Synthetic study on prion protein fragments using a SPPS and native chemical ligation
Czech Academy of Sciences Publication Activity Database
Zawada, Z.; Šebestík, Jaroslav; Bednárová, Lucie; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan
2009-01-01
Roč. 37, Suppl. 1 (2009), s. 44-44 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /11./. 03.08.2009-07.08.2009, Vienna] Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * SPPS * native chemical ligation * fragments Subject RIV: CC - Organic Chemistry
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure
Energy Technology Data Exchange (ETDEWEB)
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-09-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Truncated forms of the prion protein PrP demonstrate the need for complexity in prion structure.
Wan, William; Stöhr, Jan; Kendall, Amy; Stubbs, Gerald
2015-01-01
Self-propagation of aberrant protein folds is the defining characteristic of prions. Knowing the structural basis of self-propagation is essential to understanding prions and their related diseases. Prion rods are amyloid fibrils, but not all amyloids are prions. Prions have been remarkably intractable to structural studies, so many investigators have preferred to work with peptide fragments, particularly in the case of the mammalian prion protein PrP. We compared the structures of a number of fragments of PrP by X-ray fiber diffraction, and found that although all of the peptides adopted amyloid conformations, only the larger fragments adopted conformations that modeled the complexity of self-propagating prions, and even these fragments did not always adopt the PrP structure. It appears that the relatively complex structure of the prion form of PrP is not accessible to short model peptides, and that self-propagation may be tied to a level of structural complexity unobtainable in simple model systems. The larger fragments of PrP, however, are useful to illustrate the phenomenon of deformed templating (heterogeneous seeding), which has important biological consequences.
Baral, Pravas Kumar; Swayampakula, Mridula; Aguzzi, Adriano; James, Michael N G
2018-05-01
Conversion of the cellular prion protein PrP C into its pathogenic isoform PrP S c is the hallmark of prion diseases, fatal neurodegenerative diseases affecting many mammalian species including humans. Anti-prion monoclonal antibodies can arrest the progression of prion diseases by stabilizing the cellular form of the prion protein. Here, we present the crystal structure of the POM6 Fab fragment, in complex with the mouse prion protein (moPrP). The prion epitope of POM6 is in close proximity to the epitope recognized by the purportedly toxic antibody fragment, POM1 Fab also complexed with moPrP. The POM6 Fab recognizes a larger binding interface indicating a likely stronger binding compared to POM1. POM6 and POM1 exhibit distinct biological responses. Structural comparisons of the bound mouse prion proteins from the POM6 Fab:moPrP and POM1 Fab:moPrP complexes reveal several key regions of the prion protein that might be involved in initiating mis-folding events. The structural data of moPrP:POM6 Fab complex are available in the PDB under the accession number www.rcsb.org/pdb/search/structidSearch.do?structureId=6AQ7. © 2018 Federation of European Biochemical Societies.
International Nuclear Information System (INIS)
Baral, Pravas Kumar; Wieland, Barbara; Swayampakula, Mridula; Polymenidou, Magdalini; Aguzzi, Adriano; Kav, Nat N. V.; James, Michael N. G.
2011-01-01
The complex of MoPrP(120–232) and Fab POM1 has been crystallized (space group C2, unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°). Diffraction data to 2.30 Å resolution have been collected using synchrotron radiation. Prion diseases are neurodegenerative diseases that are characterized by the conversion of the cellular prion protein PrP c to the pathogenic isoform PrP sc . Several antibodies are known to interact with the cellular prion protein and to inhibit this transition. An antibody Fab fragment, Fab POM1, was produced that recognizes a structural motif of the C-terminal domain of mouse prion protein. To study the mechanism by which Fab POM1 recognizes and binds the prion molecule, the complex between Fab POM1 and the C-terminal domain of mouse prion (residues 120–232) was prepared and crystallized. Crystals of this binary complex belonged to the monoclinic space group C2, with unit-cell parameters a = 83.68, b = 106.9, c = 76.25 Å, β = 95.6°
Prions and prion-like proteins.
Fraser, Paul E
2014-07-18
Prions are self-replicating protein aggregates and are the primary causative factor in a number of neurological diseases in mammals. The prion protein (PrP) undergoes a conformational transformation leading to aggregation into an infectious cellular pathogen. Prion-like protein spreading and transmission of aggregates between cells have also been demonstrated for other proteins associated with Alzheimer disease and Parkinson disease. This protein-only phenomenon may therefore have broader implications in neurodegenerative disorders. The minireviews in this thematic series highlight the recent advances in prion biology and the roles these unique proteins play in disease. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Harris, Julia M; Nguyen, Phil P; Patel, Milan J; Sporn, Zachary A; Hines, Justin K
2014-07-01
Yeast prions are heritable amyloid aggregates of functional yeast proteins; their propagation to subsequent cell generations is dependent upon fragmentation of prion protein aggregates by molecular chaperone proteins. Mounting evidence indicates the J-protein Sis1 may act as an amyloid specificity factor, recognizing prion and other amyloid aggregates and enabling Ssa and Hsp104 to act in prion fragmentation. Chaperone interactions with prions, however, can be affected by variations in amyloid-core structure resulting in distinct prion variants or 'strains'. Our genetic analysis revealed that Sis1 domain requirements by distinct variants of [PSI+] are strongly dependent upon overall variant stability. Notably, multiple strong [PSI+] variants can be maintained by a minimal construct of Sis1 consisting of only the J-domain and glycine/phenylalanine-rich (G/F) region that was previously shown to be sufficient for cell viability and [RNQ+] prion propagation. In contrast, weak [PSI+] variants are lost under the same conditions but maintained by the expression of an Sis1 construct that lacks only the G/F region and cannot support [RNQ+] propagation, revealing mutually exclusive requirements for Sis1 function between these two prions. Prion loss is not due to [PSI+]-dependent toxicity or dependent upon a particular yeast genetic background. These observations necessitate that Sis1 must have at least two distinct functional roles that individual prions differentially require for propagation and which are localized to the glycine-rich domains of the Sis1. Based on these distinctions, Sis1 plasmid-shuffling in a [PSI+]/[RNQ+] strain permitted J-protein-dependent prion selection for either prion. We also found that, despite an initial report to the contrary, the human homolog of Sis1, Hdj1, is capable of [PSI+] prion propagation in place of Sis1. This conservation of function is also prion-variant dependent, indicating that only one of the two Sis1-prion functions may have
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-04-02
The abnormally folded form of the prion protein (PrP(Sc)) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrP(Sc) N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrP(Sc) accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrP(Sc) proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrP(Sc) fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrP(Sc) and cell pathogenesis of prion infection.
Dron, Michel; Moudjou, Mohammed; Chapuis, Jérôme; Salamat, Muhammad Khalid Farooq; Bernard, Julie; Cronier, Sabrina; Langevin, Christelle; Laude, Hubert
2010-01-01
The abnormally folded form of the prion protein (PrPSc) accumulating in nervous and lymphoid tissues of prion-infected individuals can be naturally cleaved to generate a N-terminal-truncated fragment called C2. Information about the identity of the cellular proteases involved in this process and its possible role in prion biology has remained limited and controversial. We investigated PrPSc N-terminal trimming in different cell lines and primary cultured nerve cells, and in the brain and spleen tissue from transgenic mice infected by ovine and mouse prions. We found the following: (i) the full-length to C2 ratio varies considerably depending on the infected cell or tissue. Thus, in primary neurons and brain tissue, PrPSc accumulated predominantly as untrimmed species, whereas efficient trimming occurred in Rov and MovS cells, and in spleen tissue. (ii) Although C2 is generally considered to be the counterpart of the PrPSc proteinase K-resistant core, the N termini of the fragments cleaved in vivo and in vitro can actually differ, as evidenced by a different reactivity toward the Pc248 anti-octarepeat antibody. (iii) In lysosome-impaired cells, the ratio of full-length versus C2 species dramatically increased, yet efficient prion propagation could occur. Moreover, cathepsin but not calpain inhibitors markedly inhibited C2 formation, and in vitro cleavage by cathepsins B and L produced PrPSc fragments lacking the Pc248 epitope, strongly arguing for the primary involvement of acidic hydrolases of the endolysosomal compartment. These findings have implications on the molecular analysis of PrPSc and cell pathogenesis of prion infection. PMID:20154089
COMPOSITE PEPTIDE COMPOUNDS FOR DIAGNOSIS AND TREATMENT OF DISEASES CAUSED BY PRION PROTEINS
DEFF Research Database (Denmark)
2004-01-01
The present invention relates to diseases caused by prion proteins, Novel composite peptide compounds are disclosed which comprise two or more peptides or peptide fragments optionally linked to a backbone and the peptides or peptide fragments are spatially positioned relative to each other so tha....... Other uses of the composite peptide compounds are also disclosed, such as use in diagnostic assays, production of antibodies and uses as vaccine immunogens for the prophylactic protection and therapeutic treatment of subjects against transmissible prion disease.......The present invention relates to diseases caused by prion proteins, Novel composite peptide compounds are disclosed which comprise two or more peptides or peptide fragments optionally linked to a backbone and the peptides or peptide fragments are spatially positioned relative to each other so...
The Prion Protein Preference of Sporadic Creutzfeldt-Jakob Disease Subtypes*
Klemm, Helen M. J.; Welton, Jeremy M.; Masters, Colin L.; Klug, Genevieve M.; Boyd, Alison; Hill, Andrew F.; Collins, Steven J.; Lawson, Victoria A.
2012-01-01
Sporadic Creutzfeldt-Jakob disease (CJD) is the most prevalent manifestation of the transmissible spongiform encephalopathies or prion diseases affecting humans. The disease encompasses a spectrum of clinical phenotypes that have been correlated with molecular subtypes that are characterized by the molecular mass of the protease-resistant fragment of the disease-related conformation of the prion protein and a polymorphism at codon 129 of the gene encoding the prion protein. A cell-free assay of prion protein misfolding was used to investigate the ability of these sporadic CJD molecular subtypes to propagate using brain-derived sources of the cellular prion protein (PrPC). This study confirmed the presence of three distinct sporadic CJD molecular subtypes with PrPC substrate requirements that reflected their codon 129 associations in vivo. However, the ability of a sporadic CJD molecular subtype to use a specific PrPC substrate was not determined solely by codon 129 as the efficiency of prion propagation was also influenced by the composition of the brain tissue from which the PrPC substrate was sourced, thus indicating that nuances in PrPC or additional factors may determine sporadic CJD subtype. The results of this study will aid in the design of diagnostic assays that can detect prion disease across the diversity of sporadic CJD subtypes. PMID:22930754
Prions: Beyond a Single Protein
Das, Alvin S.
2016-01-01
SUMMARY Since the term protein was first coined in 1838 and protein was discovered to be the essential component of fibrin and albumin, all cellular proteins were presumed to play beneficial roles in plants and mammals. However, in 1967, Griffith proposed that proteins could be infectious pathogens and postulated their involvement in scrapie, a universally fatal transmissible spongiform encephalopathy in goats and sheep. Nevertheless, this novel hypothesis had not been evidenced until 1982, when Prusiner and coworkers purified infectious particles from scrapie-infected hamster brains and demonstrated that they consisted of a specific protein that he called a “prion.” Unprecedentedly, the infectious prion pathogen is actually derived from its endogenous cellular form in the central nervous system. Unlike other infectious agents, such as bacteria, viruses, and fungi, prions do not contain genetic materials such as DNA or RNA. The unique traits and genetic information of prions are believed to be encoded within the conformational structure and posttranslational modifications of the proteins. Remarkably, prion-like behavior has been recently observed in other cellular proteins—not only in pathogenic roles but also serving physiological functions. The significance of these fascinating developments in prion biology is far beyond the scope of a single cellular protein and its related disease. PMID:27226089
Mammalian amyloidogenic proteins promote prion nucleation in yeast.
Chandramowlishwaran, Pavithra; Sun, Meng; Casey, Kristin L; Romanyuk, Andrey V; Grizel, Anastasiya V; Sopova, Julia V; Rubel, Aleksandr A; Nussbaum-Krammer, Carmen; Vorberg, Ina M; Chernoff, Yury O
2018-03-02
Fibrous cross-β aggregates (amyloids) and their transmissible forms (prions) cause diseases in mammals (including humans) and control heritable traits in yeast. Initial nucleation of a yeast prion by transiently overproduced prion-forming protein or its (typically, QN-rich) prion domain is efficient only in the presence of another aggregated (in most cases, QN-rich) protein. Here, we demonstrate that a fusion of the prion domain of yeast protein Sup35 to some non-QN-rich mammalian proteins, associated with amyloid diseases, promotes nucleation of Sup35 prions in the absence of pre-existing aggregates. In contrast, both a fusion of the Sup35 prion domain to a multimeric non-amyloidogenic protein and the expression of a mammalian amyloidogenic protein that is not fused to the Sup35 prion domain failed to promote prion nucleation, further indicating that physical linkage of a mammalian amyloidogenic protein to the prion domain of a yeast protein is required for the nucleation of a yeast prion. Biochemical and cytological approaches confirmed the nucleation of protein aggregates in the yeast cell. Sequence alterations antagonizing or enhancing amyloidogenicity of human amyloid-β (associated with Alzheimer's disease) and mouse prion protein (associated with prion diseases), respectively, antagonized or enhanced nucleation of a yeast prion by these proteins. The yeast-based prion nucleation assay, developed in our work, can be employed for mutational dissection of amyloidogenic proteins. We anticipate that it will aid in the identification of chemicals that influence initial amyloid nucleation and in searching for new amyloidogenic proteins in a variety of proteomes. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Leliveld, S. R.; Dame, R.T.; Wuite, G.J.L.; Stitz, L.; Korth, C.
2006-01-01
Insertion of additional octarepeats into the prion protein gene has been genetically linked to familial Creutzfeldt Jakob disease and hence to de novo generation of infectious prions. The pivotal event during prion formation is the conversion of the normal prion protein (PrP
Yeast prions and human prion-like proteins: sequence features and prediction methods.
Cascarina, Sean M; Ross, Eric D
2014-06-01
Prions are self-propagating infectious protein isoforms. A growing number of prions have been identified in yeast, each resulting from the conversion of soluble proteins into an insoluble amyloid form. These yeast prions have served as a powerful model system for studying the causes and consequences of prion aggregation. Remarkably, a number of human proteins containing prion-like domains, defined as domains with compositional similarity to yeast prion domains, have recently been linked to various human degenerative diseases, including amyotrophic lateral sclerosis. This suggests that the lessons learned from yeast prions may help in understanding these human diseases. In this review, we examine what has been learned about the amino acid sequence basis for prion aggregation in yeast, and how this information has been used to develop methods to predict aggregation propensity. We then discuss how this information is being applied to understand human disease, and the challenges involved in applying yeast prediction methods to higher organisms.
Recombinant human prion protein inhibits prion propagation in vitro.
Yuan, Jue; Zhan, Yi-An; Abskharon, Romany; Xiao, Xiangzhu; Martinez, Manuel Camacho; Zhou, Xiaochen; Kneale, Geoff; Mikol, Jacqueline; Lehmann, Sylvain; Surewicz, Witold K; Castilla, Joaquín; Steyaert, Jan; Zhang, Shulin; Kong, Qingzhong; Petersen, Robert B; Wohlkonig, Alexandre; Zou, Wen-Quan
2013-10-09
Prion diseases are associated with the conformational conversion of the cellular prion protein (PrP(C)) into the pathological scrapie isoform (PrP(Sc)) in the brain. Both the in vivo and in vitro conversion of PrP(C) into PrP(Sc) is significantly inhibited by differences in amino acid sequence between the two molecules. Using protein misfolding cyclic amplification (PMCA), we now report that the recombinant full-length human PrP (rHuPrP23-231) (that is unglycosylated and lacks the glycophosphatidylinositol anchor) is a strong inhibitor of human prion propagation. Furthermore, rHuPrP23-231 also inhibits mouse prion propagation in a scrapie-infected mouse cell line. Notably, it binds to PrP(Sc), but not PrP(C), suggesting that the inhibitory effect of recombinant PrP results from blocking the interaction of brain PrP(C) with PrP(Sc). Our findings suggest a new avenue for treating prion diseases, in which a patient's own unglycosylated and anchorless PrP is used to inhibit PrP(Sc) propagation without inducing immune response side effects.
Directory of Open Access Journals (Sweden)
Nicola Franscini
Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.
Prion protein immunocytochemistry helps to establish the true incidence of prion diseases.
Lantos, P L; McGill, I S; Janota, I; Doey, L J; Collinge, J; Bruce, M T; Whatley, S A; Anderton, B H; Clinton, J; Roberts, G W
1992-11-23
Creutzfeldt-Jakob disease (CJD) and Gerstmann-Strüssler-Scheinker disease (GSSD) are transmissible spongiform encephalopathies or prion diseases affecting man. It has been reported that prion diseases may occur without the histological hallmarks of spongiform encephalopathies: vacuolation of the cerebral grey matter, neuronal loss and astrocytosis. These cases without characteristic neuropathology may go undiagnosed and consequently the true incidence of transmissible dementias is likely to have been under-estimated. Immunocytochemistry using antibodies to prion protein gives positive staining of these cases, albeit the pattern of immunostaining differs from that seen in typical forms. Accumulation of prion protein is a molecular hallmark of prion diseases, and thus a reproducible, speedy and cost-efficient immunocytochemical screening of unusual dementias may help to establish the true incidence of prion diseases.
Directory of Open Access Journals (Sweden)
Imperiale Valentina
2007-07-01
Full Text Available Abstract Background A hallmark of prion disease is the transformation of normal cellular prion protein (PrPc into an infectious disease-associated isoform, (PrPsc. Anti-prion protein monoclonal antibodies are invaluable for structure-function studies of PrP molecules. Furthermore recent in vitro and in vivo studies indicate that anti-PrP monoclonal antibodies can prevent the incorporation of PrPc into propagating prions. In the present article, we show two new human phage antibodies, isolated on recombinant hamster prion protein (rHaPrP. Results We adopted an antibody phage display strategy to isolate specific human antibodies directed towards rHaPrP which has been used as a bait for panning the synthetic ETH-2 antibody phage library. Two phage antibodies clones named MA3.B4 and MA3.G3 were isolated and characterized under genetic biochemical and immunocytochemical aspects. The clones were found to recognize the prion protein in ELISA studies. In flow-cytometry studies, these human single chain Fragment variable (scFv phage-antibodies show a well defined pattern of reactivity on human lymphoblastoid and myeloid cells. Conclusion Sequence analysis of the gene encoding for the antibody fragments and antigen recognition patterns determined by flow-cytometry analysis indicate that the isolated scFvs recognize novel epitopes in the PrPc molecule. These new anti PrPc human antibodies are unique reagents for prion protein detection and may represent a biologic platform to develop new reagents to treat PrPsc associated disease.
Disturbed vesicular trafficking of membrane proteins in prion disease.
Uchiyama, Keiji; Miyata, Hironori; Sakaguchi, Suehiro
2013-01-01
The pathogenic mechanism of prion diseases remains unknown. We recently reported that prion infection disturbs post-Golgi trafficking of certain types of membrane proteins to the cell surface, resulting in reduced surface expression of membrane proteins and abrogating the signal from the proteins. The surface expression of the membrane proteins was reduced in the brains of mice inoculated with prions, well before abnormal symptoms became evident. Prions or pathogenic prion proteins were mainly detected in endosomal compartments, being particularly abundant in recycling endosomes. Some newly synthesized membrane proteins are delivered to the surface from the Golgi apparatus through recycling endosomes, and some endocytosed membrane proteins are delivered back to the surface through recycling endosomes. These results suggest that prions might cause neuronal dysfunctions and cell loss by disturbing post-Golgi trafficking of membrane proteins via accumulation in recycling endosomes. Interestingly, it was recently shown that delivery of a calcium channel protein to the cell surface was impaired and its function was abrogated in a mouse model of hereditary prion disease. Taken together, these results suggest that impaired delivery of membrane proteins to the cell surface is a common pathogenic event in acquired and hereditary prion diseases.
Controlling the prion propensity of glutamine/asparagine-rich proteins.
Paul, Kacy R; Ross, Eric D
2015-01-01
The yeast Saccharomyces cerevisiae can harbor a number of distinct prions. Most of the yeast prion proteins contain a glutamine/asparagine (Q/N) rich region that drives prion formation. Prion-like domains, defined as regions with high compositional similarity to yeast prion domains, are common in eukaryotic proteomes, and mutations in various human proteins containing prion-like domains have been linked to degenerative diseases, including amyotrophic lateral sclerosis. Here, we discuss a recent study in which we utilized two strategies to generate prion activity in non-prion Q/N-rich domains. First, we made targeted mutations in four non-prion Q/N-rich domains, replacing predicted prion-inhibiting amino acids with prion-promoting amino acids. All four mutants formed foci when expressed in yeast, and two acquired bona fide prion activity. Prion activity could be generated with as few as two mutations, suggesting that many non-prion Q/N-rich proteins may be just a small number of mutations from acquiring aggregation or prion activity. Second, we created tandem repeats of short prion-prone segments, and observed length-dependent prion activity. These studies demonstrate the considerable progress that has been made in understanding the sequence basis for aggregation of prion and prion-like domains, and suggest possible mechanisms by which new prion domains could evolve.
