrounding healthy cells and tissues, hence the treatment related morbidity is decreased. The delivery system includes a vector that delivers a therapeutic gene into the patient′s target cell. Functional proteins are created from the therapeutic gene causing the cell to return to a normal stage. The vectors used in gene therapy can be viral and non-viral. Gene therapy, an emerging field of biomedicine, is still at infancy and much research remains to be done before this approach to the treatment of condition will realize its full potential.

  4. Gene therapy in periodontics.

    Science.gov (United States)

    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini

    2013-03-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  5. Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation

    Directory of Open Access Journals (Sweden)

    Lahiri Ansuman

    2011-09-01

    Full Text Available Abstract Background HIP1 Protein Interactor (HIPPI is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS, present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a

  6. Primetime for Learning Genes.

    Science.gov (United States)

    Keifer, Joyce

    2017-02-11

    Learning genes in mature neurons are uniquely suited to respond rapidly to specific environmental stimuli. Expression of individual learning genes, therefore, requires regulatory mechanisms that have the flexibility to respond with transcriptional activation or repression to select appropriate physiological and behavioral responses. Among the mechanisms that equip genes to respond adaptively are bivalent domains. These are specific histone modifications localized to gene promoters that are characteristic of both gene activation and repression, and have been studied primarily for developmental genes in embryonic stem cells. In this review, studies of the epigenetic regulation of learning genes in neurons, particularly the brain-derived neurotrophic factor gene ( BDNF ), by methylation/demethylation and chromatin modifications in the context of learning and memory will be highlighted. Because of the unique function of learning genes in the mature brain, it is proposed that bivalent domains are a characteristic feature of the chromatin landscape surrounding their promoters. This allows them to be "poised" for rapid response to activate or repress gene expression depending on environmental stimuli.

  7. MicroRNA-145 protects cardiomyocytes against hydrogen peroxide (H₂O₂-induced apoptosis through targeting the mitochondria apoptotic pathway.

    Directory of Open Access Journals (Sweden)

    Ruotian Li

    Full Text Available MicroRNAs, a class of small and non-encoding RNAs that transcriptionally or post-transcriptionally modulate the expression of their target genes, has been implicated as critical regulatory molecules in many cardiovascular diseases, including ischemia/reperfusion induced cardiac injury. Here, we report microRNA-145, a tumor suppressor miRNA, can protect cardiomyocytes from hydrogen peroxide H₂O₂-induced apoptosis through targeting the mitochondrial pathway. Quantitative real-time PCR (qPCR demonstrated that the expression of miR-145 in either ischemia/reperfused mice myocardial tissues or H₂O₂-treated neonatal rat ventricle myocytes (NRVMs was markedly down-regulated. Over-expression of miR-145 significantly inhibited the H₂O₂-induced cellular apoptosis, ROS production, mitochondrial structure disruption as well as the activation of key signaling proteins in mitochondrial apoptotic pathway. These protective effects of miR-145 were abrogated by over-expression of Bnip3, an initiation factor of the mitochondrial apoptotic pathway in cardiomyocytes. Finally, we utilized both luciferase reporter assay and western blot analysis to identify Bnip3 as a direct target of miR-145. Our results suggest miR-145 plays an important role in regulating mitochondrial apoptotic pathway in heart challenged with oxidative stress. MiR-145 may represent a potential therapeutic target for treatment of oxidative stress-associated cardiovascular diseases, such as myocardial ischemia/reperfusion injury.

  8. Nifedipine treatment reduces resting calcium concentration, oxidative and apoptotic gene expression, and improves muscle function in dystrophic mdx mice.

    Directory of Open Access Journals (Sweden)

    Francisco Altamirano

    Full Text Available Duchenne Muscular Dystrophy (DMD is a recessive X-linked genetic disease, caused by mutations in the gene encoding dystrophin. DMD is characterized in humans and in mdx mice by a severe and progressive destruction of muscle fibers, inflammation, oxidative/nitrosative stress, and cell death. In mdx muscle fibers, we have shown that basal ATP release is increased and that extracellular ATP stimulation is pro-apoptotic. In normal fibers, depolarization-induced ATP release is blocked by nifedipine, leading us to study the potential therapeutic effect of nifedipine in mdx muscles and its relation with extracellular ATP signaling. Acute exposure to nifedipine (10 µM decreased [Ca(2+]r, NF-κB activity and iNOS expression in mdx myotubes. In addition, 6-week-old mdx mice were treated with daily intraperitoneal injections of nifedipine, 1 mg/Kg for 1 week. This treatment lowered the [Ca(2+]r measured in vivo in the mdx vastus lateralis. We demonstrated that extracellular ATP levels were higher in adult mdx flexor digitorum brevis (FDB fibers and can be significantly reduced after 1 week of treatment with nifedipine. Interestingly, acute treatment of mdx FDB fibers with apyrase, an enzyme that completely degrades extracellular ATP to AMP, reduced [Ca(2+]r to a similar extent as was seen in FDB fibers after 1-week of nifedipine treatment. Moreover, we demonstrated that nifedipine treatment reduced mRNA levels of pro-oxidative/nitrosative (iNOS and gp91(phox/p47(phox NOX2 subunits and pro-apoptotic (Bax genes in mdx diaphragm muscles and lowered serum creatine kinase (CK levels. In addition, nifedipine treatment increased muscle strength assessed by the inverted grip-hanging test and exercise tolerance measured with forced swimming test in mdx mice. We hypothesize that nifedipine reduces basal ATP release, thereby decreasing purinergic receptor activation, which in turn reduces [Ca(2+]r in mdx skeletal muscle cells. The results in this work open new

  9. The Effects of Lycopene and Insulin on Histological Changes and the Expression Level of Bcl-2 Family Genes in the Hippocampus of Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Soleymaninejad, Masoume; Joursaraei, Seyed Gholamali; Feizi, Farideh; Jafari Anarkooli, Iraj

    2017-01-01

    The aim of this study was to evaluate the effects of antioxidants lycopene and insulin on histological changes and expression of Bcl-2 family genes in the hippocampus of streptozotocin-induced type 1 diabetic rats. Forty-eight Wistar rats were divided into six groups of control (C), control treated with lycopene (CL), diabetic (D), diabetic treated with insulin (DI), diabetic treated with lycopene (DL), and diabetic treated with insulin and lycopene (DIL). Diabetes was induced by an injection of streptozotocin (60 mg/kg, IP), lycopene (4 mg/kg/day) was given to the lycopene treated groups as gavages, and insulin (Sc, 1-2 U/kg/day) was injected to the groups treated with insulin. The number of hippocampus neurons undergoing cell death in group D had significant differences with groups C and DIL ( p lycopene alone or together reduced the expression of Bax , but increased Bcl-2 and Bcl-x L levels in DI, DL, and DIL rats, especially when compared to group D ( p lycopene contribute to the prevention of cell death by reducing the expression of proapoptotic genes and increasing the expression of antiapoptotic genes in the hippocampus.

  10. Genes and Social Behavior

    OpenAIRE

    Robinson, Gene E.; Fernald, Russell D.; Clayton, David F.

    2008-01-01

    What specific genes and regulatory sequences contribute to the organization and functioning of brain circuits that support social behavior? How does social experience interact with information in the genome to modulate these brain circuits? Here we address these questions by highlighting progress that has been made in identifying and understanding two key “vectors of influence” that link genes, brain, and social behavior: 1) social information alters gene readout in the brain to influence beh...

  11. History of gene therapy.

    Science.gov (United States)

    Wirth, Thomas; Parker, Nigel; Ylä-Herttuala, Seppo

    2013-08-10

    Two decades after the initial gene therapy trials and more than 1700 approved clinical trials worldwide we not only have gained much new information and knowledge regarding gene therapy in general, but also learned to understand the concern that has persisted in society. Despite the setbacks gene therapy has faced, success stories have increasingly emerged. Examples for these are the positive recommendation for a gene therapy product (Glybera) by the EMA for approval in the European Union and the positive trials for the treatment of ADA deficiency, SCID-X1 and adrenoleukodystrophy. Nevertheless, our knowledge continues to grow and during the course of time more safety data has become available that helps us to develop better gene therapy approaches. Also, with the increased understanding of molecular medicine, we have been able to develop more specific and efficient gene transfer vectors which are now producing clinical results. In this review, we will take a historical view and highlight some of the milestones that had an important impact on the development of gene therapy. We will also discuss briefly the safety and ethical aspects of gene therapy and address some concerns that have been connected with gene therapy as an important therapeutic modality. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Refining discordant gene trees.

    Science.gov (United States)

    Górecki, Pawel; Eulenstein, Oliver

    2014-01-01

    Evolutionary studies are complicated by discordance between gene trees and the species tree in which they evolved. Dealing with discordant trees often relies on comparison costs between gene and species trees, including the well-established Robinson-Foulds, gene duplication, and deep coalescence costs. While these costs have provided credible results for binary rooted gene trees, corresponding cost definitions for non-binary unrooted gene trees, which are frequently occurring in practice, are challenged by biological realism. We propose a natural extension of the well-established costs for comparing unrooted and non-binary gene trees with rooted binary species trees using a binary refinement model. For the duplication cost we describe an efficient algorithm that is based on a linear time reduction and also computes an optimal rooted binary refinement of the given gene tree. Finally, we show that similar reductions lead to solutions for computing the deep coalescence and the Robinson-Foulds costs. Our binary refinement of Robinson-Foulds, gene duplication, and deep coalescence costs for unrooted and non-binary gene trees together with the linear time reductions provided here for computing these costs significantly extends the range of trees that can be incorporated into approaches dealing with discordance.

  13. Chromatin loops, gene positioning, and gene expression

    NARCIS (Netherlands)

    Holwerda, S.; de Laat, W.

    2012-01-01

    Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

  14. Baculovirus PTP2 functions as a pro-apoptotic protein

    NARCIS (Netherlands)

    Han, Yue; Houte, van Stineke; Oers, van Monique M.; Ros, Vera I.D.

    2018-01-01

    The family Baculoviridae encompasses a large number of invertebrate viruses, mainly infecting caterpillars of the order Lepidoptera. The baculovirus Spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) induces physiological and behavioral changes in its host Spodoptera exigua, as well as

  15. Synthesis and proapoptotic activity of oleanolic acid derived amides.

    Science.gov (United States)

    Heller, Lucie; Knorrscheidt, Anja; Flemming, Franziska; Wiemann, Jana; Sommerwerk, Sven; Pavel, Ioana Z; Al-Harrasi, Ahmed; Csuk, René

    2016-10-01

    Thirty-one different 3-O-acetyl-OA derived amides have been prepared and screened for their cytotoxic activity. In the SRB assays nearly all the carboxamides displayed good cytotoxicity in the low μM range for several human tumor cell lines. Low EC50 values were obtained especially for the picolinylamides 14-16, for a N-[2-(dimethylamino)-ethyl] derivative 27 and a N-[2-(pyrrolinyl)-ethyl] carboxamide 28. These compounds were submitted to an extensive biological testing and proved compound 15 to act mainly by an arrest of the tumor cells in the S phase of the cell cycle. Cell death occurred by autophagy while compounds 27 and 28 triggered apoptosis. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. faloabi@uniben.edu Antiproliferative and Pro-apoptotic activities

    African Journals Online (AJOL)

    MICHAEL HORSFALL

    Keyword: Persea americana, antiproliferative activity, apoptotic effect, flow ... of the stem bark of Persea americana in MCF-7 cell line by flow cytometer. .... of an electric milling machine. ... Flow Cytometric Measurement Of Cell Proliferation:.

  17. Proapoptotic Role of Potassium Ions in Liver Cells

    Directory of Open Access Journals (Sweden)

    Zhenglin Xia

    2016-01-01

    Full Text Available Potassium channels are transmembrane proteins that selectively promote the infiltration of potassium ions. The significance of these channels for tumor biology has become obvious. However, the effects of potassium ions on the tumor or normal cells have seldom been studied. To address this problem, we studied the biological effects of L02 and HepG2 cells with ectogenous potassium ions. Cell proliferation, cell cycle, and apoptosis rate were analyzed. Our results indicated that potassium ions inhibited proliferation of L02 and HepG2 cells and promoted their apoptosis. Potassium ions induced apoptosis through regulating Bcl-2 family members and depolarized the mitochondrial membrane, especially for HepG2 cell. These biological effects were associated with channel protein HERG. By facilitating expression of channel protein HERG, potassium ions may prevent it from being shunted to procancerous pathways by inducing apoptosis. These results demonstrated that potassium ions may be a key regulator of liver cell function. Thus, our findings suggest that potassium ions could inhibit tumorigenesis through inducing apoptosis of hepatoma cells by upregulating potassium ions transport channel proteins HERG and VDAC1.

  18. Your Genes, Your Choices

    Science.gov (United States)

    Table of Contents Your Genes, Your Choices describes the Human Genome Project, the science behind it, and the ethical, legal, and social issues that are ... Nothing could be further from the truth. Your Genes, Your Choices points out how the progress of ...

  19. DNA repair genes

    International Nuclear Information System (INIS)

    Morimyo, Mitsuoki

    1995-01-01

    Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)

  20. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  1. Stress-induced activation of the brainstem Bcl-xL gene expression in rats treated with fluoxetine: correlations with serotonin metabolism and depressive-like behavior.

    Science.gov (United States)

    Shishkina, Galina T; Kalinina, Tatyana S; Berezova, Inna V; Dygalo, Nikolay N

    2012-01-01

    Mechanisms underlying stress-induced depression and antidepressant drug action were shown to involve alterations in serotonergic (5-HT) neurotransmission and expression of genes coding for proteins associated with neurotrophic signaling pathways and cell-survival in the hippocampus and cortex. Expression of these genes in the brainstem containing 5-HT neurons may also be related to vulnerability or resilience to stress-related psychopathology. Here we investigated 5-HT markers and expression of genes for Brain-Derived Neurotrophic Factor (BDNF) and apoptotic proteins in the brainstem in relation to swim stress-induced behavioral despair. We found that anti-apoptotic Bcl-xL gene is sensitive to stress during the course of fluoxetine administration. Responsiveness of this gene to stress appeared concomitantly with an antidepressant-like effect of fluoxetine in the forced swim test. Bcl-xL transcript levels showed negative correlations with duration of immobility in the test and 5-HT turnover in the brainstem. In contrast, BDNF and pro-apoptotic protein Bax mRNA levels were unchanged by either fluoxetine or stress, suggesting specificity of Bcl-xL gene responses to these treatments. We also found that the levels of mRNAs for tryptophan hydroxylase-2 (TPH2) and 5-HT transporter (5-HTT) were significantly down-regulated following prolonged treatment with fluoxetine, but were not affected by stress. Unlike TPH2 and 5-HTT, 5-HT1A receptor mRNA levels were not altered by fluoxetine but significantly increased in response to swim stress. These data show that long-term fluoxetine treatment leads to changes in 5-HT and Bcl-xL responses to stress associated with antidepressant-like effects of the drug. This article is part of a Special Issue entitled 'Anxiety and Depression'. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Radionuclide reporter gene imaging

    International Nuclear Information System (INIS)

    Min, Jung Joon

    2004-01-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases

  3. Radionuclide reporter gene imaging

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Joon [School of Medicine, Chonnam National Univ., Gwangju (Korea, Republic of)

    2004-04-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases.

  4. Ebola virion attachment and entry into human macrophages profoundly effects early cellular gene expression.

    Directory of Open Access Journals (Sweden)

    Victoria Wahl-Jensen

    2011-10-01

    Full Text Available Zaire ebolavirus (ZEBOV infections are associated with high lethality in primates. ZEBOV primarily targets mononuclear phagocytes, which are activated upon infection and secrete mediators believed to trigger initial stages of pathogenesis. The characterization of the responses of target cells to ZEBOV infection may therefore not only further understanding of pathogenesis but also suggest possible points of therapeutic intervention. Gene expression profiles of primary human macrophages exposed to ZEBOV were determined using DNA microarrays and quantitative PCR to gain insight into the cellular response immediately after cell entry. Significant changes in mRNA concentrations encoding for 88 cellular proteins were observed. Most of these proteins have not yet been implicated in ZEBOV infection. Some, however, are inflammatory mediators known to be elevated during the acute phase of disease in the blood of ZEBOV-infected humans. Interestingly, the cellular response occurred within the first hour of Ebola virion exposure, i.e. prior to virus gene expression. This observation supports the hypothesis that virion binding or entry mediated by the spike glycoprotein (GP(1,2 is the primary stimulus for an initial response. Indeed, ZEBOV virions, LPS, and virus-like particles consisting of only the ZEBOV matrix protein VP40 and GP(1,2 (VLP(VP40-GP triggered comparable responses in macrophages, including pro-inflammatory and pro-apoptotic signals. In contrast, VLP(VP40 (particles lacking GP(1,2 caused an aberrant response. This suggests that GP(1,2 binding to macrophages plays an important role in the immediate cellular response.

  5. Identification of genes involved in Ca2+ ionophore A23187-mediated apoptosis and demonstration of a high susceptibility for transcriptional repression of cell cycle genes in B lymphoblasts from a patient with Scott syndrome

    Directory of Open Access Journals (Sweden)

    Meyer Dominique

    2005-10-01

    Full Text Available Abstract Background In contrast to other agents able to induce apoptosis of cultured cells, Ca2+ ionophore A23187 was shown to elicit direct activation of intracellular signal(s. The phenotype of the cells derived from patients having the hemorrhagic disease Scott syndrome, is associated with an abnormally high proportion of apoptotic cells, both in basal culture medium and upon addition of low ionophore concentrations in long-term cultures. These features are presumably related to the mutation also responsible for the defective procoagulant plasma membrane remodeling. We analyzed the specific transcriptional re-programming induced by A23187 to get insights into the effect of this agent on gene expression and a defective gene regulation in Scott cells. Results The changes in gene expression upon 48 hours treatment with 200 nM A23187 were measured in Scott B lymphoblasts compared to B lymphoblasts derived from the patient's daughter or unrelated individuals using Affymetrix microarrays. In a similar manner in all of the B cell lines, results showed up-regulation of 55 genes, out of 12,000 represented sequences, involved in various pathways of the cell metabolism. In contrast, a group of 54 down-regulated genes, coding for histones and proteins involved in the cell cycle progression, was more significantly repressed in Scott B lymphoblasts than in the other cell lines. These data correlated with the alterations of the cell cycle phases in treated cells and suggested that the potent effect of A23187 in Scott B lymphoblasts may be the consequence of the underlying molecular defect. Conclusion The data illustrate that the ionophore A23187 exerts its pro-apoptotic effect by promoting a complex pattern of genetic changes. These results also suggest that a subset of genes participating in various steps of the cell cycle progress can be transcriptionally regulated in a coordinated fashion. Furthermore, this research brings a new insight into the defect

  6. Gene amplification in carcinogenesis

    Directory of Open Access Journals (Sweden)

    Lucimari Bizari

    2006-01-01

    Full Text Available Gene amplification increases the number of genes in a genome and can give rise to karyotype abnormalities called double minutes (DM and homogeneously staining regions (HSR, both of which have been widely observed in human tumors but are also known to play a major role during embryonic development due to the fact that they are responsible for the programmed increase of gene expression. The etiology of gene amplification during carcinogenesis is not yet completely understood but can be considered a result of genetic instability. Gene amplification leads to an increase in protein expression and provides a selective advantage during cell growth. Oncogenes such as CCND1, c-MET, c-MYC, ERBB2, EGFR and MDM2 are amplified in human tumors and can be associated with increased expression of their respective proteins or not. In general, gene amplification is associated with more aggressive tumors, metastases, resistance to chemotherapy and a decrease in the period during which the patient stays free of the disease. This review discusses the major role of gene amplification in the progression of carcinomas, formation of genetic markers and as possible therapeutic targets for the development of drugs for the treatment of some types of tumors.

  7. Methanogenesis and methane genes

    International Nuclear Information System (INIS)

    Reeve, J.N.; Shref, B.A.

    1991-01-01

    An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)

  8. Gene Expression ‏‏‏‏Profiles of BAD and Bcl-xL in the CA1 Region of the Hippocampus Following Global Ischemic/Reperfusion and FK-506 Administration.

    Science.gov (United States)

    Badr, Ramak; Hashemi, Mehrdad; Javadi, Gholamreza; Movafagh, Abolfazl; Mahdian, Reza

    2015-12-01

    The hippocampus is a tiny nub in the mammalian brain that is involved in forming, organizing, and storing memories. Global cerebral ischemia (GCI) and reperfusion induced apoptosis lead to cell injury and death. FK-506 is a strong immunosuppressant drug that has neuroprotective effects on the hypoxic-ischemic effects of brain damage. BAD and Bcl-xL are pro-apoptotic and anti-apoptotic genes, respectively. These genes belong to The B-cell lymphoma-2 (Bcl-2) family. In this study, we assessed the neurotrophic properties of FK-506 on expression of the BAD and Bcl-xL genes in the hippocampus following global ischemia and reperfusion. In the present experimental study, adult male Wistar rats were obtained and housed under standard conditions in the Tehran University of Medical Science in Iran. Rats were equally distributed in groups of three among the following groups: normal control, treated-1 (ischemia/reperfusion), and treated-2 (ischemia/reperfusion followed by FK-506). Global ischemia was induced for animals in the treated-1 and treated-2 groups. In treated-2, two doses of FK-506 were injected: one dose as an IV injection immediately after reperfusion and another as an intra-peritoneal (IP) injection after 48 hours. Then, the hippocampus tissue was removed after anaesthetizing the rats. RNA was isolated, cDNA was synthesized, and real-time PCR was performed. Finally, the obtained data were analyzed statistically (P value ˂ 0.05). The quantitative results of real-time PCR show that the mRNA expression ratio of Bcl-xL down-regulated was 0.75 ± 0.06 in the ischemia/reperfusion group versus 1.57 ± 0.09 in the control group (P value BAD up-regulated in the ischemia/reperfusion + FK506 group was 3.65 ± 0.49 compared to Normal control (1.39 ± 0.09) and Ischemia/reperfusion + FK506 was 1.09 ± 0.20 (P value BAD /Bcl-xL) confirmed that expression of the pro-apoptotic gene significantly decreased (P value ˂ 0.001) under the ischemia/reperfusion condition. In contrast

  9. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  10. Finding Genes for Schizophrenia

    OpenAIRE

    Åberg, Karolina

    2005-01-01

    Schizophrenia is one of our most common psychiatric diseases. It severely affects all aspects of psychological functions and results in loss of contact with reality. No cure exists and the treatments available today produce only partial relief for disease symptoms. The aim of this work is to better understand the etiology of schizophrenia by identification of candidate genes and gene pathways involved in the development of the disease. In a preliminarily study, the effects of medication and g...

  11. Epigenetics: beyond genes

    CSIR Research Space (South Africa)

    Fossey, A

    2009-06-01

    Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...

  12. Gene-Gene and Gene-Environment Interactions in the Etiology of Breast Cancer

    National Research Council Canada - National Science Library

    Adegoke, Olufemi

    2003-01-01

    The objective of this CDA is to evaluate the gene-gene and gene-environment interactions in the etiology of breast cancer in two ongoing case-control studies, the Shanghai Breast Cancer Study (SBCS...

  13. Radiosensitivity and genes

    Energy Technology Data Exchange (ETDEWEB)

    Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.

  14. Radiosensitivity and genes

    International Nuclear Information System (INIS)

    Hu Qiyue; Lun Mingyue

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation

  15. Evidence for homosexuality gene

    Energy Technology Data Exchange (ETDEWEB)

    Pool, R.

    1993-07-16

    A genetic analysis of 40 pairs of homosexual brothers has uncovered a region on the X chromosome that appears to contain a gene or genes for homosexuality. When analyzing the pedigrees of homosexual males, the researcheres found evidence that the trait has a higher likelihood of being passed through maternal genes. This led them to search the X chromosome for genes predisposing to homosexuality. The researchers examined the X chromosomes of pairs of homosexual brothers for regions of DNA that most or all had in common. Of the 40 sets of brothers, 33 shared a set of five markers in the q28 region of the long arm of the X chromosome. The linkage has a LOD score of 4.0, which translates into a 99.5% certainty that there is a gene or genes in this area that predispose males to homosexuality. The chief researcher warns, however, that this one site cannot explain all instances of homosexuality, since there were some cases where the trait seemed to be passed paternally. And even among those brothers where there was no evidence that the trait was passed paternally, seven sets of brothers did not share the Xq28 markers. It seems likely that homosexuality arises from a variety of causes.

  16. Pro-apoptotic and pro-autophagic effects of the Aurora kinase A inhibitor alisertib (MLN8237 on human osteosarcoma U-2 OS and MG-63 cells through the activation of mitochondria-mediated pathway and inhibition of p38 MAPK/PI3K/Akt/mTOR signaling pathway

    Directory of Open Access Journals (Sweden)

    Niu NK

    2015-03-01

    mesenchymal transition (EMT and the underlying mechanisms in two human OS cell lines U-2 OS and MG-63. The results showed that ALS had potent growth inhibitory, pro-apoptotic, pro-autophagic, and EMT inhibitory effects on U-2 OS and MG-63 cells. ALS remarkably induced G2/M arrest and down-regulated the expression levels of cyclin-dependent kinases 1 and 2 and cyclin B1 in both U-2 OS and MG-63 cells. ALS markedly induced mitochondria-mediated apoptosis with a significant increase in the expression of key pro-apoptotic proteins and a decrease in main anti-apoptotic proteins. Furthermore, ALS promoted autophagic cell death via the inhibition of phosphatidylinositol 3-kinase (PI3K/protein kinase B (Akt/mammalian target of rapamycin (mTOR and p38 mitogen-activated protein kinase (p38 MAPK signaling pathways, and activation of 5'-AMP-dependent kinase (AMPK signaling pathway. Inducers or inhibitors of apoptosis or autophagy simultaneously altered ALS-induced apoptotic and autophagic death in both U-2 OS and MG-63 cells, suggesting a crosstalk between these two primary modes of programmed cell death. Moreover, ALS suppressed EMT-like phenotypes with a marked increase in the expression of E-cadherin but a decrease in N-cadherin in U-2 OS and MG-63 cells. ALS treatment also induced reactive oxygen species (ROS generation but inhibited the expression levels of sirtuin 1 and nuclear factor-erythroid-2-related factor 2 (Nrf2 in both cell lines. Taken together, these findings show that ALS promotes apoptosis and autophagy but inhibits EMT via PI3K/Akt/mTOR, p38 MAPK, and AMPK signaling pathways with involvement of ROS- and sirtuin 1-associated pathways in U-2 OS and MG-63 cells. ALS is a promising anticancer agent in OS treatment and further studies are needed to confirm its efficacy and safety in OS chemotherapy. Keywords: ALS, autophagy, apoptosis, osteosarcoma, PI3K/Akt/mTOR pathway, EMT

  17. A close connection between the PERK and IRE arms of the UPR and the transcriptional regulation of autophagy.

    Science.gov (United States)

    Deegan, Shane; Koryga, Izabela; Glynn, Sharon A; Gupta, Sanjeev; Gorman, Adrienne M; Samali, Afshin

    2015-01-02

    Endoplasmic reticulum (ER) stress is known to lead to activation of both the unfolded protein response (UPR) and autophagy. Although regulatory connections have been identified between the UPR and autophagy, it is still unclear to what extent the UPR regulates the genes involved at the different stages of the autophagy pathway. Here, we carried out a microarray analysis of HCT116 cells subjected to ER stress and observed the transcriptional upregulation of a large cohort of autophagy-related genes. Of particular interest, we identified the transcriptional upregulation of the autophagy receptor genes SQSTM1/p62, NBR1 and BNIP3L/NIX in response to ER stress and show that the inhibition of the UPR transmembrane receptors, PERK and IRE1, abrogates this upregulation. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. The Mycoplasma hominis vaa gene displays a mosaic gene structure

    DEFF Research Database (Denmark)

    Boesen, Thomas; Emmersen, Jeppe M. G.; Jensen, Lise T.

    1998-01-01

    Mycoplasma hominis contains a variable adherence-associated (vaa) gene. To classify variants of the vaa genes, we examined 42 M. hominis isolated by PCR, DNA sequencing and immunoblotting. This uncovered the existence of five gene categories. Comparison of the gene types revealed a modular...

  19. Expression microarray identifies the unliganded glucocorticoid receptor as a regulator of gene expression in mammary epithelial cells

    International Nuclear Information System (INIS)

    Ritter, Heather D; Mueller, Christopher R

    2014-01-01

    While glucocorticoids and the liganded glucocorticoid receptor (GR) have a well-established role in the maintenance of differentiation and suppression of apoptosis in breast tissue, the involvement of unliganded GR in cellular processes is less clear. Our previous studies implicated unliganded GR as a positive regulator of the BRCA1 tumour suppressor gene in the absence of glucocorticoid hormone, which suggested it could play a similar role in the regulation of other genes. An shRNA vector directed against GR was used to create mouse mammary cell lines with depleted endogenous levels of this receptor in order to further characterize the role of GR in breast cells. An expression microarray screen for targets of unliganded GR was performed using our GR-depleted cell lines maintained in the absence of glucocorticoids. Candidate genes positively regulated by unliganded GR were identified, classified by Gene Ontology and Ingenuity Pathway Analysis, and validated using quantitative real-time reverse transcriptase PCR. Chromatin immunoprecipitation and dual luciferase expression assays were conducted to further investigate the mechanism through which unliganded GR regulates these genes. Expression microarray analysis revealed 260 targets negatively regulated and 343 targets positively regulated by unliganded GR. A number of the positively regulated targets were involved in pro-apoptotic networks, possibly opposing the activity of liganded GR targets. Validation and further analysis of five candidates from the microarray indicated that two of these, Hsd11b1 and Ch25h, were regulated by unliganded GR in a manner similar to Brca1 during glucocorticoid treatment. Furthermore, GR was shown to interact directly with and upregulate the Ch25h promoter in the absence, but not the presence, of hydrocortisone (HC), confirming our previously described model of gene regulation by unliganded GR. This work presents the first identification of targets of unliganded GR. We propose that

  20. FunGene: the functional gene pipeline and repository.

    Science.gov (United States)

    Fish, Jordan A; Chai, Benli; Wang, Qiong; Sun, Yanni; Brown, C Titus; Tiedje, James M; Cole, James R

    2013-01-01

    Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer. While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/) offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  1. FunGene: the Functional Gene Pipeline and Repository

    Directory of Open Access Journals (Sweden)

    Jordan A. Fish

    2013-10-01

    Full Text Available Ribosomal RNA genes have become the standard molecular markers for microbial community analysis for good reasons, including universal occurrence in cellular organisms, availability of large databases, and ease of rRNA gene region amplification and analysis. As markers, however, rRNA genes have some significant limitations. The rRNA genes are often present in multiple copies, unlike most protein-coding genes. The slow rate of change in rRNA genes means that multiple species sometimes share identical 16S rRNA gene sequences, while many more species share identical sequences in the short 16S rRNA regions commonly analyzed. In addition, the genes involved in many important processes are not distributed in a phylogenetically coherent manner, potentially due to gene loss or horizontal gene transfer.While rRNA genes remain the most commonly used markers, key genes in ecologically important pathways, e.g., those involved in carbon and nitrogen cycling, can provide important insights into community composition and function not obtainable through rRNA analysis. However, working with ecofunctional gene data requires some tools beyond those required for rRNA analysis. To address this, our Functional Gene Pipeline and Repository (FunGene; http://fungene.cme.msu.edu/ offers databases of many common ecofunctional genes and proteins, as well as integrated tools that allow researchers to browse these collections and choose subsets for further analysis, build phylogenetic trees, test primers and probes for coverage, and download aligned sequences. Additional FunGene tools are specialized to process coding gene amplicon data. For example, FrameBot produces frameshift-corrected protein and DNA sequences from raw reads while finding the most closely related protein reference sequence. These tools can help provide better insight into microbial communities by directly studying key genes involved in important ecological processes.

  2. Gene therapy prospects--intranasal delivery of therapeutic genes.

    Science.gov (United States)

    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

    2012-01-01

    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  3. Radionuclide reporter gene imaging for cardiac gene therapy

    International Nuclear Information System (INIS)

    Inubushi, Masayuki; Tamaki, Nagara

    2007-01-01

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  4. GoGene: gene annotation in the fast lane.

    Science.gov (United States)

    Plake, Conrad; Royer, Loic; Winnenburg, Rainer; Hakenberg, Jörg; Schroeder, Michael

    2009-07-01

    High-throughput screens such as microarrays and RNAi screens produce huge amounts of data. They typically result in hundreds of genes, which are often further explored and clustered via enriched GeneOntology terms. The strength of such analyses is that they build on high-quality manual annotations provided with the GeneOntology. However, the weakness is that annotations are restricted to process, function and location and that they do not cover all known genes in model organisms. GoGene addresses this weakness by complementing high-quality manual annotation with high-throughput text mining extracting co-occurrences of genes and ontology terms from literature. GoGene contains over 4,000,000 associations between genes and gene-related terms for 10 model organisms extracted from more than 18,000,000 PubMed entries. It does not cover only process, function and location of genes, but also biomedical categories such as diseases, compounds, techniques and mutations. By bringing it all together, GoGene provides the most recent and most complete facts about genes and can rank them according to novelty and importance. GoGene accepts keywords, gene lists, gene sequences and protein sequences as input and supports search for genes in PubMed, EntrezGene and via BLAST. Since all associations of genes to terms are supported by evidence in the literature, the results are transparent and can be verified by the user. GoGene is available at http://gopubmed.org/gogene.

  5. Genes and inheritance.

    Science.gov (United States)

    Middelton, L A; Peters, K F

    2001-10-01

    The information gained from the Human Genome Project and related genetic research will undoubtedly create significant changes in healthcare practice. It is becoming increasingly clear that nurses in all areas of clinical practice will require a fundamental understanding of basic genetics. This article provides the oncology nurse with an overview of basic genetic concepts, including inheritance patterns of single gene conditions, pedigree construction, chromosome aberrations, and the multifactorial basis underlying the common diseases of adulthood. Normal gene structure and function are introduced and the biochemistry of genetic errors is described.

  6. Neighboring Genes Show Correlated Evolution in Gene Expression

    Science.gov (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  7. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

    Science.gov (United States)

    White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

    2014-08-01

    The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

  8. Norrie disease gene is distinct from the monoamine oxidase genes

    OpenAIRE

    Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

    1989-01-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

  9. The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Dan, E-mail: danw@bjmu.edu.cn [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Liu, Jing; Wu, Baiyan [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Tu, Bo; Zhu, Weiguo [Department of Biochemistry and Molecular Biology, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Luo, Jianyuan, E-mail: jluo@som.umaryland.edu [Department of Medical Genetics, Peking University Health Science Center, No 38 Xueyuan Road, Haidian district, Beijing 100191 (China); Department of Medical and Research Technology, School of Medicine, University of Maryland, Baltimore 21201 (United States)

    2014-04-25

    Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration.

  10. The Batten disease gene CLN3 confers resistance to endoplasmic reticulum stress induced by tunicamycin

    International Nuclear Information System (INIS)

    Wu, Dan; Liu, Jing; Wu, Baiyan; Tu, Bo; Zhu, Weiguo; Luo, Jianyuan

    2014-01-01

    Highlights: • The work reveals a protective properties of CLN3 towards TM-induced apoptosis. • CLN3 regulates expression of the GRP78 and the CHOP in response to the ER stress. • CLN3 plays a specific role in the ERS response. - Abstract: Mutations in CLN3 gene cause juvenile neuronal ceroid lipofuscinosis (JNCL or Batten disease), an early-onset neurodegenerative disorder that is characterized by the accumulation of ceroid lipofuscin within lysosomes. The function of the CLN3 protein remains unclear and is presumed to be related to Endoplasmic reticulum (ER) stress. To investigate the function of CLN3 in the ER stress signaling pathway, we measured proliferation and apoptosis in cells transfected with normal and mutant CLN3 after treatment with the ER stress inducer tunicamycin (TM). We found that overexpression of CLN3 was sufficient in conferring increased resistance to ER stress. Wild-type CLN3 protected cells from TM-induced apoptosis and increased cell proliferation. Overexpression of wild-type CLN3 enhanced expression of the ER chaperone protein, glucose-regulated protein 78 (GRP78), and reduced expression of the proapoptotic protein CCAAT/-enhancer-binding protein homologous protein (CHOP). In contrast, overexpression of mutant CLN3 or siRNA knockdown of CLN3 produced the opposite effect. Together, our data suggest that the lack of CLN3 function in cells leads to a failure of management in the response to ER stress and this may be the key deficit in JNCL that causes neuronal degeneration

  11. A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo.

    Science.gov (United States)

    Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian

    2005-12-01

    The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.

  12. Hidden genes in birds

    Czech Academy of Sciences Publication Activity Database

    Hron, Tomáš; Pajer, Petr; Pačes, Jan; Bartůněk, Petr; Elleder, Daniel

    2015-01-01

    Roč. 16, August 18 (2015) ISSN 1465-6906 R&D Projects: GA MŠk(CZ) LK11215; GA MŠk LO1419 Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:68378050 Keywords : REPETITIVE SEQUENCES * G/C stretches * avian genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 11.313, year: 2015

  13. Rhabdovirus accessory genes.

    Science.gov (United States)

    Walker, Peter J; Dietzgen, Ralf G; Joubert, D Albert; Blasdell, Kim R

    2011-12-01

    The Rhabdoviridae is one of the most ecologically diverse families of RNA viruses with members infecting a wide range of organisms including placental mammals, marsupials, birds, reptiles, fish, insects and plants. The availability of complete nucleotide sequences for an increasing number of rhabdoviruses has revealed that their ecological diversity is reflected in the diversity and complexity of their genomes. The five canonical rhabdovirus structural protein genes (N, P, M, G and L) that are shared by all rhabdoviruses are overprinted, overlapped and interspersed with a multitude of novel and diverse accessory genes. Although not essential for replication in cell culture, several of these genes have been shown to have roles associated with pathogenesis and apoptosis in animals, and cell-to-cell movement in plants. Others appear to be secreted or have the characteristics of membrane-anchored glycoproteins or viroporins. However, most encode proteins of unknown function that are unrelated to any other known proteins. Understanding the roles of these accessory genes and the strategies by which rhabdoviruses use them to engage, divert and re-direct cellular processes will not only present opportunities to develop new anti-viral therapies but may also reveal aspects of cellar function that have broader significance in biology, agriculture and medicine. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  14. Targeting fumonisin biosynthetic genes

    Science.gov (United States)

    The fungus Fusarium is an agricultural problem because it can cause disease on most crop plants and can contaminate crops with mycotoxins. There is considerable variation in the presence/absence and genomic location of gene clusters responsible for synthesis of mycotoxins and other secondary metabol...

  15. Radio-induced genes

    International Nuclear Information System (INIS)

    Rigaud, O.; Kazmaier, M.

    2000-01-01

    The monitoring system of the DNA integrity of an irradiated cell does not satisfy oneself to recruit the enzymes allowing the repair of detected damages. It sends an alarm signal whom transmission leads to the activation of specific genes in charge of stopping the cell cycle, the time to make the repair works, or to lead to the elimination of a too much damaged cell. Among the numerous genes participating to the monitoring of cell response to irradiation, the target genes of the mammalian P53 protein are particularly studied. Caretaker of the genome, this protein play a central part in the cell response to ionizing radiations. this response is less studied among plants. A way to tackle it is to be interested in the radioinduced genes identification in the vegetal cell, while taking advantage of knowledge got in the animal field. The knowledge of the complete genome of the arabette (arabidopsis thaliana), the model plant and the arising of new techniques allow to lead this research at a previously unknown rhythm in vegetal biology. (N.C.)

  16. The Gene Guessing Game

    OpenAIRE

    Dunham, Ian

    2000-01-01

    A recent flurry of publications and media attention has revived interest in the question of how many genes exist in the human genome. Here, I review the estimates and use genomic sequence data from human chromosomes 21 and 22 to establish my own prediction.

  17. Targeting trichothecene biosynthetic genes

    NARCIS (Netherlands)

    Wei, Songhong; Lee, van der Theo; Verstappen, Els; Gent, van Marga; Waalwijk, Cees

    2017-01-01

    Biosynthesis of trichothecenes requires the involvement of at least 15 genes, most of which have been targeted for PCR. Qualitative PCRs are used to assign chemotypes to individual isolates, e.g., the capacity to produce type A and/or type B trichothecenes. Many regions in the core cluster

  18. Silence of the Genes

    Indian Academy of Sciences (India)

    Srimath

    a gene in the opposite orientation in a cultured plant cell line and observed that the ..... started emerging in early 1990s from the work carried out by the. It is believed that ... cause human diseases such as cervical cancer, hepatitis, measles.

  19. Silence of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

  20. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  1. Genes2FANs: connecting genes through functional association networks

    Science.gov (United States)

    2012-01-01

    Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs), researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI) network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our finding that disease genes in

  2. Industrial scale gene synthesis.

    Science.gov (United States)

    Notka, Frank; Liss, Michael; Wagner, Ralf

    2011-01-01

    The most recent developments in the area of deep DNA sequencing and downstream quantitative and functional analysis are rapidly adding a new dimension to understanding biochemical pathways and metabolic interdependencies. These increasing insights pave the way to designing new strategies that address public needs, including environmental applications and therapeutic inventions, or novel cell factories for sustainable and reconcilable energy or chemicals sources. Adding yet another level is building upon nonnaturally occurring networks and pathways. Recent developments in synthetic biology have created economic and reliable options for designing and synthesizing genes, operons, and eventually complete genomes. Meanwhile, high-throughput design and synthesis of extremely comprehensive DNA sequences have evolved into an enabling technology already indispensable in various life science sectors today. Here, we describe the industrial perspective of modern gene synthesis and its relationship with synthetic biology. Gene synthesis contributed significantly to the emergence of synthetic biology by not only providing the genetic material in high quality and quantity but also enabling its assembly, according to engineering design principles, in a standardized format. Synthetic biology on the other hand, added the need for assembling complex circuits and large complexes, thus fostering the development of appropriate methods and expanding the scope of applications. Synthetic biology has also stimulated interdisciplinary collaboration as well as integration of the broader public by addressing socioeconomic, philosophical, ethical, political, and legal opportunities and concerns. The demand-driven technological achievements of gene synthesis and the implemented processes are exemplified by an industrial setting of large-scale gene synthesis, describing production from order to delivery. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Genes contributing to prion pathogenesis

    DEFF Research Database (Denmark)

    Tamgüney, Gültekin; Giles, Kurt; Glidden, David V

    2008-01-01

    incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...

  4. Using gene expression noise to understand gene regulation

    NARCIS (Netherlands)

    Munsky, B.; Neuert, G.; van Oudenaarden, A.

    2012-01-01

    Phenotypic variation is ubiquitous in biology and is often traceable to underlying genetic and environmental variation. However, even genetically identical cells in identical environments display variable phenotypes. Stochastic gene expression, or gene expression "noise," has been suggested as a

  5. A Single Nucleotide Polymorphism in the Bax Gene Promoter Affects Transcription and Influences Retinal Ganglion Cell Death

    Directory of Open Access Journals (Sweden)

    Sheila J Semaan

    2010-03-01

    Full Text Available Pro-apoptotic Bax is essential for RGC (retinal ganglion cell death. Gene dosage experiments in mice, yielding a single wild-type Bax allele, indicated that genetic background was able to influence the cell death phenotype. DBA/2J Bax+/− mice exhibited complete resistance to nerve damage after 2 weeks (similar to Bax −/− mice, but 129B6 Bax+/− mice exhibited significant cell loss (similar to wild-type mice. The different cell death phenotype was associated with the level of Bax expression, where 129B6 neurons had twice the level of endogenous Bax mRNA and protein as DBA/2J neurons. Sequence analysis of the Bax promoters between these strains revealed a single nucleotide polymorphism (T129B6 to CDBA/2J at position −515. A 1.5- to 2.5-fold increase in transcriptional activity was observed from the 129B6 promoter in transient transfection assays in a variety of cell types, including RGC5 cells derived from rat RGCs. Since this polymorphism occurred in a p53 half-site, we investigated the requirement of p53 for the differential transcriptional activity. Differential transcriptional activity from either 129B6 or DBA/2J Bax promoters were unaffected in p53−/− cells, and addition of exogenous p53 had no further effect on this difference, thus a role for p53 was excluded. Competitive electrophoretic mobility-shift assays identified two DNA-protein complexes that interacted with the polymorphic region. Those forming Complex 1 bound with higher affinity to the 129B6 polymorphic site, suggesting that these proteins probably comprised a transcriptional activator complex. These studies implicated quantitative expression of the Bax gene as playing a possible role in neuronal susceptibility to damaging stimuli.

  6. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  7. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  8. Modulation of Apoptosis Pathways by Oxidative Stress and Autophagy in β Cells

    Directory of Open Access Journals (Sweden)

    Maorong Wang

    2012-01-01

    Full Text Available Human islets isolated for transplantation are exposed to multiple stresses including oxidative stress and hypoxia resulting in significant loss of functional β cell mass. In this study we examined the modulation of apoptosis pathway genes in islets exposed to hydrogen peroxide, peroxynitrite, hypoxia, and cytokines. We observed parallel induction of pro- and antiapoptotic pathways and identified several novel genes including BFAR, CARD8, BNIP3, and CIDE-A. As BNIP3 is an inducer of autophagy, we examined this pathway in MIN6 cells, a mouse beta cell line and in human islets. Culture of MIN6 cells under low serum conditions increased the levels of several proteins in autophagy pathway, including ATG4, Beclin 1, LAMP-2, and UVRAG. Amino acid deprivation led to induction of autophagy in human islets. Preconditioning of islets with inducers of autophagy protected them from hypoxia-induced apoptosis. However, induction of autophagy during hypoxia exacerbated apoptotic cell death. ER stress led to induction of autophagy and apoptosis in β cells. Overexpression of MnSOD, an enzyme that scavenges free radicals, resulted in protection of MIN6 cells from cytokine-induced apoptosis. Ceramide, a mediator of cytokine-induced injury, reduced the active phosphorylated form of Akt and downregulated the promoter activity of the antiapoptotic gene bcl-2. Furthermore, cytokine-stimulated JNK pathway downregulated the bcl-2 promoter activity which was reversed by preincubation with SP600125, a JNK inhibitor. Our findings suggest that β cell apoptosis by multiple stresses in islets isolated for transplantation is the result of orchestrated gene expression in apoptosis pathway.

  9. Genes, stress, and depression.

    Science.gov (United States)

    Wurtman, Richard J

    2005-05-01

    A relationship between genetic makeup and susceptibility to major depressive disorder (MDD) has long been suspected on the basis of family and twin studies. A metaanalysis of reports on the basis of twin studies has estimated MDD's degree of heritability to be 0.33 (confidence interval, 0.26-0.39). Among families exhibiting an increased prevalence of MDD, risk of developing the illness was enhanced in members exposed to a highly stressful environment. Aberrant genes can predispose to depression in a number of ways, for example, by diminishing production of growth factors that act during brain development. An aberrant gene could also increase or decrease a neurotransmitter's release into synapses, its actions, or its duration of activity. The gene products of greatest interest at present are those involved in the synthesis and actions of serotonin; among them, the serotonin-uptake protein localized within the terminals and dendrites of serotonin-releasing neurons. It has been found that the Vmax of platelet serotonin uptake is low in some patients with MDD; also, Vmax is highly correlated in twins. Antidepressant drugs such as the selective serotonin reuptake inhibitors act on this uptake protein. The specific genetic locus causing serotonin uptake to be lower in some patients with major depression involves a polymorphic region (5-HTTLPR) in the promoter region of the gene for the uptake protein. The gene itself exists as several alleles, the short "S" allele and the long "L" allele. The S variant is associated with less, and the L variant with more, of the uptake protein. The effect of stressful life events on depressive symptoms in young adults was found to be significantly stronger among SS or SL subjects than among LL subjects. Neuroimaging studies showed that people with the SS or SL alleles exhibited a greater activation of the amygdala in response to fearful stimuli than those with LL. It has been reported recently that mutations in the gene that controls

  10. Vertebrate gene predictions and the problem of large genes

    DEFF Research Database (Denmark)

    Wang, Jun; Li, ShengTing; Zhang, Yong

    2003-01-01

    To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistent...

  11. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  12. Brains, Genes and Primates

    Science.gov (United States)

    Belmonte, Juan Carlos Izpisua; Callaway, Edward M.; Churchland, Patricia; Caddick, Sarah J.; Feng, Guoping; Homanics, Gregg E.; Lee, Kuo-Fen; Leopold, David A.; Miller, Cory T.; Mitchell, Jude F.; Mitalipov, Shoukhrat; Moutri, Alysson R.; Movshon, J. Anthony; Okano, Hideyuki; Reynolds, John H.; Ringach, Dario; Sejnowski, Terrence J.; Silva, Afonso C.; Strick, Peter L.; Wu, Jun; Zhang, Feng

    2015-01-01

    One of the great strengths of the mouse model is the wide array of genetic tools that have been developed. Striking examples include methods for directed modification of the genome, and for regulated expression or inactivation of genes. Within neuroscience, it is now routine to express reporter genes, neuronal activity indicators and opsins in specific neuronal types in the mouse. However, there are considerable anatomical, physiological, cognitive and behavioral differences between the mouse and the human that, in some areas of inquiry, limit the degree to which insights derived from the mouse can be applied to understanding human neurobiology. Several recent advances have now brought into reach the goal of applying these tools to understanding the primate brain. Here we describe these advances, consider their potential to advance our understanding of the human brain and brain disorders, discuss bioethical considerations, and describe what will be needed to move forward. PMID:25950631

  13. Gene Porter Bridwell

    Science.gov (United States)

    1994-01-01

    Gene Porter Bridwell served as the director of the Marshall Space Flight Center from January 6, 1994 until February 3, 1996, when he retired from NASA after thirty-four years service. Bridwell, a Marshall employee since 1962, had been Marshall's Space Shuttle Projects Office Director and Space Station Redesign Team deputy manager. Under Bridwell, Marshall worked to develop its role as a Center of Excellence for propulsion and for providing access to space.

  14. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  15. Gene doping in modern sport.

    OpenAIRE

    MAREK SAWCZUK; AGNIESZKA MACIEJEWSKA; PAWEL CIESZCZYK,

    2009-01-01

    Background: The subject of this paper is gene doping, which should be understood as "he non-therapeutic use of cells, genes, genetic elements, or of the modulation of gene expression, having the capacity to improve athletic performance". The authors of this work, based on the review of literature and previous research, make an attempt at wider characterization of gene doping and the discussion of related potential threats.Methods: This is a comprehensive survey of literature on the latest app...

  16. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  17. Genealogy and gene trees.

    Science.gov (United States)

    Rasmuson, Marianne

    2008-02-01

    Heredity can be followed in persons or in genes. Persons can be identified only a few generations back, but simplified models indicate that universal ancestors to all now living persons have occurred in the past. Genetic variability can be characterized as variants of DNA sequences. Data are available only from living persons, but from the pattern of variation gene trees can be inferred by means of coalescence models. The merging of lines backwards in time leads to a MRCA (most recent common ancestor). The time and place of living for this inferred person can give insights in human evolutionary history. Demographic processes are incorporated in the model, but since culture and customs are known to influence demography the models used ought to be tested against available genealogy. The Icelandic data base offers a possibility to do so and points to some discrepancies. Mitochondrial DNA and Y chromosome patterns give a rather consistent view of human evolutionary history during the latest 100 000 years but the earlier epochs of human evolution demand gene trees with longer branches. The results of such studies reveal as yet unsolved problems about the sources of our genome.

  18. Gene therapy of cancer and development of therapeutic target gene

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.

  19. Gene therapy of cancer and development of therapeutic target gene

    International Nuclear Information System (INIS)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene

  20. Gene electrotransfer in clinical trials

    DEFF Research Database (Denmark)

    Gehl, Julie

    2014-01-01

    Electroporation is increasingly being used for delivery of chemotherapy to tumors. Likewise, gene delivery by electroporation is rapidly gaining momentum for both vaccination purposes and for delivery of genes coding for other therapeutic molecules, such as chronic diseases or cancer. This chapter...... describes how gene therapy may be performed using electric pulses to enhance uptake and expression....

  1. Gene probes: principles and protocols

    National Research Council Canada - National Science Library

    Aquino de Muro, Marilena; Rapley, Ralph

    2002-01-01

    ... of labeled DNA has allowed genes to be mapped to single chromosomes and in many cases to a single chromosome band, promoting significant advance in human genome mapping. Gene Probes: Principles and Protocols presents the principles for gene probe design, labeling, detection, target format, and hybridization conditions together with detailed protocols, accom...

  2. Compositional gradients in Gramineae genes

    DEFF Research Database (Denmark)

    Wong, Gane Ka-Shu; Wang, Jun; Tao, Lin

    2002-01-01

    In this study, we describe a property of Gramineae genes, and perhaps all monocot genes, that is not observed in eudicot genes. Along the direction of transcription, beginning at the junction of the 5'-UTR and the coding region, there are gradients in GC content, codon usage, and amino-acid usage...

  3. Independent Gene Discovery and Testing

    Science.gov (United States)

    Palsule, Vrushalee; Coric, Dijana; Delancy, Russell; Dunham, Heather; Melancon, Caleb; Thompson, Dennis; Toms, Jamie; White, Ashley; Shultz, Jeffry

    2010-01-01

    A clear understanding of basic gene structure is critical when teaching molecular genetics, the central dogma and the biological sciences. We sought to create a gene-based teaching project to improve students' understanding of gene structure and to integrate this into a research project that can be implemented by instructors at the secondary level…

  4. Gene function prediction based on Gene Ontology Hierarchy Preserving Hashing.

    Science.gov (United States)

    Zhao, Yingwen; Fu, Guangyuan; Wang, Jun; Guo, Maozu; Yu, Guoxian

    2018-02-23

    Gene Ontology (GO) uses structured vocabularies (or terms) to describe the molecular functions, biological roles, and cellular locations of gene products in a hierarchical ontology. GO annotations associate genes with GO terms and indicate the given gene products carrying out the biological functions described by the relevant terms. However, predicting correct GO annotations for genes from a massive set of GO terms as defined by GO is a difficult challenge. To combat with this challenge, we introduce a Gene Ontology Hierarchy Preserving Hashing (HPHash) based semantic method for gene function prediction. HPHash firstly measures the taxonomic similarity between GO terms. It then uses a hierarchy preserving hashing technique to keep the hierarchical order between GO terms, and to optimize a series of hashing functions to encode massive GO terms via compact binary codes. After that, HPHash utilizes these hashing functions to project the gene-term association matrix into a low-dimensional one and performs semantic similarity based gene function prediction in the low-dimensional space. Experimental results on three model species (Homo sapiens, Mus musculus and Rattus norvegicus) for interspecies gene function prediction show that HPHash performs better than other related approaches and it is robust to the number of hash functions. In addition, we also take HPHash as a plugin for BLAST based gene function prediction. From the experimental results, HPHash again significantly improves the prediction performance. The codes of HPHash are available at: http://mlda.swu.edu.cn/codes.php?name=HPHash. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. The ethics of gene therapy.

    Science.gov (United States)

    Chan, Sarah; Harris, John

    2006-10-01

    Recent developments have progressed in areas of science that pertain to gene therapy and its ethical implications. This review discusses the current state of therapeutic gene technologies, including stem cell therapies and genetic modification, and identifies ethical issues of concern in relation to the science of gene therapy and its application, including the ethics of embryonic stem cell research and therapeutic cloning, the risks associated with gene therapy, and the ethics of clinical research in developing new therapeutic technologies. Additionally, ethical issues relating to genetic modification itself are considered: the significance of the human genome, the distinction between therapy and enhancement, and concerns regarding gene therapy as a eugenic practice.

  6. Differential control of growth, apoptotic activity and gene expression in human colon cancer cells by extracts derived from medicinal herbs, Rhazya stricta and Zingiber officinale and their combination.