Porcine prion protein amyloid.
Hammarström, Per; Nyström, Sofie
2015-01-01
Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.
Directory of Open Access Journals (Sweden)
Diego La Mendola
2014-05-01
Full Text Available Prion disorders are a group of fatal neurodegenerative conditions of mammals. The key molecular event in the pathogenesis of such diseases is the conformational conversion of prion protein, PrPC, into a misfolded form rich in β-sheet structure, PrPSc, but the detailed mechanistic aspects of prion protein conversion remain enigmatic. There is uncertainty on the precise physiological function of PrPC in healthy individuals. Several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ mainly through a domain composed by four to five repeats of eight amino acids. In addition to mammals, PrP homologues have also been identified in birds, reptiles, amphibians and fish. The globular domain of protein is retained in the different species, suggesting that the protein carries out an essential common function. However, the comparison of amino acid sequences indicates that prion protein has evolved differently in each vertebrate class. The primary sequences are strongly conserved in each group, but these exhibit a low similarity with those of mammals. The N-terminal domain of different prions shows tandem amino acid repeats with an increasing amount of histidine residues going from amphibians to mammals. The difference in the sequence affects the number of copper binding sites, the affinity and the coordination environment of metal ions, suggesting that the involvement of prion in metal homeostasis may be a specific characteristic of mammalian prion protein. In this review, we describe the similarities and the differences in the metal binding of different species’ prion protein, as revealed by studies carried out on the entire protein and related peptide fragments.
Thermodynamic Stabilization of the Folded Domain of Prion Protein Inhibits Prion Infection in Vivo
Directory of Open Access Journals (Sweden)
Qingzhong Kong
2013-07-01
Full Text Available Prion diseases, or transmissible spongiform encephalopathies (TSEs, are associated with the conformational conversion of the cellular prion protein, PrPC, into a protease-resistant form, PrPSc. Here, we show that mutation-induced thermodynamic stabilization of the folded, α-helical domain of PrPC has a dramatic inhibitory effect on the conformational conversion of prion protein in vitro, as well as on the propagation of TSE disease in vivo. Transgenic mice expressing a human prion protein variant with increased thermodynamic stability were found to be much more resistant to infection with the TSE agent than those expressing wild-type human prion protein, in both the primary passage and three subsequent subpassages. These findings not only provide a line of evidence in support of the protein-only model of TSEs but also yield insight into the molecular nature of the PrPC→PrPSc conformational transition, and they suggest an approach to the treatment of prion diseases.
Ultraviolet-ozone treatment reduces levels of disease-associated prion protein and prion infectivity
Johnson, C.J.; Gilbert, P.; McKenzie, D.; Pedersen, J.A.; Aiken, Judd M.
2009-01-01
Background. Transmissible spongiform encephalopathies (TSEs) are a group of fatal neurodegenerative diseases caused by novel infectious agents referred to as prions. Prions appear to be composed primarily, if not exclusively, of a misfolded isoform of the cellular prion protein. TSE infectivity is remarkably stable and can resist many aggressive decontamination procedures, increasing human, livestock and wildlife exposure to TSEs. Findings. We tested the hypothesis that UV-ozone treatment reduces levels of the pathogenic prion protein and inactivates the infectious agent. We found that UV-ozone treatment decreased the carbon and prion protein content in infected brain homogenate to levels undetectable by dry-ashing carbon analysis or immunoblotting, respectively. After 8 weeks of ashing, UV-ozone treatment reduced the infectious titer of treated material by a factor of at least 105. A small amount of infectivity, however, persisted despite UV-ozone treatment. When bound to either montmorillonite clay or quartz surfaces, PrPTSE was still susceptible to degradation by UV-ozone. Conclusion. Our findings strongly suggest that UV-ozone treatment can degrade pathogenic prion protein and inactivate prions, even when the agent is associated with surfaces. Using larger UV-ozone doses or combining UV-ozone treatment with other decontaminant methods may allow the sterilization of TSE-contaminated materials. ?? 2009 Aiken et al; licensee BioMed Central Ltd.
De novo generation of infectious prions with bacterially expressed recombinant prion protein.
Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan
2013-12-01
The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.
Tavares, Evandro; Macedo, Joana A; Paulo, Pedro M R; Tavares, Catarina; Lopes, Carlos; Melo, Eduardo P
2014-07-01
Prion diseases are associated to the conversion of the prion protein into a misfolded pathological isoform. The mechanism of propagation of protein misfolding by protein templating remains largely unknown. Neuroblastoma cells were transfected with constructs of the prion protein fused to both CFP-GPI-anchored and to YFP-GPI-anchored and directed to its cell membrane location. Live-cell FRET imaging between the prion protein fused to CFP or YFP was measured giving consistent values of 10±2%. This result was confirmed by fluorescence lifetime imaging microscopy and indicates intermolecular interactions between neighbor prion proteins. In particular, considering that a maximum FRET efficiency of 17±2% was determined from a positive control consisting of a fusion CFP-YFP-GPI-anchored. A stable cell clone expressing the two fusions containing the prion protein was also selected to minimize cell-to-cell variability. In both, stable and transiently transfected cells, the FRET efficiency consistently increased in the presence of infectious prions - from 4±1% to 7±1% in the stable clone and from 10±2% to 16±1% in transiently transfected cells. These results clearly reflect an increased clustering of the prion protein on the membrane in the presence of infectious prions, which was not observed in negative control using constructs without the prion protein and upon addition of non-infected brain. Our data corroborates the recent view that the primary site for prion conversion is the cell membrane. Since our fluorescent cell clone is not susceptible to propagate infectivity, we hypothesize that the initial event of prion infectivity might be the clustering of the GPI-anchored prion protein. Copyright © 2014 Elsevier B.V. All rights reserved.
Ionic mechanisms of action of prion protein fragment PrP(106-126) in rat basal forebrain neurons.
Alier, Kwai; Li, Zongming; Mactavish, David; Westaway, David; Jhamandas, Jack H
2010-08-01
Prion diseases are neurodegenerative disorders that are characterized by the presence of the misfolded prion protein (PrP). Neurotoxicity in these diseases may result from prion-induced modulation of ion channel function, changes in neuronal excitability, and consequent disruption of cellular homeostasis. We therefore examined PrP effects on a suite of potassium (K(+)) conductances that govern excitability of basal forebrain neurons. Our study examined the effects of a PrP fragment [PrP(106-126), 50 nM] on rat neurons using the patch clamp technique. In this paradigm, PrP(106-126) peptide, but not the "scrambled" sequence of PrP(106-126), evoked a reduction of whole-cell outward currents in a voltage range between -30 and +30 mV. Reduction of whole-cell outward currents was significantly attenuated in Ca(2+)-free external media and also in the presence of iberiotoxin, a blocker of calcium-activated potassium conductance. PrP(106-126) application also evoked a depression of the delayed rectifier (I(K)) and transient outward (I(A)) potassium currents. By using single cell RT-PCR, we identified the presence of two neuronal chemical phenotypes, GABAergic and cholinergic, in cells from which we recorded. Furthermore, cholinergic and GABAergic neurons were shown to express K(v)4.2 channels. Our data establish that the central region of PrP, defined by the PrP(106-126) peptide used at nanomolar concentrations, induces a reduction of specific K(+) channel conductances in basal forebrain neurons. These findings suggest novel links between PrP signalling partners inferred from genetic experiments, K(+) channels, and PrP-mediated neurotoxicity.
Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE–like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion. PMID:21888788
Neurotoxic Antibodies against the Prion Protein Do Not Trigger Prion Replication.
Directory of Open Access Journals (Sweden)
Karl Frontzek
Full Text Available Prions are the infectious agents causing transmissible spongiform encephalopathies (TSE, progressive, inexorably lethal neurological diseases. Antibodies targeting the globular domain (GD of the cellular prion protein PrPC trigger a neurotoxic syndrome morphologically and molecularly similar to prion disease. This phenomenon raises the question whether such antibodies induce infectious prions de novo. Here we exposed cerebellar organotypic cultured slices (COCS to the neurotoxic antibody, POM1. We then inoculated COCS homogenates into tga20 mice, which overexpress PrPC and are commonly utilized as sensitive indicators of prion infectivity. None of the mice inoculated with COCS-derived lysates developed any signs of disease, and all mice survived for at least 200 days post-inoculation. In contrast, all mice inoculated with bona fide prions succumbed to TSE after 55-95 days. Post-mortem analyses did not reveal any signs of prion pathology in mice inoculated with POM1-COCS lysates. Also, lysates from POM1-exposed COCS were unable to convert PrP by quaking. Hence, anti-GD antibodies do not catalyze the generation of prion infectivity. These data indicate that prion replication can be separated from prion toxicity, and suggest that anti-GD antibodies exert toxicity by acting downstream of prion replication.
Watts, Joel C; Giles, Kurt; Saltzberg, Daniel J; Dugger, Brittany N; Patel, Smita; Oehler, Abby; Bhardwaj, Sumita; Sali, Andrej; Prusiner, Stanley B
2016-11-01
The biochemical and neuropathological properties of bovine spongiform encephalopathy (BSE) and variant Creutzfeldt-Jakob disease (vCJD) prions are faithfully maintained upon transmission to guinea pigs. However, primary and secondary transmissions of BSE and vCJD in guinea pigs result in long incubation periods of ∼450 and ∼350 days, respectively. To determine if the incubation periods of BSE and vCJD prions could be shortened, we generated transgenic (Tg) mice expressing guinea pig prion protein (GPPrP). Inoculation of Tg(GPPrP) mice with BSE and vCJD prions resulted in mean incubation periods of 210 and 199 days, respectively, which shortened to 137 and 122 days upon serial transmission. In contrast, three different isolates of sporadic CJD prions failed to transmit disease to Tg(GPPrP) mice. Many of the strain-specified biochemical and neuropathological properties of BSE and vCJD prions, including the presence of type 2 protease-resistant PrP Sc , were preserved upon propagation in Tg(GPPrP) mice. Structural modeling revealed that two residues near the N-terminal region of α-helix 1 in GPPrP might mediate its susceptibility to BSE and vCJD prions. Our results demonstrate that expression of GPPrP in Tg mice supports the rapid propagation of BSE and vCJD prions and suggest that Tg(GPPrP) mice may serve as a useful paradigm for bioassaying these prion isolates. Variant Creutzfeldt-Jakob disease (vCJD) and bovine spongiform encephalopathy (BSE) prions are two of the prion strains most relevant to human health. However, propagating these strains in mice expressing human or bovine prion protein has been difficult because of prolonged incubation periods or inefficient transmission. Here, we show that transgenic mice expressing guinea pig prion protein are fully susceptible to vCJD and BSE prions but not to sporadic CJD prions. Our results suggest that the guinea pig prion protein is a better, more rapid substrate than either bovine or human prion protein for
A systematic investigation of production of synthetic prions from recombinant prion protein.
Schmidt, Christian; Fizet, Jeremie; Properzi, Francesca; Batchelor, Mark; Sandberg, Malin K; Edgeworth, Julie A; Afran, Louise; Ho, Sammy; Badhan, Anjna; Klier, Steffi; Linehan, Jacqueline M; Brandner, Sebastian; Hosszu, Laszlo L P; Tattum, M Howard; Jat, Parmjit; Clarke, Anthony R; Klöhn, Peter C; Wadsworth, Jonathan D F; Jackson, Graham S; Collinge, John
2015-12-01
According to the protein-only hypothesis, infectious mammalian prions, which exist as distinct strains with discrete biological properties, consist of multichain assemblies of misfolded cellular prion protein (PrP). A critical test would be to produce prion strains synthetically from defined components. Crucially, high-titre 'synthetic' prions could then be used to determine the structural basis of infectivity and strain diversity at the atomic level. While there have been multiple reports of production of prions from bacterially expressed recombinant PrP using various methods, systematic production of high-titre material in a form suitable for structural analysis remains a key goal. Here, we report a novel high-throughput strategy for exploring a matrix of conditions, additives and potential cofactors that might generate high-titre prions from recombinant mouse PrP, with screening for infectivity using a sensitive automated cell-based bioassay. Overall, approximately 20,000 unique conditions were examined. While some resulted in apparently infected cell cultures, this was transient and not reproducible. We also adapted published methods that reported production of synthetic prions from recombinant hamster PrP, but again did not find evidence of significant infectious titre when using recombinant mouse PrP as substrate. Collectively, our findings are consistent with the formation of prion infectivity from recombinant mouse PrP being a rare stochastic event and we conclude that systematic generation of prions from recombinant PrP may only become possible once the detailed structure of authentic ex vivo prions is solved. © 2015 The Authors.
Protease-resistant prions selectively decrease Shadoo protein.
Directory of Open Access Journals (Sweden)
Joel C Watts
2011-11-01
Full Text Available The central event in prion diseases is the conformational conversion of the cellular prion protein (PrP(C into PrP(Sc, a partially protease-resistant and infectious conformer. However, the mechanism by which PrP(Sc causes neuronal dysfunction remains poorly understood. Levels of Shadoo (Sho, a protein that resembles the flexibly disordered N-terminal domain of PrP(C, were found to be reduced in the brains of mice infected with the RML strain of prions [1], implying that Sho levels may reflect the presence of PrP(Sc in the brain. To test this hypothesis, we examined levels of Sho during prion infection using a variety of experimental systems. Sho protein levels were decreased in the brains of mice, hamsters, voles, and sheep infected with different natural and experimental prion strains. Furthermore, Sho levels were decreased in the brains of prion-infected, transgenic mice overexpressing Sho and in infected neuroblastoma cells. Time-course experiments revealed that Sho levels were inversely proportional to levels of protease-resistant PrP(Sc. Membrane anchoring and the N-terminal domain of PrP both influenced the inverse relationship between Sho and PrP(Sc. Although increased Sho levels had no discernible effect on prion replication in mice, we conclude that Sho is the first non-PrP marker specific for prion disease. Additional studies using this paradigm may provide insight into the cellular pathways and systems subverted by PrP(Sc during prion disease.
Shattuck, Jenifer E; Waechter, Aubrey C; Ross, Eric D
2017-07-04
Prion-like domains are low complexity, intrinsically disordered domains that compositionally resemble yeast prion domains. Many prion-like domains are involved in the formation of either functional or pathogenic protein aggregates. These aggregates range from highly dynamic liquid droplets to highly ordered detergent-insoluble amyloid-like aggregates. To better understand the amino acid sequence features that promote conversion to stable, detergent-insoluble aggregates, we used the prediction algorithm PAPA to identify predicted aggregation-prone prion-like domains with a range of compositions. While almost all of the predicted aggregation-prone domains formed foci when expressed in cells, the ability to form the detergent-insoluble aggregates was highly correlated with glutamine/asparagine (Q/N) content, suggesting that high Q/N content may specifically promote conversion to the amyloid state in vivo. We then used this data set to examine cross-seeding between prion-like proteins. The prion protein Sup35 requires the presence of a second prion, [PIN + ], to efficiently form prions, but this requirement can be circumvented by the expression of various Q/N-rich protein fragments. Interestingly, almost all of the Q/N-rich domains that formed SDS-insoluble aggregates were able to promote prion formation by Sup35, highlighting the highly promiscuous nature of these interactions.
Prion protein and scrapie susceptibility
Smits, M.A.; Bossers, A.; Schreuder, B.E.C.
1997-01-01
This article presents briefly current views on the role of prion protein (PrP) in Transmissible Spongiform Encephalopathies or prion diseases and the effect of PrP polymoryhisms on the susceptibility to these diseases, with special emphasis on sheep scrapie. The PrP genotype of sheep apears to be a
Directory of Open Access Journals (Sweden)
Lisa eGasperini
2014-08-01
Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and
Protein Misfolding Cyclic Amplification of Infectious Prions.
Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies, or prion diseases, are a group of incurable disorders caused by the accumulation of an abnormally folded prion protein (PrP Sc ) in the brain. According to the "protein-only" hypothesis, PrP Sc is the infectious agent able to propagate the disease by acting as a template for the conversion of the correctly folded prion protein (PrP C ) into the pathological isoform. Recently, the mechanism of PrP C conversion has been mimicked in vitro using an innovative technique named protein misfolding cyclic amplification (PMCA). This technology represents a great tool for studying diverse aspects of prion biology in the field of basic research and diagnosis. Moreover, PMCA can be expanded for the study of the misfolding process associated to other neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and frontotemporal lobar degeneration. © 2017 Elsevier Inc. All rights reserved.
A naturally occurring variant of the human prion protein completely prevents prion disease.
Asante, Emmanuel A; Smidak, Michelle; Grimshaw, Andrew; Houghton, Richard; Tomlinson, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Richard-Londt, Angela; Linehan, Jacqueline M; Brandner, Sebastian; Alpers, Michael; Whitfield, Jerome; Mead, Simon; Wadsworth, Jonathan D F; Collinge, John
2015-06-25
Mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (PrP). A novel PrP variant, G127V, was under positive evolutionary selection during the epidemic of kuru--an acquired prion disease epidemic of the Fore population in Papua New Guinea--and appeared to provide strong protection against disease in the heterozygous state. Here we have investigated the protective role of this variant and its interaction with the common, worldwide M129V PrP polymorphism. V127 was seen exclusively on a M129 PRNP allele. We demonstrate that transgenic mice expressing both variant and wild-type human PrP are completely resistant to both kuru and classical Creutzfeldt-Jakob disease (CJD) prions (which are closely similar) but can be infected with variant CJD prions, a human prion strain resulting from exposure to bovine spongiform encephalopathy prions to which the Fore were not exposed. Notably, mice expressing only PrP V127 were completely resistant to all prion strains, demonstrating a different molecular mechanism to M129V, which provides its relative protection against classical CJD and kuru in the heterozygous state. Indeed, this single amino acid substitution (G→V) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. Further study in transgenic mice expressing different ratios of variant and wild-type PrP indicates that not only is PrP V127 completely refractory to prion conversion but acts as a potent dose-dependent inhibitor of wild-type prion propagation.
Ex vivo mammalian prions are formed of paired double helical prion protein fibrils.
Terry, Cassandra; Wenborn, Adam; Gros, Nathalie; Sells, Jessica; Joiner, Susan; Hosszu, Laszlo L P; Tattum, M Howard; Panico, Silvia; Clare, Daniel K; Collinge, John; Saibil, Helen R; Wadsworth, Jonathan D F
2016-05-01
Mammalian prions are hypothesized to be fibrillar or amyloid forms of prion protein (PrP), but structures observed to date have not been definitively correlated with infectivity and the three-dimensional structure of infectious prions has remained obscure. Recently, we developed novel methods to obtain exceptionally pure preparations of prions from mouse brain and showed that pathogenic PrP in these high-titre preparations is assembled into rod-like assemblies. Here, we have used precise cell culture-based prion infectivity assays to define the physical relationship between the PrP rods and prion infectivity and have used electron tomography to define their architecture. We show that infectious PrP rods isolated from multiple prion strains have a common hierarchical assembly comprising twisted pairs of short fibres with repeating substructure. The architecture of the PrP rods provides a new structural basis for understanding prion infectivity and can explain the inability to systematically generate high-titre synthetic prions from recombinant PrP. © 2016 The Authors.
New insights into structural determinants of prion protein folding and stability.
Benetti, Federico; Legname, Giuseppe
2015-01-01
Prions are the etiological agent of fatal neurodegenerative diseases called prion diseases or transmissible spongiform encephalopathies. These maladies can be sporadic, genetic or infectious disorders. Prions are due to post-translational modifications of the cellular prion protein leading to the formation of a β-sheet enriched conformer with altered biochemical properties. The molecular events causing prion formation in sporadic prion diseases are still elusive. Recently, we published a research elucidating the contribution of major structural determinants and environmental factors in prion protein folding and stability. Our study highlighted the crucial role of octarepeats in stabilizing prion protein; the presence of a highly enthalpically stable intermediate state in prion-susceptible species; and the role of disulfide bridge in preserving native fold thus avoiding the misfolding to a β-sheet enriched isoform. Taking advantage from these findings, in this work we present new insights into structural determinants of prion protein folding and stability.