    Science.gov (United States)

    Elkady, Ayman I; Hussein, Rania Abd El Hamid; Abu-Zinadah, Osama A

    2014-11-07

    To investigate the effects of extracts from Rhazya stricta (R. stricta) and Zingiber officinale (Z. officinale) on human colorectal cancer cells. Human colorectal cancer cells (HCT116) were subjected to increasing doses of crude alkaloid extracts from R. stricta (CAERS) and crude flavonoid extracts from Z. officinale (CFEZO). Cells were then harvested after 24, 48 or 72 h and cell viability was examined by trypan blue exclusion dye test; clonogenicity and soft agar colony-forming assays were also carried out. Nuclear stain (Hoechst 33342), acridine orange/ethidium bromide double staining, agarose gel electrophoresis and comet assays were performed to assess pro-apoptotic potentiality of the extracts. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR), using gene-specific primers and Western blot analyses were performed to assess the impact of CAERS and CFEZO on the expression levels of key regulatory proteins in HCT116 cells. Treatment with a combination of CAERS and CFEZO synergistically suppressed the proliferation, colony formation and anchorage-independent growth of HCT116 cells. Calculated IC50, after 24, 48 and 72 h, were 70, 90 and 130 μg/mL for CAERS, 65, 85 and 120 μg/mL for CFEZO and 20, 25 and 45 μg/mL for both agents, respectively. CAERS- and CFEZO-treated cells exhibited morphologic and biochemical features of apoptotic cell death. The induction of apoptosis was associated with the release of mitochondrial cytochrome c, an increase in the Bax/Bcl-2 ratio, activation of caspases 3 and 9 and cleavage of poly ADP-ribose polymerase. CAERS and CFEZO treatments downregulated expression levels of anti-apoptotic proteins including Bcl-2, Bcl-X, Mcl-1, survivin and XIAP, and upregulated expression levels of proapoptotic proteins such as Bad and Noxa. CAERS and CFEZO treatments elevated expression levels of the oncosuppressor proteins, p53, p21 and p27, and reduced levels of the oncoproteins, cyclin D1, cyclin/cyclin-dependent kinase-4 and

  7. Fenofibrate down-regulates the expressions of androgen receptor (AR) and AR target genes and induces oxidative stress in the prostate cancer cell line LNCaP

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Hu; Zhu, Chen; Qin, Chao [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Tao, Tao [Department of Neurosurgery, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Li, Jie; Cheng, Gong; Li, Pu; Cao, Qiang; Meng, Xiaoxin; Ju, Xiaobing; Shao, Pengfei; Hua, Lixin [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Gu, Min, E-mail: medzhao1980@163.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China); Yin, Changjun, E-mail: drcjyin@gmail.com [State Key Laboratory of Reproductive Medicine, Department of Urology, First Affiliated Hospital of Nanjing Medical University, Nanjing (China)

    2013-03-08

    Highlights: ► Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells. ► Fenofibrate reduces the expressions of androgen receptor in LNCaP cells. ► Fenofibrate induces oxidative stress in the prostate cancer cell line LNCaP. -- Abstract: Fenofibrate, a peroxisome proliferator-androgen receptor-alpha agonist, is widely used in treating different forms of hyperlipidemia and hypercholesterolemia. Recent reports have indicated that fenofibrate exerts anti-proliferative and pro-apoptotic properties. This study aims to investigate the effects of fenofibrate on the prostate cancer (PCa) cell line LNCaP. The effects of fenofibrate on LNCaP cells were evaluated by flow cytometry, reverse transcription-polymerase chain reaction, enzyme-linked immunosorbent assays, Western blot analysis, and dual-luciferase reporter assay. Fenofibrate induces cell cycle arrest in G1 phase and apoptosis in LNCaP cells, reduces the expressions of androgen receptor (AR) and AR target genes (prostate-specific antigen and TMPRSS2), and inhibits Akt phosphorylation. Fenofibrate can induce the accumulation of intracellular reactive oxygen species and malondialdehyde, and decrease the activities of total anti-oxidant and superoxide dismutase in LNCaP cells. Fenofibrate exerts an anti-proliferative property by inhibiting the expression of AR and induces apoptosis by causing oxidative stress. Therefore, our data suggest fenofibrate may have beneficial effects in fenofibrate users by preventing prostate cancer growth through inhibition of androgen activation and expression.

  8. Interleukin-17 retinotoxicity is prevented by gene transfer of a soluble interleukin-17 receptor acting as a cytokine blocker: implications for age-related macular degeneration.

    Directory of Open Access Journals (Sweden)

    Daniel Ardeljan

    Full Text Available Age-related macular degeneration (AMD is a common yet complex retinal degeneration that causes irreversible central blindness in the elderly. Pathology is widely believed to follow loss of retinal pigment epithelium (RPE and photoreceptor degeneration. Here we report aberrant expression of interleukin-17A (IL17A and the receptor IL17RC in the macula of AMD patients. In vitro, IL17A induces RPE cell death characterized by the accumulation of cytoplasmic lipids and autophagosomes with subsequent activation of pro-apoptotic Caspase-3 and Caspase-9. This pathology is reduced by siRNA knockdown of IL17RC. IL17-dependent retinal degeneration in a mouse model of focal retinal degeneration can be prevented by gene therapy with adeno-associated virus vector encoding soluble IL17 receptor. This intervention rescues RPE and photoreceptors in a MAPK-dependent process. The IL17 pathway plays a key role in RPE and photoreceptor degeneration and could hold therapeutic potential in AMD.

  9. Orphan Nuclear Receptor NR4A1 Binds a Novel Protein Interaction Site on Anti-apoptotic B Cell Lymphoma Gene 2 Family Proteins.

    Science.gov (United States)

    Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C

    2016-07-01

    B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Lycopene modulates cholinergic dysfunction, Bcl-2/Bax balance, and antioxidant enzymes gene transcripts in monosodium glutamate (E621) induced neurotoxicity in a rat model.

    Science.gov (United States)

    Sadek, Kadry; Abouzed, Tarek; Nasr, Sherif

    2016-04-01

    The effect of monosodium glutamate (MSG) on brain tissue and the relative ability of lycopene to avert these neurotoxic effects were investigated. Thirty-two male Wistar rats were distributed into 4 groups: group I, untreated (placebo); group II, injected with MSG (5 mg·kg(-1)) s.c.; group III, gastrogavaged with lycopene (10 mg·kg(-1)) p.o.; and group IV received MSG with lycopene with the same mentioned doses for 30 days. The results showed that MSG induced elevation in lipid peroxidation marker and perturbation in the antioxidant homeostasis and increased the levels of brain and serum cholinesterase (ChE), total creatine phosphokinase (CPK), creatine phosphokinase isoenzymes BB (CPK-BB), and lactate dehydrogenase (LDH). Glutathione S-transferase (GST), superoxide dismutase (SOD), and catalase (CAT) activities and gene expression were increased and glutathione content was reduced in the MSG-challenged rats, and these effects were ameliorated by lycopene. Furthermore, MSG induced apoptosis in brain tissues reflected in upregulation of pro-apoptotic Bax while lycopene upregulated the anti-apoptotic Bcl-2. Our results indicate that lycopene appears to be highly effective in relieving the toxic effects of MSG by inhibiting lipid peroxidation and inducing modifications in the activity of cholinesterase and antioxidant pathways. Interestingly, lycopene protects brain tissue by inhibiting apoptosis signaling induced by MSG.

  11. MiR-7 triggers cell cycle arrest at the G1/S transition by targeting multiple genes including Skp2 and Psme3.

    Directory of Open Access Journals (Sweden)

    Noelia Sanchez

    Full Text Available MiR-7 acts as a tumour suppressor in many cancers and abrogates proliferation of CHO cells in culture. In this study we demonstrate that miR-7 targets key regulators of the G1 to S phase transition, including Skp2 and Psme3, to promote increased levels of p27(KIP and temporary growth arrest of CHO cells in the G1 phase. Simultaneously, the down-regulation of DNA repair-specific proteins via miR-7 including Rad54L, and pro-apoptotic regulators such as p53, combined with the up-regulation of anti-apoptotic factors like p-Akt, promoted cell survival while arrested in G1. Thus miR-7 can co-ordinate the levels of multiple genes and proteins to influence G1 to S phase transition and the apoptotic response in order to maintain cellular homeostasis. This work provides further mechanistic insight into the role of miR-7 as a regulator of cell growth in times of cellular stress.

  12. Neuroprotective effect of non-viral gene therapy treatment based on tetanus toxin C-fragment in a severe mouse model of Spinal Muscular Atrophy.

    Directory of Open Access Journals (Sweden)

    Sara Olivan Garcia

    2016-08-01

    Full Text Available Spinal muscular atrophy (SMA is a hereditary childhood disease that causes paralysis and progressive degeneration of skeletal muscles and spinal motor neurons. SMA is associated with reduced levels of full-length Survival of Motor Neuron (SMN protein, due to mutations in the Survival of Motor Neuron 1 gene. Nowadays there are no effective therapies available to treat patients with SMA, so our aim was to test whether the non-toxic carboxy-terminal fragment of tetanus toxin heavy chain (TTC, which exhibits neurotrophic properties, might have a therapeutic role or benefit in SMA. In this manuscript, we have demonstrated that TTC enhance the SMN expression in motor neurons in vitro and evaluated the effect of intramuscular injection of TTC-encoding plasmid in the spinal cord and the skeletal muscle of SMNdelta7 mice. For this purpose, we studied the weight and the survival time, as well as, the survival and cell death pathways and muscular atrophy. Our results showed that TTC treatment reduced the expression of autophagy markers (Becn1, Atg5, Lc3 and p62 and pro-apoptotic genes such as Bax and Casp3 in spinal cord. In skeletal muscle, TTC was able to downregulate the expression of the main marker of autophagy, Lc3, to wild type levels and the expression of the apoptosis effector protein, Casp3. Regarding the genes related to muscular atrophy (Ankrd1, Calm1, Col19a1, Fbox32, Mt2, Myod1, NogoA, Pax7, Rrad, and Sln, TTC suggest a compensatory effect for muscle damage response, diminished oxidative stress and modulated calcium homeostasis. These preliminary findings suggest the need for further experiments to depth study the effect of TTC in SMA disease.

  13. Low Doses of Cadmium Chloride and Methallothionein-1-Bound Cadmium Display Different Accumulation Kinetics and Induce Different Genes in Cells of the Human Nephron

    Directory of Open Access Journals (Sweden)

    Dana Cucu

    2011-08-01

    Full Text Available Background/Aims: The present study was conducted to investigate the renal tubular handling of inorganic cadmium (Cd2+ by exposing primary human tubular cell cultures to physiologically relevant doses of cadmium chloride (CdCl2. Furthermore, the cellular accumulation of Cd2+ was compared to that of metallothionein-1-bound Cd (Cd7MT-1. Finally, this study aimed to investigate the effect of the accumulation of Cd (both Cd2+ and Cd7MT-1 in renal cells on the expression of genes relevant to nephrotoxic processes. Methods: Cd concentration was measured using atomic absorption spectrometry. mRNA expression was evaluated by quantitative real-time RT-PCR. Results: Cd2+ accumulated into human tubular cells in a concentration- and time-dependent way. Furthermore, cellular accumulation of Cd2+ was different from the cellular accumulation of Cd7MT-1, indicative for different uptake routes. Finally, mRNA expression of the genes encoding the anti-oxidative proteins metallothionein-1 (MT-1 and heme-oxygenase-1 (HO-1 as well as the pro-apoptotic Bcl-2-associated X protein (Bax were upregulated by CdCl2 and not by Cd7MT1. Conclusion: In the presence of physiologically relevant Cd concentrations, tubular accumulation of the element in its inorganic form is different from that of Cd7MT-1. Furthermore, the tubular accumulation of inorganic Cd induces mRNA expression of genes of which the protein products may play a role in Cd-associated renal toxicity.

  14. Radiopharmaceuticals to monitor gene transfer

    International Nuclear Information System (INIS)

    Wiebe, L. I.; Morin, K. W.; Knaus, E. E.

    1997-01-01

    Advances in genetic engineering and molecular biology have opened the door to disease treatment by transferring genes to cells that are responsible for the pathological condition being addressed. These genes can serve to supplement or introduce the function of indigenous genes that are either inadequately expressed or that are congenitally absent in the patient. They can introduce new functions such as drug sensitization to provide a unique therapeutic target. Gene transfer is readily monitored in vitro using a range of histochemical and biochemical tests that are ''built in'' to the therapeutic gene cassette. In vivo, in situ monitoring of the gene transfer and gene expression processes can be achieved with these tests only if biopsy is possible. Scintigraphic imaging can offer unique information on both the extent and location of gene expression, provided that an appropriate reporter gene is included in the therapeutic cassette. This overview includes a brief orientation to gene transfer therapy and is followed by a review of current approaches to gene therapy imaging. The concluding section deals with imaging based on radiolabelled nucleoside substrates for herpes simplex type-1 thymidine kinase, with emphasis on IVFRU, a stable potent and selective HSV-1 TK substrate developed in their laboratories

  15. Gene Circuit Analysis of the Terminal Gap Gene huckebein

    Science.gov (United States)

    Ashyraliyev, Maksat; Siggens, Ken; Janssens, Hilde; Blom, Joke; Akam, Michael; Jaeger, Johannes

    2009-01-01

    The early embryo of Drosophila melanogaster provides a powerful model system to study the role of genes in pattern formation. The gap gene network constitutes the first zygotic regulatory tier in the hierarchy of the segmentation genes involved in specifying the position of body segments. Here, we use an integrative, systems-level approach to investigate the regulatory effect of the terminal gap gene huckebein (hkb) on gap gene expression. We present quantitative expression data for the Hkb protein, which enable us to include hkb in gap gene circuit models. Gap gene circuits are mathematical models of gene networks used as computational tools to extract regulatory information from spatial expression data. This is achieved by fitting the model to gap gene expression patterns, in order to obtain estimates for regulatory parameters which predict a specific network topology. We show how considering variability in the data combined with analysis of parameter determinability significantly improves the biological relevance and consistency of the approach. Our models are in agreement with earlier results, which they extend in two important respects: First, we show that Hkb is involved in the regulation of the posterior hunchback (hb) domain, but does not have any other essential function. Specifically, Hkb is required for the anterior shift in the posterior border of this domain, which is now reproduced correctly in our models. Second, gap gene circuits presented here are able to reproduce mutants of terminal gap genes, while previously published models were unable to reproduce any null mutants correctly. As a consequence, our models now capture the expression dynamics of all posterior gap genes and some variational properties of the system correctly. This is an important step towards a better, quantitative understanding of the developmental and evolutionary dynamics of the gap gene network. PMID:19876378

  16. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  17. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  18. Maximum Gene-Support Tree

    Directory of Open Access Journals (Sweden)

    Yunfeng Shan

    2008-01-01

    Full Text Available Genomes and genes diversify during evolution; however, it is unclear to what extent genes still retain the relationship among species. Model species for molecular phylogenetic studies include yeasts and viruses whose genomes were sequenced as well as plants that have the fossil-supported true phylogenetic trees available. In this study, we generated single gene trees of seven yeast species as well as single gene trees of nine baculovirus species using all the orthologous genes among the species compared. Homologous genes among seven known plants were used for validation of the finding. Four algorithms—maximum parsimony (MP, minimum evolution (ME, maximum likelihood (ML, and neighbor-joining (NJ—were used. Trees were reconstructed before and after weighting the DNA and protein sequence lengths among genes. Rarely a gene can always generate the “true tree” by all the four algorithms. However, the most frequent gene tree, termed “maximum gene-support tree” (MGS tree, or WMGS tree for the weighted one, in yeasts, baculoviruses, or plants was consistently found to be the “true tree” among the species. The results provide insights into the overall degree of divergence of orthologous genes of the genomes analyzed and suggest the following: 1 The true tree relationship among the species studied is still maintained by the largest group of orthologous genes; 2 There are usually more orthologous genes with higher similarities between genetically closer species than between genetically more distant ones; and 3 The maximum gene-support tree reflects the phylogenetic relationship among species in comparison.

  19. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  20. Genes and Disease: Prader-Willi Syndrome

    Science.gov (United States)

    ... MD): National Center for Biotechnology Information (US); 1998-. Genes and Disease [Internet]. Show details National Center for ... 45K) PDF version of this title (3.8M) Gene sequence Genome view see gene locations Entrez Gene ...

  1. Gene Therapy and Children (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Gene Therapy and Children KidsHealth / For Parents / Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  2. Mapping of repair genes

    International Nuclear Information System (INIS)

    Hori, Tadaaki

    1985-01-01

    Chromosome mapping of repair genes involved in U.V. sensitivity is reported. Twenty-three of 25 hybrid cells were resistant to U.V. light. Survival curves of 2 U.V.-resistant cell strains, which possessed mouse chromosomes and human chromosome No.7 - 16, were similar to those of wild strain (L5178Y). On the other hand, survival curves of U.V.-sensitive hybrid cells was analogous to those of Q31. There was a definitive difference in the frequency of inducible chromosome aberrations between U.V. resistant and sensitive mouse-human hybrid cells. U.V.-resistant cell strains possessed the ability of excision repair. Analysis of karyotype in hybrid cells showed that the difference in U.V. sensitivity is dependent upon whether or not human chromosome No.13 is present. Synteny test on esterase D-determining locus confirmed that there is an agreement between the presence of chromosome No.13 and the presence of human esterase D activity. These results led to a conclusion that human genes which compensate recessive character of U.V.-sensitive mutant strain, Q31, with mouse-human hybrid cells are located on the locus of chromosome No.13. (Namekawa, K.)

  3. Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-05-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  4. Evolving chromosomes and gene regulatory networks

    Indian Academy of Sciences (India)

    Aswin

    Genes under H NS control can be. (a) regulated by H NS. (b) regulated by H NS and StpA. Because backup by StpA is partial. Page 19. Gene expression level. H NS regulated xenogenes. Other genes. Page 20 ... recollect: H&NS silences highl transcribable genes. Gene expression level unilateral. Other genes epistatic ...

  5. Bayesian assignment of gene ontology terms to gene expression experiments.

    Science.gov (United States)

    Sykacek, P

    2012-09-15

    Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Source code under GPL license is available from the author. peter.sykacek@boku.ac.at.

  6. Bayesian assignment of gene ontology terms to gene expression experiments

    Science.gov (United States)

    Sykacek, P.

    2012-01-01

    Motivation: Gene expression assays allow for genome scale analyses of molecular biological mechanisms. State-of-the-art data analysis provides lists of involved genes, either by calculating significance levels of mRNA abundance or by Bayesian assessments of gene activity. A common problem of such approaches is the difficulty of interpreting the biological implication of the resulting gene lists. This lead to an increased interest in methods for inferring high-level biological information. A common approach for representing high level information is by inferring gene ontology (GO) terms which may be attributed to the expression data experiment. Results: This article proposes a probabilistic model for GO term inference. Modelling assumes that gene annotations to GO terms are available and gene involvement in an experiment is represented by a posterior probabilities over gene-specific indicator variables. Such probability measures result from many Bayesian approaches for expression data analysis. The proposed model combines these indicator probabilities in a probabilistic fashion and provides a probabilistic GO term assignment as a result. Experiments on synthetic and microarray data suggest that advantages of the proposed probabilistic GO term inference over statistical test-based approaches are in particular evident for sparsely annotated GO terms and in situations of large uncertainty about gene activity. Provided that appropriate annotations exist, the proposed approach is easily applied to inferring other high level assignments like pathways. Availability: Source code under GPL license is available from the author. Contact: peter.sykacek@boku.ac.at PMID:22962488

  7. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  8. Generalist genes and learning disabilities.

    Science.gov (United States)

    Plomin, Robert; Kovas, Yulia

    2005-07-01

    The authors reviewed recent quantitative genetic research on learning disabilities that led to the conclusion that genetic diagnoses differ from traditional diagnoses in that the effects of relevant genes are largely general rather than specific. This research suggests that most genes associated with common learning disabilities--language impairment, reading disability, and mathematics disability--are generalists in 3 ways. First, genes that affect common learning disabilities are largely the same genes responsible for normal variation in learning abilities. Second, genes that affect any aspect of a learning disability affect other aspects of the disability. Third, genes that affect one learning disability are also likely to affect other learning disabilities. These quantitative genetic findings have far-reaching implications for molecular genetics and neuroscience as well as psychology. Copyright 2005 APA, all rights reserved.

  9. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

    Science.gov (United States)

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

    2014-06-01

    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  10. A genetic ensemble approach for gene-gene interaction identification

    Directory of Open Access Journals (Sweden)

    Ho Joshua WK

    2010-10-01

    Full Text Available Abstract Background It has now become clear that gene-gene interactions and gene-environment interactions are ubiquitous and fundamental mechanisms for the development of complex diseases. Though a considerable effort has been put into developing statistical models and algorithmic strategies for identifying such interactions, the accurate identification of those genetic interactions has been proven to be very challenging. Methods In this paper, we propose a new approach for identifying such gene-gene and gene-environment interactions underlying complex diseases. This is a hybrid algorithm and it combines genetic algorithm (GA and an ensemble of classifiers (called genetic ensemble. Using this approach, the original problem of SNP interaction identification is converted into a data mining problem of combinatorial feature selection. By collecting various single nucleotide polymorphisms (SNP subsets as well as environmental factors generated in multiple GA runs, patterns of gene-gene and gene-environment interactions can be extracted using a simple combinatorial ranking method. Also considered in this study is the idea of combining identification results obtained from multiple algorithms. A novel formula based on pairwise double fault is designed to quantify the degree of complementarity. Conclusions Our simulation study demonstrates that the proposed genetic ensemble algorithm has comparable identification power to Multifactor Dimensionality Reduction (MDR and is slightly better than Polymorphism Interaction Analysis (PIA, which are the two most popular methods for gene-gene interaction identification. More importantly, the identification results generated by using our genetic ensemble algorithm are highly complementary to those obtained by PIA and MDR. Experimental results from our simulation studies and real world data application also confirm the effectiveness of the proposed genetic ensemble algorithm, as well as the potential benefits of

  11. Introduction: Cancer Gene Networks.

    Science.gov (United States)

    Clarke, Robert

    2017-01-01

    Constructing, evaluating, and interpreting gene networks generally sits within the broader field of systems biology, which continues to emerge rapidly, particular with respect to its application to understanding the complexity of signaling in the context of cancer biology. For the purposes of this volume, we take a broad definition of systems biology. Considering an organism or disease within an organism as a system, systems biology is the study of the integrated and coordinated interactions of the network(s) of genes, their variants both natural and mutated (e.g., polymorphisms, rearrangements, alternate splicing, mutations), their proteins and isoforms, and the organic and inorganic molecules with which they interact, to execute the biochemical reactions (e.g., as enzymes, substrates, products) that reflect the function of that system. Central to systems biology, and perhaps the only approach that can effectively manage the complexity of such systems, is the building of quantitative multiscale predictive models. The predictions of the models can vary substantially depending on the nature of the model and its inputoutput relationships. For example, a model may predict the outcome of a specific molecular reaction(s), a cellular phenotype (e.g., alive, dead, growth arrest, proliferation, and motility), a change in the respective prevalence of cell or subpopulations, a patient or patient subgroup outcome(s). Such models necessarily require computers. Computational modeling can be thought of as using machine learning and related tools to integrate the very high dimensional data generated from modern, high throughput omics technologies including genomics (next generation sequencing), transcriptomics (gene expression microarrays; RNAseq), metabolomics and proteomics (ultra high performance liquid chromatography, mass spectrometry), and "subomic" technologies to study the kinome, methylome, and others. Mathematical modeling can be thought of as the use of ordinary

  12. Genes, evolution and intelligence.

    Science.gov (United States)

    Bouchard, Thomas J

    2014-11-01

    I argue that the g factor meets the fundamental criteria of a scientific construct more fully than any other conception of intelligence. I briefly discuss the evidence regarding the relationship of brain size to intelligence. A review of a large body of evidence demonstrates that there is a g factor in a wide range of species and that, in the species studied, it relates to brain size and is heritable. These findings suggest that many species have evolved a general-purpose mechanism (a general biological intelligence) for dealing with the environments in which they evolved. In spite of numerous studies with considerable statistical power, we know of very few genes that influence g and the effects are very small. Nevertheless, g appears to be highly polygenic. Given the complexity of the human brain, it is not surprising that that one of its primary faculties-intelligence-is best explained by the near infinitesimal model of quantitative genetics.

  13. Gene therapy for hemophilia

    Science.gov (United States)

    Rogers, Geoffrey L.; Herzog, Roland W.

    2015-01-01

    Hemophilia is an X-linked inherited bleeding disorder consisting of two classifications, hemophilia A and hemophilia B, depending on the underlying mutation. Although the disease is currently treatable with intravenous delivery of replacement recombinant clotting factor, this approach represents a significant cost both monetarily and in terms of quality of life. Gene therapy is an attractive alternative approach to the treatment of hemophilia that would ideally provide life-long correction of clotting activity with a single injection. In this review, we will discuss the multitude of approaches that have been explored for the treatment of both hemophilia A and B, including both in vivo and ex vivo approaches with viral and nonviral delivery vectors. PMID:25553466

  14. Gene therapy and reproductive medicine.

    Science.gov (United States)

    Stribley, John M; Rehman, Khurram S; Niu, Hairong; Christman, Gregory M

    2002-04-01

    To review the literature on the principles of gene therapy and its potential application in reproductive medicine. Literature review. Gene therapy involves transfer of genetic material to target cells using a delivery system, or vector. Attention has primarily focused on viral vectors. Significant problems remain to be overcome including low efficacy of gene transfer, the transient expression of some vectors, safety issues with modified adenoviruses and retroviruses, and ethical concerns. If these issues can be resolved, gene therapy will be applicable to an increasing spectrum of single and multiple gene disorders, as the Human Genome Project data are analyzed, and the genetic component of human disease becomes better understood. Gynecologic gene therapy has advanced to human clinical trials for ovarian carcinoma, and shows potential for the treatment of uterine leiomyomata. Obstetric applications of gene therapy, including fetal gene therapy, remain more distant goals. Concerns about the safety of human gene therapy research are being actively addressed, and remarkable progress in improving DNA transfer has been made. The first treatment success for a genetic disease (severe combined immunodeficiency disease) has been achieved, and ongoing research efforts will eventually yield clinical applications in many spheres of reproductive medicine.

  15. Synthetic sustained gene delivery systems.

    Science.gov (United States)

    Agarwal, Ankit; Mallapragada, Surya K

    2008-01-01

    Gene therapy today is hampered by the need of a safe and efficient gene delivery system that can provide a sustained therapeutic effect without cytotoxicity or unwanted immune responses. Bolus gene delivery in solution results in the loss of delivered factors via lymphatic system and may cause undesired effects by the escape of bioactive molecules to distant sites. Controlled gene delivery systems, acting as localized depot of genes, provide an extended sustained release of genes, giving prolonged maintenance of the therapeutic level of encoded proteins. They also limit the DNA degradation in the nuclease rich extra-cellular environment. While attempts have been made to adapt existing controlled drug delivery technologies, more novel approaches are being investigated for controlled gene delivery. DNA encapsulated in nano/micro spheres of polymers have been administered systemically/orally to be taken up by the targeted tissues and provide sustained release once internalized. Alternatively, DNA entrapped in hydrogels or scaffolds have been injected/implanted in tissues/cavities as platforms for gene delivery. The present review examines these different modalities for sustained delivery of viral and non-viral gene-delivery vectors. Design parameters and release mechanisms of different systems made with synthetic or natural polymers are presented along with their prospective applications and opportunities for continuous development.

  16. Anticancer Drug 2-Methoxyestradiol Protects against Renal Ischemia/Reperfusion Injury by Reducing Inflammatory Cytokines Expression

    Directory of Open Access Journals (Sweden)

    Ying-Yin Chen

    2014-01-01

    Full Text Available Background. Ischemia/reperfusion (I/R injury is a major cause of acute renal failure and allograft dysfunction in kidney transplantation. ROS/inflammatory cytokines are involved in I/R injury. 2-Methoxyestradiol (2ME2, an endogenous metabolite of estradiol, inhibits inflammatory cytokine expression and is an antiangiogenic and antitumor agent. We investigated the inhibitory effect of 2ME2 on renal I/R injury and possible molecular actions. Methods. BALB/c mice were intraperitoneally injected with 2ME2 (10 or 20 mg/kg or vehicle 12 h before and immediately after renal I/R experiments. The kidney weight, renal function, tubular damages, and apoptotic response were examined 24 h after I/R injury. The expression of mRNA of interleukin-1β, tumor necrosis factor- (TNF α, caspase-3, hypoxia inducible factor- (HIF 1α, and proapoptotic Bcl-2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3 in kidney tissue was determined using RT-PCR, while the expression of nuclear factor κB (NF-κB, BCL-2, and BCL-xL, activated caspase-9, and HIF-1α was determined using immunoblotting. In vitro, we determined the effect of 2ME2 on reactive oxygen species (ROS production and cell viability in antimycin-A-treated renal mesangial (RMC and tubular (NRK52E cells. Results. Serum creatinine and blood urea nitrogen were significantly higher in mice with renal I/R injury than in sham control and in I/R+2ME2-treated mice. Survival in I/R+2ME2-treated mice was higher than in I/R mice. Histological examination showed that 2ME2 attenuated tubular damage in I/R mice, which was associated with lower expression TNF-α, IL-1β, caspase-9, HIF-1α, and BNIP3 mRNA in kidney tissue. Western blotting showed that 2ME2 treatment substantially decreased the expression of activated caspase-9, NF-κB, and HIF-1α but increased the antiapoptotic proteins BCL-2 and BCL-xL in kidney of I/R injury. In vitro, 2MR2 decreased ROS production and increased cell viability in antimycin

  17. Evaluation of suitable reference genes for gene expression studies ...

    Indian Academy of Sciences (India)

    2011-12-14

    Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...

  18. Are TMEM genes potential candidate genes for panic disorder?

    DEFF Research Database (Denmark)

    NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne

    2014-01-01

    We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...

  19. Cadmium induces Wnt signaling to upregulate proliferation and survival genes in sub-confluent kidney proximal tubule cells

    Directory of Open Access Journals (Sweden)

    Wolff Natascha A

    2010-05-01

    Full Text Available Abstract Background The class 1 carcinogen cadmium (Cd2+ disrupts the E-cadherin/β-catenin complex of epithelial adherens junctions (AJs and causes renal cancer. Deregulation of E-cadherin adhesion and changes in Wnt/β-catenin signaling are known to contribute to carcinogenesis. Results We investigated Wnt signaling after Cd2+-induced E-cadherin disruption in sub-confluent cultured kidney proximal tubule cells (PTC. Cd2+ (25 μM, 3-9 h caused nuclear translocation of β-catenin and triggered a Wnt response measured by TOPflash reporter assays. Cd2+ reduced the interaction of β-catenin with AJ components (E-cadherin, α-catenin and increased binding to the transcription factor TCF4 of the Wnt pathway, which was upregulated and translocated to the nucleus. While Wnt target genes (c-Myc, cyclin D1 and ABCB1 were up-regulated by Cd2+, electromobility shift assays showed increased TCF4 binding to cyclin D1 and ABCB1 promoter sequences with Cd2+. Overexpression of wild-type and mutant TCF4 confirmed Cd2+-induced Wnt signaling. Wnt signaling elicited by Cd2+ was not observed in confluent non-proliferating cells, which showed increased E-cadherin expression. Overexpression of E-cadherin reduced Wnt signaling, PTC proliferation and Cd2+ toxicity. Cd2+ also induced reactive oxygen species dependent expression of the pro-apoptotic ER stress marker and Wnt suppressor CHOP/GADD153 which, however, did not abolish Wnt response and cell viability. Conclusions Cd2+ induces Wnt signaling in PTC. Hence, Cd2+ may facilitate carcinogenesis of PTC by promoting Wnt pathway-mediated proliferation and survival of pre-neoplastic cells.

  20. Classifying genes to the correct Gene Ontology Slim term in Saccharomyces cerevisiae using neighbouring genes with classification learning

    Directory of Open Access Journals (Sweden)

    Tsatsoulis Costas

    2010-05-01

    Full Text Available Abstract Background There is increasing evidence that gene location and surrounding genes influence the functionality of genes in the eukaryotic genome. Knowing the Gene Ontology Slim terms associated with a gene gives us insight into a gene's functionality by informing us how its gene product behaves in a cellular context using three different ontologies: molecular function, biological process, and cellular component. In this study, we analyzed if we could classify a gene in Saccharomyces cerevisiae to its correct Gene Ontology Slim term using information about its location in the genome and information from its nearest-neighbouring genes using classification learning. Results We performed experiments to establish that the MultiBoostAB algorithm using the J48 classifier could correctly classify Gene Ontology Slim terms of a gene given information regarding the gene's location and information from its nearest-neighbouring genes for training. Different neighbourhood sizes were examined to determine how many nearest neighbours should be included around each gene to provide better classification rules. Our results show that by just incorporating neighbour information from each gene's two-nearest neighbours, the percentage of correctly classified genes to their correct Gene Ontology Slim term for each ontology reaches over 80% with high accuracy (reflected in F-measures over 0.80 of the classification rules produced. Conclusions We confirmed that in classifying genes to their correct Gene Ontology Slim term, the inclusion of neighbour information from those genes is beneficial. Knowing the location of a gene and the Gene Ontology Slim information from neighbouring genes gives us insight into that gene's functionality. This benefit is seen by just including information from a gene's two-nearest neighbouring genes.

  1. Gene doping: possibilities and practicalities.

    Science.gov (United States)

    Wells, Dominic J

    2009-01-01

    Our ever-increasing understanding of the genetic control of cardiovascular and musculoskeletal function together with recent technical improvements in genetic manipulation generates mounting concern over the possibility of such technology being abused by athletes in their quest for improved performance. Genetic manipulation in the context of athletic performance is commonly referred to as gene doping. A review of the literature was performed to identify the genes and methodologies most likely to be used for gene doping and the technologies that might be used to identify such doping. A large number of candidate performance-enhancing genes have been identified from animal studies, many of them using transgenic mice. Only a limited number have been shown to be effective following gene transfer into adults. Those that seem most likely to be abused are genes that exert their effects locally and leave little, if any, trace in blood or urine. There is currently no evidence that gene doping has yet been undertaken in competitive athletes but the anti-doping authorities will need to remain vigilant in reviewing this rapidly emerging technology. The detection of gene doping involves some different challenges from other agents and a number of promising approaches are currently being explored. 2009 S. Karger AG, Basel

  2. Determining Semantically Related Significant Genes.

    Science.gov (United States)

    Taha, Kamal

    2014-01-01

    GO relation embodies some aspects of existence dependency. If GO term xis existence-dependent on GO term y, the presence of y implies the presence of x. Therefore, the genes annotated with the function of the GO term y are usually functionally and semantically related to the genes annotated with the function of the GO term x. A large number of gene set enrichment analysis methods have been developed in recent years for analyzing gene sets enrichment. However, most of these methods overlook the structural dependencies between GO terms in GO graph by not considering the concept of existence dependency. We propose in this paper a biological search engine called RSGSearch that identifies enriched sets of genes annotated with different functions using the concept of existence dependency. We observe that GO term xcannot be existence-dependent on GO term y, if x- and y- have the same specificity (biological characteristics). After encoding into a numeric format the contributions of GO terms annotating target genes to the semantics of their lowest common ancestors (LCAs), RSGSearch uses microarray experiment to identify the most significant LCA that annotates the result genes. We evaluated RSGSearch experimentally and compared it with five gene set enrichment systems. Results showed marked improvement.

  3. Gene set analysis for GWAS

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Soerensen, Mette

    2014-01-01

    Abstract We discuss the use of modified Kolmogorov-Smirnov (KS) statistics in the context of gene set analysis and review corresponding null and alternative hypotheses. Especially, we show that, when enhancing the impact of highly significant genes in the calculation of the test statistic, the co...

  4. On meme--gene coevolution.

    Science.gov (United States)

    Bull, L; Holland, O; Blackmore, S

    2000-01-01

    In this article we examine the effects of the emergence of a new replicator, memes, on the evolution of a pre-existing replicator, genes. Using a version of the NKCS model we examine the effects of increasing the rate of meme evolution in relation to the rate of gene evolution, for various degrees of interdependence between the two replicators. That is, the effects of memes' (suggested) more rapid rate of evolution in comparison to that of genes is investigated using a tunable model of coevolution. It is found that, for almost any degree of interdependence between the two replicators, as the rate of meme evolution increases, a phase transition-like dynamic occurs under which memes have a significantly detrimental effect on the evolution of genes, quickly resulting in the cessation of effective gene evolution. Conversely, the memes experience a sharp increase in benefit from increasing their rate of evolution. We then examine the effects of enabling genes to reduce the percentage of gene-detrimental evolutionary steps taken by memes. Here a critical region emerges as the comparative rate of meme evolution increases, such that if genes cannot effectively select memes a high percentage of the time, they suffer from meme evolution as if they had almost no selective capability.

  5. Susceptibility Genes in Thyroid Autoimmunity

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ban

    2005-01-01

    Full Text Available The autoimmune thyroid diseases (AITD are complex diseases which are caused by an interaction between susceptibility genes and environmental triggers. Genetic susceptibility in combination with external factors (e.g. dietary iodine is believed to initiate the autoimmune response to thyroid antigens. Abundant epidemiological data, including family and twin studies, point to a strong genetic influence on the development of AITD. Various techniques have been employed to identify the genes contributing to the etiology of AITD, including candidate gene analysis and whole genome screening. These studies have enabled the identification of several loci (genetic regions that are linked with AITD, and in some of these loci, putative AITD susceptibility genes have been identified. Some of these genes/loci are unique to Graves' disease (GD and Hashimoto's thyroiditis (HT and some are common to both the diseases, indicating that there is a shared genetic susceptibility to GD and HT. The putative GD and HT susceptibility genes include both immune modifying genes (e.g. HLA, CTLA-4 and thyroid specific genes (e.g. TSHR, Tg. Most likely, these loci interact and their interactions may influence disease phenotype and severity.

  6. Gene polymorphisms in chronic periodontitis

    NARCIS (Netherlands)

    Laine, M.L.; Loos, B.G.; Crielaard, W.

    2010-01-01

    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or

  7. Imaging after vascular gene therapy

    International Nuclear Information System (INIS)

    Manninen, Hannu I.; Yang, Xiaoming

    2005-01-01

    Targets for cardiovascular gene therapy currently include limiting restenosis after balloon angioplasty and stent placement, inhibiting vein bypass graft intimal hyperplasia/stenosis, therapeutic angiogenesis for cardiac and lower-limb ischemia, and prevention of thrombus formation. While catheter angiography is still standard method to follow-up vascular gene transfer, other modern imaging techniques, especially intravascular ultrasound (IVUS), magnetic resonance (MR), and positron emission tomography (PET) imaging provide complementary information about the therapeutic effect of vascular gene transfer in humans. Although molecular imaging of therapeutic gene expression in the vasculatures is still in its technical development phase, it has already offered basic medical science an extremely useful in vivo evaluation tool for non- or minimally invasive imaging of vascular gene therapy

  8. Function analysis of unknown genes

    DEFF Research Database (Denmark)

    Rogowska-Wrzesinska, A.

    2002-01-01

      This thesis entitled "Function analysis of unknown genes" presents the use of proteome analysis for the characterisation of yeast (Saccharomyces cerevisiae) genes and their products (proteins especially those of unknown function). This study illustrates that proteome analysis can be used...... to describe different aspects of molecular biology of the cell, to study changes that occur in the cell due to overexpression or deletion of a gene and to identify various protein modifications. The biological questions and the results of the described studies show the diversity of the information that can...... genes and proteins. It reports the first global proteome database collecting 36 yeast single gene deletion mutants and selecting over 650 differences between analysed mutants and the wild type strain. The obtained results show that two-dimensional gel electrophoresis and mass spectrometry based proteome...

  9. Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2013-12-01

    Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

  10. Therapeutic genes for anti-HIV/AIDS gene therapy.

    Science.gov (United States)

    Bovolenta, Chiara; Porcellini, Simona; Alberici, Luca

    2013-01-01

    The multiple therapeutic approaches developed so far to cope HIV-1 infection, such as anti-retroviral drugs, germicides and several attempts of therapeutic vaccination have provided significant amelioration in terms of life-quality and survival rate of AIDS patients. Nevertheless, no approach has demonstrated efficacy in eradicating this lethal, if untreated, infection. The curative power of gene therapy has been proven for the treatment of monogenic immunodeficiensies, where permanent gene modification of host cells is sufficient to correct the defect for life-time. No doubt, a similar concept is not applicable for gene therapy of infectious immunodeficiensies as AIDS, where there is not a single gene to be corrected; rather engineered cells must gain immunotherapeutic or antiviral features to grant either short- or long-term efficacy mostly by acquisition of antiviral genes or payloads. Anti-HIV/AIDS gene therapy is one of the most promising strategy, although challenging, to eradicate HIV-1 infection. In fact, genetic modification of hematopoietic stem cells with one or multiple therapeutic genes is expected to originate blood cell progenies resistant to viral infection and thereby able to prevail on infected unprotected cells. Ultimately, protected cells will re-establish a functional immune system able to control HIV-1 replication. More than hundred gene therapy clinical trials against AIDS employing different viral vectors and transgenes have been approved or are currently ongoing worldwide. This review will overview anti-HIV-1 infection gene therapy field evaluating strength and weakness of the transgenes and payloads used in the past and of those potentially exploitable in the future.

  11. Time-dependent transcriptional response of GOT1 human small intestine neuroendocrine tumor after 177Lu[Lu]-octreotate therapy.

    Science.gov (United States)

    Spetz, Johan; Rudqvist, Nils; Langen, Britta; Parris, Toshima Z; Dalmo, Johanna; Schüler, Emil; Wängberg, Bo; Nilsson, Ola; Helou, Khalil; Forssell-Aronsson, Eva

    2018-05-01

    Patients with neuroendocrine tumors expressing somatostatin receptors are often treated with 177 Lu[Lu]-octreotate. Despite being highly effective in animal models, 177 Lu[Lu]-octreotate-based therapies in the clinical setting can be optimized further. The aims of the study were to identify and elucidate possible optimization venues for 177 Lu[Lu]-octreotate tumor therapy by characterizing transcriptional responses in the GOT1 small intestine neuroendocrine tumor model in nude mice. GOT1-bearing female BALB/c nude mice were intravenously injected with 15 MBq 177 Lu[Lu]-octreotate (non-curative amount) or mock-treated with saline solution. Animals were killed 1, 3, 7 or 41 d after injection. Total RNA was extracted from the tumor samples and profiled using Illumina microarray expression analysis. Differentially expressed genes were identified (treated vs. control) and pathway analysis was performed. Distribution of differentially expressed transcripts indicated a time-dependent treatment response in GOT1 tumors after 177 Lu[Lu]-octreotate administration. Regulation of CDKN1A, BCAT1 and PAM at 1 d after injection was compatible with growth arrest as the initial response to treatment. Upregulation of APOE and BAX at 3 d, and ADORA2A, BNIP3, BNIP3L and HSPB1 at 41 d after injection suggests first activation and then inhibition of the intrinsic apoptotic pathway during tumor regression and regrowth, respectively. Transcriptional analysis showed radiation-induced apoptosis as an early response after 177 Lu[Lu]-octreotate administration, followed by pro-survival transcriptional changes in the tumor during the regrowth phase. Time-dependent changes in cell cycle and apoptosis-related processes suggest different time points after radionuclide therapy when tumor cells may be more susceptible to additional treatment, highlighting the importance of timing when administering multiple therapeutic agents. Copyright © 2018 The Authors. Published by Elsevier Inc. All

  12. Increased tumour ascorbate is associated with extended disease-free survival and decreased hypoxia-inducible factor-1 activation in human colorectal cancer

    Directory of Open Access Journals (Sweden)

    Caroline eKuiper

    2014-02-01

    Full Text Available Ascorbate is a co-factor for the hydroxylases that regulate the transcription factor hypoxia-inducible factor (HIF-1, which provides cancer cells with a metabolic and survival advantage in the hypoxic environment of solid tumors. However, whether ascorbate affects tumor development is a highly debated issue. We aimed to determine whether tumor ascorbate was associated with HIF-1 activation and patient disease-free survival. In this study we undertook a retrospective observational analysis of tissue-banked tumor and paired normal tissue from 49 colorectal cancer patients, measuring ascorbate levels, HIF-1α and its downstream gene products BNIP3 and VEGF. Patient survival was monitored for the first six years after surgery. We found that ascorbate levels were lower in tumor tissue compared to normal tissue (p< 0.001 but overall levels varied considerably. HIF-1α, VEGF and BNIP3 were elevated in tumor samples (p< 0.01. There was an inverse relationship between tumor ascorbate content and HIF-1 pathway activation (p=0.002 and tumor size (p=0.018. Higher tumor ascorbate content was associated with significantly improved disease-free survival in the first 6 years after surgery (p=0.006, with 141 - 1,094 additional disease free days. This was independent of tumor grade and stage. Survival advantage was associated with the amount of ascorbate in the tumor, but not with the amount in adjacent normal tissue. Our results demonstrate that higher tumor ascorbate content is associated decreased HIF-1 activation, most likely due to the co-factor activity of ascorbate for the regulatory HIF hydroxylases. Our findings support the need for future studies to determine whether raising tumor ascorbate is possible with clinical intervention and whether this results in modification of hydroxylase-dependent pathways in the tumor.

  13. The roles of autophagy and hypoxia in human inflammatory periapical lesions.

    Science.gov (United States)

    Huang, H Y; Wang, W C; Lin, P Y; Huang, C P; Chen, C Y; Chen, Y K

    2018-02-01

    To determine the expressions of hypoxia-related [hypoxia-inducible transcription factors (HIF)-1α, BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 (BNIP3) and phospho-adenosine monophosphate activated protein kinase (pAMPK)] and autophagy-related [microtubule-associated protein 1 light chain 3 (LC3), beclin-1 (BECN-1), autophagy-related gene (Atg)5-12, and p62] proteins in human inflammatory periapical lesions. Fifteen samples of radicular cysts (RCs) and 21 periapical granulomas (PGs), combined with 17 healthy dental pulp tissues, were examined. Enzyme-linked immunosorbent assay (ELISA) was used to detect interleukin (IL)-1β cytokine; immunohistochemical (IHC) and Western blot (WB) analyses were employed to examine autophagy-related and hypoxia-related proteins. Transmission electron microscopy (TEM) was used to explore the ultrastructural morphology of autophagy in periapical lesions. Nonparametric Kruskal-Wallis tests and Mann-Whitney U-tests were used for statistical analyses. ELISA revealed a significantly higher (P periapical lesions than in normal pulp tissue. Immunoscores of IHC expressions of pAMPK, HIF-1α, BNIP3, BECN-1 and Atg5-12 proteins in periapical lesions were significantly higher (P periapical lesions were noted as compared to normal pulp tissue. Upon TEM, ultrastructural double-membrane autophagosomes and autolysosomes were observed in PGs and RCs. Autophagy associated with hypoxia may play a potential causative role in the development and maintenance of inflamed periapical lesions. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  14. GENES IN SPORT AND DOPING

    Directory of Open Access Journals (Sweden)

    Andrzej Pokrywka

    2013-06-01

    Full Text Available Genes control biological processes such as muscle production of energy, mitochondria biogenesis, bone formation erythropoiesis, angiogenesis, vasodilation, neurogenesis, etc. DNA profiling for athletes reveals genetic variations that may be associated with endurance ability, muscle performance and power exercise, tendon susceptibility to injuries and psychological aptitude. Already, over 200 genes relating to physical performance have been identified by several research groups. Athletes’ genotyping is developing as a tool for the formulation of personalized training and nutritional programmes to optimize sport training as well as for the prediction of exercise-related injuries. On the other hand, development of molecular technology and gene therapy creates a risk of non-therapeutic use of cells, genes and genetic elements to improve athletic performance. Therefore, the World Anti-Doping Agency decided to include prohibition of gene doping within their World Anti-Doping Code in 2003. In this review article, we will provide a current overview of genes for use in athletes’ genotyping and gene doping possibilities, including their development and detection techniques.

  15. [Gene doping: gene transfer and possible molecular detection].

    Science.gov (United States)

    Argüelles, Carlos Francisco; Hernández-Zamora, Edgar

    2007-01-01

    The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

  16. Delimiting Coalescence Genes (C-Genes) in Phylogenomic Data Sets.

    Science.gov (United States)

    Springer, Mark S; Gatesy, John

    2018-02-26

    coalescence methods have emerged as a popular alternative for inferring species trees with large genomic datasets, because these methods explicitly account for incomplete lineage sorting. However, statistical consistency of summary coalescence methods is not guaranteed unless several model assumptions are true, including the critical assumption that recombination occurs freely among but not within coalescence genes (c-genes), which are the fundamental units of analysis for these methods. Each c-gene has a single branching history, and large sets of these independent gene histories should be the input for genome-scale coalescence estimates of phylogeny. By contrast, numerous studies have reported the results of coalescence analyses in which complete protein-coding sequences are treated as c-genes even though exons for these loci can span more than a megabase of DNA. Empirical estimates of recombination breakpoints suggest that c-genes may be much shorter, especially when large clades with many species are the focus of analysis. Although this idea has been challenged recently in the literature, the inverse relationship between c-gene size and increased taxon sampling in a dataset-the 'recombination ratchet'-is a fundamental property of c-genes. For taxonomic groups characterized by genes with long intron sequences, complete protein-coding sequences are likely not valid c-genes and are inappropriate units of analysis for summary coalescence methods unless they occur in recombination deserts that are devoid of incomplete lineage sorting (ILS). Finally, it has been argued that coalescence methods are robust when the no-recombination within loci assumption is violated, but recombination must matter at some scale because ILS, a by-product of recombination, is the raison d'etre for coalescence methods. That is, extensive recombination is required to yield the large number of independently segregating c-genes used to infer a species tree. If coalescent methods are powerful

  17. Gene therapy of cancer by vaccines carrying inserted immunostimulatory genes

    Czech Academy of Sciences Publication Activity Database

    Bubeník, Jan

    2007-01-01

    Roč. 53, č. 3 (2007), s. 71-73 ISSN 0015-5500 Grant - others:EU-FP6 NoE Clinigene(XE) 018933; Liga proti rakovině, Praha(CZ) XX Institutional research plan: CEZ:AV0Z50520514 Keywords : gene therapy * immunostimulatory genes * vaccine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.596, year: 2007

  18. Cloning and selection of reference genes for gene expression ...

    African Journals Online (AJOL)

    Full length mRNA sequences of Ac-β-actin and Ac-gapdh, and partial mRNA sequences of Ac-18SrRNA and Ac-ubiquitin were cloned from pineapple in this study. The four genes were tested as housekeeping genes in three experimental sets. GeNorm and NormFinder analysis revealed that β-actin was the most ...

  19. The hunt for gene dopers.

    Science.gov (United States)

    Mansour, Mai M H; Azzazy, Hassan M E

    2009-07-01

    Gene doping, the abuse of gene therapy for illicit athletic enhancement, is perceived as a coming threat and is a prime concern to the anti-doping community. This doping technique represents a significant ethical challenge and there are concerns regarding its safety for athletes. This article presents the basics of gene doping, potential strategies for its detection and the role of promising new technologies in aiding detection efforts. These include the use of lab-on-a-chip techniques as well as nanoparticles to enhance the performance of current analytical methods and to develop new doping detection strategies.

  20. Gene Therapy Approaches to Hemoglobinopathies.

    Science.gov (United States)

    Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

    2017-10-01

    Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...

  2. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin

    2014-01-01

    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

  3. American Society of Gene & Cell Therapy

    Science.gov (United States)

    ... Gene & Cell Therapy Defined Gene therapy and cell therapy are overlapping fields of biomedical research that aim to repair the direct cause of genetic diseases. Read More Gene & Cell Therapy FAQ's Read the most common questions raised by ...

  4. Basics on Genes and Genetic Disorders

    Science.gov (United States)

    ... for Educators Search English Español The Basics on Genes and Genetic Disorders KidsHealth / For Teens / The Basics ... such as treating health problems. What Is a Gene? To understand how genes work, let's review some ...

  5. Norrie disease gene is distinct from the monoamine oxidase genes.

    Science.gov (United States)

    Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

    1989-09-01

    The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

  6. Information-processing genes

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1995-01-01

    There are an estimated 100,000 genes in the human genome of which 97% is non-coding. On the other hand, bacteria have little or no non-coding DNA. Non-coding region includes introns, ALU sequences, satellite DNA, and other segments not expressed as proteins. Why it exists? Why nature has kept non-coding during the long evolutionary period if it has no role in the development of complex life forms? Does complexity of a species somehow correlated to the existence of apparently useless sequences? What kind of capability is encoded within such nucleotide sequences that is a necessary, but not a sufficient condition for the evolution of complex life forms, keeping in mind the C-value paradox and the omnipresence of non-coding segments in higher eurkaryotes and also in many archea and prokaryotes. The physico-chemical description of biological processes is hardware oriented and does not highlight algorithmic or information processing aspect. However, an algorithm without its hardware implementation is useless as much as hardware without its capability to run an algorithm. The nature and type of computation an information-processing hardware can perform depends only on its algorithm and the architecture that reflects the algorithm. Given that enormously difficult tasks such as high fidelity replication, transcription, editing and regulation are all achieved within a long linear sequence, it is natural to think that some parts of a genome are involved is these tasks. If some complex algorithms are encoded with these parts, then it is natural to think that non-coding regions contain processing-information algorithms. A comparison between well-known automatic sequences and sequences constructed out of motifs is found in all species proves the point: noncoding regions are a sort of ''hardwired'' programs, i.e., they are linear representations of information-processing machines. Thus in our model, a noncoding region, e.g., an intron contains a program (or equivalently, it is

  7. Gene Therapy for Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Rachel Denyer

    2012-01-01

    Full Text Available Current pharmacological and surgical treatments for Parkinson's disease offer symptomatic improvements to those suffering from this incurable degenerative neurological disorder, but none of these has convincingly shown effects on disease progression. Novel approaches based on gene therapy have several potential advantages over conventional treatment modalities. These could be used to provide more consistent dopamine supplementation, potentially providing superior symptomatic relief with fewer side effects. More radically, gene therapy could be used to correct the imbalances in basal ganglia circuitry associated with the symptoms of Parkinson's disease, or to preserve or restore dopaminergic neurons lost during the disease process itself. The latter neuroprotective approach is the most exciting, as it could theoretically be disease modifying rather than simply symptom alleviating. Gene therapy agents using these approaches are currently making the transition from the laboratory to the bedside. This paper summarises the theoretical approaches to gene therapy for Parkinson's disease and the findings of clinical trials in this rapidly changing field.

  8. [Obesity studies in candidate genes].

    Science.gov (United States)

    Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo

    2004-04-17

    There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.

  9. Novel genes in LDL metabolism

    DEFF Research Database (Denmark)

    Christoffersen, Mette; Tybjærg-Hansen, Anne

    2015-01-01

    PURPOSE OF REVIEW: To summarize recent findings from genome-wide association studies (GWAS), whole-exome sequencing of patients with familial hypercholesterolemia and 'exome chip' studies pointing to novel genes in LDL metabolism. RECENT FINDINGS: The genetic loci for ATP-binding cassette......-exome sequencing and 'exome chip' studies have additionally suggested several novel genes in LDL metabolism including insulin-induced gene 2, signal transducing adaptor family member 1, lysosomal acid lipase A, patatin-like phospholipase domain-containing protein 5 and transmembrane 6 superfamily member 2. Most...... of these findings still require independent replications and/or functional studies to confirm the exact role in LDL metabolism and the clinical implications for human health. SUMMARY: GWAS, exome sequencing studies, and recently 'exome chip' studies have suggested several novel genes with effects on LDL cholesterol...

  10. Gene discovery in Triatoma infestans

    Directory of Open Access Journals (Sweden)

    de Burgos Nelia

    2011-03-01

    Full Text Available Abstract Background Triatoma infestans is the most relevant vector of Chagas disease in the southern cone of South America. Since its genome has not yet been studied, sequencing of Expressed Sequence Tags (ESTs is one of the most powerful tools for efficiently identifying large numbers of expressed genes in this insect vector. Results In this work, we generated 826 ESTs, resulting in an increase of 47% in the number of ESTs available for T. infestans. These ESTs were assembled in 471 unique sequences, 151 of which represent 136 new genes for the Reduviidae family. Conclusions Among the putative new genes for the Reduviidae family, we identified and described an interesting subset of genes involved in development and reproduction, which constitute potential targets for insecticide development.