Race, Brent; Phillips, Katie; Meade-White, Kimberly; Striebel, James; Chesebro, Bruce
2015-06-01
Prion protein (PrP) is found in all mammals, mostly as a glycoprotein anchored to the plasma membrane by a C-terminal glycosylphosphatidylinositol (GPI) linkage. Following prion infection, host protease-sensitive prion protein (PrPsen or PrPC) is converted into an abnormal, disease-associated, protease-resistant form (PrPres). Biochemical characteristics, such as the PrP amino acid sequence, and posttranslational modifications, such as glycosylation and GPI anchoring, can affect the transmissibility of prions as well as the biochemical properties of the PrPres generated. Previous in vivo studies on the effects of GPI anchoring on prion infectivity have not examined cross-species transmission. In this study, we tested the effect of lack of GPI anchoring on a species barrier model using mice expressing human PrP. In this model, anchorless 22L prions derived from tg44 mice were more infectious than 22L prions derived from C57BL/10 mice when tested in tg66 transgenic mice, which expressed wild-type anchored human PrP at 8- to 16-fold above normal. Thus, the lack of the GPI anchor on the PrPres from tg44 mice appeared to reduce the effect of the mouse-human PrP species barrier. In contrast, neither source of prions induced disease in tgRM transgenic mice, which expressed human PrP at 2- to 4-fold above normal. Prion protein (PrP) is found in all mammals, usually attached to cells by an anchor molecule called GPI. Following prion infection, PrP is converted into a disease-associated form (PrPres). While most prion diseases are species specific, this finding is not consistent, and species barriers differ in strength. The amino acid sequence of PrP varies among species, and this variability affects prion species barriers. However, other PrP modifications, including glycosylation and GPI anchoring, may also influence cross-species infectivity. We studied the effect of PrP GPI anchoring using a mouse-to-human species barrier model. Experiments showed that prions produced by
Patterns of [PSI+] aggregation allow insights into cellular organization of yeast prion aggregates
Tyedmers, Jens
2012-01-01
The yeast prion phenomenon is very widespread and mounting evidence suggests that it has an impact on cellular regulatory mechanisms related to phenotypic responses to changing environments. Studying the aggregation patterns of prion amyloids during different stages of the prion life cycle is a first key step to understand major principles of how and where cells generate, organize and turn-over prion aggregates. The induction of the [PSI+] state involves the actin cytoskeleton and quality control compartments such as the Insoluble Protein Deposit (IPOD). An initially unstable transitional induction state can be visualized by overexpression of the prion determinant and displays characteristic large ring- and ribbon-shaped aggregates consisting of poorly fragmented bundles of very long prion fibrils. In the mature prion state, the aggregation pattern is characterized by highly fragmented, shorter prion fibrils that form aggregates, which can be visualized through tagging with fluorescent proteins. The number of aggregates formed varies, ranging from a single large aggregate at the IPOD to multiple smaller ones, depending on several parameters discussed. Aggregate units below the resolution of light microscopy that are detectable by fluorescence correlation spectroscopy are in equilibrium with larger aggregates in this stage and can mediate faithful inheritance of the prion state. Loss of the prion state is often characterized by reduced fragmentation of prion fibrils and fewer, larger aggregates. PMID:22449721
Comparative analysis of the prion protein gene sequences in African lion.
Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming
2006-10-01
The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.
Homma, Takujiro; Ishibashi, Daisuke; Nakagaki, Takehiro; Satoh, Katsuya; Sano, Kazunori; Atarashi, Ryuichiro; Nishida, Noriyuki
2014-03-28
Prion diseases are neurodegenerative disorders characterized by the aggregation of abnormally folded prion protein (PrP(Sc)). In this study, we focused on the mechanism of clearance of PrP(Sc), which remains unclear. p62 is a cytosolic protein known to mediate both the formation and degradation of aggregates of abnormal proteins. The levels of p62 protein increased in prion-infected brains and persistently infected cell cultures. Upon proteasome inhibition, p62 co-localized with PrP(Sc), forming a large aggregate in the perinuclear region, hereafter referred to as PrP(Sc)-aggresome. These aggregates were surrounded with autophagosome marker LC3 and lysosomes in prion-infected cells. Moreover, transient expression of the phosphomimic form of p62, which has enhanced ubiquitin-binding activity, reduced the amount of PrP(Sc) in prion-infected cells, indicating that the activation of p62 could accelerate the clearance of PrP(Sc). Our findings would thus suggest that p62 could be a target for the therapeutic control of prion diseases.
Sandberg, Malin K; Al-Doujaily, Huda; Sigurdson, Christina J; Glatzel, Markus; O'Malley, Catherine; Powell, Caroline; Asante, Emmanuel A; Linehan, Jacqueline M; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2010-10-01
Chronic wasting disease (CWD) is a prion disease that affects free-ranging and captive cervids, including mule deer, white-tailed deer, Rocky Mountain elk and moose. CWD-infected cervids have been reported in 14 USA states, two Canadian provinces and in South Korea. The possibility of a zoonotic transmission of CWD prions via diet is of particular concern in North America where hunting of cervids is a popular sport. To investigate the potential public health risks posed by CWD prions, we have investigated whether intracerebral inoculation of brain and spinal cord from CWD-infected mule deer transmits prion infection to transgenic mice overexpressing human prion protein with methionine or valine at polymorphic residue 129. These transgenic mice have been utilized in extensive transmission studies of human and animal prion disease and are susceptible to BSE and vCJD prions, allowing comparison with CWD. Here, we show that these mice proved entirely resistant to infection with mule deer CWD prions arguing that the transmission barrier associated with this prion strain/host combination is greater than that observed with classical BSE prions. However, it is possible that CWD may be caused by multiple prion strains. Further studies will be required to evaluate the transmission properties of distinct cervid prion strains as they are characterized.
Yeast prions: structure, biology, and prion-handling systems.
Wickner, Reed B; Shewmaker, Frank P; Bateman, David A; Edskes, Herman K; Gorkovskiy, Anton; Dayani, Yaron; Bezsonov, Evgeny E
2015-03-01
A prion is an infectious protein horizontally transmitting a disease or trait without a required nucleic acid. Yeast and fungal prions are nonchromosomal genes composed of protein, generally an altered form of a protein that catalyzes the same alteration of the protein. Yeast prions are thus transmitted both vertically (as genes composed of protein) and horizontally (as infectious proteins, or prions). Formation of amyloids (linear ordered β-sheet-rich protein aggregates with β-strands perpendicular to the long axis of the filament) underlies most yeast and fungal prions, and a single prion protein can have any of several distinct self-propagating amyloid forms with different biological properties (prion variants). Here we review the mechanism of faithful templating of protein conformation, the biological roles of these prions, and their interactions with cellular chaperones, the Btn2 and Cur1 aggregate-handling systems, and other cellular factors governing prion generation and propagation. Human amyloidoses include the PrP-based prion conditions and many other, more common amyloid-based diseases, several of which show prion-like features. Yeast prions increasingly are serving as models for the understanding and treatment of many mammalian amyloidoses. Patients with different clinical pictures of the same amyloidosis may be the equivalent of yeasts with different prion variants. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Immunology of Prion Protein and Prions.
Mabbott, Neil A
2017-01-01
Many natural prion diseases are acquired peripherally, such as following the oral consumption of contaminated food or pasture. After peripheral exposure many prion isolates initially accumulate to high levels within the host's secondary lymphoid tissues. The replication of prions within these tissues is essential for their efficient spread to the brain where they ultimately cause neurodegeneration. This chapter describes our current understanding of the critical tissues, cells, and molecules which the prions exploit to mediate their efficient propagation from the site of exposure (such as the intestine) to the brain. Interactions between the immune system and prions are not only restricted to the secondary lymphoid tissues. Therefore, an account of how the activation status of the microglial in the brain can also influence progression of prion disease pathogenesis is provided. Prion disease susceptibility may also be influenced by additional factors such as chronic inflammation, coinfection with other pathogens, and aging. Finally, the potential for immunotherapy to provide a means of safe and effective prophylactic or therapeutic intervention in these currently untreatable diseases is considered. © 2017 Elsevier Inc. All rights reserved.
Daus, Martin L
2016-01-04
In 1982, the term "prions" (proteinaceous infectious particles) was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE) was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid) can store and transmit information similarly to DNA was initially even denoted as being "heretical" but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the "protein-only hypothesis" expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
Role of Prion Protein Aggregation in Neurotoxicity
Directory of Open Access Journals (Sweden)
Tullio Florio
2012-07-01
Full Text Available In several neurodegenerative diseases, such as Parkinson, Alzheimer’s, Huntington, and prion diseases, the deposition of aggregated misfolded proteins is believed to be responsible for the neurotoxicity that characterizes these diseases. Prion protein (PrP, the protein responsible of prion diseases, has been deeply studied for the peculiar feature of its misfolded oligomers that are able to propagate within affected brains, inducing the conversion of the natively folded PrP into the pathological conformation. In this review, we summarize the available experimental evidence concerning the relationship between aggregation status of misfolded PrP and neuronal death in the course of prion diseases. In particular, we describe the main findings resulting from the use of different synthetic (mainly PrP106-126 and recombinant PrP-derived peptides, as far as mechanisms of aggregation and amyloid formation, and how these different spatial conformations can affect neuronal death. In particular, most data support the involvement of non-fibrillar oligomers rather than actual amyloid fibers as the determinant of neuronal death.
Directory of Open Access Journals (Sweden)
Samuel E Saunders
2011-04-01
Full Text Available Prion interactions with soil may play an important role in the transmission of chronic wasting disease (CWD and scrapie. Prions are known to bind to a wide range of soil surfaces, but the effects of adsorption solution chemistry and long-term soil binding on prion fate and transmission risk are unknown. We investigated HY TME prion protein (PrP(Sc adsorption to soil minerals in aqueous solutions of phosphate buffered saline (PBS, sodium chloride, calcium chloride, and deionized water using western blotting. The replication efficiency of bound prions following adsorption in these solutions was also evaluated by protein misfolding cyclic amplification (PMCA. Aging studies investigated PrP(Sc desorption and replication efficiency up to one year following adsorption in PBS or DI water. Results indicate that adsorption solution chemistry can affect subsequent prion replication or desorption ability, especially after incubation periods of 30 d or longer. Observed effects were minor over the short-term (7 d or less. Results of long-term aging experiments demonstrate that unbound prions or prions bound to a diverse range of soil surfaces can readily replicate after one year. Our results suggest that while prion-soil interactions can vary with solution chemistry, prions bound to soil could remain a risk for transmitting prion diseases after months in the environment.
Development of techniques in magnetic resonance and structural studies of the prion protein
Energy Technology Data Exchange (ETDEWEB)
Bitter, Hans-Marcus L. [Univ. of California, Berkeley, CA (United States)
2000-07-01
Magnetic resonance is the most powerful analytical tool used by chemists today. Its applications range from determining structures of large biomolecules to imaging of human brains. Nevertheless, magnetic resonance remains a relatively young field, in which many techniques are currently being developed that have broad applications. In this dissertation, two new techniques are presented, one that enables the determination of torsion angles in solid-state peptides and proteins, and another that involves imaging of heterogenous materials at ultra-low magnetic fields. In addition, structural studies of the prion protein via solid-state NMR are described. More specifically, work is presented in which the dependence of chemical shifts on local molecular structure is used to predict chemical shift tensors in solid-state peptides with theoretical ab initio surfaces. These predictions are then used to determine the backbone dihedral angles in peptides. This method utilizes the theoretical chemicalshift tensors and experimentally determined chemical-shift anisotropies (CSAs) to predict the backbone and side chain torsion angles in alanine, leucine, and valine residues. Additionally, structural studies of prion protein fragments are described in which conformationally-dependent chemical-shift measurements were made to gain insight into the structural differences between the various conformational states of the prion protein. These studies are of biological and pathological interest since conformational changes in the prion protein are believed to cause prion diseases. Finally, an ultra-low field magnetic resonance imaging technique is described that enables imaging and characterization of heterogeneous and porous media. The notion of imaging gases at ultra-low fields would appear to be very difficult due to the prohibitively low polarization and spin densities as well as the low sensitivities of conventional Faraday coil detectors. However, Chapter 5 describes how gas imaging
Race, Brent; Meade-White, Kimberly; Race, Richard; Baumann, Frank; Aguzzi, Adriano; Chesebro, Bruce
2009-01-01
Prion protein (PrP) is a host-encoded membrane-anchored glycoprotein which is required for susceptibility to prion disease. PrP may also be important for normal brain functions such as hippocampal spatial memory. Previously transgenic mice expressing amino terminally truncated mouse PrP (Δ32–134) spontaneously developed a fatal disease associated with degeneration of cerebellar granular neurons as well as vacuolar degeneration of deep cerebellar and brain stem white matter. This disease could...
Mapping of possible prion protein self interaction domains using peptide arrays
Rigter, A.; Langeveld, J.P.M.; Timmers-Parohi, D.; Jacobs, J.G.; Moonen, P.L.J.M.; Bossers, A.
2007-01-01
Background The common event in transmissible spongiform encephalopathies (TSEs) or prion diseases is the conversion of host-encoded protease sensitive cellular prion protein (PrPC) into strain dependent isoforms of scrapie associated protease resistant isoform (PrPSc) of prion protein (PrP). These
Molecular modeling of the conformational dynamics of the cellular prion protein
Nguyen, Charles; Colling, Ian; Bartz, Jason; Soto, Patricia
2014-03-01
Prions are infectious agents responsible for transmissible spongiform encephalopathies (TSEs), a type of fatal neurodegenerative disease in mammals. Prions propagate biological information by conversion of the non-pathological version of the prion protein to the infectious conformation, PrPSc. A wealth of knowledge has shed light on the nature and mechanism of prion protein conversion. In spite of the significance of this problem, we are far from fully understanding the conformational dynamics of the cellular isoform. To remedy this situation we employ multiple biomolecular modeling techniques such as docking and molecular dynamics simulations to map the free energy landscape and determine what specific regions of the prion protein are most conductive to binding. The overall goal is to characterize the conformational dynamics of the cell form of the prion protein, PrPc, to gain insight into inhibition pathways against misfolding. NE EPSCoR FIRST Award to Patricia Soto.
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Directory of Open Access Journals (Sweden)
Djamel Harbi
Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic
PrionHome: a database of prions and other sequences relevant to prion phenomena.
Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M
2012-01-01
Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing
Wadsworth, Jonathan D F; Joiner, Susan; Linehan, Jacqueline M; Balkema-Buschmann, Anne; Spiropoulos, John; Simmons, Marion M; Griffiths, Peter C; Groschup, Martin H; Hope, James; Brandner, Sebastian; Asante, Emmanuel A; Collinge, John
2013-11-01
Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants.
Directory of Open Access Journals (Sweden)
Martin L. Daus
2016-01-01
Full Text Available In 1982, the term “prions” (proteinaceous infectious particles was coined to specify a new principle of infection. A misfolded isoform of a cellular protein has been described as the causative agent of a fatal neurodegenerative disease. At the beginning of prion research scientists assumed that the infectious agent causing transmissible spongiform encephalopathy (TSE was a virus, but some unconventional properties of these pathogens were difficult to bring in line with the prevailing viral model. The discovery that prions (obviously devoid of any coding nucleic acid can store and transmit information similarly to DNA was initially even denoted as being “heretical” but is nowadays mainly accepted by the scientific community. This review describes, from a historical point of view, how the “protein-only hypothesis” expands the Central Dogma. Definition of both, the prion principle and the Central Dogma, have been essential steps to understand information storage and transfer within and among cells and organisms. Furthermore, the current understanding of the infectivity of prion-proteins after misfolding is summarized succinctly. Finally, prion-like amyloids and functional amyloids, as found in yeast and bacteria, will be discussed.
Prion protein self-interaction in prion disease therapy approaches
Rigter, A.; Priem, J.; Langeveld, J.P.M.; Bossers, A.
2011-01-01
Transmissible spongiform encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seem to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.
Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L
2001-04-06
The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
Strain-dependent profile of misfolded prion protein aggregates.
Morales, Rodrigo; Hu, Ping Ping; Duran-Aniotz, Claudia; Moda, Fabio; Diaz-Espinoza, Rodrigo; Chen, Baian; Bravo-Alegria, Javiera; Makarava, Natallia; Baskakov, Ilia V; Soto, Claudio
2016-02-15
Prions are composed of the misfolded prion protein (PrP(Sc)) organized in a variety of aggregates. An important question in the prion field has been to determine the identity of functional PrP(Sc) aggregates. In this study, we used equilibrium sedimentation in sucrose density gradients to separate PrP(Sc) aggregates from three hamster prion strains (Hyper, Drowsy, SSLOW) subjected to minimal manipulations. We show that PrP(Sc) aggregates distribute in a wide range of arrangements and the relative proportion of each species depends on the prion strain. We observed a direct correlation between the density of the predominant PrP(Sc) aggregates and the incubation periods for the strains studied. The relative presence of PrP(Sc) in fractions of different sucrose densities was indicative of the protein deposits present in the brain as analyzed by histology. Interestingly, no association was found between sensitivity to proteolytic degradation and aggregation profiles. Therefore, the organization of PrP molecules in terms of the density of aggregates generated may determine some of the particular strain properties, whereas others are independent from it. Our findings may contribute to understand the mechanisms of strain variation and the role of PrP(Sc) aggregates in prion-induced neurodegeneration.
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Torres, Juan-María; Andréoletti, Olivier; Lacroux, Caroline; Prieto, Irene; Lorenzo, Patricia; Larska, Magdalena; Baron, Thierry; Espinosa, Juan-Carlos
2011-01-01
Bovine spongiform encephalopathy (BSE) and BSErelated disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profi les of abnormal protease-resistant prion protein (PrPres), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molec...
Leske, Henning; Hornemann, Simone; Herrmann, Uli Simon; Zhu, Caihong; Dametto, Paolo; Li, Bei; Laferriere, Florent; Polymenidou, Magdalini; Pelczar, Pawel; Reimann, Regina Rose; Schwarz, Petra; Rushing, Elisabeth Jane; Wüthrich, Kurt; Aguzzi, Adriano
2017-01-01
Resistance to proteolytic digestion has long been considered a defining trait of prions in tissues of organisms suffering from transmissible spongiform encephalopathies. Detection of proteinase K-resistant prion protein (PrPSc) still represents the diagnostic gold standard for prion diseases in humans, sheep and cattle. However, it has become increasingly apparent that the accumulation of PrPSc does not always accompany prion infections: high titers of prion infectivity can be reached also in the absence of protease resistant PrPSc. Here, we describe a structural basis for the phenomenon of protease-sensitive prion infectivity. We studied the effect on proteinase K (PK) resistance of the amino acid substitution Y169F, which removes a single oxygen atom from the β2-α2 loop of the cellular prion protein (PrPC). When infected with RML or the 263K strain of prions, transgenic mice lacking wild-type (wt) PrPC but expressing MoPrP169F generated prion infectivity at levels comparable to wt mice. The newly generated MoPrP169F prions were biologically indistinguishable from those recovered from prion-infected wt mice, and elicited similar pathologies in vivo. Surprisingly, MoPrP169F prions showed greatly reduced PK resistance and density gradient analyses showed a significant reduction in high-density aggregates. Passage of MoPrP169F prions into mice expressing wt MoPrP led to full recovery of protease resistance, indicating that no strain shift had taken place. We conclude that a subtle structural variation in the β2-α2 loop of PrPC affects the sensitivity of PrPSc to protease but does not impact prion replication and infectivity. With these findings a specific structural feature of PrPC can be linked to a physicochemical property of the corresponding PrPSc.
Energy Technology Data Exchange (ETDEWEB)
Douma, M.D.; Kerr, G.M.; Brown, R.S.; Keller, B.O.; Oleschuk, R.D. [Queen' s Univ., Kingston, ON (Canada). Dept. of Chemistry
2008-08-15
This paper presented a filtration method for detecting protein traces in non-aqueous media. The extraction technique used a mixture of acetonitrile, non-ionic detergent and water along with filter disks with embedded C{sub 8}-modified silica particles to capture the proteins from non-aqueous samples. The extraction process was then followed by an elution of the protein from the filter disk and direct mass spectrometric detection and tryptic digestion with peptide mapping and MS/MS fragmentation of protein-specific peptides. The method was used to detect prion proteins in spiked biodiesel samples. A tryptic peptide with the sequence YGQGSPGGNR was used for unambiguous identification. Results of the study showed that the method is suitable for the large-scale testing of protein impurities in tallow-based biodiesel production processes. 33 refs., 6 figs.
Ito, Yoko; Sanjo, Nobuo; Hizume, Masaki; Kobayashi, Atsushi; Ohgami, Tetsuya; Satoh, Katsuya; Hamaguchi, Tsuyoshi; Yamada, Masahito; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro; Yokota, Takanori
2018-02-19
Valine-to-isoleucine substitution at codon 180 of the prion protein gene is only observed in patients with Creutzfeldt-Jakob disease and accounts for approximately half of all cases of genetic prion disease in Japan. In the present study, we investigated the biochemical characteristics of valine-to-isoleucine substitution at codon 180 in the prion protein gene, using samples obtained from the autopsied brains of seven patients with genetic Creutzfeldt-Jakob disease exhibiting this mutation (diagnoses confirmed via neuropathological examination). Among these patients, we observed an absence of diglycosylated and monoglycosylated forms of PrP res at codon 181. Our findings further indicated that the abnormal prion proteins were composed of at least three components, although smaller carboxyl-terminal fragments were predominant. Western blot analyses revealed large amounts of PrP res in the cerebral neocortices, where neuropathological examination revealed marked spongiosis. Relatively smaller amounts of PrP res were detected in the hippocampus, where milder spongiosis was observed, than in the cerebral neocortex. These findings indicate that abnormal prion proteins in the neocortex are associated with severe toxicity, resulting in severe spongiosis. Our findings further indicate that the valine-to-isoleucine substitution is not a polymorphism, but rather an authentic pathogenic mutation associated with specific biochemical characteristics that differ from those observed in sporadic Creutzfeldt-Jakob disease. Copyright © 2018 Elsevier Inc. All rights reserved.