  11. Gene therapy of thyroid carcinoma

    International Nuclear Information System (INIS)

    Zheng Wei; Tan Jian

    2007-01-01

    Normally, differentiated thyroid carcinoma(DTC) is a disease of good prognosis, but about 30% of the tumors are dedifferentiate, which are inaccessible to standard therapeutic procedures such as 'operation, 131 I therapy and thyroid hormone'. Both internal and abroad experts are researching a new therapy of dedifferentiated thyroid carcinoma--gene therapy. Many of them utilize methods of it, but follow different strategies: (1) transduction of the thyroid sodium/iodide transporter gene to make tissues that do not accumulate iodide treatable by 131 I therapy; (2) strengthening of the anti-tumor immune response; (3) suicide gene therapy; (4) depression the generation of tumor cells; (5) gene therapy of anti- vascularization. (authors)

  12. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  13. Endocrine aspects of cancer gene therapy.

    Science.gov (United States)

    Barzon, Luisa; Boscaro, Marco; Palù, Giorgio

    2004-02-01

    The field of cancer gene therapy is in continuous expansion, and technology is quickly moving ahead as far as gene targeting and regulation of gene expression are concerned. This review focuses on the endocrine aspects of gene therapy, including the possibility to exploit hormone and hormone receptor functions for regulating therapeutic gene expression, the use of endocrine-specific genes as new therapeutic tools, the effects of viral vector delivery and transgene expression on the endocrine system, and the endocrine response to viral vector delivery. Present ethical concerns of gene therapy and the risk of germ cell transduction are also discussed, along with potential lines of innovation to improve cell and gene targeting.

  14. Gene Therapy in Cardiac Arrhythmias

    OpenAIRE

    Praveen, S.V; Francis, Johnson; Venugopal, K

    2006-01-01

    Gene therapy has progressed from a dream to a bedside reality in quite a few human diseases. From its first application in adenosine deaminase deficiency, through the years, its application has evolved to vascular angiogenesis and cardiac arrhythmias. Gene based biological pacemakers using viral vectors or mesenchymal cells tested in animal models hold much promise. Induction of pacemaker activity within the left bundle branch can provide stable heart rates. Genetic modification of the AV...

  15. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  16. Decoding Gene Patents in Australia

    OpenAIRE

    Denley, Adam; Cherry, James

    2015-01-01

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents—the Australian Patent Office, Australian courts, and Australian government—have dealt with the issue of whether genetic m...

  17. Identification of sumoylation sites in CCDC6, the first identified RET partner gene in papillary thyroid carcinoma, uncovers a mode of regulating CCDC6 function on CREB1 transcriptional activity.

    Directory of Open Access Journals (Sweden)

    Chiara Luise

    Full Text Available CCDC6 was originally identified in chimeric genes as caused by chromosomal translocation involving the RET protooncogene in some thyroid tumors. Recognised as a 65 kDa pro-apoptotic phosphoprotein, CCDC6 has been enrolled as an ATM substrate that contribute to protect genome integrity by modulating PP4c activity in response to genotoxic stress. Recently, CCDC6 has been identified as a repressor of CREB1-dependent transcription. Sumoylation has emerged as an important mechanism in transcriptional control. Here, we report the identification and characterization of three sites of sumoylation in CCDC6 (K74, K266 and K424 which are highly conserved in vertebrates. We demonstrate that the post-translational modifications by SUMO2 constrain most of the CCDC6 protein in the cytosol and affect its functional interaction with CREB1 with a decrease of CCDC6 repressive function on CREB1 transcriptional activity. Indeed, the impairment of functional outcome of sumoylated CCDC6 is obtained knocking down all three the sumoylation sites. Interestingly, in thyroid cells the SUMO2-mediated CCDC6 post-translational modifications are induced by Forskolin, a cAMP analog. Signal transduction via the cAMP pathway is known to be ubiquitous and represents a major line of communication between many organisms and their environment. We believe that CCDC6 could be an important player in the dynamics of cAMP signaling by fine regulating CREB1 transcriptional activity in normal and transformed thyroid cells.

  18. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    Science.gov (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  19. Cationic Bolaamphiphiles for Gene Delivery

    Science.gov (United States)

    Tan, Amelia Li Min; Lim, Alisa Xue Ling; Zhu, Yiting; Yang, Yi Yan; Khan, Majad

    2014-05-01

    Advances in medical research have shed light on the genetic cause of many human diseases. Gene therapy is a promising approach which can be used to deliver therapeutic genes to treat genetic diseases at its most fundamental level. In general, nonviral vectors are preferred due to reduced risk of immune response, but they are also commonly associated with low transfection efficiency and high cytotoxicity. In contrast to viral vectors, nonviral vectors do not have a natural mechanism to overcome extra- and intracellular barriers when delivering the therapeutic gene into cell. Hence, its design has been increasingly complex to meet challenges faced in targeting of, penetration of and expression in a specific host cell in achieving more satisfactory transfection efficiency. Flexibility in design of the vector is desirable, to enable a careful and controlled manipulation of its properties and functions. This can be met by the use of bolaamphiphile, a special class of lipid. Unlike conventional lipids, bolaamphiphiles can form asymmetric complexes with the therapeutic gene. The advantage of having an asymmetric complex lies in the different purposes served by the interior and exterior of the complex. More effective gene encapsulation within the interior of the complex can be achieved without triggering greater aggregation of serum proteins with the exterior, potentially overcoming one of the great hurdles faced by conventional single-head cationic lipids. In this review, we will look into the physiochemical considerations as well as the biological aspects of a bolaamphiphile-based gene delivery system.

  20. BEEF CATTLE MUSCULARITY CANDIDATE GENES

    Directory of Open Access Journals (Sweden)

    Irida Novianti

    2010-04-01

    Full Text Available Muscularity is a potential indicator for the selection of more productive cattle. Mapping quantitative trait loci (QTL for traits related to muscularity is useful to identify the genomic regions where the genes affecting muscularity reside. QTL analysis from a Limousin-Jersey double backcross herd was conducted using QTL Express software with cohort and breed as the fixed effects. Nine QTL suggested to have an association with muscularity were identified on cattle chromosomes BTA 1, 2, 3, 4, 5, 8, 12, 14 and 17. The myostatin gene is located at the centromeric end of chromosome 2 and not surprisingly, the Limousin myostatin F94L variant accounted for the QTL on BTA2. However, when the myostatin F94L genotype was included as an additional fixed effect, the QTL on BTA17 was also no longer significant. This result suggests that there may be gene(s that have epistatic effects with myostatin located on cattle chromosome 17. Based on the position of the QTL in base pairs, all the genes that reside in the region were determined using the Ensembl data base (www.ensembl.org. There were two potential candidate genes residing within these QTL regions were selected. They were Smad nuclear interacting protein 1 (SNIP1 and similar to follistatin-like 5 (FSTL5. (JIIPB 2010 Vol 20 No 1: 1-10

  1. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  2. Apoptosis Induction by Polygonum minus is related to antioxidant capacity, alterations in expression of apoptotic-related genes, and S-phase cell cycle arrest in HepG2 cell line.

    Science.gov (United States)

    Mohd Ghazali, Mohd Alfazari; Al-Naqeb, Ghanya; Krishnan Selvarajan, Kesavanarayanan; Hazizul Hasan, Mizaton; Adam, Aishah

    2014-01-01

    Polygonum minus (Polygonaceae) is a medicinal herb distributed throughout eastern Asia. The present study investigated antiproliferative effect of P. minus and its possible mechanisms. Four extracts (petroleum ether, methanol, ethyl acetate, and water) were prepared by cold maceration. Extracts were subjected to phytochemical screening, antioxidant, and antiproliferative assays; the most bioactive was fractionated using vacuum liquid chromatography into seven fractions (F1-F7). Antioxidant activity was measured via total phenolic content (TPC), 2,2-diphenyl-1-picrylhydrazyl (DPPH), and ferric reducing antioxidant power (FRAP) assays. Antiproliferative activity was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Most active fraction was tested for apoptosis induction and cell cycle arrest in HepG2 cells using flow cytometry and confocal microscopy. Apoptotic-related gene expression was studied by RT-PCR. Ethyl acetate extract was bioactive in initial assays. Its fraction, F7, exhibited highest antioxidant capacity (TPC; 113.16 ± 6.2 mg GAE/g extract, DPPH; EC50: 30.5 ± 3.2 μg/mL, FRAP; 1169 ± 20.3 μmol Fe (II)/mg extract) and selective antiproliferative effect (IC50: 25.75 ± 1.5 μg/mL). F7 induced apoptosis in concentration- and time-dependent manner and caused cell cycle arrest at S-phase. Upregulation of proapoptotic genes (Bax, p53, and caspase-3) and downregulation of antiapoptotic gene, Bcl-2, were observed. In conclusion, F7 was antiproliferative to HepG2 cells by inducing apoptosis, cell cycle arrest, and via antioxidative effects.

  3. Homology-dependent Gene Silencing in Paramecium

    Science.gov (United States)

    Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

    1998-01-01

    Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

  4. New Gene Evolution: Little Did We Know

    Science.gov (United States)

    Long, Manyuan; VanKuren, Nicholas W.; Chen, Sidi; Vibranovski, Maria D.

    2014-01-01

    Genes are perpetually added to and deleted from genomes during evolution. Thus, it is important to understand how new genes are formed and evolve as critical components of the genetic systems determining the biological diversity of life. Two decades of effort have shed light on the process of new gene origination, and have contributed to an emerging comprehensive picture of how new genes are added to genomes, ranging from the mechanisms that generate new gene structures to the presence of new genes in different organisms to the rates and patterns of new gene origination and the roles of new genes in phenotypic evolution. We review each of these aspects of new gene evolution, summarizing the main evidence for the origination and importance of new genes in evolution. We highlight findings showing that new genes rapidly change existing genetic systems that govern various molecular, cellular and phenotypic functions. PMID:24050177

  5. Advances in study of reporter gene imaging for monitoring gene therapy

    International Nuclear Information System (INIS)

    Mu Chuanjie; Zhou Jiwen

    2003-01-01

    To evaluate the efficiency of gene therapy, it is requisite to monitor localization and expression of the therapeutic gene in vivo. Monitoring expression of reporter gene using radionuclide reporter gene technique is the best method. Adenoviral vectors expressing reporter gene are constructed using gene fusion, bicistronic, double promoter or bidirectional transcriptional recombination techniques, and transferred into target cells and tissues, then injected radiolabeled reporter probes which couple to the reporter genes. The reporter genes can be imaged invasively, repeatedly, quantitatively with γ-camera, PET and SPECT. Recently, several reporter gene and reporter probe systems have been used in studies of gene therapy. The part of them has been used for clinic trials

  6. Newer Gene Editing Technologies toward HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  7. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  8. Gene expression profiles in skeletal muscle after gene electrotransfer

    DEFF Research Database (Denmark)

    Hojman, Pernille; Zibert, John R; Gissel, Hanne

    2007-01-01

    BACKGROUND: Gene transfer by electroporation (DNA electrotransfer) to muscle results in high level long term transgenic expression, showing great promise for treatment of e.g. protein deficiency syndromes. However little is known about the effects of DNA electrotransfer on muscle fibres. We have...... caused down-regulation of structural proteins e.g. sarcospan and catalytic enzymes. Injection of DNA induced down-regulation of intracellular transport proteins e.g. sentrin. The effects on muscle fibres were transient as the expression profiles 3 weeks after treatment were closely related......) followed by a long low voltage pulse (LV, 100 V/cm, 400 ms); a pulse combination optimised for efficient and safe gene transfer. Muscles were transfected with green fluorescent protein (GFP) and excised at 4 hours, 48 hours or 3 weeks after treatment. RESULTS: Differentially expressed genes were...

  9. Combining gene prediction methods to improve metagenomic gene annotation

    Directory of Open Access Journals (Sweden)

    Rosen Gail L

    2011-01-01

    Full Text Available Abstract Background Traditional gene annotation methods rely on characteristics that may not be available in short reads generated from next generation technology, resulting in suboptimal performance for metagenomic (environmental samples. Therefore, in recent years, new programs have been developed that optimize performance on short reads. In this work, we benchmark three metagenomic gene prediction programs and combine their predictions to improve metagenomic read gene annotation. Results We not only analyze the programs' performance at different read-lengths like similar studies, but also separate different types of reads, including intra- and intergenic regions, for analysis. The main deficiencies are in the algorithms' ability to predict non-coding regions and gene edges, resulting in more false-positives and false-negatives than desired. In fact, the specificities of the algorithms are notably worse than the sensitivities. By combining the programs' predictions, we show significant improvement in specificity at minimal cost to sensitivity, resulting in 4% improvement in accuracy for 100 bp reads with ~1% improvement in accuracy for 200 bp reads and above. To correctly annotate the start and stop of the genes, we find that a consensus of all the predictors performs best for shorter read lengths while a unanimous agreement is better for longer read lengths, boosting annotation accuracy by 1-8%. We also demonstrate use of the classifier combinations on a real dataset. Conclusions To optimize the performance for both prediction and annotation accuracies, we conclude that the consensus of all methods (or a majority vote is the best for reads 400 bp and shorter, while using the intersection of GeneMark and Orphelia predictions is the best for reads 500 bp and longer. We demonstrate that most methods predict over 80% coding (including partially coding reads on a real human gut sample sequenced by Illumina technology.

  10. COGNATE: comparative gene annotation characterizer.

    Science.gov (United States)

    Wilbrandt, Jeanne; Misof, Bernhard; Niehuis, Oliver

    2017-07-17

    The comparison of gene and genome structures across species has the potential to reveal major trends of genome evolution. However, such a comparative approach is currently hampered by a lack of standardization (e.g., Elliott TA, Gregory TR, Philos Trans Royal Soc B: Biol Sci 370:20140331, 2015). For example, testing the hypothesis that the total amount of coding sequences is a reliable measure of potential proteome diversity (Wang M, Kurland CG, Caetano-Anollés G, PNAS 108:11954, 2011) requires the application of standardized definitions of coding sequence and genes to create both comparable and comprehensive data sets and corresponding summary statistics. However, such standard definitions either do not exist or are not consistently applied. These circumstances call for a standard at the descriptive level using a minimum of parameters as well as an undeviating use of standardized terms, and for software that infers the required data under these strict definitions. The acquisition of a comprehensive, descriptive, and standardized set of parameters and summary statistics for genome publications and further analyses can thus greatly benefit from the availability of an easy to use standard tool. We developed a new open-source command-line tool, COGNATE (Comparative Gene Annotation Characterizer), which uses a given genome assembly and its annotation of protein-coding genes for a detailed description of the respective gene and genome structure parameters. Additionally, we revised the standard definitions of gene and genome structures and provide the definitions used by COGNATE as a working draft suggestion for further reference. Complete parameter lists and summary statistics are inferred using this set of definitions to allow down-stream analyses and to provide an overview of the genome and gene repertoire characteristics. COGNATE is written in Perl and freely available at the ZFMK homepage ( https://www.zfmk.de/en/COGNATE ) and on github ( https

  11. Characterisation of haematological profiles and whole blood relative gene expression levels in Holstein-Friesian and Jersey bull calves undergoing gradual weaning.

    Science.gov (United States)

    Johnston, D; Kenny, D A; Kelly, A K; McCabe, M S; McGee, M; Waters, S M; Earley, B

    2016-09-01

    Haematological profiles indicate the health status of an animal and can be used to identify sub-clinical stress responses. The objectives of the study were to examine (i) the effect of breed and plane of nutrition, on haematological profiles of artificially reared Holstein-Friesian and Jersey bull calves in response to gradual weaning, and (ii) the effect of breed on immune response genes in bovine whole blood using real-time quantitative PCR. Holstein-Friesian and Jersey bull calves were group housed indoors and individually fed using an automatic feeder. They were allocated to a high, medium or low plane of nutrition, based on milk replacer (MR) and concentrate. The nutrition treatments were calculated using National Research Council guidelines in order to achieve a high, medium or low growth rate for each respective breed. During the weaning phase MR was gradually reduced over a 14-day (d) period (d -13 to d 0). Calves were blood sampled on d -14, -6, -3, 0, 1, 3, 8 and 14 relative to weaning (d 0) for subsequent haematological analysis. On d -14, 1 and 8, a subset of eight Holstein-Friesian calves randomly selected from the medium nutrition treatment and eight Jersey calves randomly selected from the high nutrition treatment, were blood sampled for gene expression profiling, targeting biomarkers of weaning stress. These two treatment groups were chosen to examine the effect of breed on expression of the genes of interest, as energy intake and animal performance were similar. There was no effect of breed×plane of nutrition interaction nor effect of plane of nutrition on any variable measured (P>0.05). Gradual weaning produced differential biological responses in the two breeds evidenced by breed×time interactions for lymphocyte, monocyte and red blood cell number, plasma haemoglobin and haptoglobin concentrations (Plevel of the pro-apoptotic gene, Fas, increased on d 1 relative to d -14 (Plevels were greater in Jersey calves compared with Holstein-Friesian for

  12. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  13. Deregulated genes in sporadic vestibular schwannomas

    DEFF Research Database (Denmark)

    Cayé-Thomasen, Per; Helweg-Larsen, Rehannah Holga Andrea; Stangerup, Sven-Eric

    2010-01-01

    In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology.......In search of genes associated with vestibular schwannoma tumorigenesis, this study examines the gene expression in human vestibular nerve versus vestibular schwannoma tissue samples using microarray technology....

  14. The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study

    DEFF Research Database (Denmark)

    Hedley, Paula L; Haundrup, Ole; Andersen, Paal S

    2011-01-01

    The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a genetic...

  15. Melatonin Receptor Genes in Vertebrates

    Directory of Open Access Journals (Sweden)

    Hua Dong Yin

    2013-05-01

    Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.

  16. Gene replacement in Penicillium roqueforti.

    Science.gov (United States)

    Goarin, Anne; Silar, Philippe; Malagnac, Fabienne

    2015-05-01

    Most cheese-making filamentous fungi lack suitable molecular tools to improve their biotechnology potential. Penicillium roqueforti, a species of high industrial importance, would benefit from functional data yielded by molecular genetic approaches. This work provides the first example of gene replacement by homologous recombination in P. roqueforti, demonstrating that knockout experiments can be performed in this fungus. To do so, we improved the existing transformation method to integrate transgenes into P. roqueforti genome. In the meantime, we cloned the PrNiaD gene, which encodes a NADPH-dependent nitrate reductase that reduces nitrate to nitrite. Then, we performed a deletion of the PrNiaD gene from P. roqueforti strain AGO. The ΔPrNiaD mutant strain is more resistant to chlorate-containing medium than the wild-type strain, but did not grow on nitrate-containing medium. Because genomic data are now available, we believe that generating selective deletions of candidate genes will be a key step to open the way for a comprehensive exploration of gene function in P. roqueforti.

  17. Gene Ontology Consortium: going forward.

    Science.gov (United States)

    2015-01-01

    The Gene Ontology (GO; http://www.geneontology.org) is a community-based bioinformatics resource that supplies information about gene product function using ontologies to represent biological knowledge. Here we describe improvements and expansions to several branches of the ontology, as well as updates that have allowed us to more efficiently disseminate the GO and capture feedback from the research community. The Gene Ontology Consortium (GOC) has expanded areas of the ontology such as cilia-related terms, cell-cycle terms and multicellular organism processes. We have also implemented new tools for generating ontology terms based on a set of logical rules making use of templates, and we have made efforts to increase our use of logical definitions. The GOC has a new and improved web site summarizing new developments and documentation, serving as a portal to GO data. Users can perform GO enrichment analysis, and search the GO for terms, annotations to gene products, and associated metadata across multiple species using the all-new AmiGO 2 browser. We encourage and welcome the input of the research community in all biological areas in our continued effort to improve the Gene Ontology. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Exploring autophagy with Gene Ontology

    Science.gov (United States)

    2018-01-01

    ABSTRACT Autophagy is a fundamental cellular process that is well conserved among eukaryotes. It is one of the strategies that cells use to catabolize substances in a controlled way. Autophagy is used for recycling cellular components, responding to cellular stresses and ridding cells of foreign material. Perturbations in autophagy have been implicated in a number of pathological conditions such as neurodegeneration, cardiac disease and cancer. The growing knowledge about autophagic mechanisms needs to be collected in a computable and shareable format to allow its use in data representation and interpretation. The Gene Ontology (GO) is a freely available resource that describes how and where gene products function in biological systems. It consists of 3 interrelated structured vocabularies that outline what gene products do at the biochemical level, where they act in a cell and the overall biological objectives to which their actions contribute. It also consists of ‘annotations’ that associate gene products with the terms. Here we describe how we represent autophagy in GO, how we create and define terms relevant to autophagy researchers and how we interrelate those terms to generate a coherent view of the process, therefore allowing an interoperable description of its biological aspects. We also describe how annotation of gene products with GO terms improves data analysis and interpretation, hence bringing a significant benefit to this field of study. PMID:29455577

  19. A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

    Science.gov (United States)

    Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

    2015-01-01

    Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

  20. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  1. Gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Zhang Yaowen; Cao Yongzhen; Li Jin; Wang Qin

    2008-01-01

    Tumor treatment is one of the most important fields in medical research. Nowadays, a novel method which is combined gene therapy with radiotherapy plays an important role in the field of cancer research, and mainly includes immune gene therapy combined with radiotherapy, suicide gene therapy or tumor suppressor gene therapy combined with radiotherapy, antiangiogenesis gene therapy combined with radiotherapy and protective gene therapy combined with radiotherapy based on the technical features. This review summarized the current status of combined therapies of gene therapy and radiotherapy and possible mechanism. (authors)

  2. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  3. Gene therapy for lipid disorders

    Directory of Open Access Journals (Sweden)

    Rader Daniel J

    2000-10-01

    Full Text Available Abstract Lipid disorders are associated with atherosclerotic vascular disease, and therapy is associated with a substantial reduction in cardiovascular events. Current approaches to the treatment of lipid disorders are ineffective in a substantial number of patients. New therapies for refractory hypercholesterolemia, severe hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol are needed: somatic gene therapy is one viable approach. The molecular etiology and pathophysiology of most of the candidate diseases are well understood. Animal models exist for the diseases and in many cases preclinical proof-of-principle studies have already been performed. There has been progress in the development of vectors that provide long-term gene expression. New clinical gene therapy trials for lipid disorders are likely to be initiated within the next few years.

  4. Candidate genes in panic disorder

    DEFF Research Database (Denmark)

    Howe, A. S.; Buttenschön, Henriette N; Bani-Fatemi, A.

    2016-01-01

    The utilization of molecular genetics approaches in examination of panic disorder (PD) has implicated several variants as potential susceptibility factors for panicogenesis. However, the identification of robust PD susceptibility genes has been complicated by phenotypic diversity, underpowered...... association studies and ancestry-specific effects. In the present study, we performed a succinct review of case-control association studies published prior to April 2015. Meta-analyses were performed for candidate gene variants examined in at least three studies using the Cochrane Mantel-Haenszel fixed......-effect model. Secondary analyses were also performed to assess the influences of sex, agoraphobia co-morbidity and ancestry-specific effects on panicogenesis. Meta-analyses were performed on 23 variants in 20 PD candidate genes. Significant associations after correction for multiple testing were observed...

  5. Gene Therapy in Cardiac Arrhythmias

    Directory of Open Access Journals (Sweden)

    Praveen S.V

    2006-04-01

    Full Text Available Gene therapy has progressed from a dream to a bedside reality in quite a few human diseases. From its first application in adenosine deaminase deficiency, through the years, its application has evolved to vascular angiogenesis and cardiac arrhythmias. Gene based biological pacemakers using viral vectors or mesenchymal cells tested in animal models hold much promise. Induction of pacemaker activity within the left bundle branch can provide stable heart rates. Genetic modification of the AV node mimicking beta blockade can be therapeutic in the management of atrial fibrillation. G protein overexpression to modify the AV node also is experimental. Modification and expression of potassium channel genes altering the delayed rectifier potassium currents may permit better management of congenital long QT syndromes. Arrhythmias in a failing heart are due to abnormal calcium cycling. Potential targets for genetic modulation include the sarcoplasmic reticulum calcium pump, calsequestrin and sodium calcium exchanger.Lastly the ethical concerns need to be addressed.

  6. [Advances and strategies in gene doping detection].

    Science.gov (United States)

    He, Jiangang; Liu, Zhen; Liu, Jing; Dou, Peng; Chen, Hong-Yuan

    2008-07-01

    This review surveys the recent status of gene doping detection and the strategies for anti-gene doping. The main gene doping candidates for athletes are summarized, and the advances in the detection of the proteins expressed by these genes such as erythropoietin (EPO) and human growth hormone (hGH) are reviewed. The potential detection strategies for further gene doping analysis are also discussed.

  7. Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

    NARCIS (Netherlands)

    Jaakson, K.; Zernant, J.; Kulm, M.; Hutchinson, A.; Tonisson, N.; Glavac, D.; Ravnik-Glavac, M.; Hawlina, M.; Meltzer, M.R.; Caruso, R.C.; Testa, F.; Maugeri, A.; Hoyng, C.B.; Gouras, P.; Simonelli, F.; Lewis, R.A.; Lupski, J.R.; Cremers, F.P.M.; Allikmets, R.

    2003-01-01

    Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics

  8. Good genes, complementary genes and human mate preferences.

    Science.gov (United States)

    Roberts, S Craig; Little, Anthony C

    2008-09-01

    The past decade has witnessed a rapidly growing interest in the biological basis of human mate choice. Here we review recent studies that demonstrate preferences for traits which might reveal genetic quality to prospective mates, with potential but still largely unknown influence on offspring fitness. These include studies assessing visual, olfactory and auditory preferences for potential good-gene indicator traits, such as dominance or bilateral symmetry. Individual differences in these robust preferences mainly arise through within and between individual variation in condition and reproductive status. Another set of studies have revealed preferences for traits indicating complementary genes, focussing on discrimination of dissimilarity at genes in the major histocompatibility complex (MHC). As in animal studies, we are only just beginning to understand how preferences for specific traits vary and inter-relate, how consideration of good and compatible genes can lead to substantial variability in individual mate choice decisions and how preferences expressed in one sensory modality may reflect those in another. Humans may be an ideal model species in which to explore these interesting complexities.

  9. Gene expression analysis identifies global gene dosage sensitivity in cancer

    DEFF Research Database (Denmark)

    Fehrmann, Rudolf S. N.; Karjalainen, Juha M.; Krajewska, Malgorzata

    2015-01-01

    Many cancer-associated somatic copy number alterations (SCNAs) are known. Currently, one of the challenges is to identify the molecular downstream effects of these variants. Although several SCNAs are known to change gene expression levels, it is not clear whether each individual SCNA affects gen...

  10. Candidate Gene Identification of Flowering Time Genes in Cotton

    Directory of Open Access Journals (Sweden)

    Corrinne E. Grover

    2015-07-01

    Full Text Available Flowering time control is critically important to all sexually reproducing angiosperms in both natural ecological and agronomic settings. Accordingly, there is much interest in defining the genes involved in the complex flowering-time network and how these respond to natural and artificial selection, the latter often entailing transitions in day-length responses. Here we describe a candidate gene analysis in the cotton genus , which uses homologs from the well-described flowering network to bioinformatically and phylogenetically identify orthologs in the published genome sequence from Ulbr., one of the two model diploid progenitors of the commercially important allopolyploid cottons, L. and L. Presence and patterns of expression were evaluated from 13 aboveground tissues related to flowering for each of the candidate genes using allopolyploid as a model. Furthermore, we use a comparative context to determine copy number variability of each key gene family across 10 published angiosperm genomes. Data suggest a pattern of repeated loss of duplicates following ancient whole-genome doubling events in diverse lineages. The data presented here provide a foundation for understanding both the parallel evolution of day-length neutrality in domesticated cottons and the flowering-time network, in general, in this important crop plant.

  11. Candidate gene studies and the quest for the entrepreneurial gene

    NARCIS (Netherlands)

    M.J.H.M. van der Loos (Matthijs); Ph.D. Koellinger (Philipp); P.J.F. Groenen (Patrick); C.A. Rietveld (Niels); F. Rivadeneira Ramirez (Fernando); F.J.A. van Rooij (Frank); A.G. Uitterlinden (André); A. Hofman (Albert); A.R. Thurik (Roy)

    2011-01-01

    textabstractCandidate gene studies of human behavior are gaining interest in economics and entrepreneurship research. Performing and interpreting these studies is not straightforward because the selection of candidates influences the interpretation of the results. As an example, Nicolaou et al.

  12. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  13. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  14. Decoding gene patents in Australia.

    Science.gov (United States)

    Denley, Adam; Cherry, James

    2014-10-03

    Patents directed to naturally occurring genetic material, such as DNA, RNA, chromosomes, and genes, in an isolated or purified form have been granted in Australia for many years. This review provides scientists with a summary of the gene patent debate from an Australian perspective and specifically reviews how the various levels of the legal system as they apply to patents-the Australian Patent Office, Australian courts, and Australian government-have dealt with the issue of whether genetic material is proper subject matter for a patent. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  15. Gene therapy in cystic fibrosis.

    Science.gov (United States)

    Flotte, T R; Laube, B L

    2001-09-01

    Theoretically, cystic fibrosis transmembrane conductance regulator (CFTR) gene replacement during the neonatal period can decrease morbidity and mortality from cystic fibrosis (CF). In vivo gene transfers have been accomplished in CF patients. Choice of vector, mode of delivery to airways, translocation of genetic information, and sufficient expression level of the normalized CFTR gene are issues that currently are being addressed in the field. The advantages and limitations of viral vectors are a function of the parent virus. Viral vectors used in this setting include adenovirus (Ad) and adeno-associated virus (AAV). Initial studies with Ad vectors resulted in a vector that was efficient for gene transfer with dose-limiting inflammatory effects due to the large amount of viral protein delivered. The next generation of Ad vectors, with more viral coding sequence deletions, has a longer duration of activity and elicits a lesser degree of cell-mediated immunity in mice. A more recent generation of Ad vectors has no viral genes remaining. Despite these changes, the problem of humoral immunity remains with Ad vectors. A variety of strategies such as vector systems requiring single, or widely spaced, administrations, pharmacologic immunosuppression at administration, creation of a stealth vector, modification of immunogenic epitopes, or tolerance induction are being considered to circumvent humoral immunity. AAV vectors have been studied in animal and human models. They do not appear to induce inflammatory changes over a wide range of doses. The level of CFTR messenger RNA expression is difficult to ascertain with AAV vectors since the small size of the vector relative to the CFTR gene leaves no space for vector-specific sequences on which to base assays to distinguish endogenous from vector-expressed messenger RNA. In general, AAV vectors appear to be safe and have superior duration profiles. Cationic liposomes are lipid-DNA complexes. These vectors generally have been

  16. Interactive visualization of gene regulatory networks with associated gene expression time series data

    NARCIS (Netherlands)

    Westenberg, M.A.; Hijum, van S.A.F.T.; Lulko, A.T.; Kuipers, O.P.; Roerdink, J.B.T.M.; Linsen, L.; Hagen, H.; Hamann, B.

    2008-01-01

    We present GENeVis, an application to visualize gene expression time series data in a gene regulatory network context. This is a network of regulator proteins that regulate the expression of their respective target genes. The networks are represented as graphs, in which the nodes represent genes,

  17. Targeting the human lysozyme gene on bovine αs1- casein gene ...

    African Journals Online (AJOL)

    Targeting an exogenous gene into a favorable gene locus and for expression under endogenous regulators is an ideal method in mammary gland bioreactor research. For this purpose, a gene targeting vector was constructed to targeting the human lysozyme gene on bovine αs1-casein gene locus. In this case, the ...

  18. Integrones: los coleccionistas de genes Integrons: gene collectors

    Directory of Open Access Journals (Sweden)

    J. A. Di Conza

    2010-02-01

    Full Text Available Los integrones son estructuras genéticas que han despertado gran interés, debido a que algunos de ellos vehiculizan genes de resistencia a los antimicrobianos. Están formados por un fragmento que codifica una integrasa (intI y, a continuación, una secuencia attI a la que se unen los genes en casetes que codifican diferentes mecanismos de resistencia. Dentro de intI, en su extremo 3´, hay una secuencia promotora Pc a partir de la cual se transcriben los casetes de resistencia integrados, ya que estos genes carecen de promotor. Sin embargo, estos casetes presentan una secuencia específica denominada attC, la cual es reconocida por la integrasa que se une, por recombinación, a la secuencia attI del integrón en la orientación adecuada para su expresión. Los integrones se han clasificado según la secuencia de su integrasa, pero en la actualidad se prefiere clasificarlos según su localización. Se habla, en general, de "integrones móviles" para referirse a aquellos asociados a secuencias de inserción, transposones y/o plásmidos conjugativos, los que en su mayoría median mecanismos de resistencia, y de "superintegrones", de localización cromosómica y con grandes arreglos de genes en casetes. Los integrones móviles de clase 1 son los más abundantes en aislamientos clínicos y suelen estar asociados a transposones del subgrupo Tn21, seguidos por los de clase 2, derivados principalmente de Tn7. Estos elementos no son móviles por sí mismos, pero su asociación con elementos que sí lo son facilita su transferencia horizontal, lo que explica su amplia difusión entre las bacterias. Esta revisión intenta recopilar la información disponible acerca de los integrones móviles descritos en Argentina hasta la fecha.Integrons gained great interest due to their participation in resistance gene recruitment and expression. Their basic structure includes a fragment that encodes an integrase (intI followed by a recognition sequence (attI into

  19. Persistence drives gene clustering in bacterial genomes

    Directory of Open Access Journals (Sweden)

    Rocha Eduardo PC

    2008-01-01

    Full Text Available Abstract Background Gene clustering plays an important role in the organization of the bacterial chromosome and several mechanisms have been proposed to explain its extent. However, the controversies raised about the validity of each of these mechanisms remind us that the cause of this gene organization remains an open question. Models proposed to explain clustering did not take into account the function of the gene products nor the likely presence or absence of a given gene in a genome. However, genomes harbor two very different categories of genes: those genes present in a majority of organisms – persistent genes – and those present in very few organisms – rare genes. Results We show that two classes of genes are significantly clustered in bacterial genomes: the highly persistent and the rare genes. The clustering of rare genes is readily explained by the selfish operon theory. Yet, genes persistently present in bacterial genomes are also clustered and we try to understand why. We propose a model accounting specifically for such clustering, and show that indispensability in a genome with frequent gene deletion and insertion leads to the transient clustering of these genes. The model describes how clusters are created via the gene flux that continuously introduces new genes while deleting others. We then test if known selective processes, such as co-transcription, physical interaction or functional neighborhood, account for the stabilization of these clusters. Conclusion We show that the strong selective pressure acting on the function of persistent genes, in a permanent state of flux of genes in bacterial genomes, maintaining their size fairly constant, that drives persistent genes clustering. A further selective stabilization process might contribute to maintaining the clustering.

  20. Radiation of different human melanoma cell lines increased expression of RHOB. Level of this tumor suppressor gene in different cell lines

    International Nuclear Information System (INIS)

    Notcovich, C.; Molinari, B.; Duran, H.; Delgado González, D.; Sánchez Crespo, R.

    2013-01-01

    Previous results of our group show that a correlation exists between intrinsic radiosensitivity of human melanoma cells and cell death by apoptosis. RhoB is a small GTPase that regulates cytoskeletal organization. Besides, is related to the process of apoptosis in cells exposed to DNA damage as radiation. Also, RhoB levels decrease in a wide variety of tumors with the tumor stage, being considered a tumor suppressor gene due to its antiproliferative and proapoptotic effect. The aim of this study was to analyze the expression of RhoB in different human melanoma cell lines in relation to melanocytes, and evaluate the effect of gamma radiation on the expression of RhoB. We used the A375, SB2 and Meljcell lines, and the derived from melanocytes Pig1. It was found for all three tumor lines RhoB expression levels significantly lower than those of Pig1 (p <0.05), as assessed by semiquantitative RT-PCR . When tumor cells were irradiated to a dose of 2Gyinduction was observed at 3 hours RhoB irradiation. RhoB expression increased in all lines relative to non-irradiated control, showing a greater induction ( p< 0.05) for the more radiosensitive line SB2, consistent with apoptosis in response to radiation. The results allow for the first time in melanoma demonstrate that RhoB, as well as in other tumor types, has a lower expression in tumor cells than their normal counterparts. Moreover, induction in the expression of RhoB in irradiated cells may be associated with the process of radiation-induced apoptosis. The modulation of RhoB could be a new tool to sensitize radioresistant melanoma. (author)

  1. Cycloheximide and actinomycin D delay death and affect bcl-2, bax, and Ice gene expression in astrocytes under in vitro ischemia.

    Science.gov (United States)

    Yu, Albert Cheung Hoi; Yung, Hon Wa; Hui, Michael Hung Kit; Lau, Lok Ting; Chen, Xiao Qian; Collins, Richard A

    2003-10-15

    An in vitro ischemia model was established and the effect of the metabolic inhibitors cycloheximide (CHX) and actinomycin D (ActD) on apoptosis in astrocytes under ischemia studied. CHX decreased by 75% the number of cells dying after 6 hr of ischemia compared with control cultures. TdT-mediated dUTP nick end labelling (TUNEL) staining of comparable cultures was reduced by 40%. ActD decreased cell death by 60% compared with controls. The number of TUNEL-positive cells was reduced by 38%. The nuclear shrinkage in TUNEL-positive astrocytes in control cultures did not occur in ActD-treated astrocytes, indicating that nuclear shrinkage and DNA fragmentation during apoptosis are two unrelated processes. Expression of bcl-2 (alpha and beta), bax, and Ice in astrocytes under similar ischemic conditions, as measured by quantitative reverse transcription-polymerase chain reaction, indicated that ischemia down-regulated bcl-2 (alpha and beta) and bax. Ice was initially down-regulated from 0 to 4 hr, before returning to control levels after 8 hr of ischemia. ActD decreased the expression of these genes. CHX reduced the expression of bcl-2 (alpha and beta) but increased bax and Ice expression. It is hypothesized that the balance of proapoptotic (Bad, Bax) and antiapoptotic (Bcl-2, Bcl-Xl) proteins determines apoptosis. The data suggest that the ratio of Bcl-2/Bad in astrocytes following ActD and CHX treatment does not decrease as much in untreated cells during ischemia. Our data indicate that it is the ratio of Bcl-2 family members that plays a critical role in determining ischemia-induced apoptosis. It is also important to note that ischemia-induced apoptosis involves the regulation of RNA and protein synthesis. Copyright 2003 Wiley-Liss, Inc.

  2. Genes and Syndromic Hearing Loss.

    Science.gov (United States)

    Keats, Bronya J. B.

    2002-01-01

    This article provides a description of the human genome and patterns of inheritance and discusses genes that are associated with some of the syndromes for which hearing loss is a common finding, including: Waardenburg, Stickler, Jervell and Lange-Neilsen, Usher, Alport, mitochondrial encephalomyopathy, and sensorineural hearing loss. (Contains…

  3. Gene Therapy for Color Blindness.

    Science.gov (United States)

    Hassall, Mark M; Barnard, Alun R; MacLaren, Robert E

    2017-12-01

    Achromatopsia is a rare congenital cause of vision loss due to isolated cone photoreceptor dysfunction. The most common underlying genetic mutations are autosomal recessive changes in CNGA3 , CNGB3 , GNAT2 , PDE6H , PDE6C , or ATF6 . Animal models of Cnga3 , Cngb3 , and Gnat2 have been rescued using AAV gene therapy; showing partial restoration of cone electrophysiology and integration of this new photopic vision in reflexive and behavioral visual tests. Three gene therapy phase I/II trials are currently being conducted in human patients in the USA, the UK, and Germany. This review details the AAV gene therapy treatments of achromatopsia to date. We also present novel data showing rescue of a Cnga3 -/- mouse model using an rAAV.CBA.CNGA3 vector. We conclude by synthesizing the implications of this animal work for ongoing human trials, particularly, the challenge of restoring integrated cone retinofugal pathways in an adult visual system. The evidence to date suggests that gene therapy for achromatopsia will need to be applied early in childhood to be effective.

  4. Gene therapy for lung cancer.

    Science.gov (United States)

    Toloza, Eric M; Morse, Michael A; Lyerly, H Kim

    2006-09-01

    Lung cancer patients suffer a 15% overall survival despite advances in chemotherapy, radiation therapy, and surgery. This unacceptably low survival rate is due to the usual finding of advanced disease at diagnosis. However, multimodality strategies using conventional therapies only minimally improve survival rates even in early stages of lung cancer. Attempts to improve survival in advanced disease using various combinations of platinum-based chemotherapy have demonstrated that no regimen is superior, suggesting a therapeutic plateau and the need for novel, more specific, and less toxic therapeutic strategies. Over the past three decades, the genetic etiology of cancer has been gradually delineated, albeit not yet completely. Understanding the molecular events that occur during the multistep process of bronchogenic carcinogenesis may make these tasks more surmountable. During these same three decades, techniques have been developed which allow transfer of functional genes into mammalian cells. For example, blockade of activated tumor-promoting oncogenes or replacement of inactivated tumor-suppressing or apoptosis-promoting genes can be achieved by gene therapy. This article will discuss the therapeutic implications of these molecular changes associated with bronchogenic carcinomas and will then review the status of gene therapies for treatment of lung cancer. (c) 2006 Wiley-Liss, Inc.

  5. Ethics of Gene Therapy Debated.

    Science.gov (United States)

    Borman, Stu

    1991-01-01

    Presented are the highlights of a press conference featuring biomedical ethicist LeRoy Walters of Georgetown University and attorney Andrew Kimbrell of the Foundation on Economic Trends. The opposing points of view of these two speakers serve to outline the pros and cons of the gene therapy issue. (CW)

  6. Genes, Environment, and Human Behavior.

    Science.gov (United States)

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  7. The Language of the Genes

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 3. The Language of the Genes Linking the Past and the Future. Amitabh Joshi. Book Review Volume 2 ... Amitabh Joshi1. Animal Behaviour Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur P.O., Bangalore 560 064, India.

  8. Gene expression profile of pulpitis.

    Science.gov (United States)

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  9. Homeobox genes and melatonin synthesis

    DEFF Research Database (Denmark)

    Rohde, Kristian; Møller, Morten; Rath, Martin Fredensborg

    2014-01-01

    Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a cAMP-based indu......Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a c......AMP-based induction of Aanat transcription. However, additional transcriptional control mechanisms exist. Homeobox genes, which are generally known to encode transcription factors controlling developmental processes, are also expressed in the mature rodent pineal gland. Among these, the cone-rod homeobox (CRX......) transcription factor is believed to control pineal-specific Aanat expression. Based on recent advances in our understanding of Crx in the rodent pineal gland, we here suggest that homeobox genes play a role in adult pineal physiology both by ensuring pineal-specific Aanat expression and by facilitating c...

  10. Sculpting the Barnyard Gene Pool

    Science.gov (United States)

    Childers, Gina; Wolfe, Kim; Dupree, Alan; Young, Sheila; Caver, Jessica; Quintanilla, Ruby; Thornton, Laura

    2016-01-01

    Project-based learning (PBL) takes student engagement to a higher level through reflective collaboration, inquiry, critical thinking, problem solving, and personal relevance. This article explains how six high school teachers developed an interconnected, interdisciplinary STEM-focused PBL called "Sculpting the Barnyard Gene Pool." The…

  11. Genome position and gene amplification

    Czech Academy of Sciences Publication Activity Database

    Jirsová, Pavla; Snijders, A.M.; Kwek, S.; Roydasgupta, R.; Fridlyand, J.; Tokuyasu, T.; Pinkel, D.; Albertson, D. G.

    2007-01-01

    Roč. 8, č. 6 (2007), r120 ISSN 1474-760X Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : gene amplification * array comparative genomic hybridization * oncogene Subject RIV: BO - Biophysics Impact factor: 6.589, year: 2007

  12. Embryos, genes, and birth defects

    National Research Council Canada - National Science Library

    Ferretti, Patrizia

    2006-01-01

    ... Structural anomalies The genesis of chromosome abnormalities Embryo survival The cause of high levels of chromosome abnormality in human embryos Relative parental risks - age, translocations, inversions, gonadal and germinal mosaics 33 33 34 35 36 44 44 45 4 Identification and Analysis of Genes Involved in Congenital Malformation Syndromes Peter J. Scambler Ge...

  13. Empirical study of supervised gene screening

    Directory of Open Access Journals (Sweden)

    Ma Shuangge

    2006-12-01

    Full Text Available Abstract Background Microarray studies provide a way of linking variations of phenotypes with their genetic causations. Constructing predictive models using high dimensional microarray measurements usually consists of three steps: (1 unsupervised gene screening; (2 supervised gene screening; and (3 statistical model building. Supervised gene screening based on marginal gene ranking is commonly used to reduce the number of genes in the model building. Various simple statistics, such as t-statistic or signal to noise ratio, have been used to rank genes in the supervised screening. Despite of its extensive usage, statistical study of supervised gene screening remains scarce. Our study is partly motivated by the differences in gene discovery results caused by using different supervised gene screening methods. Results We investigate concordance and reproducibility of supervised gene screening based on eight commonly used marginal statistics. Concordance is assessed by the relative fractions of overlaps between top ranked genes screened using different marginal statistics. We propose a Bootstrap Reproducibility Index, which measures reproducibility of individual genes under the supervised screening. Empirical studies are based on four public microarray data. We consider the cases where the top 20%, 40% and 60% genes are screened. Conclusion From a gene discovery point of view, the effect of supervised gene screening based on different marginal statistics cannot be ignored. Empirical studies show that (1 genes passed different supervised screenings may be considerably different; (2 concordance may vary, depending on the underlying data structure and percentage of selected genes; (3 evaluated with the Bootstrap Reproducibility Index, genes passed supervised screenings are only moderately reproducible; and (4 concordance cannot be improved by supervised screening based on reproducibility.

  14. Gene transfer therapy in vascular diseases.

    Science.gov (United States)

    McKay, M J; Gaballa, M A

    2001-01-01

    Somatic gene therapy of vascular diseases is a promising new field in modern medicine. Recent advancements in gene transfer technology have greatly evolved our understanding of the pathophysiologic role of candidate disease genes. With this knowledge, the expression of selective gene products provides the means to test the therapeutic use of gene therapy in a multitude of medical conditions. In addition, with the completion of genome sequencing programs, gene transfer can be used also to study the biologic function of novel genes in vivo. Novel genes are delivered to targeted tissue via several different vehicles. These vectors include adenoviruses, retroviruses, plasmids, plasmid/liposomes, and oligonucleotides. However, each one of these vectors has inherent limitations. Further investigations into developing delivery systems that not only allow for efficient, targeted gene transfer, but also are stable and nonimmunogenic, will optimize the clinical application of gene therapy in vascular diseases. This review further discusses the available mode of gene delivery and examines six major areas in vascular gene therapy, namely prevention of restenosis, thrombosis, hypertension, atherosclerosis, peripheral vascular disease in congestive heart failure, and ischemia. Although we highlight some of the recent advances in the use of gene therapy in treating vascular disease discovered primarily during the past two years, many excellent studies published during that period are not included in this review due to space limitations. The following is a selective review of practical uses of gene transfer therapy in vascular diseases. This review primarily covers work performed in the last 2 years. For earlier work, the reader may refer to several excellent review articles. For instance, Belalcazer et al. (6) reviewed general aspects of somatic gene therapy and the different vehicles used for the delivery of therapeutic genes. Gene therapy in restenosis and stimulation of

  15. Transferring alien genes to wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1987-01-01

    In broad terms an alien gene can be considered to be any gene transferred to wheat from a related species. As described above by Maan (section 7D) the genus Triticum contains a broad range of species, some of which cross readily with the cultivated tetraploid (T. Turgidum L.) or hexaploid (T. aestivum L.) wheats, and others only with great difficulty. In addition, wheat will also cross with species in a number of other genera including Agropyron, Elymus, Elytrigia (=Agropyron), Haynaldia, Hordeum, and Secale (Riley and Kimber, 1966; Knobloch, 1968; Feldman and Sears, 1981). In discussing the Triticum and Aegilops spp., the classification by Kimber and Sears, section SA-I, above, will be followed. For the Agropyron and related species the classification described by Dewey (1983) will be used. To avoid confusion, in referring to the literature the designations used by the authors will be given, followed by the new designation. The wild relatives of wheat are adapted to a broad range of environments and carry a large reservoir of useful genes (Zohary et al., 1969; Kerber and Dyck, 1973; Brezhnev, 1977; Feldman and Sears, 1981; Limin and Fowler, 1981; Sharma et aI., 1981; McGuire and Dvorak, 1981). Initially they were considered to be primarily sources of disease resistance, but more recently they have been recognized as potential sources of genes for high protein, cold tolerance, salt tolerance, drought tolerance, lodging resistance, early maturity, and even yield. Extensive screening of the wild relatives of wheat needs to be done before their useful genes can be fully utilized

  16. Transferring alien genes to wheat

    Energy Technology Data Exchange (ETDEWEB)

    Knott, D. R.

    1987-07-01

    In broad terms an alien gene can be considered to be any gene transferred to wheat from a related species. As described above by Maan (section 7D) the genus Triticum contains a broad range of species, some of which cross readily with the cultivated tetraploid (T. Turgidum L.) or hexaploid (T. aestivum L.) wheats, and others only with great difficulty. In addition, wheat will also cross with species in a number of other genera including Agropyron, Elymus, Elytrigia (=Agropyron), Haynaldia, Hordeum, and Secale (Riley and Kimber, 1966; Knobloch, 1968; Feldman and Sears, 1981). In discussing the Triticum and Aegilops spp., the classification by Kimber and Sears, section SA-I, above, will be followed. For the Agropyron and related species the classification described by Dewey (1983) will be used. To avoid confusion, in referring to the literature the designations used by the authors will be given, followed by the new designation. The wild relatives of wheat are adapted to a broad range of environments and carry a large reservoir of useful genes (Zohary et al., 1969; Kerber and Dyck, 1973; Brezhnev, 1977; Feldman and Sears, 1981; Limin and Fowler, 1981; Sharma et aI., 1981; McGuire and Dvorak, 1981). Initially they were considered to be primarily sources of disease resistance, but more recently they have been recognized as potential sources of genes for high protein, cold tolerance, salt tolerance, drought tolerance, lodging resistance, early maturity, and even yield. Extensive screening of the wild relatives of wheat needs to be done before their useful genes can be fully utilized.

  17. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro

    2013-07-01

    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  18. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    OpenAIRE

    Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

    2016-01-01

    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

  19. Gene therapy and its implications in Periodontics

    Science.gov (United States)

    Mahale, Swapna; Dani, Nitin; Ansari, Shumaila S.; Kale, Triveni

    2009-01-01

    Gene therapy is a field of Biomedicine. With the advent of gene therapy in dentistry, significant progress has been made in the control of periodontal diseases and reconstruction of dento-alveolar apparatus. Implementation in periodontics include: -As a mode of tissue engineering with three approaches: cell, protein-based and gene delivery approach. -Genetic approach to Biofilm Antibiotic Resistance. Future strategies of gene therapy in preventing periodontal diseases: -Enhances host defense mechanism against infection by transfecting host cells with an antimicrobial peptide protein-encoding gene. -Periodontal vaccination. Gene therapy is one of the recent entrants and its applications in the field of periodontics are reviewed in general here. PMID:20376232

  20. Gene doping: the hype and the harm.

    Science.gov (United States)

    McKanna, Trudy A; Toriello, Helga V

    2010-06-01

    "Gene doping" is the term used to describe the potential abuse of gene therapy as a performance-enhancing agent. Gene doping would apply the techniques used in gene therapy to provide altered expression of genes that would promote physical superiority. For example, insulin-like growth factor 1 (IGF-1) is a primary target for growth hormone; overexpression of IGF-1 can lead to increased muscle mass and power. Although gene doping is still largely theoretical, its implications for sports, health, ethics, and medical genetics are significant.

  1. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal

    2002-01-01

    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... that the method can be applied to modulating the expression of native genes on the chromosome. We constructed a series of strains in which the expression of the las operon, containing the genes pfk, pyk, and ldh, was modulated by integrating a truncated copy of the pfk gene. Importantly, the modulation affected...

  2. Investigation progress of PET reporter gene imaging

    International Nuclear Information System (INIS)

    Chen Yumei; Huang Gang

    2006-01-01

    Molecular imaging for gene therapy and gene expression has been more and more attractive, while the use of gene therapy has been widely investigated and intense research have allowed it to the clinical setting in the last two-decade years. In vivo imaging with positron emission tomography (PET) by combination of appropriate PET reporter gene and PET reporter probe could provide qualitative and quantitative information for gene therapy. PET imaging could also obtain some valuable parameters not available by other techniques. This technology is useful to understand the process and development of gene therapy and how to apply it into clinical practice in the future. (authors)

  3. Effect of apigenin, kaempferol and resveratrol on the gene expression and protein secretion of tumor necrosis factor alpha (TNF-α) and interleukin-10 (IL-10) in RAW-264.7 macrophages.

    Science.gov (United States)

    Palacz-Wrobel, Marta; Borkowska, Paulina; Paul-Samojedny, Monika; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Suchanek-Raif, Renata; Kowalski, Jan

    2017-09-01

    Polyphenols such as apigenin, kaempferol or resveratrol are typically found in plants, including fruits, vegetables, herbs and spices, which have a wide range of biological functions such as antioxidative, anti-inflammatory, vasodilative, anticoagulative and proapoptotic. Discovering such multifunctional compounds in widely consumed plant-based products - ones that both inhibit the release of TNF-α from tissue macrophages and at the same time enhance the secretion of IL-10 - would be an important signpost in the quest for effective pharmacological treatment of numerous diseases that have an inflammatory etiology. The aim of the study is to investigate the impact of biologically active polyphenols such as apigenin, resveratrol and kaempferol on gene expression and protein secretion of IL-10 and TNF-α in line RAW-264.7. Cells were cultured under standard conditions. IL-10 and TNF-α genes expression were examined using QRT-PCR and to assess cytokines concentration ELISA have been used. Apigenin, kaempferol and resveratrol at a dose 30μM significantly decrease the TNF-α expression and secretion. Apigenin decrease the IL-10 expression and secretion. Furthermore, increase in IL-10 secretion after administration of kaempferol and resveratrol were observed. In the process of administration of tested compounds before LPS, which activate macrophages, decrease of TNF-α secretion after apigenin and kaempferol and increase of IL-10 secretion after resveratrol were observed. The results of present work indicate that 1) apigenin, resveratrol and kaempferol may reduce the intensity of inflammatory processes by inhibiting the secretion of proinflammatory cytokine TNF-α, and resveratrol and kaempferol additionally by increasing the secretion of anti-inflammatory cytokine IL-10 2) the studies indicate the potentially beneficial - anti-inflammatory - impact of diet rich in products including apigenin, resveratrol and kaempferol. Copyright © 2017 Elsevier Masson SAS. All rights

  4. The relationship among gene expression, the evolution of gene dosage, and the rate of protein evolution.

    Directory of Open Access Journals (Sweden)

    Jean-François Gout

    2010-05-01

    Full Text Available The understanding of selective constraints affecting genes is a major issue in biology. It is well established that gene expression level is a major determinant of the rate of protein evolution, but the reasons for this relationship remain highly debated. Here we demonstrate that gene expression is also a major determinant of the evolution of gene dosage: the rate of gene losses after whole genome duplications in the Paramecium lineage is negatively correlated to the level of gene expression, and this relationship is not a byproduct of other factors known to affect the fate of gene duplicates. This indicates that changes in gene dosage are generally more deleterious for highly expressed genes. This rule also holds for other taxa: in yeast, we find a clear relationship between gene expression level and the fitness impact of reduction in gene dosage. To explain these observations, we propose a model based on the fact that the optimal expression level of a gene corresponds to a trade-off between the benefit and cost of its expression. This COSTEX model predicts that selective pressure against mutations changing gene expression level or affecting the encoded protein should on average be stronger in highly expressed genes and hence that both the frequency of gene loss and the rate of protein evolution should correlate negatively with gene expression. Thus, the COSTEX model provides a simple and common explanation for the general relationship observed between the level of gene expression and the different facets of gene evolution.