Nyström, Sofie; Hammarström, Per
2015-05-11
Prion diseases are lethal, infectious diseases associated with prion protein (PrP) misfolding. A large number of mammals are susceptible to both sporadic and acquired prion diseases. Although PrP is highly conserved and ubiquitously expressed in all mammals, not all species exhibit prion disease. By employing full length recombinant PrP from five known prion susceptible species (human, cattle, cat, mouse and hamster) and two species considered to be prion resistant (pig and dog) the amyloidogenicity of these PrPs has been delineated. All the mammalian PrPs, even from resistant species, were swiftly converted from the native state to amyloid-like structure when subjected to a native condition conversion assay. The PrPs displayed amyloidotypic tinctorial and ultrastructural hallmarks. Self-seeded conversion of the PrPs displayed significantly decreased lag phases demonstrating that nucleation dependent polymerization is a dominating mechanism in the fibrillation process. Fibrils from Aβ1-40, Aβ1-42, Lysozyme, Insulin and Transthyretin did not accelerate conversion of HuPrP whereas fibrils from HuPrP90-231 and HuPrP121-231 as well as full length PrPs of all PrPs efficiently seeded conversion showing specificity of the assay requiring the C-terminal PrP sequence. Our findings have implications for PrP misfolding and could have ramifications in the context of prion resistant species and silent carriers.
Quinacrine reactivity with prion proteins and prion-derived peptides
Czech Academy of Sciences Publication Activity Database
Zawada, Zbigniew; Šafařík, Martin; Dvořáková, E.; Janoušková, O.; Březinová, Anna; Stibor, Ivan; Holada, K.; Bouř, Petr; Hlaváček, Jan; Šebestík, Jaroslav
2013-01-01
Roč. 44, č. 5 (2013), s. 1279-1292 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional support: RVO:61388963 Keywords : quinacrine * prion protein and peptide model reactions * solid phase and recombinant synthesis Subject RIV: CE - Biochemistry Impact factor: 3.653, year: 2013
Yeast prion architecture explains how proteins can be genes
Wickner, Reed
2013-03-01
Prions (infectious proteins) transmit information without an accompanying DNA or RNA. Most yeast prions are self-propagating amyloids that inactivate a normally functional protein. A single protein can become any of several prion variants, with different manifestations due to different amyloid structures. We showed that the yeast prion amyloids of Ure2p, Sup35p and Rnq1p are folded in-register parallel beta sheets using solid state NMR dipolar recoupling experiments, mass-per-filament-length measurements, and filament diameter measurements. The extent of beta sheet structure, measured by chemical shifts in solid-state NMR and acquired protease-resistance on amyloid formation, combined with the measured filament diameters, imply that the beta sheets must be folded along the long axis of the filament. We speculate that prion variants of a single protein sequence differ in the location of these folds. Favorable interactions between identical side chains must hold these structures in-register. The same interactions must guide an unstructured monomer joining the end of a filament to assume the same conformation as molecules already in the filament, with the turns at the same locations. In this way, a protein can template its own conformation, in analogy to the ability of a DNA molecule to template its sequence by specific base-pairing. Bldg. 8, Room 225, NIH, 8 Center Drive MSC 0830, Bethesda, MD 20892-0830, wickner@helix.nih.gov, 301-496-3452
Directory of Open Access Journals (Sweden)
Aya Kojima
2014-05-01
Full Text Available Prions are the cause of neurodegenerative disease in humans and other mammals. The structural conversion of the prion protein (PrP from a normal cellular protein (PrPC to a protease-resistant isoform (PrPSc is thought to relate to Cu2+ binding to histidine residues. In this study, we focused on the membrane-type matrix metalloproteinases (MT-MMPs such as MT1-MMP and MT3-MMP, which are expressed in the brain as PrPC-degrading proteases. We synthesized 21 prion fragment peptides. Each purified peptide was individually incubated with recombinant MT1-MMP or MT3-MMP in the presence or absence of Cu2+ and the cleavage sites determined by LC-ESI-MS analysis. Recombinant MMP-7 and human serum (HS were also tested as control. hPrP61-90, from the octapeptide-repeat region, was cleaved by HS but not by the MMPs tested here. On the other hand, hPrP92-168 from the central region was cleaved by MT1-MMP and MT3-MMP at various sites. These cleavages were inhibited by treatment with Cu2+. The C-terminal peptides had higher resistance than the central region. The data obtained from this study suggest that MT-MMPs expressed in the brain might possess PrPC-degrading activity.
Jansen, Casper; Parchi, Piero; Capellari, Sabina; Vermeij, Ad J.; Corrado, Patrizia; Baas, Frank; Strammiello, Rosaria; van Gool, Willem A.; van Swieten, John C.; Rozemuller, Annemieke J. M.
2010-01-01
Stop codon mutations in the gene encoding the prion protein (PRNP) are very rare and have thus far only been described in two patients with prion protein cerebral amyloid angiopathy (PrP-CAA). In this report, we describe the clinical, histopathological and pathological prion protein (PrPSc)
Watts, Joel C; Giles, Kurt; Stöhr, Jan; Oehler, Abby; Bhardwaj, Sumita; Grillo, Sunny K; Patel, Smita; DeArmond, Stephen J; Prusiner, Stanley B
2012-02-28
Currently, there are no animal models of the most common human prion disorder, sporadic Creutzfeldt-Jakob disease (CJD), in which prions are formed spontaneously from wild-type (WT) prion protein (PrP). Interestingly, bank voles (BV) exhibit an unprecedented promiscuity for diverse prion isolates, arguing that bank vole PrP (BVPrP) may be inherently prone to adopting misfolded conformations. Therefore, we constructed transgenic (Tg) mice expressing WT BVPrP. Tg(BVPrP) mice developed spontaneous CNS dysfunction between 108 and 340 d of age and recapitulated the hallmarks of prion disease, including spongiform degeneration, pronounced astrogliosis, and deposition of alternatively folded PrP in the brain. Brain homogenates of ill Tg(BVPrP) mice transmitted disease to Tg(BVPrP) mice in ∼35 d, to Tg mice overexpressing mouse PrP in under 100 d, and to WT mice in ∼185 d. Our studies demonstrate experimentally that WT PrP can spontaneously form infectious prions in vivo. Thus, Tg(BVPrP) mice may be useful for studying the spontaneous formation of prions, and thus may provide insight into the etiology of sporadic CJD.
Do prion protein gene polymorphisms induce apoptosis in non ...
Indian Academy of Sciences (India)
2016-08-26
Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...
Classifying prion and prion-like phenomena.
Harbi, Djamel; Harrison, Paul M
2014-01-01
The universe of prion and prion-like phenomena has expanded significantly in the past several years. Here, we overview the challenges in classifying this data informatically, given that terms such as "prion-like", "prion-related" or "prion-forming" do not have a stable meaning in the scientific literature. We examine the spectrum of proteins that have been described in the literature as forming prions, and discuss how "prion" can have a range of meaning, with a strict definition being for demonstration of infection with in vitro-derived recombinant prions. We suggest that although prion/prion-like phenomena can largely be apportioned into a small number of broad groups dependent on the type of transmissibility evidence for them, as new phenomena are discovered in the coming years, a detailed ontological approach might be necessary that allows for subtle definition of different "flavors" of prion / prion-like phenomena.
The tip of the iceberg: RNA-binding proteins with prion-like domains in neurodegenerative disease
King, Oliver D.; Gitler, Aaron D.; Shorter, James
2012-01-01
Prions are self-templating protein conformers that are naturally transmitted between individuals and promote phenotypic change. In yeast, prion-encoded phenotypes can be beneficial, neutral or deleterious depending upon genetic background and environmental conditions. A distinctive and portable ‘prion domain’ enriched in asparagine, glutamine, tyrosine and glycine residues unifies the majority of yeast prion proteins. Deletion of this domain precludes prionogenesis and appending this domain to reporter proteins can confer prionogenicity. An algorithm designed to detect prion domains has successfully identified 19 domains that can confer prion behavior. Scouring the human genome with this algorithm enriches a select group of RNA-binding proteins harboring a canonical RNA recognition motif (RRM) and a putative prion domain. Indeed, of 210 human RRM-bearing proteins, 29 have a putative prion domain, and 12 of these are in the top 60 prion candidates in the entire genome. Startlingly, these RNA-binding prion candidates are inexorably emerging, one by one, in the pathology and genetics of devastating neurodegenerative disorders, including: amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U), Alzheimer’s disease and Huntington’s disease. For example, FUS and TDP-43, which rank 1st and 10th among RRM-bearing prion candidates, form cytoplasmic inclusions in the degenerating motor neurons of ALS patients and mutations in TDP-43 and FUS cause familial ALS. Recently, perturbed RNA-binding proteostasis of TAF15, which is the 2nd ranked RRM-bearing prion candidate, has been connected with ALS and FTLD-U. We strongly suspect that we have now merely reached the tip of the iceberg. We predict that additional RNA-binding prion candidates identified by our algorithm will soon surface as genetic modifiers or causes of diverse neurodegenerative conditions. Indeed, simple prion-like transfer mechanisms involving the
Probing Early Misfolding Events in Prion Protein Mutants by NMR Spectroscopy
Directory of Open Access Journals (Sweden)
Gregor Ilc
2013-08-01
Full Text Available The post-translational conversion of the ubiquitously expressed cellular form of the prion protein, PrPC, into its misfolded and pathogenic isoform, known as prion or PrPSc, plays a key role in prion diseases. These maladies are denoted transmissible spongiform encephalopathies (TSEs and affect both humans and animals. A prerequisite for understanding TSEs is unraveling the molecular mechanism leading to the conversion process whereby most α-helical motifs are replaced by β-sheet secondary structures. Importantly, most point mutations linked to inherited prion diseases are clustered in the C-terminal domain region of PrPC and cause spontaneous conversion to PrPSc. Structural studies with PrP variants promise new clues regarding the proposed conversion mechanism and may help identify “hot spots” in PrPC involved in the pathogenic conversion. These investigations may also shed light on the early structural rearrangements occurring in some PrPC epitopes thought to be involved in modulating prion susceptibility. Here we present a detailed overview of our solution-state NMR studies on human prion protein carrying different pathological point mutations and the implications that such findings may have for the future of prion research.
Prion protein induced signaling cascades in monocytes
International Nuclear Information System (INIS)
Krebs, Bjarne; Dorner-Ciossek, Cornelia; Schmalzbauer, Ruediger; Vassallo, Neville; Herms, Jochen; Kretzschmar, Hans A.
2006-01-01
Prion proteins play a central role in transmission and pathogenesis of transmissible spongiform encephalopathies. The cellular prion protein (PrP C ), whose physiological function remains elusive, is anchored to the surface of a variety of cell types including neurons and cells of the lymphoreticular system. In this study, we investigated the response of a mouse monocyte/macrophage cell line to exposure with PrP C fusion proteins synthesized with a human Fc-tag. PrP C fusion proteins showed an attachment to the surface of monocyte/macrophages in nanomolar concentrations. This was accompanied by an increase of cellular tyrosine phosphorylation as a result of activated signaling pathways. Detailed investigations exhibited activation of downstream pathways through a stimulation with PrP fusion proteins, which include phosphorylation of ERK 1,2 and Akt kinase. Macrophages opsonize and present antigenic structures, contact lymphocytes, and deliver cytokines. The findings reported here may become the basis of understanding the molecular function of PrP C in monocytes and macrophages
Prion search and cellular prion protein expression in stranded dolphins.
Di Guardo, G; Cocumelli, C; Meoli, R; Barbaro, K; Terracciano, G; Di Francesco, C E; Mazzariol, S; Eleni, C
2012-01-01
The recent description of a prion disease (PD) case in a free-ranging bottlenose dolphin (Tursiops truncatus) prompted us to carry out an extensive search for the disease-associated isoform (PrPSc) of the cellular prion protein (PrPC) in the brain and in a range of lymphoid tissues from 23 striped dolphins (Stenella coeruleoalba), 5 bottlenose dolphins and 2 Risso s dolphins (Grampus griseus) found stranded between 2007 and 2012 along the Italian coastline. Three striped dolphins and one bottlenose dolphin showed microscopic lesions of encephalitis, with no evidence of spongiform brain lesions being detected in any of the 30 free-ranging cetaceans investigated herein. Nevertheless, we could still observe a prominent PrPC immunoreactivity in the brain as well as in lymphoid tissues from these dolphins. Although immunohistochemical and Western blot investigations yielded negative results for PrPSc deposition in all tissues from the dolphins under study, the reported occurrence of a spontaneous PD case in a wild dolphin is an intriguing issue and a matter of concern for both prion biology and intra/inter-species transmissibility, as well as for cetacean conservation medicine.
Joiner, Susan; Asante, Emmanuel A; Linehan, Jacqueline M; Brock, Lara; Brandner, Sebastian; Bellworthy, Susan J; Simmons, Marion M; Hope, James; Collinge, John; Wadsworth, Jonathan D F
2018-03-15
The epizootic prion disease of cattle, bovine spongiform encephalopathy (BSE), causes variant Creutzfeldt-Jakob disease (vCJD) in humans following dietary exposure. While it is assumed that all cases of vCJD attributed to a dietary aetiology are related to cattle BSE, sheep and goats are susceptible to experimental oral challenge with cattle BSE prions and farmed animals in the UK were undoubtedly exposed to BSE-contaminated meat and bone meal during the late 1980s and early 1990s. Although no natural field cases of sheep BSE have been identified, it cannot be excluded that some BSE-infected sheep might have entered the European human food chain. Evaluation of the zoonotic potential of sheep BSE prions has been addressed by examining the transmission properties of experimental brain isolates in transgenic mice that express human prion protein, however to-date there have been relatively few studies. Here we report that serial passage of experimental sheep BSE prions in transgenic mice expressing human prion protein with methionine at residue 129 produces the vCJD phenotype that mirrors that seen when the same mice are challenged with vCJD prions from patient brain. These findings are congruent with those reported previously by another laboratory, and thereby strongly reinforce the view that sheep BSE prions could have acted as a causal agent of vCJD within Europe. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Asante, Emmanuel A; Linehan, Jacqueline M; Smidak, Michelle; Tomlinson, Andrew; Grimshaw, Andrew; Jeelani, Asif; Jakubcova, Tatiana; Hamdan, Shyma; Powell, Caroline; Brandner, Sebastian; Wadsworth, Jonathan D F; Collinge, John
2013-01-01
Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP) gene (PRNP) and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS) caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc)), pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((Ctm)PrP). Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc) was demonstrated in the brains of recipient transgenic mice. This PrP(Sc) rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (Ctm)PrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Directory of Open Access Journals (Sweden)
Emmanuel A Asante
Full Text Available Prions are infectious agents causing fatal neurodegenerative diseases of humans and animals. In humans, these have sporadic, acquired and inherited aetiologies. The inherited prion diseases are caused by one of over 30 coding mutations in the human prion protein (PrP gene (PRNP and many of these generate infectious prions as evidenced by their experimental transmissibility by inoculation to laboratory animals. However, some, and in particular an extensively studied type of Gerstmann-Sträussler-Scheinker syndrome (GSS caused by a PRNP A117V mutation, are thought not to generate infectious prions and instead constitute prion proteinopathies with a quite distinct pathogenetic mechanism. Multiple attempts to transmit A117V GSS have been unsuccessful and typical protease-resistant PrP (PrP(Sc, pathognomonic of prion disease, is not detected in brain. Pathogenesis is instead attributed to production of an aberrant topological form of PrP, C-terminal transmembrane PrP ((CtmPrP. Barriers to transmission of prion strains from one species to another appear to relate to structural compatibility of PrP in host and inoculum and we have therefore produced transgenic mice expressing human 117V PrP. We found that brain tissue from GSS A117V patients did transmit disease to these mice and both the neuropathological features of prion disease and presence of PrP(Sc was demonstrated in the brains of recipient transgenic mice. This PrP(Sc rapidly degraded during laboratory analysis, suggesting that the difficulty in its detection in patients with GSS A117V could relate to post-mortem proteolysis. We conclude that GSS A117V is indeed a prion disease although the relative contributions of (CtmPrP and prion propagation in neurodegeneration and their pathogenetic interaction remains to be established.
Prion protein accumulation in lipid rafts of mouse aging brain.
Directory of Open Access Journals (Sweden)
Federica Agostini
Full Text Available The cellular form of the prion protein (PrP(C is a normal constituent of neuronal cell membranes. The protein misfolding causes rare neurodegenerative disorders known as transmissible spongiform encephalopathies or prion diseases. These maladies can be sporadic, genetic or infectious. Sporadic prion diseases are the most common form mainly affecting aging people. In this work, we investigate the biochemical environment in which sporadic prion diseases may develop, focusing our attention on the cell membrane of neurons in the aging brain. It is well established that with aging the ratio between the most abundant lipid components of rafts undergoes a major change: while cholesterol decreases, sphingomyelin content rises. Our results indicate that the aging process modifies the compartmentalization of PrP(C. In old mice, this change favors PrP(C accumulation in detergent-resistant membranes, particularly in hippocampi. To confirm the relationship between lipid content changes and PrP(C translocation into detergent-resistant membranes (DRMs, we looked at PrP(C compartmentalization in hippocampi from acid sphingomyelinase (ASM knockout (KO mice and synaptosomes enriched in sphingomyelin. In the presence of high sphingomyelin content, we observed a significant increase of PrP(C in DRMS. This process is not due to higher levels of total protein and it could, in turn, favor the onset of sporadic prion diseases during aging as it increases the PrP intermolecular contacts into lipid rafts. We observed that lowering sphingomyelin in scrapie-infected cells by using fumonisin B1 led to a 50% decrease in protease-resistant PrP formation. This may suggest an involvement of PrP lipid environment in prion formation and consequently it may play a role in the onset or development of sporadic forms of prion diseases.
Prions, prion-like prionoids, and neurodegenerative disordersVacancy
Directory of Open Access Journals (Sweden)
Ashok Verma
2016-01-01
Full Text Available Prion diseases or transmissible spongiform encephalopathies are fatal neurodegenerative diseases characterized by the aggregation and deposition of the misfolded prion protein in the brain. α-synuclein (α-syn-associated multiple system atrophy has been recently shown to be caused by a bona fide α-syn prion strain. Several other misfolded native proteins such as β-amyloid, tau and TDP-43 share some aspects of prions although none of them is shown to be transmissible in nature or in experimental animals. However, these prion-like “prionoids” are causal to a variety of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis. The remarkable recent discovery of at least two new α-syn prion strains and their transmissibility in transgenic mice and in vitro cell models raises a distinct question as to whether some specific strain of other prionoids could have the capability of disease transmission in a manner similar to prions. In this overview, we briefly describe human and other mammalian prion diseases and comment on certain similarities between prion and prionoid and the possibility of prion-like transmissibility of some prionoid strains.
International Nuclear Information System (INIS)
Abskharon, Romany N. N.; Soror, Sameh H.; Pardon, Els; El Hassan, Hassan; Legname, Giuseppe; Steyaert, Jan; Wohlkonig, Alexandre
2010-01-01
The crystallization of a specific nanobody against mouse PrP C and preliminary diffraction analysis of a crystal that diffracted to 1.23 Å resolution are presented. Prion disorders are infectious diseases that are characterized by the conversion of the cellular prion protein PrP C into the pathogenic isoform PrP Sc . Specific antibodies that interact with the cellular prion protein have been shown to inhibit this transition. Recombinant VHHs (variable domain of dromedary heavy-chain antibodies) or nanobodies are single-domain antibodies, making them the smallest antigen-binding fragments. A specific nanobody (Nb-PrP-01) was raised against mouse PrP C . A crystallization condition for this recombinant nanobody was identified using high-throughput screening. The crystals were optimized using streak-seeding and the hanging-drop method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 30.04, b = 37.15, c = 83.00 Å, and diffracted to 1.23 Å resolution using synchrotron radiation. The crystal structure of this specific nanobody against PrP C together with the known PrP C structure may help in understanding the PrP C /PrP Sc transition mechanism
Destabilization and recovery of a yeast prion after mild heat shock.