  5. Using the gene ontology to scan multilevel gene sets for associations in genome wide association studies.

    Science.gov (United States)

    Schaid, Daniel J; Sinnwell, Jason P; Jenkins, Gregory D; McDonnell, Shannon K; Ingle, James N; Kubo, Michiaki; Goss, Paul E; Costantino, Joseph P; Wickerham, D Lawrence; Weinshilboum, Richard M

    2012-01-01

    Gene-set analyses have been widely used in gene expression studies, and some of the developed methods have been extended to genome wide association studies (GWAS). Yet, complications due to linkage disequilibrium (LD) among single nucleotide polymorphisms (SNPs), and variable numbers of SNPs per gene and genes per gene-set, have plagued current approaches, often leading to ad hoc "fixes." To overcome some of the current limitations, we developed a general approach to scan GWAS SNP data for both gene-level and gene-set analyses, building on score statistics for generalized linear models, and taking advantage of the directed acyclic graph structure of the gene ontology when creating gene-sets. However, other types of gene-set structures can be used, such as the popular Kyoto Encyclopedia of Genes and Genomes (KEGG). Our approach combines SNPs into genes, and genes into gene-sets, but assures that positive and negative effects of genes on a trait do not cancel. To control for multiple testing of many gene-sets, we use an efficient computational strategy that accounts for LD and provides accurate step-down adjusted P-values for each gene-set. Application of our methods to two different GWAS provide guidance on the potential strengths and weaknesses of our proposed gene-set analyses. © 2011 Wiley Periodicals, Inc.

  6. Gene therapy for Stargardt disease associated with ABCA4 gene.

    Science.gov (United States)

    Han, Zongchao; Conley, Shannon M; Naash, Muna I

    2014-01-01

    Mutations in the photoreceptor-specific flippase ABCA4 lead to accumulation of the toxic bisretinoid A2E, resulting in atrophy of the retinal pigment epithelium (RPE) and death of the photoreceptor cells. Many blinding diseases are associated with these mutations including Stargardt's disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), and increased susceptibility to age-related macular degeneration. There are no curative treatments for any of these dsystrophies. While the monogenic nature of many of these conditions makes them amenable to treatment with gene therapy, the ABCA4 cDNA is 6.8 kb and is thus too large for the AAV vectors which have been most successful for other ocular genes. Here we review approaches to ABCA4 gene therapy including treatment with novel AAV vectors, lentiviral vectors, and non-viral compacted DNA nanoparticles. Lentiviral and compacted DNA nanoparticles in particular have a large capacity and have been successful in improving disease phenotypes in the Abca4 (-/-) murine model. Excitingly, two Phase I/IIa clinical trials are underway to treat patients with ABCA4-associated Startgardt's disease (STGD1). As a result of the development of these novel technologies, effective therapies for ABCA4-associated diseases may finally be within reach.

  7. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  8. Gene set analysis using variance component tests.

    Science.gov (United States)

    Huang, Yen-Tsung; Lin, Xihong

    2013-06-28

    Gene set analyses have become increasingly important in genomic research, as many complex diseases are contributed jointly by alterations of numerous genes. Genes often coordinate together as a functional repertoire, e.g., a biological pathway/network and are highly correlated. However, most of the existing gene set analysis methods do not fully account for the correlation among the genes. Here we propose to tackle this important feature of a gene set to improve statistical power in gene set analyses. We propose to model the effects of an independent variable, e.g., exposure/biological status (yes/no), on multiple gene expression values in a gene set using a multivariate linear regression model, where the correlation among the genes is explicitly modeled using a working covariance matrix. We develop TEGS (Test for the Effect of a Gene Set), a variance component test for the gene set effects by assuming a common distribution for regression coefficients in multivariate linear regression models, and calculate the p-values using permutation and a scaled chi-square approximation. We show using simulations that type I error is protected under different choices of working covariance matrices and power is improved as the working covariance approaches the true covariance. The global test is a special case of TEGS when correlation among genes in a gene set is ignored. Using both simulation data and a published diabetes dataset, we show that our test outperforms the commonly used approaches, the global test and gene set enrichment analysis (GSEA). We develop a gene set analyses method (TEGS) under the multivariate regression framework, which directly models the interdependence of the expression values in a gene set using a working covariance. TEGS outperforms two widely used methods, GSEA and global test in both simulation and a diabetes microarray data.

  9. Developing strategies for detection of gene doping.

    Science.gov (United States)

    Baoutina, Anna; Alexander, Ian E; Rasko, John E J; Emslie, Kerry R

    2008-01-01

    It is feared that the use of gene transfer technology to enhance athletic performance, the practice that has received the term 'gene doping', may soon become a real threat to the world of sport. As recognised by the anti-doping community, gene doping, like doping in any form, undermines principles of fair play in sport and most importantly, involves major health risks to athletes who partake in gene doping. One attraction of gene doping for such athletes and their entourage lies in the apparent difficulty of detecting its use. Since the realisation of the threat of gene doping to sport in 2001, the anti-doping community and scientists from different disciplines concerned with potential misuse of gene therapy technologies for performance enhancement have focused extensive efforts on developing robust methods for gene doping detection which could be used by the World Anti-Doping Agency to monitor athletes and would meet the requirements of a legally defensible test. Here we review the approaches and technologies which are being evaluated for the detection of gene doping, as well as for monitoring the efficacy of legitimate gene therapy, in relation to the detection target, the type of sample required for analysis and detection methods. We examine the accumulated knowledge on responses of the body, at both cellular and systemic levels, to gene transfer and evaluate strategies for gene doping detection based on current knowledge of gene technology, immunology, transcriptomics, proteomics, biochemistry and physiology. (c) 2008 John Wiley & Sons, Ltd.

  10. Research progress in machine learning methods for gene-gene interaction detection.

    Science.gov (United States)

    Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu

    2018-03-20

    Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.

  11. Biodegradable nanoparticles for gene therapy technology

    International Nuclear Information System (INIS)

    Hosseinkhani, Hossein; He, Wen-Jie; Chiang, Chiao-Hsi; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.; Ou, Keng-Liang

    2013-01-01

    Rapid propagations in materials technology together with biology have initiated great hopes in the possibility of treating many diseases by gene therapy technology. Viral and non-viral gene carriers are currently applied for gene delivery. Non-viral technology is safe and effective for the delivery of genetic materials to cells and tissues. Non-viral systems are based on plasmid expression containing a gene encoding a therapeutic protein and synthetic biodegradable nanoparticles as a safe carrier of gene. Biodegradable nanoparticles have shown great interest in drug and gene delivery systems as they are easy to be synthesized and have no side effect in cells and tissues. This review provides a critical view of applications of biodegradable nanoparticles on gene therapy technology to enhance the localization of in vitro and in vivo and improve the function of administered genes

  12. In The Genes? Searching for Methuselah

    Science.gov (United States)

    ... Current Issue Past Issues Special Section In The Genes? Searching for Methuselah Past Issues / Winter 2007 Table ... 18 million effort to learn more about the genes, lifestyle or other factors that contribute to long, ...

  13. Mutation analysis of the preproghrelin gene

    DEFF Research Database (Denmark)

    Larsen, Lesli H; Gjesing, Anette P; Sørensen, Thorkild I A

    2005-01-01

    To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes.......To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes....

  14. IGF-Regulated Genes in Prostate Cancer

    National Research Council Canada - National Science Library

    Roberts, Charles

    2003-01-01

    We hypothesized that genes that are differentially expressed as a result of the decreased IGF-I receptor gene expression seen in metastatic prostate cancer contribute to prostate cancer progression...

  15. IGF-Regulated Genes in Prostate Cancer

    National Research Council Canada - National Science Library

    Roberts, Charles T., Jr

    2005-01-01

    We hypothesized that genes that are differentially expressed as a result of the decreased IGF-I receptor gene expression seen in metastatic prostate cancer contribute to prostate cancer progression...

  16. NIH Researchers Identify OCD Risk Gene

    Science.gov (United States)

    ... News From NIH NIH Researchers Identify OCD Risk Gene Past Issues / Summer 2006 Table of Contents For ... and Alcoholism (NIAAA) have identified a previously unknown gene variant that doubles an individual's risk for obsessive- ...

  17. Religious coalition opposes gene patents.

    Science.gov (United States)

    James, J S

    1995-05-19

    The biotechnology industry is concerned about a coalition of mainstream religious leaders, working with Jeremy Rifkin of the Foundation of Economic Trends, who oppose the patenting of human and animal life forms, body parts, and genes. The coalition called a press conference on May 18 to ask the government to prohibit the current patenting practices for genetic engineering. The biotechnology industry argues that patents indicate that a company's research tool has significant value, and encourages capitalists to invest their dollars in the development of new treatments for diseases. They also argue that the 29 biotech drugs that are on the market have been developed as a result of patents on genes. Although most business leaders are united in opposing restrictions, many scientists are divided, citing both religious and scientific reasons.

  18. Phenotypic deconstruction of gene circuitry.

    Science.gov (United States)

    Lomnitz, Jason G; Savageau, Michael A

    2013-06-01

    It remains a challenge to obtain a global perspective on the behavioral repertoire of complex nonlinear gene circuits. In this paper, we describe a method for deconstructing complex systems into nonlinear sub-systems, based on mathematically defined phenotypes, which are then represented within a system design space that allows the repertoire of qualitatively distinct phenotypes of the complex system to be identified, enumerated, and analyzed. This method efficiently characterizes large regions of system design space and quickly generates alternative hypotheses for experimental testing. We describe the motivation and strategy in general terms, illustrate its use with a detailed example involving a two-gene circuit with a rich repertoire of dynamic behavior, and discuss experimental means of navigating the system design space.

  19. Phenotypic deconstruction of gene circuitry

    Science.gov (United States)

    Lomnitz, Jason G.; Savageau, Michael A.

    2013-06-01

    It remains a challenge to obtain a global perspective on the behavioral repertoire of complex nonlinear gene circuits. In this paper, we describe a method for deconstructing complex systems into nonlinear sub-systems, based on mathematically defined phenotypes, which are then represented within a system design space that allows the repertoire of qualitatively distinct phenotypes of the complex system to be identified, enumerated, and analyzed. This method efficiently characterizes large regions of system design space and quickly generates alternative hypotheses for experimental testing. We describe the motivation and strategy in general terms, illustrate its use with a detailed example involving a two-gene circuit with a rich repertoire of dynamic behavior, and discuss experimental means of navigating the system design space.

  20. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  1. Genes

    Science.gov (United States)

    ... the human body. Together, they make up the blueprint for the human body and how it works. ... this important distinction for online health information and services. Learn more about A.D.A.M.'s editorial ...

  2. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  3. Gene coexpression network analysis as a source of functional annotation for rice genes.

    Directory of Open Access Journals (Sweden)

    Kevin L Childs

    Full Text Available With the existence of large publicly available plant gene expression data sets, many groups have undertaken data analyses to construct gene coexpression networks and functionally annotate genes. Often, a large compendium of unrelated or condition-independent expression data is used to construct gene networks. Condition-dependent expression experiments consisting of well-defined conditions/treatments have also been used to create coexpression networks to help examine particular biological processes. Gene networks derived from either condition-dependent or condition-independent data can be difficult to interpret if a large number of genes and connections are present. However, algorithms exist to identify modules of highly connected and biologically relevant genes within coexpression networks. In this study, we have used publicly available rice (Oryza sativa gene expression data to create gene coexpression networks using both condition-dependent and condition-independent data and have identified gene modules within these networks using the Weighted Gene Coexpression Network Analysis method. We compared the number of genes assigned to modules and the biological interpretability of gene coexpression modules to assess the utility of condition-dependent and condition-independent gene coexpression networks. For the purpose of providing functional annotation to rice genes, we found that gene modules identified by coexpression analysis of condition-dependent gene expression experiments to be more useful than gene modules identified by analysis of a condition-independent data set. We have incorporated our results into the MSU Rice Genome Annotation Project database as additional expression-based annotation for 13,537 genes, 2,980 of which lack a functional annotation description. These results provide two new types of functional annotation for our database. Genes in modules are now associated with groups of genes that constitute a collective functional

  4. Gene therapy: theoretical and bioethical concepts.

    Science.gov (United States)

    Smith, Kevin R

    2003-01-01

    Gene therapy holds great promise. Somatic gene therapy has the potential to treat a wide range of disorders, including inherited conditions, cancers, and infectious diseases. Early progress has already been made in the treatment of a range of disorders. Ethical issues surrounding somatic gene therapy are primarily those concerned with safety. Germline gene therapy is theoretically possible but raises serious ethical concerns concerning future generations.

  5. Gene transfer to the cerebellum.

    Science.gov (United States)

    Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

    2010-12-01

    There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

  6. Horizontal gene transfer between bacteria.

    Science.gov (United States)

    Heuer, Holger; Smalla, Kornelia

    2007-01-01

    Horizontal gene transfer (HGT) refers to the acquisition of foreign genes by organisms. The occurrence of HGT among bacteria in the environment is assumed to have implications in the risk assessment of genetically modified bacteria which are released into the environment. First, introduced genetic sequences from a genetically modified bacterium could be transferred to indigenous micro-organisms and alter their genome and subsequently their ecological niche. Second, the genetically modified bacterium released into the environment might capture mobile genetic elements (MGE) from indigenous micro-organisms which could extend its ecological potential. Thus, for a risk assessment it is important to understand the extent of HGT and genome plasticity of bacteria in the environment. This review summarizes the present state of knowledge on HGT between bacteria as a crucial mechanism contributing to bacterial adaptability and diversity. In view of the use of GM crops and microbes in agricultural settings, in this mini-review we focus particularly on the presence and role of MGE in soil and plant-associated bacteria and the factors affecting gene transfer.

  7. Horizontal gene transfer in chromalveolates

    Directory of Open Access Journals (Sweden)

    Bhattacharya Debashish

    2007-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT, the non-genealogical transfer of genetic material between different organisms, is considered a potentially important mechanism of genome evolution in eukaryotes. Using phylogenomic analyses of expressed sequence tag (EST data generated from a clonal cell line of a free living dinoflagellate alga Karenia brevis, we investigated the impact of HGT on genome evolution in unicellular chromalveolate protists. Results We identified 16 proteins that have originated in chromalveolates through ancient HGTs before the divergence of the genera Karenia and Karlodinium and one protein that was derived through a more recent HGT. Detailed analysis of the phylogeny and distribution of identified proteins demonstrates that eight have resulted from independent HGTs in several eukaryotic lineages. Conclusion Recurring intra- and interdomain gene exchange provides an important source of genetic novelty not only in parasitic taxa as previously demonstrated but as we show here, also in free-living protists. Investigating the tempo and mode of evolution of horizontally transferred genes in protists will therefore advance our understanding of mechanisms of adaptation in eukaryotes.

  8. Gene adaptation to extreme environments

    International Nuclear Information System (INIS)

    Marlaire, P.; Rodriguez, V.; Kerner, N.

    2005-01-01

    Full text: This work is oriented to the study of gene adaptation to extreme conditions, such as the hydrothermal system located in Copahue, Neuquen, Argentina. The organisms living there develop under two pressure selection conditions: the high temperature of thermal water and the strong impact of ultraviolet (UV) radiation. Several microorganisms found in this region were isolated and different colonies resistant to UV radiation were selected, a Geobacillus thermoleovorans strain identified through 16S RNA sequence, being the most remarkable. A gene library was prepared out of this strain with UV sensitive bacteria BH200 (uvrA::Tn10). A number of clones were isolated by means of UV selection, the most outstanding being a gene carrier able to codify for the guanosine monophosphate synthetase enzyme (GMPs). The suitability of said enzyme was proved by means of additional assays performed on ght 1 bacteria (guaA26::Tn 10) which lacked the enzyme. A transcript of 1100 pb was detected through Northern Blot. The result was consistent with that obtained for the mapping of the starting transcription site. The cloned GMPs produces an increase in growth speed and a greater biomass in BH200 bacteria. (author)

  9. A constructive approach to gene expression dynamics

    International Nuclear Information System (INIS)

    Ochiai, T.; Nacher, J.C.; Akutsu, T.

    2004-01-01

    Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property

  10. Uses of antimicrobial genes from microbial genome

    Science.gov (United States)

    Sorek, Rotem; Rubin, Edward M.

    2013-08-20

    We describe a method for mining microbial genomes to discover antimicrobial genes and proteins having broad spectrum of activity. Also described are antimicrobial genes and their expression products from various microbial genomes that were found using this method. The products of such genes can be used as antimicrobial agents or as tools for molecular biology.

  11. Problem-Solving Test: Targeted Gene Disruption

    Science.gov (United States)

    Szeberenyi, Jozsef

    2008-01-01

    Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…

  12. Mining disease genes using integrated protein-protein interaction and gene-gene co-regulation information.

    Science.gov (United States)

    Li, Jin; Wang, Limei; Guo, Maozu; Zhang, Ruijie; Dai, Qiguo; Liu, Xiaoyan; Wang, Chunyu; Teng, Zhixia; Xuan, Ping; Zhang, Mingming

    2015-01-01

    In humans, despite the rapid increase in disease-associated gene discovery, a large proportion of disease-associated genes are still unknown. Many network-based approaches have been used to prioritize disease genes. Many networks, such as the protein-protein interaction (PPI), KEGG, and gene co-expression networks, have been used. Expression quantitative trait loci (eQTLs) have been successfully applied for the determination of genes associated with several diseases. In this study, we constructed an eQTL-based gene-gene co-regulation network (GGCRN) and used it to mine for disease genes. We adopted the random walk with restart (RWR) algorithm to mine for genes associated with Alzheimer disease. Compared to the Human Protein Reference Database (HPRD) PPI network alone, the integrated HPRD PPI and GGCRN networks provided faster convergence and revealed new disease-related genes. Therefore, using the RWR algorithm for integrated PPI and GGCRN is an effective method for disease-associated gene mining.

  13. Using RNA-Seq data to select refence genes for normalizing gene expression in apple roots

    Science.gov (United States)

    Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for t...

  14. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  15. Reranking candidate gene models with cross-species comparison for improved gene prediction

    Directory of Open Access Journals (Sweden)

    Pereira Fernando CN

    2008-10-01

    Full Text Available Abstract Background Most gene finders score candidate gene models with state-based methods, typically HMMs, by combining local properties (coding potential, splice donor and acceptor patterns, etc. Competing models with similar state-based scores may be distinguishable with additional information. In particular, functional and comparative genomics datasets may help to select among competing models of comparable probability by exploiting features likely to be associated with the correct gene models, such as conserved exon/intron structure or protein sequence features. Results We have investigated the utility of a simple post-processing step for selecting among a set of alternative gene models, using global scoring rules to rerank competing models for more accurate prediction. For each gene locus, we first generate the K best candidate gene models using the gene finder Evigan, and then rerank these models using comparisons with putative orthologous genes from closely-related species. Candidate gene models with lower scores in the original gene finder may be selected if they exhibit strong similarity to probable orthologs in coding sequence, splice site location, or signal peptide occurrence. Experiments on Drosophila melanogaster demonstrate that reranking based on cross-species comparison outperforms the best gene models identified by Evigan alone, and also outperforms the comparative gene finders GeneWise and Augustus+. Conclusion Reranking gene models with cross-species comparison improves gene prediction accuracy. This straightforward method can be readily adapted to incorporate additional lines of evidence, as it requires only a ranked source of candidate gene models.

  16. [Key effect genes responding to nerve injury identified by gene ontology and computer pattern recognition].

    Science.gov (United States)

    Pan, Qian; Peng, Jin; Zhou, Xue; Yang, Hao; Zhang, Wei

    2012-07-01

    In order to screen out important genes from large gene data of gene microarray after nerve injury, we combine gene ontology (GO) method and computer pattern recognition technology to find key genes responding to nerve injury, and then verify one of these screened-out genes. Data mining and gene ontology analysis of gene chip data GSE26350 was carried out through MATLAB software. Cd44 was selected from screened-out key gene molecular spectrum by comparing genes' different GO terms and positions on score map of principal component. Function interferences were employed to influence the normal binding of Cd44 and one of its ligands, chondroitin sulfate C (CSC), to observe neurite extension. Gene ontology analysis showed that the first genes on score map (marked by red *) mainly distributed in molecular transducer activity, receptor activity, protein binding et al molecular function GO terms. Cd44 is one of six effector protein genes, and attracted us with its function diversity. After adding different reagents into the medium to interfere the normal binding of CSC and Cd44, varying-degree remissions of CSC's inhibition on neurite extension were observed. CSC can inhibit neurite extension through binding Cd44 on the neuron membrane. This verifies that important genes in given physiological processes can be identified by gene ontology analysis of gene chip data.

  17. Genotyping microarray (gene chip) for the ABCR (ABCA4) gene.

    Science.gov (United States)

    Jaakson, K; Zernant, J; Külm, M; Hutchinson, A; Tonisson, N; Glavac, D; Ravnik-Glavac, M; Hawlina, M; Meltzer, M R; Caruso, R C; Testa, F; Maugeri, A; Hoyng, C B; Gouras, P; Simonelli, F; Lewis, R A; Lupski, J R; Cremers, F P M; Allikmets, R

    2003-11-01

    Genetic variation in the ABCR (ABCA4) gene has been associated with five distinct retinal phenotypes, including Stargardt disease/fundus flavimaculatus (STGD/FFM), cone-rod dystrophy (CRD), and age-related macular degeneration (AMD). Comparative genetic analyses of ABCR variation and diagnostics have been complicated by substantial allelic heterogeneity and by differences in screening methods. To overcome these limitations, we designed a genotyping microarray (gene chip) for ABCR that includes all approximately 400 disease-associated and other variants currently described, enabling simultaneous detection of all known ABCR variants. The ABCR genotyping microarray (the ABCR400 chip) was constructed by the arrayed primer extension (APEX) technology. Each sequence change in ABCR was included on the chip by synthesis and application of sequence-specific oligonucleotides. We validated the chip by screening 136 confirmed STGD patients and 96 healthy controls, each of whom we had analyzed previously by single strand conformation polymorphism (SSCP) technology and/or heteroduplex analysis. The microarray was >98% effective in determining the existing genetic variation and was comparable to direct sequencing in that it yielded many sequence changes undetected by SSCP. In STGD patient cohorts, the efficiency of the array to detect disease-associated alleles was between 54% and 78%, depending on the ethnic composition and degree of clinical and molecular characterization of a cohort. In addition, chip analysis suggested a high carrier frequency (up to 1:10) of ABCR variants in the general population. The ABCR genotyping microarray is a robust, cost-effective, and comprehensive screening tool for variation in one gene in which mutations are responsible for a substantial fraction of retinal disease. The ABCR chip is a prototype for the next generation of screening and diagnostic tools in ophthalmic genetics, bridging clinical and scientific research. Copyright 2003 Wiley

  18. Comparative Genomic Analysis of Soybean Flowering Genes

    Science.gov (United States)

    Jung, Chol-Hee; Wong, Chui E.; Singh, Mohan B.; Bhalla, Prem L.

    2012-01-01

    Flowering is an important agronomic trait that determines crop yield. Soybean is a major oilseed legume crop used for human and animal feed. Legumes have unique vegetative and floral complexities. Our understanding of the molecular basis of flower initiation and development in legumes is limited. Here, we address this by using a computational approach to examine flowering regulatory genes in the soybean genome in comparison to the most studied model plant, Arabidopsis. For this comparison, a genome-wide analysis of orthologue groups was performed, followed by an in silico gene expression analysis of the identified soybean flowering genes. Phylogenetic analyses of the gene families highlighted the evolutionary relationships among these candidates. Our study identified key flowering genes in soybean and indicates that the vernalisation and the ambient-temperature pathways seem to be the most variant in soybean. A comparison of the orthologue groups containing flowering genes indicated that, on average, each Arabidopsis flowering gene has 2-3 orthologous copies in soybean. Our analysis highlighted that the CDF3, VRN1, SVP, AP3 and PIF3 genes are paralogue-rich genes in soybean. Furthermore, the genome mapping of the soybean flowering genes showed that these genes are scattered randomly across the genome. A paralogue comparison indicated that the soybean genes comprising the largest orthologue group are clustered in a 1.4 Mb region on chromosome 16 of soybean. Furthermore, a comparison with the undomesticated soybean (Glycine soja) revealed that there are hundreds of SNPs that are associated with putative soybean flowering genes and that there are structural variants that may affect the genes of the light-signalling and ambient-temperature pathways in soybean. Our study provides a framework for the soybean flowering pathway and insights into the relationship and evolution of flowering genes between a short-day soybean and the long-day plant, Arabidopsis. PMID:22679494

  19. Expression and Functions of Immediate Early Response Gene X-1 (IEX-1 in Rheumatoid Arthritis Synovial Fibroblasts.

    Directory of Open Access Journals (Sweden)

    Akio Morinobu

    Full Text Available In rheumatoid arthritis (RA, synovial fibroblasts (RA-SFs accumulate in affected joints, where they play roles in inflammation and joint destruction. RA-SFs exhibit tumor-like proliferation and are resistant to apoptosis. Although RA-SF activation is well described, negative regulators of RA-SF activation are unknown. We previously reported that histone deacetylase (HDAC inhibitors facilitate apoptosis in RA-SFs. Here we found that RA-SFs treated with the HDAC inhibitor Trichostatin A (TSA exhibited an upregulation of the immediate early response gene X-1 (IEX-1. IEX-1 has roles in apoptosis sensitivity, cell-cycle progression, and proliferation, and is reported to be involved in immune responses, inflammation, and tumorigenesis, and to have anti-arthritic properties. To investigate IEX-1's role in RA-SFs, we used in vitro-cultured synovial fibroblasts from RA and osteoarthritis (OA patients. We confirmed that TSA upregulated the IEX-1 protein and mRNA expressions in RA-SFs by western blotting and quantitative RT-PCR. Inhibiting HDAC1, 2, and 3 (but not 6 or 8 also upregulated IEX-1. The IEX-1 mRNA levels were higher in RA-SFs than in OA-SFs, and were further upregulated in RA-SFs by the pro-inflammatory cytokines TNFα and IL-1β. The staining of surgical specimens showed that IEX-1 was present in the pannus from affected RA joints. Si-RNA-mediated IEX-1 knockdown upregulated the lipopolysaccharide (LPS-induced expression of TNFα and various chemokine mRNAs, indicating that IEX-1 downregulates TNFα and chemokines. Furthermore, apoptosis analysis showed that IEX-1 knockdown protected RA-SFs from apoptosis induced by TSA or by an anti-Fas mAb, indicating that IEX-1 is pro-apoptotic in RA-SFs. Collectively, our results showed that IEX-1 is induced by TNFα and IL-1β in RA-SFs, in which it suppresses TNFα and chemokine production and induces apoptosis; thus, IEX-1 negatively regulates RA-SF activation. Further investigation of IEX1's functions

  20. Integrating Ontological Knowledge and Textual Evidence in Estimating Gene and Gene Product Similarity

    Energy Technology Data Exchange (ETDEWEB)

    Sanfilippo, Antonio P.; Posse, Christian; Gopalan, Banu; Tratz, Stephen C.; Gregory, Michelle L.

    2006-06-08

    With the rising influence of the Gene On-tology, new approaches have emerged where the similarity between genes or gene products is obtained by comparing Gene Ontology code annotations associ-ated with them. So far, these approaches have solely relied on the knowledge en-coded in the Gene Ontology and the gene annotations associated with the Gene On-tology database. The goal of this paper is to demonstrate that improvements to these approaches can be obtained by integrating textual evidence extracted from relevant biomedical literature.

  1. Thermostable cellulase from a thermomonospora gene

    Science.gov (United States)

    Wilson, D.B.; Walker, L.P.; Zhang, S.

    1997-10-14

    The invention relates to a gene isolated from Thermomonospora fusca, wherein the gene encodes a thermostable cellulase. Disclosed is the nucleotide sequence of the T. fusca gene; and nucleic acid molecules comprising the gene, or a fragment of the gene, that can be used to recombinantly express the cellulase or a catalytically active polypeptide thereof, respectively. The isolated and purified recombinant cellulase or catalytically active polypeptide may be used to hydrolyze substrate either by itself; or in combination with other cellulases, with the resultant combination having unexpected hydrolytic activity. 3 figs.

  2. Gene doping: of mice and men.

    Science.gov (United States)

    Azzazy, Hassan M E; Mansour, Mai M H; Christenson, Robert H

    2009-04-01

    Gene doping is the newest threat to the spirit of fair play in sports. Its concept stemmed out from legitimate gene therapy trials, but anti-doping authorities fear that they now may be facing a form of doping that is virtually undetectable and extremely appealing to athletes. This paper presents studies that generated mouse models with outstanding physical performance, by manipulating genes such as insulin-like growth factor 1 (IGF-1) or phosphoenolpyruvate carboxykinase (PEPCK), which are likely to be targeted for gene doping. The potential transition from super mice to super athletes will also be discussed, in addition to possible strategies for detection of gene doping.

  3. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  4. Positron emission tomography imaging of gene expression

    International Nuclear Information System (INIS)

    Tang Ganghua

    2001-01-01

    The merging of molecular biology and nuclear medicine is developed into molecular nuclear medicine. Positron emission tomography (PET) of gene expression in molecular nuclear medicine has become an attractive area. Positron emission tomography imaging gene expression includes the antisense PET imaging and the reporter gene PET imaging. It is likely that the antisense PET imaging will lag behind the reporter gene PET imaging because of the numerous issues that have not yet to be resolved with this approach. The reporter gene PET imaging has wide application into animal experimental research and human applications of this approach will likely be reported soon

  5. GSEH: A Novel Approach to Select Prostate Cancer-Associated Genes Using Gene Expression Heterogeneity.

    Science.gov (United States)

    Kim, Hyunjin; Choi, Sang-Min; Park, Sanghyun

    2018-01-01

    When a gene shows varying levels of expression among normal people but similar levels in disease patients or shows similar levels of expression among normal people but different levels in disease patients, we can assume that the gene is associated with the disease. By utilizing this gene expression heterogeneity, we can obtain additional information that abets discovery of disease-associated genes. In this study, we used collaborative filtering to calculate the degree of gene expression heterogeneity between classes and then scored the genes on the basis of the degree of gene expression heterogeneity to find "differentially predicted" genes. Through the proposed method, we discovered more prostate cancer-associated genes than 10 comparable methods. The genes prioritized by the proposed method are potentially significant to biological processes of a disease and can provide insight into them.

  6. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  7. Validation of reference genes for quantifying changes in gene expression in virus-infected tobacco.

    Science.gov (United States)

    Baek, Eseul; Yoon, Ju-Yeon; Palukaitis, Peter

    2017-10-01

    To facilitate quantification of gene expression changes in virus-infected tobacco plants, eight housekeeping genes were evaluated for their stability of expression during infection by one of three systemically-infecting viruses (cucumber mosaic virus, potato virus X, potato virus Y) or a hypersensitive-response-inducing virus (tobacco mosaic virus; TMV) limited to the inoculated leaf. Five reference-gene validation programs were used to establish the order of the most stable genes for the systemically-infecting viruses as ribosomal protein L25 > β-Tubulin > Actin, and the least stable genes Ubiquitin-conjugating enzyme (UCE) genes were EF1α > Cysteine protease > Actin, and the least stable genes were GAPDH genes, three defense responsive genes were examined to compare their relative changes in gene expression caused by each virus. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. A review for detecting gene-gene interactions using machine learning methods in genetic epidemiology.

    Science.gov (United States)

    Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed

    2013-01-01

    Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

  9. Bioinformatics study of the mangrove actin genes

    Science.gov (United States)

    Basyuni, M.; Wasilah, M.; Sumardi

    2017-01-01

    This study describes the bioinformatics methods to analyze eight actin genes from mangrove plants on DDBJ/EMBL/GenBank as well as predicted the structure, composition, subcellular localization, similarity, and phylogenetic. The physical and chemical properties of eight mangroves showed variation among the genes. The percentage of the secondary structure of eight mangrove actin genes followed the order of a helix > random coil > extended chain structure for BgActl, KcActl, RsActl, and A. corniculatum Act. In contrast to this observation, the remaining actin genes were random coil > extended chain structure > a helix. This study, therefore, shown the prediction of secondary structure was performed for necessary structural information. The values of chloroplast or signal peptide or mitochondrial target were too small, indicated that no chloroplast or mitochondrial transit peptide or signal peptide of secretion pathway in mangrove actin genes. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove actin genes. To clarify the relationship among the mangrove actin gene, a phylogenetic tree was constructed. Three groups of mangrove actin genes were formed, the first group contains B. gymnorrhiza BgAct and R. stylosa RsActl. The second cluster which consists of 5 actin genes the largest group, and the last branch consist of one gene, B. sexagula Act. The present study, therefore, supported the previous results that plant actin genes form distinct clusters in the tree.

  10. Two fundamentally different classes of microbial genes.

    Science.gov (United States)

    Wolf, Yuri I; Makarova, Kira S; Lobkovsky, Alexander E; Koonin, Eugene V

    2016-11-07

    The evolution of bacterial and archaeal genomes is highly dynamic and involves extensive horizontal gene transfer and gene loss 1-4 . Furthermore, many microbial species appear to have open pangenomes, where each newly sequenced genome contains more than 10% ORFans, that is, genes without detectable homologues in other species 5,6 . Here, we report a quantitative analysis of microbial genome evolution by fitting the parameters of a simple, steady-state evolutionary model to the comparative genomic data on the gene content and gene order similarity between archaeal genomes. The results reveal two sharply distinct classes of microbial genes, one of which is characterized by effectively instantaneous gene replacement, and the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of the size of the prokaryotic genomic universe, which appears to consist of at least a billion distinct genes. Furthermore, the same distribution of constraints is shown to govern the evolution of gene complement and gene order, without the need to invoke long-range conservation or the selfish operon concept 7 .

  11. Progress in Gene Therapy for Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Kamran A.; Davis, Brian J. [Department of Radiation Oncology, Mayo Clinic, Rochester, MN (United States); Wilson, Torrence M. [Department of Urology, Mayo Clinic, Rochester, MN (United States); Wiseman, Gregory A. [Division of Nuclear Medicine, Mayo Clinic, Rochester, MN (United States); Federspiel, Mark J. [Department of Molecular Medicine, Mayo Clinic, Rochester, MN (United States); Morris, John C., E-mail: davis.brian@mayo.edu [Division of Endocrinology, Mayo Clinic, Rochester, MN (United States)

    2012-11-19

    Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our institution attempts to address this deficiency. The sodium-iodide symporter (NIS) is responsible for the ability of the thyroid gland to transport and concentrate iodide. The characteristics of the NIS gene suggest that it could represent an ideal therapeutic gene for cancer therapy. Published results from Mayo Clinic researchers have indicated several important successes with the use of the NIS gene and prostate gene therapy. Studies have demonstrated that transfer of the human NIS gene into prostate cancer using adenovirus vectors in vitro and in vivo results in efficient uptake of radioactive iodine and significant tumor growth delay with prolongation of survival. Preclinical successes have culminated in the opening of a phase I trial for patients with advanced prostate disease which is currently accruing patients. Further study will reveal the clinical promise of NIS gene therapy in the treatment of prostate as well as other malignancies.

  12. Progress in Gene Therapy for Prostate Cancer

    International Nuclear Information System (INIS)

    Ahmed, Kamran A.; Davis, Brian J.; Wilson, Torrence M.; Wiseman, Gregory A.; Federspiel, Mark J.; Morris, John C.

    2012-01-01

    Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our institution attempts to address this deficiency. The sodium-iodide symporter (NIS) is responsible for the ability of the thyroid gland to transport and concentrate iodide. The characteristics of the NIS gene suggest that it could represent an ideal therapeutic gene for cancer therapy. Published results from Mayo Clinic researchers have indicated several important successes with the use of the NIS gene and prostate gene therapy. Studies have demonstrated that transfer of the human NIS gene into prostate cancer using adenovirus vectors in vitro and in vivo results in efficient uptake of radioactive iodine and significant tumor growth delay with prolongation of survival. Preclinical successes have culminated in the opening of a phase I trial for patients with advanced prostate disease which is currently accruing patients. Further study will reveal the clinical promise of NIS gene therapy in the treatment of prostate as well as other malignancies.

  13. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  14. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  15. Apolipoprotein gene involved in lipid metabolism

    Science.gov (United States)

    Rubin, Edward; Pennacchio, Len A.

    2007-07-03

    Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.

  16. MRI Reporter Genes for Noninvasive Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Caixia Yang

    2016-05-01

    Full Text Available Magnetic resonance imaging (MRI is one of the most important imaging technologies used in clinical diagnosis. Reporter genes for MRI can be applied to accurately track the delivery of cell in cell therapy, evaluate the therapy effect of gene delivery, and monitor tissue/cell-specific microenvironments. Commonly used reporter genes for MRI usually include genes encoding the enzyme (e.g., tyrosinase and β-galactosidase, the receptor on the cells (e.g., transferrin receptor, and endogenous reporter genes (e.g., ferritin reporter gene. However, low sensitivity limits the application of MRI and reporter gene-based multimodal imaging strategies are common including optical imaging and radionuclide imaging. These can significantly improve diagnostic efficiency and accelerate the development of new therapies.

  17. [Current status of gene test market].

    Science.gov (United States)

    Ohtani, Shinichi

    2002-12-01

    The technological innovation of the gene analysis makes the adaptation range of the gene test in clinical diagnosis expand. Then, gene test has popularized increasingly around the infection disease for clinical inspection. Also in the field of clinical inspection, the increase of the importance of clinical application and the inspection item new year by year have appeared with the functional analysis of a gene. Moreover, the new test method and automation analysis equipment tend to be developed by progress of gene-analysis technology, and it is going to be introduced. The spread of gene test and development of a gene test market have an important possibility of activating the present clinical inspection field.

  18. Determinants of human adipose tissue gene expression

    DEFF Research Database (Denmark)

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José

    2012-01-01

    weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong...... interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index...... on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently...

  19. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU

    2011-01-01

    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  20. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  1. Gene flow from transgenic common beans expressing the bar gene.

    Science.gov (United States)

    Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

    2010-01-01

    Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

  2. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies.

    Science.gov (United States)

    Chapman, Joanne R; Waldenström, Jonas

    2015-01-01

    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  3. Evolutionary signatures amongst disease genes permit novel methods for gene prioritization and construction of informative gene-based networks.

    Directory of Open Access Journals (Sweden)

    Nolan Priedigkeit

    2015-02-01

    Full Text Available Genes involved in the same function tend to have similar evolutionary histories, in that their rates of evolution covary over time. This coevolutionary signature, termed Evolutionary Rate Covariation (ERC, is calculated using only gene sequences from a set of closely related species and has demonstrated potential as a computational tool for inferring functional relationships between genes. To further define applications of ERC, we first established that roughly 55% of genetic diseases posses an ERC signature between their contributing genes. At a false discovery rate of 5% we report 40 such diseases including cancers, developmental disorders and mitochondrial diseases. Given these coevolutionary signatures between disease genes, we then assessed ERC's ability to prioritize known disease genes out of a list of unrelated candidates. We found that in the presence of an ERC signature, the true disease gene is effectively prioritized to the top 6% of candidates on average. We then apply this strategy to a melanoma-associated region on chromosome 1 and identify MCL1 as a potential causative gene. Furthermore, to gain global insight into disease mechanisms, we used ERC to predict molecular connections between 310 nominally distinct diseases. The resulting "disease map" network associates several diseases with related pathogenic mechanisms and unveils many novel relationships between clinically distinct diseases, such as between Hirschsprung's disease and melanoma. Taken together, these results demonstrate the utility of molecular evolution as a gene discovery platform and show that evolutionary signatures can be used to build informative gene-based networks.

  4. Gene therapy for prostate cancer.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Cancer remains a leading cause of morbidity and mortality. Despite advances in understanding, detection, and treatment, it accounts for almost one-fourth of all deaths per year in Western countries. Prostate cancer is currently the most commonly diagnosed noncutaneous cancer in men in Europe and the United States, accounting for 15% of all cancers in men. As life expectancy of individuals increases, it is expected that there will also be an increase in the incidence and mortality of prostate cancer. Prostate cancer may be inoperable at initial presentation, unresponsive to chemotherapy and radiotherapy, or recur following appropriate treatment. At the time of presentation, patients may already have metastases in their tissues. Preventing tumor recurrence requires systemic therapy; however, current modalities are limited by toxicity or lack of efficacy. For patients with such metastatic cancers, the development of alternative therapies is essential. Gene therapy is a realistic prospect for the treatment of prostate and other cancers, and involves the delivery of genetic information to the patient to facilitate the production of therapeutic proteins. Therapeutics can act directly (eg, by inducing tumor cells to produce cytotoxic agents) or indirectly by upregulating the immune system to efficiently target tumor cells or by destroying the tumor\\'s vasculature. However, technological difficulties must be addressed before an efficient and safe gene medicine is achieved (primarily by developing a means of delivering genes to the target cells or tissue safely and efficiently). A wealth of research has been carried out over the past 20 years, involving various strategies for the treatment of prostate cancer at preclinical and clinical trial levels. The therapeutic efficacy observed with many of these approaches in patients indicates that these treatment modalities will serve as an important component of urological malignancy treatment in the clinic, either in isolation or

  5. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  6. QB1 - Stochastic Gene Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Munsky, Brian [Los Alamos National Laboratory

    2012-07-23

    Summaries of this presentation are: (1) Stochastic fluctuations or 'noise' is present in the cell - Random motion and competition between reactants, Low copy, quantization of reactants, Upstream processes; (2) Fluctuations may be very important - Cell-to-cell variability, Cell fate decisions (switches), Signal amplification or damping, stochastic resonances; and (3) Some tools are available to mode these - Kinetic Monte Carlo simulations (SSA and variants), Moment approximation methods, Finite State Projection. We will see how modeling these reactions can tell us more about the underlying processes of gene regulation.

  7. Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.

    Science.gov (United States)

    Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción

    2016-02-27

    In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a

  8. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    Science.gov (United States)

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  9. The iojap gene in maize

    Energy Technology Data Exchange (ETDEWEB)

    Martienssen, Robert

    2001-12-01

    The classical maize mutant iojap (Iodent japonica) has variegated green and white leaves. Green sectors have cells with normal chloroplasts whereas white sectors have cells where plastids fail to differentiate. These mutant plastids, when transmitted through the female gametophyte, do not recover in the presence of wild type Iojap. We cloned the Ij locus, and we have investigated the mechanism of epigenetic inheritance and phenotypic expression. More recently, a modifier of this type of variegation, ''Inhibitor of striate'', has also been cloned. Both the iojap and inhibitor of striate proteins have homologs in bacteria and are members of ancient conserved families found in multiple species. These tools can be used to address fundamental questions of inheritance and variegation associated with this classical conundrum of maize genetics. Since the work of Rhoades there has been considerable speculation concerning the nature of the Iojap gene product, the origin of leaf variegation and the mechanism behind the material inheritance of defective plastids. This has made Iojap a textbook paradigm for cytoplasmic inheritance and nuclear-organellar interaction for almost 50 years. Cloning of the Iojap gene in maize, and homologs in other plants and bacteria, provides a new means to address the origin of heteroplastidity, variegation and cytoplasmic inheritance in higher plants.

  10. Genes that bias Mendelian segregation.

    Science.gov (United States)

    Grognet, Pierre; Lalucque, Hervé; Malagnac, Fabienne; Silar, Philippe

    2014-01-01

    Mendel laws of inheritance can be cheated by Meiotic Drive Elements (MDs), complex nuclear genetic loci found in various eukaryotic genomes and distorting segregation in their favor. Here, we identify and characterize in the model fungus Podospora anserina Spok1 and Spok2, two MDs known as Spore Killers. We show that they are related genes with both spore-killing distorter and spore-protecting responder activities carried out by the same allele. These alleles act as autonomous elements, exert their effects independently of their location in the genome and can act as MDs in other fungi. Additionally, Spok1 acts as a resistance factor to Spok2 killing. Genetical data and cytological analysis of Spok1 and Spok2 localization during the killing process suggest a complex mode of action for Spok proteins. Spok1 and Spok2 belong to a multigene family prevalent in the genomes of many ascomycetes. As they have no obvious cellular role, Spok1 and Spok2 Spore Killer genes represent a novel kind of selfish genetic elements prevalent in fungal genome that proliferate through meiotic distortion.

  11. Genes that bias Mendelian segregation.

    Directory of Open Access Journals (Sweden)

    Pierre Grognet

    Full Text Available Mendel laws of inheritance can be cheated by Meiotic Drive Elements (MDs, complex nuclear genetic loci found in various eukaryotic genomes and distorting segregation in their favor. Here, we identify and characterize in the model fungus Podospora anserina Spok1 and Spok2, two MDs known as Spore Killers. We show that they are related genes with both spore-killing distorter and spore-protecting responder activities carried out by the same allele. These alleles act as autonomous elements, exert their effects independently of their location in the genome and can act as MDs in other fungi. Additionally, Spok1 acts as a resistance factor to Spok2 killing. Genetical data and cytological analysis of Spok1 and Spok2 localization during the killing process suggest a complex mode of action for Spok proteins. Spok1 and Spok2 belong to a multigene family prevalent in the genomes of many ascomycetes. As they have no obvious cellular role, Spok1 and Spok2 Spore Killer genes represent a novel kind of selfish genetic elements prevalent in fungal genome that proliferate through meiotic distortion.

  12. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  13. Republished review: Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-07-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  14. Detection of EPO gene doping in blood.

    Science.gov (United States)

    Neuberger, Elmo W I; Jurkiewicz, Magdalena; Moser, Dirk A; Simon, Perikles

    2012-11-01

    Gene doping--or the abuse of gene therapy--will continue to threaten the sports world. History has shown that progress in medical research is likely to be abused in order to enhance human performance. In this review, we critically discuss the progress and the risks associated with the field of erythropoietin (EPO) gene therapy and its applicability to EPO gene doping. We present typical vector systems that are employed in ex vivo and in vivo gene therapy trials. Due to associated risks, gene doping is not a feasible alternative to conventional EPO or blood doping at this time. Nevertheless, it is well described that about half of the elite athlete population is in principle willing to risk its health to gain a competitive advantage. This includes the use of technologies that lack safety approval. Sophisticated detection approaches are a prerequisite for prevention of unapproved and uncontrolled use of gene therapy technology. In this review, we present current detection approaches for EPO gene doping, with a focus on blood-based direct and indirect approaches. Gene doping is detectable in principle, and recent DNA-based detection strategies enable long-term detection of transgenic DNA (tDNA) following in vivo gene transfer. Copyright © 2012 John Wiley & Sons, Ltd.

  15. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  16. Targeting Herpetic Keratitis by Gene Therapy

    Directory of Open Access Journals (Sweden)

    Hossein Mostafa Elbadawy

    2012-01-01

    Full Text Available Ocular gene therapy is rapidly becoming a reality. By November 2012, approximately 28 clinical trials were approved to assess novel gene therapy agents. Viral infections such as herpetic keratitis caused by herpes simplex virus 1 (HSV-1 can cause serious complications that may lead to blindness. Recurrence of the disease is likely and cornea transplantation, therefore, might not be the ideal therapeutic solution. This paper will focus on the current situation of ocular gene therapy research against herpetic keratitis, including the use of viral and nonviral vectors, routes of delivery of therapeutic genes, new techniques, and key research strategies. Whereas the correction of inherited diseases was the initial goal of the field of gene therapy, here we discuss transgene expression, gene replacement, silencing, or clipping. Gene therapy of herpetic keratitis previously reported in the literature is screened emphasizing candidate gene therapy targets. Commonly adopted strategies are discussed to assess the relative advantages of the protective therapy using antiviral drugs and the common gene therapy against long-term HSV-1 ocular infections signs, inflammation and neovascularization. Successful gene therapy can provide innovative physiological and pharmaceutical solutions against herpetic keratitis.

  17. New Genes and Functional Innovation in Mammals.

    Science.gov (United States)

    Luis Villanueva-Cañas, José; Ruiz-Orera, Jorge; Agea, M Isabel; Gallo, Maria; Andreu, David; Albà, M Mar

    2017-07-01

    The birth of genes that encode new protein sequences is a major source of evolutionary innovation. However, we still understand relatively little about how these genes come into being and which functions they are selected for. To address these questions, we have obtained a large collection of mammalian-specific gene families that lack homologues in other eukaryotic groups. We have combined gene annotations and de novo transcript assemblies from 30 different mammalian species, obtaining ∼6,000 gene families. In general, the proteins in mammalian-specific gene families tend to be short and depleted in aromatic and negatively charged residues. Proteins which arose early in mammalian evolution include milk and skin polypeptides, immune response components, and proteins involved in reproduction. In contrast, the functions of proteins which have a more recent origin remain largely unknown, despite the fact that these proteins also have extensive proteomics support. We identify several previously described cases of genes originated de novo from noncoding genomic regions, supporting the idea that this mechanism frequently underlies the evolution of new protein-coding genes in mammals. Finally, we show that most young mammalian genes are preferentially expressed in testis, suggesting that sexual selection plays an important role in the emergence of new functional genes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. IL26 gene inactivation in Equidae.

    Science.gov (United States)

    Shakhsi-Niaei, M; Drögemüller, M; Jagannathan, V; Gerber, V; Leeb, T

    2013-12-01

    Interleukin-26 (IL26) is a member of the IL10 cytokine family. The IL26 gene is located between two other well-known cytokines genes of this family encoding interferon-gamma (IFNG) and IL22 in an evolutionary conserved gene cluster. In contrast to humans and most other mammals, mice lack a functional Il26 gene. We analyzed the genome sequences of other vertebrates for the presence or absence of functional IL26 orthologs and found that the IL26 gene has also become inactivated in several equid species. We detected a one-base pair frameshift deletion in exon 2 of the IL26 gene in the domestic horse (Equus caballus), Przewalski horse (Equus przewalskii) and donkey (Equus asinus). The remnant IL26 gene in the horse is still transcribed and gives rise to at least five alternative transcripts. None of these transcripts share a conserved open reading frame with the human IL26 gene. A comparative analysis across diverse vertebrates revealed that the IL26 gene has also independently been inactivated in a few other mammals, including the African elephant and the European hedgehog. The IL26 gene thus appears to be highly variable, and the conserved open reading frame has been lost several times during mammalian evolution. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  19. Selection of Phototransduction Genes in Homo sapiens.

    Science.gov (United States)

    Christopher, Mark; Scheetz, Todd E; Mullins, Robert F; Abràmoff, Michael D

    2013-08-13

    We investigated the evidence of recent positive selection in the human phototransduction system at single nucleotide polymorphism (SNP) and gene level. SNP genotyping data from the International HapMap Project for European, Eastern Asian, and African populations was used to discover differences in haplotype length and allele frequency between these populations. Numeric selection metrics were computed for each SNP and aggregated into gene-level metrics to measure evidence of recent positive selection. The level of recent positive selection in phototransduction genes was evaluated and compared to a set of genes shown previously to be under recent selection, and a set of highly conserved genes as positive and negative controls, respectively. Six of 20 phototransduction genes evaluated had gene-level selection metrics above the 90th percentile: RGS9, GNB1, RHO, PDE6G, GNAT1, and SLC24A1. The selection signal across these genes was found to be of similar magnitude to the positive control genes and much greater than the negative control genes. There is evidence for selective pressure in the genes involved in retinal phototransduction, and traces of this selective pressure can be demonstrated using SNP-level and gene-level metrics of allelic variation. We hypothesize that the selective pressure on these genes was related to their role in low light vision and retinal adaptation to ambient light changes. Uncovering the underlying genetics of evolutionary adaptations in phototransduction not only allows greater understanding of vision and visual diseases, but also the development of patient-specific diagnostic and intervention strategies.

  20. Mining gene expression data of multiple sclerosis.

    Directory of Open Access Journals (Sweden)

    Pi Guo

    Full Text Available Microarray produces a large amount of gene expression data, containing various biological implications. The challenge is to detect a panel of discriminative genes associated with disease. This study proposed a robust classification model for gene selection using gene expression data, and performed an analysis to identify disease-related genes using multiple sclerosis as an example.Gene expression profiles based on the transcriptome of peripheral blood mononuclear cells from a total of 44 samples from 26 multiple sclerosis patients and 18 individuals with other neurological diseases (control were analyzed. Feature selection algorithms including Support Vector Machine based on Recursive Feature Elimination, Receiver Operating Characteristic Curve, and Boruta algorithms were jointly performed to select candidate genes associating with multiple sclerosis. Multiple classification models categorized samples into two different groups based on the identified genes. Models' performance was evaluated using cross-validation methods, and an optimal classifier for gene selection was determined.An overlapping feature set was identified consisting of 8 genes that were differentially expressed between the two phenotype groups. The genes were significantly associated with the pathways of apoptosis and cytokine-cytokine receptor interaction. TNFSF10 was significantly associated with multiple sclerosis. A Support Vector Machine model was established based on the featured genes and gave a practical accuracy of ∼86%. This binary classification model also outperformed the other models in terms of Sensitivity, Specificity and F1 score.The combined analytical framework integrating feature ranking algorithms and Support Vector Machine model could be used for selecting genes for other diseases.

  1. Intermediate filaments and gene regulation.

    Science.gov (United States)

    Traub, P

    1995-01-01

    The biological role of intermediate filaments (IFs) of eukaryotic cells is still a matter of conjecture. On the basis of immunofluorescence and electron microscopic observations, they appear to play a cytoskeletal role in that they stabilize cellular structure and organize the distribution and interactions of intracellular organelles and components. The expression of a large number of cell type-specific and developmentally regulated subunit proteins is believed to provide multicellular organisms with different IF systems capable of differential interactions with the various substructures and components of their multiple, differentiated cells. However, the destruction of distinct IF systems by manipulation of cultured cells or by knock-out mutation of IF subunit proteins in transgenic mice exerts relatively little influence on cellular morphology and physiology and on development of mutant animals. In order to rationalize this dilemma, the cytoskeletal concept of IF function has been extended to purport that cytoplasmic (c) IFs and their subunit proteins also play fundamental roles in gene regulation. It is based on the in vitro capacity of cIF(protein)s to interact with guanine-rich, single-stranded DNA, supercoiled DNA and histones, as well as on their close structural relatedness to gene-regulatory DNA-binding and nuclear matrix proteins. Since cIF proteins do not possess classical nuclear localization signals, it is proposed that cIFs directly penetrate the double nuclear membrane, exploiting the amphiphilic, membrane-active character of their subunit proteins. Since they can establish metastable multisite contacts with nuclear matrix structures and/or chromatin areas containing highly repetitive DNA sequence elements at the nuclear periphery, they are supposed to participate in chromosome distribution and chromatin organization in interphase nuclei of differentiated cells. Owing to their different DNA-binding specificities, the various cIF systems may in this

  2. Prediction of regulatory gene pairs using dynamic time warping and gene ontology.

    Science.gov (United States)

    Yang, Andy C; Hsu, Hui-Huang; Lu, Ming-Da; Tseng, Vincent S; Shih, Timothy K

    2014-01-01

    Selecting informative genes is the most important task for data analysis on microarray gene expression data. In this work, we aim at identifying regulatory gene pairs from microarray gene expression data. However, microarray data often contain multiple missing expression values. Missing value imputation is thus needed before further processing for regulatory gene pairs becomes possible. We develop a novel approach to first impute missing values in microarray time series data by combining k-Nearest Neighbour (KNN), Dynamic Time Warping (DTW) and Gene Ontology (GO). After missing values are imputed, we then perform gene regulation prediction based on our proposed DTW-GO distance measurement of gene pairs. Experimental results show that our approach is more accurate when compared with existing missing value imputation methods on real microarray data sets. Furthermore, our approach can also discover more regulatory gene pairs that are known in the literature than other methods.

  3. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  4. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    Science.gov (United States)

    Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  5. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    Directory of Open Access Journals (Sweden)

    Zhimin Dai

    Full Text Available Biological nitrogen fixation is an essential function of acid mine drainage (AMD microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  6. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    Science.gov (United States)

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  7. Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.

    Science.gov (United States)

    Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang

    2018-02-01

    Whenever gene expression is being examined, it is essential that a normalization