Newnam, Gary P; Birchmore, Jennifer L; Chernoff, Yury O
2011-05-06
Yeast prion [PSI(+)] is a self-perpetuating amyloid of the translational termination factor Sup35. Although [PSI(+)] propagation is modulated by heat shock proteins (Hsps), high temperature was previously reported to have little or no effect on [PSI(+)]. Our results show that short-term exposure of exponentially growing yeast culture to mild heat shock, followed by immediate resumption of growth, leads to [PSI(+)] destabilization, sometimes persisting for several cell divisions after heat shock. Prion loss occurring in the first division after heat shock is preferentially detected in a daughter cell, indicating the impairment of prion segregation that results in asymmetric prion distribution between a mother cell and a bud. Longer heat shock or prolonged incubation in the absence of nutrients after heat shock led to [PSI(+)] recovery. Both prion destabilization and recovery during heat shock depend on protein synthesis. Maximal prion destabilization coincides with maximal imbalance between Hsp104 and other Hsps such as Hsp70-Ssa. Deletions of individual SSA genes increase prion destabilization and/or counteract recovery. The dynamics of prion aggregation during destabilization and recovery are consistent with the notion that efficient prion fragmentation and segregation require a proper balance between Hsp104 and other (e.g., Hsp70-Ssa) chaperones. In contrast to heat shock, [PSI(+)] destabilization by osmotic stressors does not always depend on cell proliferation and/or protein synthesis, indicating that different stresses may impact the prion via different mechanisms. Our data demonstrate that heat stress causes asymmetric prion distribution in a cell division and confirm that the effects of Hsps on prions are physiologically relevant. Copyright © 2011 Elsevier Ltd. All rights reserved.
Prion Protein-specific antibodies that detect multiple TSE Agents with high sensitivity
McCutcheon, S.; Langeveld, J.P.M.; Tan, B.C.; Gill, A.C.; Wolf, de C.A.; Martin, S.; Gonzalez, L.; Alibhai, J.; Alejo Blanco, A.R.; Campbell, L.; Hunter, N.; Houston, E.F.
2014-01-01
This paper describes the generation, characterisation and potential applications of a panel of novel anti-prion protein monoclonal antibodies (mAbs). The mAbs were generated by immunising PRNP null mice, using a variety of regimes, with a truncated form of recombinant ovine prion protein spanning
The first report of prion-related protein gene (PRNT) polymorphisms in goat.
Kim, Yong-Chan; Jeong, Byung-Hoon
2017-06-01
Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.
The Prion Concept and Synthetic Prions.
Legname, Giuseppe; Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies or prion diseases are a group of fatal neurodegenerative diseases caused by unconventional infectious agents, known as prions (PrP Sc ). Prions derive from a conformational conversion of the normally folded prion protein (PrP C ), which acquires pathological and infectious features. Moreover, PrP Sc is able to transmit the pathological conformation to PrP C through a mechanism that is still not well understood. The generation of synthetic prions, which behave like natural prions, is of fundamental importance to study the process of PrP C conversion and to assess the efficacy of therapeutic strategies to interfere with this process. Moreover, the ability of synthetic prions to induce pathology in animals confirms that the pathological properties of the prion strains are all enciphered in abnormal conformations, characterizing these infectious agents. © 2017 Elsevier Inc. All rights reserved.
PrionScan: an online database of predicted prion domains in complete proteomes.
Espinosa Angarica, Vladimir; Angulo, Alfonso; Giner, Arturo; Losilla, Guillermo; Ventura, Salvador; Sancho, Javier
2014-02-05
Prions are a particular type of amyloids related to a large variety of important processes in cells, but also responsible for serious diseases in mammals and humans. The number of experimentally characterized prions is still low and corresponds to a handful of examples in microorganisms and mammals. Prion aggregation is mediated by specific protein domains with a remarkable compositional bias towards glutamine/asparagine and against charged residues and prolines. These compositional features have been used to predict new prion proteins in the genomes of different organisms. Despite these efforts, there are only a few available data sources containing prion predictions at a genomic scale. Here we present PrionScan, a new database of predicted prion-like domains in complete proteomes. We have previously developed a predictive methodology to identify and score prionogenic stretches in protein sequences. In the present work, we exploit this approach to scan all the protein sequences in public databases and compile a repository containing relevant information of proteins bearing prion-like domains. The database is updated regularly alongside UniprotKB and in its present version contains approximately 28000 predictions in proteins from different functional categories in more than 3200 organisms from all the taxonomic subdivisions. PrionScan can be used in two different ways: database query and analysis of protein sequences submitted by the users. In the first mode, simple queries allow to retrieve a detailed description of the properties of a defined protein. Queries can also be combined to generate more complex and specific searching patterns. In the second mode, users can submit and analyze their own sequences. It is expected that this database would provide relevant insights on prion functions and regulation from a genome-wide perspective, allowing researches performing cross-species prion biology studies. Our database might also be useful for guiding experimentalists
Directory of Open Access Journals (Sweden)
Maxime Belondrade
Full Text Available The prevalence of variant Creutzfeldt-Jakob disease (vCJD in the population remains uncertain, although it has been estimated that 1 in 2000 people in the United Kingdom are positive for abnormal prion protein (PrPTSE by a recent survey of archived appendix tissues. The prominent lymphotropism of vCJD prions raises the possibility that some surgical procedures may be at risk of iatrogenic vCJD transmission in healthcare facilities. It is therefore vital that decontamination procedures applied to medical devices before their reprocessing are thoroughly validated. A current limitation is the lack of a rapid model permissive to human prions. Here, we developed a prion detection assay based on protein misfolding cyclic amplification (PMCA technology combined with stainless-steel wire surfaces as carriers of prions (Surf-PMCA. This assay allowed the specific detection of minute quantities (10-8 brain dilution of either human vCJD or ovine scrapie PrPTSE adsorbed onto a single steel wire, within a two week timeframe. Using Surf-PMCA we evaluated the performance of several reference and commercially available prion-specific decontamination procedures. Surprisingly, we found the efficiency of several marketed reagents to remove human vCJD PrPTSE was lower than expected. Overall, our results demonstrate that Surf-PMCA can be used as a rapid and ultrasensitive assay for the detection of human vCJD PrPTSE adsorbed onto a metallic surface, therefore facilitating the development and validation of decontamination procedures against human prions.
Directory of Open Access Journals (Sweden)
Laura McCulloch
2011-12-01
Full Text Available Prion diseases are characterised by the accumulation of PrP(Sc, an abnormally folded isoform of the cellular prion protein (PrP(C, in affected tissues. Following peripheral exposure high levels of prion-specific PrP(Sc accumulate first upon follicular dendritic cells (FDC in lymphoid tissues before spreading to the CNS. Expression of PrP(C is mandatory for cells to sustain prion infection and FDC appear to express high levels. However, whether FDC actively replicate prions or simply acquire them from other infected cells is uncertain. In the attempts to-date to establish the role of FDC in prion pathogenesis it was not possible to dissociate the Prnp expression of FDC from that of the nervous system and all other non-haematopoietic lineages. This is important as FDC may simply acquire prions after synthesis by other infected cells. To establish the role of FDC in prion pathogenesis transgenic mice were created in which PrP(C expression was specifically "switched on" or "off" only on FDC. We show that PrP(C-expression only on FDC is sufficient to sustain prion replication in the spleen. Furthermore, prion replication is blocked in the spleen when PrP(C-expression is specifically ablated only on FDC. These data definitively demonstrate that FDC are the essential sites of prion replication in lymphoid tissues. The demonstration that Prnp-ablation only on FDC blocked splenic prion accumulation without apparent consequences for FDC status represents a novel opportunity to prevent neuroinvasion by modulation of PrP(C expression on FDC.
Humic substances interfere with detection of pathogenic prion protein
Smith, Christen B.; Booth, Clarissa J.; Wadzinski, Tyler J.; Legname, Giuseppe; Chappell, Rick; Johnson, Christopher J.; Pedersen, Joel A.
2014-01-01
Studies examining the persistence of prions (the etiological agent of transmissible spongiform encephalopathies) in soil require accurate quantification of pathogenic prion protein (PrPTSE) extracted from or in the presence of soil particles. Here, we demonstrate that natural organic matter (NOM) in soil impacts PrPTSE detection by immunoblotting. Methods commonly used to extract PrPTSE from soils release substantial amounts of NOM, and NOM inhibited PrPTSE immunoblot signal. The degree of immunoblot interference increased with increasing NOM concentration and decreasing NOM polarity. Humic substances affected immunoblot detection of prion protein from both deer and hamsters. We also establish that after interaction with humic acid, PrPTSE remains infectious to hamsters inoculated intracerebrally, and humic acid appeared to slow disease progression. These results provide evidence for interactions between PrPTSE and humic substances that influence both accurate measurement of PrPTSE in soil and disease transmission.
Differentially expressed genes in iron-induced prion protein conversion
International Nuclear Information System (INIS)
Kim, Minsun; Kim, Eun-hee; Choi, Bo-Ran; Woo, Hee-Jong
2016-01-01
The conversion of the cellular prion protein (PrP C ) to the protease-resistant isoform is the key event in chronic neurodegenerative diseases, including transmissible spongiform encephalopathies (TSEs). Increased iron in prion-related disease has been observed due to the prion protein-ferritin complex. Additionally, the accumulation and conversion of recombinant PrP (rPrP) is specifically derived from Fe(III) but not Fe(II). Fe(III)-mediated PK-resistant PrP (PrP res ) conversion occurs within a complex cellular environment rather than via direct contact between rPrP and Fe(III). In this study, differentially expressed genes correlated with prion degeneration by Fe(III) were identified using Affymetrix microarrays. Following Fe(III) treatment, 97 genes were differentially expressed, including 85 upregulated genes and 12 downregulated genes (≥1.5-fold change in expression). However, Fe(II) treatment produced moderate alterations in gene expression without inducing dramatic alterations in gene expression profiles. Moreover, functional grouping of identified genes indicated that the differentially regulated genes were highly associated with cell growth, cell maintenance, and intra- and extracellular transport. These findings showed that Fe(III) may influence the expression of genes involved in PrP folding by redox mechanisms. The identification of genes with altered expression patterns in neural cells may provide insights into PrP conversion mechanisms during the development and progression of prion-related diseases. - Highlights: • Differential genes correlated with prion degeneration by Fe(III) were identified. • Genes were identified in cell proliferation and intra- and extracellular transport. • In PrP degeneration, redox related genes were suggested. • Cbr2, Rsad2, Slc40a1, Amph and Mvd were expressed significantly.
Prions: Protein Rebels with a Cause!
Marshall, Karen E.; Serpell, Louise C.
2017-01-01
Traditionally we consider infection to arise from viruses, bacteria and parasites. Prions are infectious proteins without any nucleic acids, and therefore do not represent living things. Despite this, they have the ability to replicate themselves and cause diseases such as mad cow disease (bovine spongiform encepthalopathy) and human…
Low copper and high manganese levels in prion protein plaques
Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie
2013-01-01
Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.
Prion-Like Domains in Phagobiota
Directory of Open Access Journals (Sweden)
George Tetz
2017-11-01
Full Text Available Prions are molecules characterized by self-propagation, which can undergo a conformational switch leading to the creation of new prions. Prion proteins have originally been associated with the development of mammalian pathologies; however, recently they have been shown to contribute to the environmental adaptation in a variety of prokaryotic and eukaryotic organisms. Bacteriophages are widespread and represent the important regulators of microbiota homeostasis and have been shown to be diverse across various bacterial families. Here, we examined whether bacteriophages contain prion-like proteins and whether these prion-like protein domains are involved in the regulation of homeostasis. We used a computational algorithm, prion-like amino acid composition, to detect prion-like domains in 370,617 publicly available bacteriophage protein sequences, which resulted in the identification of 5040 putative prions. We analyzed a set of these prion-like proteins, and observed regularities in their distribution across different phage families, associated with their interactions with the bacterial host cells. We found that prion-like domains could be found across all phages of various groups of bacteria and archaea. The results obtained in this study indicate that bacteriophage prion-like proteins are predominantly involved in the interactions between bacteriophages and bacterial cell, such as those associated with the attachment and penetration of bacteriophage in the cell, and the release of the phage progeny. These data allow the identification of phage prion-like proteins as novel regulators of the interactions between bacteriophages and bacterial cells.
Hwang, Soyoun; Greenlee, Justin J; Nicholson, Eric M
2017-01-01
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from the normal cellular prion protein to the pathogenic misfolded conformation (PrPSc). This conversion has been used for in vitro assays including serial protein misfolding amplification and real-time quaking induced conversion (RT-QuIC). RT-QuIC can be used for the detection of prions in a variety of biological tissues from humans and animals. Extensive work has been done to demonstrate that RT-QuIC is a rapid, specific, and highly sensitive prion detection assay. RT-QuIC uses recombinant prion protein to detect minute amounts of PrPSc. RT-QuIC has been successfully used to detect PrPSc from different prion diseases with a variety of substrates including hamster, human, sheep, bank vole, bovine and chimeric forms of prion protein. However, recombinant bovine prion protein has not been used to detect transmissible mink encephalopathy (TME) or to differentiate types of bovine spongiform encephalopathy (BSE) in samples from cattle. We evaluated whether PrPSc from TME and BSE infected cattle can be detected with RT-QuIC using recombinant bovine prion proteins, and optimized the reaction conditions to specifically detect cattle TME and to discriminate between classical and atypical BSE by conversion efficiency. We also found that substrate composed of the disease associated E211K mutant protein can be effective for the detection of TME in cattle and that wild type prion protein appears to be a practical substrate to discriminate between the different types of BSEs.
The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion
Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe
2015-10-01
The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.
Bezdíčka, Martin
2013-01-01
The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...
Glycosaminoglycan sulphation affects the seeded misfolding of a mutant prion protein.
Directory of Open Access Journals (Sweden)
Victoria A Lawson
Full Text Available BACKGROUND: The accumulation of protease resistant conformers of the prion protein (PrP(res is a key pathological feature of prion diseases. Polyanions, including RNA and glycosaminoglycans have been identified as factors that contribute to the propagation, transmission and pathogenesis of prion disease. Recent studies have suggested that the contribution of these cofactors to prion propagation may be species specific. METHODOLOGY/PRINCIPAL FINDING: In this study a cell-free assay was used to investigate the molecular basis of polyanion stimulated PrP(res formation using brain tissue or cell line derived murine PrP. Enzymatic depletion of endogenous nucleic acids or heparan sulphate (HS from the PrP(C substrate was found to specifically prevent PrP(res formation seeded by mouse derived PrP(Sc. Modification of the negative charge afforded by the sulphation of glycosaminoglycans increased the ability of a familial PrP mutant to act as a substrate for PrP(res formation, while having no effect on PrP(res formed by wildtype PrP. This difference may be due to the observed differences in the binding of wild type and mutant PrP for glycosaminoglycans. CONCLUSIONS/SIGNIFICANCE: Cofactor requirements for PrP(res formation are host species and prion strain specific and affected by disease associated mutations of the prion protein. This may explain both species and strain dependent propagation characteristics and provide insights into the underlying mechanisms of familial prion disease. It further highlights the challenge of designing effective therapeutics against a disease which effects a range of mammalian species, caused by range of aetiologies and prion strains.
Prion protein degradation by lichens of the genus Cladonia
Bennett, James P.; Rodriguez, Cynthia M.; Johnson, Christopher J.
2012-01-01
It has recently been discovered that lichens contain a serine protease capable of degrading the pathogenic prion protein, the etiological agent of prion diseases such as sheep scrapie and cervid chronic wasting disease. Limited methods are available to degrade or inactivate prion disease agents, especially in the environment, and lichens or their serine protease could prove important for management of these diseases. Scant information is available regarding the presence or absence of the protease responsible for degrading prion protein (PrP) in lichen species and, in this study, we tested the hypothesis that PrP degradation activity in lichens is phylogenetically-based by testing 44 species of Cladonia lichens, a genus for which a significant portion of the phylogeny is well established. We categorized PrP degradation activity among the 44 species (high, moderate, low or none) and found that activity in Cladonia species did not correspond with phylogenetic position of the species. Degradation of PrP did correspond, however, with three classical taxonomic characters within the genus: species with brown apothecia, no usnic acid, and the presence of a cortex. Of the 44 species studied, 18 (41%) had either high or moderate PrP degradation activity, suggesting the protease may be frequent in this genus of lichens.
Meade-White, K.; Race, B.; Trifilo, M.; Bossers, A.; Favara, C.; Lacasse, R.; Miller, M.; Williams, E.; Oldstone, M.; Race, R.; Chesebro, B.
2007-01-01
Prion protein (PrP) is a required factor for susceptibility to transmissible spongiform encephalopathy or prion diseases. In transgenic mice, expression of prion protein (PrP) from another species often confers susceptibility to prion disease from that donor species. For example, expression of deer
International Nuclear Information System (INIS)
Yang Chiming
2003-01-01
Owing to the high oxygen-respiration in the brain of mammals, oxidative damage to prion protein has been suggested to be an additional factor. A large body of intriguing features of scrapie and prion diseases have provided multiple lines of indirect chemistry evidence, suggesting that the infectious agents may be putative forms of sequence-specific prion radicals (SSPR) and/or their immediate precursors in the transmissible spongiform encephalopathies (TSE). Here a molecular mechanism corresponding to the self-replication of scrapie protein mediated by prion free-radical processes, consonant with 'protein-only' hypotheses is proposed. This new theory may not only aid our understanding of the occurrence of prions, but also provides new insight into the possible chemistry principles underlying the neutrodegenerative disorders. It is anticipated that future studies based on this suggestion and chemistry principles of genetic diseases may allow us to determine an effective approach to stop mad cow disease and its human version, new variant of Creutzfeldt-Jakob disease (v CJD)
Accelerated high fidelity prion amplification within and across prion species barriers.
Directory of Open Access Journals (Sweden)
Kristi M Green
2008-08-01
Full Text Available Experimental obstacles have impeded our ability to study prion transmission within and, more particularly, between species. Here, we used cervid prion protein expressed in brain extracts of transgenic mice, referred to as Tg(CerPrP, as a substrate for in vitro generation of chronic wasting disease (CWD prions by protein misfolding cyclic amplification (PMCA. Characterization of this infectivity in Tg(CerPrP mice demonstrated that serial PMCA resulted in the high fidelity amplification of CWD prions with apparently unaltered properties. Using similar methods to amplify mouse RML prions and characterize the resulting novel cervid prions, we show that serial PMCA abrogated a transmission barrier that required several hundred days of adaptation and subsequent stabilization in Tg(CerPrP mice. While both approaches produced cervid prions with characteristics distinct from CWD, the subtly different properties of the resulting individual prion isolates indicated that adaptation of mouse RML prions generated multiple strains following inter-species transmission. Our studies demonstrate that combined transgenic mouse and PMCA approaches not only expedite intra- and inter-species prion transmission, but also provide a facile means of generating and characterizing novel prion strains.
Detection of type 1 prion protein in variant Creutzfeldt-Jakob disease
Yull, H.M.; Ritchie, D.L.; Langeveld, J.P.M.; Zijderveld, van F.G.; Bruce, M.E.; Ironside, J.W.; Head, M.W.
2006-01-01
Molecular typing of the abnormal form of the prion protein (PrPSc) has come to be regarded as a powerful tool in the investigation of the prion diseases. All evidence thus far presented indicates a single PrPSc molecular type in variant Creutzfeldt-Jakob disease (termed type 2B), presumably
Yamaguchi, Yoshitaka; Miyata, Hironori; Uchiyama, Keiji; Ootsuyama, Akira; Inubushi, Sachiko; Mori, Tsuyoshi; Muramatsu, Naomi; Katamine, Shigeru; Sakaguchi, Suehiro
2012-01-01
Accumulating lines of evidence indicate that the N-terminal domain of prion protein (PrP) is involved in prion susceptibility in mice. In this study, to investigate the role of the octapeptide repeat (OR) region alone in the N-terminal domain for the susceptibility and pathogenesis of prion disease, we intracerebrally inoculated RML scrapie prions into tg(PrPΔOR)/Prnp(0/0) mice, which express mouse PrP missing only the OR region on the PrP-null background. Incubation times of these mice were not extended. Protease-resistant PrPΔOR, or PrP(Sc)ΔOR, was easily detectable but lower in the brains of these mice, compared to that in control wild-type mice. Consistently, prion titers were slightly lower and astrogliosis was milder in their brains. However, in their spinal cords, PrP(Sc)ΔOR and prion titers were abundant and astrogliosis was as strong as in control wild-type mice. These results indicate that the role of the OR region in prion susceptibility and pathogenesis of the disease is limited. We also found that the PrP(Sc)ΔOR, including the pre-OR residues 23-50, was unusually protease-resistant, indicating that deletion of the OR region could cause structural changes to the pre-OR region upon prion infection, leading to formation of a protease-resistant structure for the pre-OR region.
Cali, I.; Castellani, R.; Alshekhlee, A.; Cohen, Y.; Blevins, J.; Yuan, J.; Langeveld, J.P.M.; Parchi, P.; Safar, J.G.; Zou, W.Q.; Gambetti, P.
2009-01-01
Five phenotypically distinct subtypes have been identified in sporadic Creutzfeldt-Jakob disease (sCJD), based on the methionine/valine polymorphic genotype of codon 129 of the prion protein (PrP) gene and the presence of either one of the two protease K-resistant scrapie prion protein (PrPSc) types
Bossers, A.; Belt, P.B.G.M.; Raymond, G.J.; Caughey, B.; Vries, de R.; Smits, M.
1997-01-01
Prion diseases are natural transmissible neurodegenerative disorders in humans and animals. They are characterized by the accumulation of a protease-resistant scrapie-associated prion protein (PrPSc) of the host-encoded cellular prion protein (PrPC) mainly in the central nervous system.
Yeast and Fungal Prions: Amyloid-Handling Systems, Amyloid Structure, and Prion Biology.
Wickner, R B; Edskes, H K; Gorkovskiy, A; Bezsonov, E E; Stroobant, E E
2016-01-01
Yeast prions (infectious proteins) were discovered by their outré genetic properties and have become important models for an array of human prion and amyloid diseases. A single prion protein can become any of many distinct amyloid forms (called prion variants or strains), each of which is self-propagating, but with different biological properties (eg, lethal vs mild). The folded in-register parallel β sheet architecture of the yeast prion amyloids naturally suggests a mechanism by which prion variant information can be faithfully transmitted for many generations. The yeast prions rely on cellular chaperones for their propagation, but can be cured by various chaperone imbalances. The Btn2/Cur1 system normally cures most variants of the [URE3] prion that arise. Although most variants of the [PSI+] and [URE3] prions are toxic or lethal, some are mild in their effects. Even the most mild forms of these prions are rare in the wild, indicating that they too are detrimental to yeast. The beneficial [Het-s] prion of Podospora anserina poses an important contrast in its structure, biology, and evolution to the yeast prions characterized thus far. Copyright © 2016 Elsevier Inc. All rights reserved.
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2014-01-01
A model of protein folding kinetics is applied to study the combined effects of protein flexibility and macromolecular crowding on protein folding rate and stability. It is found that the increase in stability and folding rate promoted by macromolecular crowding is damped for proteins with highly flexible native structures. The model is applied to the folding dynamics of the murine prion protein (121-231). It is found that the high flexibility of the native isoform of the murine prion protein (121-231) reduces the effects of macromolecular crowding on its folding dynamics. The relevance of these findings for the pathogenic mechanism are discussed.
Directory of Open Access Journals (Sweden)
Zi Yang
Full Text Available Prions are self-propagating conformations of proteins that can cause heritable phenotypic traits. Most yeast prions contain glutamine (Q/asparagine (N-rich domains that facilitate the accumulation of the protein into amyloid-like aggregates. Efficient transmission of these infectious aggregates to daughter cells requires that chaperones, including Hsp104 and Sis1, continually sever the aggregates into smaller "seeds." We previously identified 11 proteins with Q/N-rich domains that, when overproduced, facilitate the de novo aggregation of the Sup35 protein into the [PSI(+] prion state. Here, we show that overexpression of many of the same 11 Q/N-rich proteins can also destabilize pre-existing [PSI(+] or [URE3] prions. We explore in detail the events leading to the loss (curing of [PSI(+] by the overexpression of one of these proteins, the Q/N-rich domain of Pin4, which causes Sup35 aggregates to increase in size and decrease in transmissibility to daughter cells. We show that the Pin4 Q/N-rich domain sequesters Hsp104 and Sis1 chaperones away from the diffuse cytoplasmic pool. Thus, a mechanism by which heterologous Q/N-rich proteins impair prion propagation appears to be the loss of cytoplasmic Hsp104 and Sis1 available to sever [PSI(+].
Directory of Open Access Journals (Sweden)
Lifeng Yang
2017-05-01
Full Text Available Prion diseases are neurodegenerative pathologies characterized by the accumulation of a protease-resistant form of the cellular prion protein named prion protein scrapie (PrPSc in the brain. PrPSc accumulation in the endoplasmic reticulum (ER result in a dysregulated calcium (Ca2+ homeostasis and subsequent initiation of unfolded protein response (UPR leading to neuronal dysfunction and apoptosis. The molecular mechanisms for the transition between adaptation to ER stress and ER stress-induced apoptosis are still unclear. Mitogen-activated protein kinases (MAPKs are serine/threonine protein kinases that rule the signaling of many extracellular stimuli from plasma membrane to the nucleus. However the identification of numerous points of cross talk between the UPR and MAPK signaling pathways may contribute to our understanding of the consequences of ER stress in prion diseases. Indeed the MAPK signaling network is known to regulate cell cycle progression and cell survival or death responses following a variety of stresses including misfolded protein response stress. In this article, we review the UPR signaling in prion diseases and discuss the triad of MAPK signaling pathways. We also describe the role played by MAPK signaling cascades in Alzheimer’s (AD and Parkinson’s disease (PD. We will also overview the mechanisms of cell death and the role of MAPK signaling in prion disease progression and highlight potential avenues for therapeutic intervention.
Persistence of pathogenic prion protein during simulated wastewater treatment processes
Hinckley, G.T.; Johnson, C.J.; Jacobson, K.H.; Bartholomay, C.; Mcmahon, K.D.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2008-01-01
Transmissible spongiform encephalopathies (TSEs, prion diseases) are a class of fatal neurodegenerative diseases affecting a variety of mammalian species including humans. A misfolded form of the prion protein (PrP TSE) is the major, if not sole, component of the infectious agent. Prions are highly resistant to degradation and to many disinfection procedures suggesting that, if prions enter wastewater treatment systems through sewers and/or septic systems (e.g., from slaughterhouses, necropsy laboratories, rural meat processors, private game dressing) or through leachate from landfills that have received TSE-contaminated material, prions could survive conventional wastewater treatment Here, we report the results of experiments examining the partitioning and persistence of PrPTSE during simulated wastewater treatment processes including activated and mesophilic anaerobic sludge digestion. Incubation with activated sludge did not result in significant PrPTSE degradation. PrPTSE and prion infectivity partitioned strongly to activated sludge solids and are expected to enter biosolids treatment processes. A large fraction of PrPTSE survived simulated mesophilic anaerobic sludge digestion. The small reduction in recoverable PrPTSE after 20-d anaerobic sludge digestion appeared attributable to a combination of declining extractability with time and microbial degradation. Our results suggest that if prions were to enter municipal wastewater treatment systems, most would partition to activated sludge solids, survive mesophilic anaerobic digestion, and be present in treated biosolids. ?? 2008 American Chemical Society.
Regulation of the Hsp104 middle domain activity is critical for yeast prion propagation.
Directory of Open Access Journals (Sweden)
Jennifer E Dulle
Full Text Available Molecular chaperones play a significant role in preventing protein misfolding and aggregation. Indeed, some protein conformational disorders have been linked to changes in the chaperone network. Curiously, in yeast, chaperones also play a role in promoting prion maintenance and propagation. While many amyloidogenic proteins are associated with disease in mammals, yeast prion proteins, and their ability to undergo conformational conversion into a prion state, are proposed to play a functional role in yeast biology. The chaperone Hsp104, a AAA+ ATPase, is essential for yeast prion propagation. Hsp104 fragments large prion aggregates to generate a population of smaller oligomers that can more readily convert soluble monomer and be transmitted to daughter cells. Here, we show that the middle (M domain of Hsp104, and its mobility, plays an integral part in prion propagation. We generated and characterized mutations in the M-domain of Hsp104 that are predicted to stabilize either a repressed or de-repressed conformation of the M-domain (by analogy to ClpB in bacteria. We show that the predicted stabilization of the repressed conformation inhibits general chaperone activity. Mutation to the de-repressed conformation, however, has differential effects on ATP hydrolysis and disaggregation, suggesting that the M-domain is involved in coupling these two activities. Interestingly, we show that changes in the M-domain differentially affect the propagation of different variants of the [PSI+] and [RNQ+] prions, which indicates that some prion variants are more sensitive to changes in the M-domain mobility than others. Thus, we provide evidence that regulation of the M-domain of Hsp104 is critical for efficient prion propagation. This shows the importance of elucidating the function of the M-domain in order to understand the role of Hsp104 in the propagation of different prions and prion variants.
LRP1 controls biosynthetic and endocytic trafficking of neuronal prion protein
DEFF Research Database (Denmark)
Parkyn, Celia J; Vermeulen, Esmeralda G M; Mootoosamy, Roy C
2008-01-01
The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly and consti......The trafficking of normal cellular prion protein (PrP(C)) is believed to control its conversion to the altered conformation (designated PrP(Sc)) associated with prion disease. Although anchored to the membrane by means of glycosylphosphatidylinositol (GPI), PrP(C) on neurons is rapidly...... required for this process. Moreover, sustained inhibition of LRP1 levels by siRNA leads to the accumulation of PrP(C) in biosynthetic compartments, with a concomitant lowering of surface PrP(C), suggesting that LRP1 expedites the trafficking of PrP(C) to the neuronal surface. PrP(C) and LRP1 can be co......-immunoprecipitated from the endoplasmic reticulum in normal neurons. The N-terminal domain of PrP(C) binds to purified human LRP1 with nanomolar affinity, even in the presence of 1 microM of the LRP-specific chaperone, receptor-associated protein (RAP). Taken together, these data argue that LRP1 controls both the surface...
Kabani, Mehdi; Melki, Ronald
2011-01-01
Yeast prions are self-perpetuating protein aggregates that are at the origin of heritable and transmissible non-Mendelian phenotypic traits. Among these, [PSI+], [URE3] and [PIN+] are the most well documented prions and arise from the assembly of Sup35p, Ure2p and Rnq1p, respectively, into insoluble fibrillar assemblies. Fibril assembly depends on the presence of N- or C-terminal prion domains (PrDs) which are not homologous in sequence but share unusual amino-acid compositions, such as enrichment in polar residues (glutamines and asparagines) or the presence of oligopeptide repeats. Purified PrDs form amyloid fibrils that can convert prion-free cells to the prion state upon transformation. Nonetheless, isolated PrDs and full-length prion proteins have different aggregation, structural and infectious properties. In addition, mutations in the "non-prion" domains (non-PrDs) of Sup35p, Ure2p and Rnq1p were shown to affect their prion properties in vitro and in vivo. Despite these evidences, the implication of the functional non-PrDs in fibril assembly and prion propagation has been mostly overlooked. In this review, we discuss the contribution of non-PrDs to prion assemblies, and the structure-function relationship in prion infectivity in the light of recent findings on Sup35p and Ure2p assembly into infectious fibrils from our laboratory and others.
DEFF Research Database (Denmark)
Jen, Angela; Parkyn, Celia J; Mootoosamy, Roy C
2010-01-01
For infectious prion protein (designated PrP(Sc)) to act as a template to convert normal cellular protein (PrP(C)) to its distinctive pathogenic conformation, the two forms of prion protein (PrP) must interact closely. The neuronal receptor that rapidly endocytoses PrP(C) is the low......-density lipoprotein receptor-related protein 1 (LRP1). We show here that on sensory neurons LRP1 is also the receptor that binds and rapidly endocytoses smaller oligomeric forms of infectious prion fibrils, and recombinant PrP fibrils. Although LRP1 binds two molecules of most ligands independently to its receptor...... both prion and LRP1 biology....
The complexity and implications of yeast prion domains
2011-01-01
Prions are infectious proteins with altered conformations converted from otherwise normal host proteins. While there is only one known mammalian prion protein, PrP, a handful of prion proteins have been identified in the yeast Saccharomyces cerevisiae. Yeast prion proteins usually have a defined region called prion domain (PrD) essential for prion properties, which are typically rich in glutamine (Q) and asparagine (N). Despite sharing several common features, individual yeast PrDs are generally intricate and divergent in their compositional characteristics, which potentially implicates their prion phenotypes, such as prion-mediated transcriptional regulations. PMID:22156731
Determining the relative susceptibility of four prion protein genotypes to atypical scrapie
Atypical scrapie is a sheep prion (PrPSc) disease whose epidemiology is consistent with a sporadic origin and is associated with specific polymorphisms of the normal cellular prion protein (PrPC). We describe a mass spectrometry-based method of detecting and quantifying the polymorphisms of sheep P...
Plasminogen stimulates propagation of protease-resistant prion protein in vitro.
Mays, Charles E; Ryou, Chongsuk
2010-12-01
To clarify the role of plasminogen as a cofactor for prion propagation, we conducted functional assays using a cell-free prion protein (PrP) conversion assay termed protein misfolding cyclic amplification (PMCA) and prion-infected cell lines. Here, we report that plasminogen stimulates propagation of the protease-resistant scrapie PrP (PrP(Sc)). Compared to control PMCA conducted without plasminogen, addition of plasminogen in PMCA using wild-type brain material significantly increased PrP conversion, with an EC(50) = ∼56 nM. PrP conversion in PMCA was substantially less efficient with plasminogen-deficient brain material than with wild-type material. The activity stimulating PrP conversion was specific for plasminogen and conserved in its kringle domains. Such activity was abrogated by modification of plasminogen structure and interference of PrP-plasminogen interaction. Kinetic analysis of PrP(Sc) generation demonstrated that the presence of plasminogen in PMCA enhanced the PrP(Sc) production rate to ∼0.97 U/μl/h and reduced turnover time to ∼1 h compared to those (∼0.4 U/μl/h and ∼2.5 h) obtained without supplementation. Furthermore, as observed in PMCA, plasminogen and kringles promoted PrP(Sc) propagation in ScN2a and Elk 21(+) cells. Our results demonstrate that plasminogen functions in stimulating conversion processes and represents the first cellular protein cofactor that enhances the hypothetical mechanism of prion propagation.
Amyloid cores in prion domains: Key regulators for prion conformational conversion.
Fernández, María Rosario; Batlle, Cristina; Gil-García, Marcos; Ventura, Salvador
2017-01-02
Despite the significant efforts devoted to decipher the particular protein features that encode for a prion or prion-like behavior, they are still poorly understood. The well-characterized yeast prions constitute an ideal model system to address this question, because, in these proteins, the prion activity can be univocally assigned to a specific region of their sequence, known as the prion forming domain (PFD). These PFDs are intrinsically disordered, relatively long and, in many cases, of low complexity, being enriched in glutamine/asparagine residues. Computational analyses have identified a significant number of proteins having similar domains in the human proteome. The compositional bias of these regions plays an important role in the transition of the prions to the amyloid state. However, it is difficult to explain how composition alone can account for the formation of specific contacts that position correctly PFDs and provide the enthalpic force to compensate for the large entropic cost of immobilizing these domains in the initial assemblies. We have hypothesized that short, sequence-specific, amyloid cores embedded in PFDs can perform these functions and, accordingly, act as preferential nucleation centers in both spontaneous and seeded aggregation. We have shown that the implementation of this concept in a prediction algorithm allows to score the prion propensities of putative PFDs with high accuracy. Recently, we have provided experimental evidence for the existence of such amyloid cores in the PFDs of Sup35, Ure2, Swi1, and Mot3 yeast prions. The fibrils formed by these short stretches may recognize and promote the aggregation of the complete proteins inside cells, being thus a promising tool for targeted protein inactivation.
Ferrucci, M; Ryskalin, L; Biagioni, F; Gambardella, S; Busceti, C L; Falleni, A; Lazzeri, G; Fornai, F
2017-07-01
The cellular prion protein (PrPc) is physiologically expressed within selective brain areas of mammals. Alterations in the secondary structure of this protein lead to scrapie-like prion protein (PrPsc), which precipitates in the cell. PrPsc has been detected in infectious, inherited or sporadic neurodegenerative disorders. Prion protein metabolism is dependent on autophagy and ubiquitin proteasome. Despite not being fully elucidated, the physiological role of prion protein relates to chaperones which rescue cells under stressful conditions.Methamphetamine (METH) is a widely abused drug which produces oxidative stress in various brain areas causing mitochondrial alterations and protein misfolding. These effects produce a compensatory increase of chaperones while clogging cell clearing pathways. In the present study, we explored whether METH administration modifies the amount of PrPc. Since high levels of PrPc when the clearing systems are clogged may lead to its misfolding into PrPsc, we further tested whether METH exposure triggers the appearance of PrPsc. We analysed the effects of METH and dopamine administration in PC12 and striatal cells by using SDS-PAGE Coomassie blue, immune- histochemistry and immune-gold electron microscopy. To analyze whether METH administration produces PrPsc aggregates we used antibodies directed against PrP following exposure to proteinase K or sarkosyl which digest folded PrPc but misfolded PrPsc. We fond that METH triggers PrPsc aggregates in DA-containing cells while METH is not effective in primary striatal neurons which do not produce DA. In the latter cells exogenous DA is needed to trigger PrPsc accumulation similarly to what happens in DA containing cells under the effects of METH. The present findings, while fostering novel molecular mechanisms involving prion proteins, indicate that, cell pathology similar to prion disorders can be mimicked via a DA-dependent mechanism by a drug of abuse.
Directory of Open Access Journals (Sweden)
Christine R Langlois
2016-11-01
Full Text Available Prions are a group of proteins that can adopt a spectrum of metastable conformations in vivo. These alternative states change protein function and are self-replicating and transmissible, creating protein-based elements of inheritance and infectivity. Prion conformational flexibility is encoded in the amino acid composition and sequence of the protein, which dictate its ability not only to form an ordered aggregate known as amyloid but also to maintain and transmit this structure in vivo. But, while we can effectively predict amyloid propensity in vitro, the mechanism by which sequence elements promote prion propagation in vivo remains unclear. In yeast, propagation of the [PSI+] prion, the amyloid form of the Sup35 protein, has been linked to an oligopeptide repeat region of the protein. Here, we demonstrate that this region is composed of separable functional elements, the repeats themselves and a repeat proximal region, which are both required for efficient prion propagation. Changes in the numbers of these elements do not alter the physical properties of Sup35 amyloid, but their presence promotes amyloid fragmentation, and therefore maintenance, by molecular chaperones. Rather than acting redundantly, our observations suggest that these sequence elements make complementary contributions to prion propagation, with the repeat proximal region promoting chaperone binding to and the repeats promoting chaperone processing of Sup35 amyloid.
Directory of Open Access Journals (Sweden)
Gabriele Giachin
Full Text Available Humic substances (HS are the largest constituent of soil organic matter and are considered as a key component of the terrestrial ecosystem. HS may facilitate the transport of organic and inorganic molecules, as well as the sorption interactions with environmentally relevant proteins such as prions. Prions enter the environment through shedding from live hosts, facilitating a sustained incidence of animal prion diseases such as Chronic Wasting Disease and scrapie in cervid and ovine populations, respectively. Changes in prion structure upon environmental exposure may be significant as they can affect prion infectivity and disease pathology. Despite its relevance, the mechanisms of prion interaction with HS are still not completely understood. The goal of this work is to advance a structural-level picture of the encapsulation of recombinant, non-infectious, prion protein (PrP into different natural HS. We observed that PrP precipitation upon addition of HS is mainly driven by a mechanism of "salting-out" whereby PrP molecules are rapidly removed from the solution and aggregate in insoluble adducts with humic molecules. Importantly, this process does not alter the protein folding since insoluble PrP retains its α-helical content when in complex with HS. The observed ability of HS to promote PrP insolubilization without altering its secondary structure may have potential relevance in the context of "prion ecology". These results suggest that soil organic matter interacts with prions possibly without altering the protein structures. This may facilitate prions preservation from biotic and abiotic degradation leading to their accumulation in the environment.
Variably Protease-Sensitive Prionopathy: A New Sporadic Disease of the Prion Protein
Zou, Wen-Quan; Puoti, Gianfranco; Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Shimoji, Miyuki; Langeveld, Jan P. M.; Castellani, Rudy; Notari, Silvio; Crain, Barbara; Schmidt, Robert E.; Geschwind, Michael; DeArmond, Stephen J.; Cairns, Nigel J.; Dickson, Dennis; Honig, Lawrence; Torres, Juan Maria; Mastrianni, James; Capellari, Sabina; Giaccone, Giorgio; Belay, Ermias D.; Schonberger, Lawrence B.; Cohen, Mark; Perry, George; Kong, Qingzhong; Parchi, Piero; Tagliavini, Fabrizio; Gambetti, Pierluigi
2011-01-01
Objective The objective of the study is to report 2 new genotypic forms of protease-sensitive prionopathy (PSPr), a novel prion disease described in 2008, in 11 subjects all homozygous for valine at codon 129 of the prion protein (PrP) gene (129VV). The 2 new PSPr forms affect individuals who are either homozygous for methionine (129MM) or heterozygous for methionine/valine (129MV). Methods Fifteen affected subjects with 129MM, 129MV, and 129VV underwent comparative evaluation at the National Prion Disease Pathology Surveillance Center for clinical, histopathologic, immunohistochemical, genotypical, and PrP characteristics. Results Disease duration (between 22 and 45 months) was significantly different in the 129VV and 129MV subjects. Most other phenotypic features along with the PrP electrophoretic profile were similar but distinguishable in the 3 129 genotypes. A major difference laid in the sensitivity to protease digestion of the disease-associated PrP, which was high in 129VV but much lower, or altogether lacking, in 129MV and 129MM. This difference prompted the substitution of the original designation with “variably protease-sensitive prionopathy” (VPSPr). None of the subjects had mutations in the PrP gene coding region. Interpretation Because all 3 129 genotypes are involved, and are associated with distinguishable phenotypes, VPSPr becomes the second sporadic prion protein disease with this feature after Creutzfeldt-Jakob disease, originally reported in 1920. However, the characteristics of the abnormal prion protein suggest that VPSPr is different from typical prion diseases, and perhaps more akin to subtypes of Gerstmann-Sträussler-Scheinker disease. PMID:20695009
Human prion diseases: surgical lessons learned from iatrogenic prion transmission.
Bonda, David J; Manjila, Sunil; Mehndiratta, Prachi; Khan, Fahd; Miller, Benjamin R; Onwuzulike, Kaine; Puoti, Gianfranco; Cohen, Mark L; Schonberger, Lawrence B; Cali, Ignazio
2016-07-01
The human prion diseases, or transmissible spongiform encephalopathies, have captivated our imaginations since their discovery in the Fore linguistic group in Papua New Guinea in the 1950s. The mysterious and poorly understood "infectious protein" has become somewhat of a household name in many regions across the globe. From bovine spongiform encephalopathy (BSE), commonly identified as mad cow disease, to endocannibalism, media outlets have capitalized on these devastatingly fatal neurological conditions. Interestingly, since their discovery, there have been more than 492 incidents of iatrogenic transmission of prion diseases, largely resulting from prion-contaminated growth hormone and dura mater grafts. Although fewer than 9 cases of probable iatrogenic neurosurgical cases of Creutzfeldt-Jakob disease (CJD) have been reported worldwide, the likelihood of some missed cases and the potential for prion transmission by neurosurgery create considerable concern. Laboratory studies indicate that standard decontamination and sterilization procedures may be insufficient to completely remove infectivity from prion-contaminated instruments. In this unfortunate event, the instruments may transmit the prion disease to others. Much caution therefore should be taken in the absence of strong evidence against the presence of a prion disease in a neurosurgical patient. While the Centers for Disease Control and Prevention (CDC) and World Health Organization (WHO) have devised risk assessment and decontamination protocols for the prevention of iatrogenic transmission of the prion diseases, incidents of possible exposure to prions have unfortunately occurred in the United States. In this article, the authors outline the historical discoveries that led from kuru to the identification and isolation of the pathological prion proteins in addition to providing a brief description of human prion diseases and iatrogenic forms of CJD, a brief history of prion disease nosocomial transmission
Pathogenic prion protein is degraded by a manganese oxide mineral found in soils
Russo, F.; Johnson, C.J.; McKenzie, D.; Aiken, Judd M.; Pedersen, J.A.
2009-01-01
Prions, the aetiological agents of transmissible spongiform encephalopathies, exhibit extreme resistance to degradation. Soil can retain prion infectivity in the environment for years. Reactive soil components may, however, contribute to the inactivation of prions in soil. Members of the birnessite family of manganese oxides (MnO2) rank among the strongest natural oxidants in soils. Here, we report the abiotic degradation of pathogenic prion protein (PrPTSE) by a synthetic analogue of naturally occurring birnessite minerals. Aqueous MnO2 suspensions degraded the PrPTSE as evidenced by decreased immunoreactivity and diminished ability to seed protein misfolding cyclic amplification reactions. Birnessite-mediated PrPTSE degradation increased as a solution's pH decreased, consistent with the pH-dependence of the redox potential of MnO2. Exposure to 5.6 mg MnO2 ml-1 (PrPTSE:MnO2=1 : 110) decreased PrPTSE levels by ???4 orders of magnitude. Manganese oxides may contribute to prion degradation in soil environments rich in these minerals. ?? 2009 SGM.
Directory of Open Access Journals (Sweden)
V. Villa
2011-01-01
Full Text Available The effects of quinacrine and minocycline on the toxicity induced by hPrP90-231 were studied. By mild thermal denaturation, hPrP90-231 can be converted in a toxic PrPSc-like structure affecting the survival of SH-SY5Y cells. Quinacrine and minocycline prevented hPrP90-231-induced toxicity interfering with different mechanisms: protective effects of quinacrine are mediated by the binding to the fragment that abolished hPrP90-231 structural changes and cell internalization, whereas, minocycline reverted MAP kinase neurotoxic signaling exerted by the prion fragment.
Du, Zhiqiang; Valtierra, Stephanie; Li, Liming
2014-01-01
The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.
Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid.
Directory of Open Access Journals (Sweden)
Andrew G Hughson
2016-09-01
protein. BrioHOCl treatments had similar effects on amyloids composed of human α-synuclein and a fragment of human tau. These results indicate that HOCl can block the self-propagating activity of prions and other amyloids.
Moscardini, Mila; Pistello, Mauro; Bendinelli, M; Ficheux, Damien; Miller, Jennifer T; Gabus, Caroline; Le Grice, Stuart F J; Surewicz, Witold K; Darlix, Jean-Luc
2002-04-19
All lentiviruses and oncoretroviruses examined so far encode a major nucleic-acid binding protein (nucleocapsid or NC* protein), approximately 2500 molecules of which coat the dimeric RNA genome. Studies on HIV-1 and MoMuLV using in vitro model systems and in vivo have shown that NC protein is required to chaperone viral RNA dimerization and packaging during virus assembly, and proviral DNA synthesis by reverse transcriptase (RT) during infection. The human cellular prion protein (PrP), thought to be the major component of the agent causing transmissible spongiform encephalopathies (TSE), was recently found to possess a strong affinity for nucleic acids and to exhibit chaperone properties very similar to HIV-1 NC protein in the HIV-1 context in vitro. Tight binding of PrP to nucleic acids is proposed to participate directly in the prion disease process. To extend our understanding of lentiviruses and of the unexpected nucleic acid chaperone properties of the human prion protein, we set up an in vitro system to investigate replication of the feline immunodeficiency virus (FIV), which is functionally and phylogenetically distant from HIV-1. The results show that in the FIV model system, NC protein chaperones viral RNA dimerization, primer tRNA(Lys,3) annealing to the genomic primer-binding site (PBS) and minus strand DNA synthesis by the homologous FIV RT. FIV NC protein is able to trigger specific viral DNA synthesis by inhibiting self-priming of reverse transcription. The human prion protein was found to mimic the properties of FIV NC with respect to primer tRNA annealing to the viral RNA and chaperoning minus strand DNA synthesis. Copyright 2002 Elsevier Science Ltd.
Prions are amyloid-forming proteins that cause transmissible spongiform encephalopathies through a process involving conversion from normal cellular prion protein to pathogenic misfolded conformation. This conversion has been used for in vitro assays including serial protein misfolding amplification...
Directory of Open Access Journals (Sweden)
Wagner Wibke
2012-12-01
Full Text Available Abstract Background It has been widely established that the conversion of the cellular prion protein (PrPC into its abnormal isoform (PrPSc is responsible for the development of transmissible spongiform encephalopathies (TSEs. However, the knowledge of the detailed molecular mechanisms and direct functional consequences within the cell is rare. In this study, we aimed at the identification of deregulated proteins which might be involved in prion pathogenesis. Findings Apolipoprotein E and peroxiredoxin 6 (PRDX6 were identified as upregulated proteins in brains of scrapie-infected mice and cultured neuronal cell lines. Downregulation of PrP gene expression using specific siRNA did not result in a decrease of PRDX6 amounts. Interestingly, selective siRNA targeting PRDX6 or overexpression of PRDX6 controlled PrPC and PrPSc protein amounts in neuronal cells. Conclusions Besides its possible function as a novel marker protein in the diagnosis of TSEs, PDRX6 represents an attractive target molecule in putative pharmacological intervention strategies in the future.
A closer look at prion strains
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrPSc), a pathogenic isoform of the host-encoded cellular prion protein (PrPC). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrPSc conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrPSc biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves. PMID:23357828
Directory of Open Access Journals (Sweden)
Alexander I Alexandrov
Full Text Available Fragmentation of amyloid polymers by the chaperone Hsp104 allows them to propagate as prions in yeast. The factors which determine the frequency of fragmentation are unclear, though it is often presumed to depend on the physical strength of prion polymers. Proteins with long polyglutamine stretches represent a tractable model for revealing sequence elements required for polymer fragmentation in yeast, since they form poorly fragmented amyloids. Here we show that interspersion of polyglutamine stretches with various amino acid residues differentially affects the in vivo formation and fragmentation of the respective amyloids. Aromatic residues tyrosine, tryptophan and phenylalanine strongly stimulated polymer fragmentation, leading to the appearance of oligomers as small as dimers. Alanine, methionine, cysteine, serine, threonine and histidine also enhanced fragmentation, while charged residues, proline, glycine and leucine inhibited polymerization. Our data indicate that fragmentation frequency primarily depends on the recognition of fragmentation-promoting residues by Hsp104 and/or its co-chaperones, rather than on the physical stability of polymers. This suggests that differential exposure of such residues to chaperones defines prion variant-specific differences in polymer fragmentation efficiency.
Yu, Peng; Zhang, Xiaohua; Zhou, Jiawan; Xiong, Erhu; Li, Xiaoyu; Chen, Jinhua
2015-11-01
A novel competitive host-guest strategy regulated by protein biogate was developed for sensitive and selective analysis of prion protein. The methylene blue (MB)-tagged prion aptamer (MB-Apt) was introduced to the multiwalled carbon nanotubes-β-cyclodextrins (MWCNTs-β-CD) composites-modified glassy carbon (GC) electrode through the host-guest interaction between β-CD and MB. In the absence of prion, MB-Apt could be displaced by ferrocenecarboxylic acid (FCA) due to its stronger binding affinity to β-CD, resulting in a large oxidation peak of FCA. However, in the presence of prion, the specific prion-aptamer interaction drove the formation of protein biogate to seal the cavity of β-CD, which hindered the guest displacement of MB by FCA and resulted in the oxidation peak current of MB (IMB) increased and that of FCA (IFCA) decreased. The developed aptasensor showed good response towards the target (prion protein) with a low detection limit of 160 fM. By changing the specific aptamers, this strategy could be easily extended to detect other proteins, showing promising potential for extensive applications in bioanalysis.
Spermidine cures yeast of prions
Directory of Open Access Journals (Sweden)
Shaun H. Speldewinde
2015-12-01
Full Text Available Prions are self-perpetuating amyloid protein aggregates which underlie various neurodegenerative diseases in mammals. The molecular basis underlying their conversion from a normally soluble protein into the prion form remains largely unknown. Studies aimed at uncovering these mechanism(s are therefore essential if we are to develop effective therapeutic strategies to counteract these disease-causing entities. Autophagy is a cellular degradation system which has predominantly been considered as a non-selective bulk degradation process which recycles macromolecules in response to starvation conditions. We now know that autophagy also serves as a protein quality control mechanism which selectively degrades protein aggregates and damaged organelles. These are commonly accumulated in various neurodegenerative disorders including prion diseases. In our recent study [Speldewinde et al. Mol. Biol. Cell. (2015] we used the well-established yeast [PSI+]/Sup35 and [PIN+]/Rnq1 prion models to show that autophagy prevents sporadic prion formation. Importantly, we found that spermidine, a polyamine that has been used to increase autophagic flux, acts as a protective agent which prevents spontaneous prion formation.
Lyu, Justin; Andrianarijaona, V. M.
2016-05-01
The causes of the misfolding of prion protein -i.e. the transformation of PrPC to PrPSc - have not been clearly elucidated. Many studies have focused on identifying possible chemical conditions, such as pH, temperature and chemical denaturation, that may trigger the pathological transformation of prion proteins (Weiwei Tao, Gwonchan Yoon, Penghui Cao, `` β-sheet-like formation during the mechanical unfolding of prion protein'', The Journal of Chemical Physics, 2015, 143, 125101). Here, we attempt to calculate the ionization energies of the prion protein, which will be able to shed light onto the possible causes of the misfolding. We plan on using the coarse-grain method which allows for a more feasible calculation time by means of approximation. We believe that by being able to approximate the ionization potential, particularly that of the regions known to form stable β-strands of the PrPSc form, the possible sources of denaturation, be it chemical or mechanical, may be narrowed down.
Directory of Open Access Journals (Sweden)
Rodríguez-Martínez Ana B
2012-10-01
Full Text Available Abstract Introduction The coexistence of different molecular types of classical protease-resistant prion protein in the same individual have been described, however, the simultaneous finding of these with the recently described protease-sensitive variant or variably protease-sensitive prionopathy has, to the best of our knowledge, not yet been reported. Case presentation A 74-year-old Caucasian woman showed a sporadic Creutzfeldt–Jakob disease clinical phenotype with reactive depression, followed by cognitive impairment, akinetic-rigid Parkinsonism with pseudobulbar syndrome and gait impairment with motor apraxia, visuospatial disorientation, and evident frontal dysfunction features such as grasping, palmomental reflex and brisk perioral reflexes. She died at age 77. Neuropathological findings showed: spongiform change in the patient’s cerebral cortex, striatum, thalamus and molecular layer of the cerebellum with proteinase K-sensitive synaptic-like, dot-like or target-like prion protein deposition in the cortex, thalamus and striatum; proteinase K-resistant prion protein in the same regions; and elongated plaque-like proteinase K-resistant prion protein in the molecular layer of the cerebellum. Molecular analysis of prion protein after proteinase K digestion revealed decreased signal intensity in immunoblot, a ladder-like protein pattern, and a 71% reduction of PrPSc signal relative to non-digested material. Her cerebellum showed a 2A prion protein type largely resistant to proteinase K. Genotype of polymorphism at codon 129 was valine homozygous. Conclusion Molecular typing of prion protein along with clinical and neuropathological data revealed, to the best of our knowledge, the first case of the coexistence of different protease-sensitive prion proteins in the same patient in a rare case that did not fulfill the current clinical diagnostic criteria for either probable or possible sporadic Creutzfeldt–Jakob disease. This highlights the
Victoria, Guiliana Soraya; Zurzolo, Chiara
2017-09-04
Progression of pathology in neurodegenerative diseases is hypothesized to be a non-cell-autonomous process that may be mediated by the productive spreading of prion-like protein aggregates from a "donor cell" that is the source of misfolded aggregates to an "acceptor cell" in which misfolding is propagated by conversion of the normal protein. Although the proteins involved in the various diseases are unrelated, common pathways appear to be used for their intercellular propagation and spreading. Here, we summarize recent evidence of the molecular mechanisms relevant for the intercellular trafficking of protein aggregates involved in prion, Alzheimer's, Huntington's, and Parkinson's diseases. We focus in particular on the common roles that lysosomes and tunneling nanotubes play in the formation and spreading of prion-like assemblies. © 2017 Victoria and Zurzolo.
The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation
Directory of Open Access Journals (Sweden)
Shi Fushan
2012-07-01
Full Text Available Abstract Background Prion diseases are neurodegenerative disorders characterized by the accumulation of an abnormal disease-associated prion protein, PrPSc. In prion-infected brains, activated microglia are often present in the vicinity of PrPSc aggregates, and microglial activation is thought to play a key role in the pathogenesis of prion diseases. Although interleukin (IL-1β release by prion-induced microglia has been widely reported, the mechanism by which primed microglia become activated and secrete IL-1β in prion diseases has not yet been elucidated. In this study, we investigated the role of the NACHT, LRR and PYD domains-containing protein (NALP3 inflammasome in IL-1β release from lipopolysaccharide (LPS-primed microglia after exposure to a synthetic neurotoxic prion fragment (PrP106-126. Methods The inflammasome components NALP3 and apoptosis-associated speck-like protein (ASC were knocked down by gene silencing. IL-1β production was assessed using ELISA. The mRNA expression of NALP3, ASC, and pro-inflammatory factors was measured by quantitative PCR. Western blot analysis was used to detect the protein level of NALP3, ASC, caspase-1 and nuclear factor-κB. Results We found that that PrP106-126-induced IL-1β release depends on NALP3 inflammasome activation, that inflammasome activation is required for the synthesis of pro-inflammatory and chemotactic factors by PrP106-126-activated microglia, that inhibition of NF-κB activation abrogated PrP106-126-induced NALP3 upregulation, and that potassium efflux and production of reactive oxygen species were implicated in PrP106-126-induced NALP3 inflammasome activation in microglia. Conclusions We conclude that the NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation. To our knowledge, this is the first time that strong evidence for the involvement of NALP3 inflammasome in prion-associated inflammation has been found.
Directory of Open Access Journals (Sweden)
Sacha Sorrentino
Full Text Available The pathological form of prion protein (PrP(Sc, as other amyloidogenic proteins, causes a marked increase of membrane permeability. PrP(Sc extracted from infected Syrian hamster brains induces a considerable change in membrane ionic conductance, although the contribution of this interaction to the molecular mechanism of neurodegeneration process is still controversial. We previously showed that the human PrP fragment 90-231 (hPrP₉₀₋₂₃₁ increases ionic conductance across artificial lipid bilayer, in a calcium-dependent manner, producing an alteration similar to that observed for PrP(Sc. In the present study we demonstrate that hPrP₉₀₋₂₃₁, pre-incubated with 10 mM Ca⁺⁺ and then re-suspended in physiological external solution increases not only membrane conductance but neurotoxicity as well. Furthermore we show the existence of a direct link between these two effects as demonstrated by a highly statistically significant correlation in several experimental conditions. A similar correlation between increased membrane conductance and cell degeneration has been observed assaying hPrP₉₀₋₂₃₁ bearing pathogenic mutations (D202N and E200K. We also report that Ca⁺⁺ binding to hPrP₉₀₋₂₃₁ induces a conformational change based on an alteration of secondary structure characterized by loss of alpha-helix content causing hydrophobic amino acid exposure and proteinase K resistance. These features, either acquired after controlled thermal denaturation or induced by D202N and E200K mutations were previously identified as responsible for hPrP₉₀₋₂₃₁ cytotoxicity. Finally, by in silico structural analysis, we propose that Ca⁺⁺ binding to hPrP₉₀₋₂₃₁ modifies amino acid orientation, in the same way induced by E200K mutation, thus suggesting a pathway for the structural alterations responsible of PrP neurotoxicity.
Moudjou, Mohammed; Chapuis, Jérôme; Mekrouti, Mériem; Reine, Fabienne; Herzog, Laetitia; Sibille, Pierre; Laude, Hubert; Vilette, Didier; Andréoletti, Olivier; Rezaei, Human; Dron, Michel; Béringue, Vincent
2016-07-07
Prions are formed of misfolded assemblies (PrP(Sc)) of the variably N-glycosylated cellular prion protein (PrP(C)). In infected species, prions replicate by seeding the conversion and polymerization of host PrP(C). Distinct prion strains can be recognized, exhibiting defined PrP(Sc) biochemical properties such as the glycotype and specific biological traits. While strain information is encoded within the conformation of PrP(Sc) assemblies, the storage of the structural information and the molecular requirements for self-perpetuation remain uncertain. Here, we investigated the specific role of PrP(C) glycosylation status. First, we developed an efficient protein misfolding cyclic amplification method using cells expressing the PrP(C) species of interest as substrate. Applying the technique to PrP(C) glycosylation mutants expressing cells revealed that neither PrP(C) nor PrP(Sc) glycoform stoichiometry was instrumental to PrP(Sc) formation and strainness perpetuation. Our study supports the view that strain properties, including PrP(Sc) glycotype are enciphered within PrP(Sc) structural backbone, not in the attached glycans.
Energy Technology Data Exchange (ETDEWEB)
Manno, D; Filippo, E; Fiore, R; Serra, A [Dipartimento di Scienza dei Materiali, Universita del Salento, Lecce (Italy); Urso, E; Rizzello, A; Maffia, M [Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Universita del Salento, Lecce (Italy)
2010-04-23
Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP{sup C}. In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP{sup C} at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.
International Nuclear Information System (INIS)
Manno, D; Filippo, E; Fiore, R; Serra, A; Urso, E; Rizzello, A; Maffia, M
2010-01-01
Surface-enhanced Raman spectroscopy (SERS) allows a new insight into the analysis of cell physiology. In this work, the difficulty of producing suitable substrates that, besides permitting the amplification of the Raman signal, do not interact with the biological material causing alteration, has been overcome by a combined method of hydrothermal green synthesis and thermal annealing. The SERS analysis of the cell membrane has been performed with special attention to the cellular prion protein PrP C . In addition, SERS has also been used to reveal the prion protein-Cu(II) interaction in four different cell models (B104, SH-SY5Y, GN11, HeLa), expressing PrP C at different levels. A significant implication of the current work consists of the intriguing possibility of revealing and quantifying prion protein expression in complex biological samples by a cheap SERS-based method, replacing the expensive and time-consuming immuno-assay systems commonly employed.
Prions cause protein misfolding diseases, such as transmissible spongiform encephalopathy. They propagate infections by converting a normal cellular prion protein into a prion (PrPSc). PrPC and PrPSc are isosequential and differ only in their respective conformations. PrPC is monomeric and sensit...
Prion Protein Gene Polymorphisms in Turkish Native Goat Breeds ...
Indian Academy of Sciences (India)
Navya
In these diseases, a neuronal glycoprotein known as prion protein PrPC ... sheep or goats in Turkey, but the OIE (World Organisation for Animal Health) does not .... Turkish goat breeds was approximately 6.3%, which is a low starting point for ...
Cellular Aspects of Prion Replication In Vitro
Grassmann, Andrea; Wolf, Hanna; Hofmann, Julia; Graham, James; Vorberg, Ina
2013-01-01
Prion diseases or transmissible spongiform encephalopathies (TSEs) are fatal neurodegenerative disorders in mammals that are caused by unconventional agents predominantly composed of aggregated misfolded prion protein (PrP). Prions self-propagate by recruitment of host-encoded PrP into highly ordered β-sheet rich aggregates. Prion strains differ in their clinical, pathological and biochemical characteristics and are likely to be the consequence of distinct abnormal prion protein conformers that stably replicate their alternate states in the host cell. Understanding prion cell biology is fundamental for identifying potential drug targets for disease intervention. The development of permissive cell culture models has greatly enhanced our knowledge on entry, propagation and dissemination of TSE agents. However, despite extensive research, the precise mechanism of prion infection and potential strain effects remain enigmatic. This review summarizes our current knowledge of the cell biology and propagation of prions derived from cell culture experiments. We discuss recent findings on the trafficking of cellular and pathologic PrP, the potential sites of abnormal prion protein synthesis and potential co-factors involved in prion entry and propagation. PMID:23340381
Rigter, A.; Bossers, A.
2005-01-01
Conversion of the host-encoded protease-sensitive cellular prion protein (PrPC) into the scrapie-associated protease-resistant isoform (PrPSc) of prion protein (PrP) is the central event in transmissible spongiform encephalopathies or prion diseases. Differences in transmissibility and
Engineered bacterial hydrophobic oligopeptide repeats in a synthetic yeast prion, [REP-PSI+
Directory of Open Access Journals (Sweden)
Fátima eGasset-Rosa
2015-04-01
Full Text Available The yeast translation termination factor Sup35p, by aggregating as the [PSI+] prion, enables ribosomes to read-through stop codons, thus expanding the diversity of the Saccharomyces cerevisiae proteome. Yeast prions are functional amyloids that replicate by templating their conformation on native protein molecules, then assembling as large aggregates and fibers. Prions propagate epigenetically from mother to daughter cells by fragmentation of such assemblies. In the N-terminal prion-forming domain, Sup35p has glutamine/asparagine-rich oligopeptide repeats (OPRs, which enable propagation through chaperone-elicited shearing. We have engineered chimeras by replacing the polar OPRs in Sup35p by up to five repeats of a hydrophobic amyloidogenic sequence from the synthetic bacterial prionoid RepA-WH1. The resulting hybrid, [REP-PSI+], i was functional in a stop codon read-through assay in S. cerevisiae; ii generates weak phenotypic variants upon both its expression or transformation into [psi-] cells; iii these variants correlated with high molecular weight aggregates resistant to SDS during electrophoresis; and iv according to fluorescence microscopy, the fusion of the prion domains from the engineered chimeras to the reporter protein mCherry generated perivacuolar aggregate foci in yeast cells. All these are signatures of bona fide yeast prions. As assessed through biophysical approaches, the chimeras assembled as oligomers rather than as the fibers characteristic of [PSI+]. These results suggest that it is the balance between polar and hydrophobic residues in OPRs what determines prion conformational dynamics. In addition, our findings illustrate the feasibility of enabling new propagation traits in yeast prions by engineering OPRs with heterologous amyloidogenic sequence repeats.
Zhou, Minghai; Ottenberg, Gregory; Sferrazza, Gian Franco; Hubbs, Christopher; Fallahi, Mohammad; Rumbaugh, Gavin; Brantley, Alicia F.
2015-01-01
The mechanisms of neuronal death in protein misfolding neurodegenerative diseases such as Alzheimer’s, Parkinson’s and prion diseases are poorly understood. We used a highly toxic misfolded prion protein (TPrP) model to understand neurotoxicity induced by prion protein misfolding. We show that abnormal autophagy activation and neuronal demise is due to severe, neuron-specific, nicotinamide adenine dinucleotide (NAD+) depletion. Toxic prion protein-exposed neuronal cells exhibit dramatic reductions of intracellular NAD+ followed by decreased ATP production, and are completely rescued by treatment with NAD+ or its precursor nicotinamide because of restoration of physiological NAD+ levels. Toxic prion protein-induced NAD+ depletion results from PARP1-independent excessive protein ADP-ribosylations. In vivo, toxic prion protein-induced degeneration of hippocampal neurons is prevented dose-dependently by intracerebral injection of NAD+. Intranasal NAD+ treatment of prion-infected sick mice significantly improves activity and delays motor impairment. Our study reveals NAD+ starvation as a novel mechanism of autophagy activation and neurodegeneration induced by a misfolded amyloidogenic protein. We propose the development of NAD+ replenishment strategies for neuroprotection in prion diseases and possibly other protein misfolding neurodegenerative diseases. PMID:25678560
Treatment with a non-toxic, self-replicating anti-prion delays or prevents prion disease in vivo.
Diaz-Espinoza, R; Morales, R; Concha-Marambio, L; Moreno-Gonzalez, I; Moda, F; Soto, C
2018-03-01
Transmissible spongiform encephalopathies (TSEs) are fatal neurological disorders caused by prions, which are composed of a misfolded protein (PrP Sc ) that self-propagates in the brain of infected individuals by converting the normal prion protein (PrP C ) into the pathological isoform. Here, we report a novel experimental strategy for preventing prion disease based on producing a self-replicating, but innocuous PrP Sc -like form, termed anti-prion, which can compete with the replication of pathogenic prions. Our results show that a prophylactic inoculation of prion-infected animals with an anti-prion delays the onset of the disease and in some animals completely prevents the development of clinical symptoms and brain damage. The data indicate that a single injection of the anti-prion eliminated ~99% of the infectivity associated to pathogenic prions. Furthermore, this treatment caused significant changes in the profile of regional PrP Sc deposition in the brains of animals that were treated, but still succumbed to the disease. Our findings provide new insights for a mechanistic understanding of prion replication and support the concept that prion replication can be separated from toxicity, providing a novel target for therapeutic intervention.
Insights into alternative prion protein topologies induced under high hydrostatic pressure
International Nuclear Information System (INIS)
Torrent, Joan; Alvarez-Martinez, Maria Teresa; Heitz, Frederic; Liautard, Jean-Pierre; Balny, Claude; Lange, Reinhard
2004-01-01
The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP C ) into a misfolded isoform (PrP Sc ). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal α-helical structure is changed into a highly aggregated β-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures
Insights into alternative prion protein topologies induced under high hydrostatic pressure
Energy Technology Data Exchange (ETDEWEB)
Torrent, Joan [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Alvarez-Martinez, Maria Teresa [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Heitz, Frederic [CRBM, CNRS-UPR 1086, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Liautard, Jean-Pierre [INSERM U431, IFR 122, Place Eugene Bataillon, F-34095 Montpellier cedex 5 (France); Balny, Claude [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France); Lange, Reinhard [INSERM U128, IFR 122, 1919 Route de Mende, F-34293 Montpellier cedex 5 (France)
2004-04-14
The critical step in the pathogenesis of transmissible spongiform encephalopathies (TSEs) appears to be a conformational transition of a normal prion protein (PrP{sup C}) into a misfolded isoform (PrP{sup Sc}). To gain insight into the structural conversion of the prion protein we have exploited the use of high hydrostatic pressure combined with various spectroscopic techniques. In vitro transitions of the recombinant PrP to a scrapie-like form have never resulted in an infectious structure. It is our hypothesis that the acquisition of the disease-causing conformation depends on folding pathways which are difficult to attain. We attempt to favour, via specific reaction conditions at high pressure, alternative routes of misfolding leading to a stable infectious amyloidogenic conformer. Our results have demonstrated the potential of high pressure to reveal various prion structural changes, which are inaccessible by conventional methods. Especially, we have characterized a pressure-induced conformer in which the normal {alpha}-helical structure is changed into a highly aggregated {beta}-sheet conformation showing markedly increased resistance to proteolysis (key markers of potential infectious agents). Our work may have important implications, not only for ultimately proving the protein-only hypothesis and for understanding the basic mechanism of the disease, but also for developing preventative and therapeutic measures.
Transmissible Spongiform Encephalopathies (Prion Diseases)
... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ... This research is aimed at determining how abnormal prion proteins lead to disease, at finding better tests ...
Kosmotropic anions promote conversion of recombinant prion protein into a PrPSc-like misfolded form.
Directory of Open Access Journals (Sweden)
Rodrigo Diaz-Espinoza
Full Text Available Prions are self-propagating proteins involved in transmissible spongiform encephalopaties in mammals. An aberrant conformation with amyloid-like features of a cell surface protein, termed prion protein (PrP, is thought to be the essential component of the infectious particle, though accessory co-factor molecules such as lipids and nucleotides may be involved. The cellular co-factors and environmental conditions implicated in PrP misfolding are not completely understood. To address this issue, several studies have been done inducing misfolding of recombinant PrP (recPrP into classical amyloid structures using partially denaturing conditions. In this work, we report that misfolding of recPrP into PrP(Sc-like aggregates can be induced by simply incubating the protein in the presence of kosmotropic salts at concentrations that are known to retain or increase the stability of the protein. We used a simple experimental reaction (protein, buffer and salts submitted to agitation/incubation cycles at physiological temperature and pH. The formation of protease resistant-recPrP was time and salt-concentration dependent and required the presence of kosmotropic anions such as F(- or SO(4(-2. The molecular weights of the protease resistant recPrP fragments are reminiscent of those found in degradation assays of bona fide PrP(Sc. The aggregates also exhibited PrP(Sc-like ultrastructural features including rod-shape morphology under electron microscope, high beta-sheet content and thioflavin-T positive signal. The formation of recPrP aggregates with PrP(Sc biochemical features under conditions closer to physiological in the absence of organic co-factor molecules provides a simple setup that may prove helpful to understand the molecular mechanism of PrP misfolding.
Long-term memory consolidation: The role of RNA-binding proteins with prion-like domains.
Sudhakaran, Indulekha P; Ramaswami, Mani
2017-05-04
Long-term and short-term memories differ primarily in the duration of their retention. At a molecular level, long-term memory (LTM) is distinguished from short-term memory (STM) by its requirement for new gene expression. In addition to transcription (nuclear gene expression) the translation of stored mRNAs is necessary for LTM formation. The mechanisms and functions for temporal and spatial regulation of mRNAs required for LTM is a major contemporary problem, of interest from molecular, cell biological, neurobiological and clinical perspectives. This review discusses primary evidence in support for translational regulatory events involved in LTM and a model in which different phases of translation underlie distinct phases of consolidation of memories. However, it focuses largely on mechanisms of memory persistence and the role of prion-like domains in this defining aspect of long-term memory. We consider primary evidence for the concept that Cytoplasmic Polyadenylation Element Binding (CPEB) protein enables the persistence of formed memories by transforming in prion-like manner from a soluble monomeric state to a self-perpetuating and persistent polymeric translationally active state required for maintaining persistent synaptic plasticity. We further discuss prion-like domains prevalent on several other RNA-binding proteins involved in neuronal translational control underlying LTM. Growing evidence indicates that such RNA regulatory proteins are components of mRNP (RiboNucleoProtein) granules. In these proteins, prion-like domains, being intrinsically disordered, could mediate weak transient interactions that allow the assembly of RNP granules, a source of silenced mRNAs whose translation is necessary for LTM. We consider the structural bases for RNA granules formation as well as functions of disordered domains and discuss how these complicate the interpretation of existing experimental data relevant to general mechanisms by which prion-domain containing RBPs
E.A. Croes (Esther); B.Z. Alizadeh (Behrooz); A.M. Bertoli Avella (Aida); T.A.M. Rademaker (Tessa); J. Vergeer-Drop (Jeannette); B. Dermaut (Bart); J.J. Houwing-Duistermaat (Jeanine); D.P.W.M. Wientjens (Dorothee); A. Hofman (Albert); C. van Broeckhoven (Christine); C.M. van Duijn (Cornelia)
2004-01-01
textabstractThe prion protein gene (PRNP) plays a central role in the origin of Creutzfeldt-Jakob disease (CJD), but there is growing interest in other polymorphisms that may be involved in CJD. Polymorphisms upstream of PRNP that may modulate the prion protein production as well as polymorphisms in
Prion-based memory of heat stress in yeast.
Chernova, Tatiana A; Chernoff, Yury O; Wilkinson, Keith D
2017-05-04
Amyloids and amyloid-based prions are self-perpetuating protein aggregates which can spread by converting a normal protein of the same sequence into a prion form. They are associated with diseases in humans and mammals, and control heritable traits in yeast and other fungi. Some amyloids are implicated in biologically beneficial processes. As prion formation generates reproducible memory of a conformational change, prions can be considered as molecular memory devices. We have demonstrated that in yeast, stress-inducible cytoskeleton-associated protein Lsb2 forms a metastable prion in response to high temperature. This prion promotes conversion of other proteins into prions and can persist in a fraction of cells for a significant number of cell generations after stress, thus maintaining the memory of stress in a population of surviving cells. Acquisition of an amino acid substitution required for Lsb2 to form a prion coincides with acquisition of increased thermotolerance in the evolution of Saccharomyces yeast. Thus the ability to form an Lsb2 prion in response to stress coincides with yeast adaptation to growth at higher temperatures. These findings intimately connect prion formation to the cellular response to environmental stresses.
Prions, From Structure to Epigenetics and Neuronal Functions
Lindquist, Susan
2012-02-01
Prions are a unique type of protein that can misfold and convert other proteins to the same shape. The well-characterized yeast prion [PSI+] is formed from an inactive amyloid fiber conformation of the translation-termination factor, Sup35. This altered conformation is passed from mother cells to daughters, acting as a template to perpetuate the prion state and providing a mechanism of protein-based inheritance. We employed a variety of methods to determine the structure of Sup35 amyloid fibrils. First, using fluorescent tags and cross-linking we identified specific segments of the protein monomer that form intermolecular contacts in a ``Head-to-Head,'' ``Tail-to-Tail'' fashion while a central region forms intramolecular contacts. Then, using peptide arrays we mapped the region responsible for the prion transmission barrier between two different yeast species. We have also used optical tweezers to reveal that the non-covalent intermolecular contacts between monomers are unusually strong, and maintain fibril integrity even under forces that partially unfold individual monomers and extend fibril length. Based on the handful of known yeast prion proteins we predicted sequences that could be responsible for prion-like amyloid folding. Our screen identified 19 new candidate prions, whose protein-folding properties and diverse cellular functions we have characterized using a combination of genetic and biochemical techniques. Prion-driven phenotypic diversity increases under stress, and can be amplified by the dynamic maturation of prion-initiating states. These qualities allow prions to act as ``bet-hedging'' devices that facilitate the adaptation of yeast to stressful environments, and might speed the evolution of new traits. Together with Kandel and Si, we have also found that a regulatory protein that plays an important role in synaptic plasticity behaves as a prion in yeast. Cytoplasmic polyAdenylation element binding protein, CPEB, maintains synapses by promoting
Silva, Christopher J
2018-06-13
Food forensicists need a variety of tools to detect the many possible food contaminants. As a result of its analytical flexibility, mass spectrometry is one of those tools. Use of the multiple reaction monitoring (MRM) method expands its use to quantitation as well as detection of infectious proteins (prions) and protein toxins, such as Shiga toxins. The sample processing steps inactivate prions and Shiga toxins; the proteins are digested with proteases to yield peptides suitable for MRM-based analysis. Prions are detected by their distinct physicochemical properties and differential covalent modification. Shiga toxin analysis is based on detecting peptides derived from the five identical binding B subunits comprising the toxin. 15 N-labeled internal standards are prepared from cloned proteins. These examples illustrate the power of MRM, in that the same instrument can be used to safely detect and quantitate protein toxins, prions, and small molecules that might contaminate our food.
The comprehensive native interactome of a fully functional tagged prion protein.
Directory of Open Access Journals (Sweden)
Dorothea Rutishauser
Full Text Available The enumeration of the interaction partners of the cellular prion protein, PrP(C, may help clarifying its elusive molecular function. Here we added a carboxy proximal myc epitope tag to PrP(C. When expressed in transgenic mice, PrP(myc carried a GPI anchor, was targeted to lipid rafts, and was glycosylated similarly to PrP(C. PrP(myc antagonized the toxicity of truncated PrP, restored prion infectibility of PrP(C-deficient mice, and was physically incorporated into PrP(Sc aggregates, indicating that it possessed all functional characteristics of genuine PrP(C. We then immunopurified myc epitope-containing protein complexes from PrP(myc transgenic mouse brains. Gentle differential elution with epitope-mimetic decapeptides, or a scrambled version thereof, yielded 96 specifically released proteins. Quantitative mass spectrometry with isotope-coded tags identified seven proteins which co-eluted equimolarly with PrP(C and may represent component of a multiprotein complex. Selected PrP(C interactors were validated using independent methods. Several of these proteins appear to exert functions in axomyelinic maintenance.
Molecular Pathology of Human Prion Diseases
Directory of Open Access Journals (Sweden)
2009-03-01
Full Text Available Prion diseases are fatal neurodegenerative conditions in humans and animals. In this review, we summarize the molecular background of phenotypic variability, relation of prion protein (PrP to other proteins associated with neurodegenerative diseases, and pathogenesis of neuronal vulnerability. PrP exists in different forms that may be present in both diseased and non-diseased brain, however, abundant disease-associated PrP together with tissue pathology characterizes prion diseases and associates with transmissibility. Prion diseases have different etiological background with distinct pathogenesis and phenotype. Mutations of the prion protein gene are associated with genetic forms. The codon 129 polymorphism in combination with the Western blot pattern of PrP after proteinase K digestion serves as a basis for molecular subtyping of sporadic Creutzfeldt-Jakob disease. Tissue damage may result from several parallel, interacting or subsequent pathways that involve cellular systems associated with synapses, protein processing, oxidative stress, autophagy, and apoptosis.
A comparative molecular dynamics study on thermostability of human and chicken prion proteins
International Nuclear Information System (INIS)
Ji, Hong-Fang; Zhang, Hong-Yu
2007-01-01
To compare the thermostabilities of human and chicken normal cellular prion proteins (HuPrP C and CkPrP C ), molecular dynamics (MD) simulations were performed for both proteins at an ensemble level (10 parallel simulations at 400 K and 5 parallel simulations at 300 K as a control). It is found that the thermostability of HuPrP C is comparable with that of CkPrP C , which implicates that the non-occurrence of prion diseases in non-mammals cannot be completely attributed to the thermodynamic properties of non-mammalian PrP C
Directory of Open Access Journals (Sweden)
Gordon Hayward
2016-12-01
Full Text Available An acoustic prion assay has been demonstrated for sheep brain samples. Only five false positives and no false negatives were observed in a test of 45 positive and 45 negative samples. The acoustic prion sensor was constructed using a thickness shear mode quartz resonator coated with a covalently bound recombinant prion protein. The characteristic indicator of a scrapie infected sheep brain sample was an observed shoulder in the frequency decrease in response to a sample.The response of the sensor aligns with a conformational shift in the surface protein and with the propagation mechanism of the disease. This alignment is evident in the response timing and shape, dependence on concentration, cross species behaviour and impact of blood plasma. This alignment is far from sufficient to prove the mechanism of the sensor but it does offer the possibility of a rapid and inexpensive additional tool to explore prion disease. Keywords: Prions, Thickness shear mode quartz sensor
High prevalence of a fungal prion
Debets, A.J.M.; Dalstra, H.J.P.; Slakhorst, S.M.; Koopmanschap-Memelink, A.B.; Hoekstra, R.F.; Saupe, S.J.
2012-01-01
Prions are infectious proteins that cause fatal diseases in mammals. Prions have also been found in fungi, but studies on their role in nature are scarce. The proposed biological function of fungal prions is debated and varies from detrimental to benign or even beneficial. [Het-s] is a prion of the
Abdulrahman, Basant A; Abdelaziz, Dalia; Thapa, Simrika; Lu, Li; Jain, Shubha; Gilch, Sabine; Proniuk, Stefan; Zukiwski, Alexander; Schatzl, Hermann M
2017-12-14
Prion diseases are fatal infectious neurodegenerative disorders that affect both humans and animals. The autocatalytic conversion of the cellular prion protein (PrP C ) into the pathologic isoform PrP Sc is a key feature in prion pathogenesis. AR-12 is an IND-approved derivative of celecoxib that demonstrated preclinical activity against several microbial diseases. Recently, AR-12 has been shown to facilitate clearance of misfolded proteins. The latter proposes AR-12 to be a potential therapeutic agent for neurodegenerative disorders. In this study, we investigated the role of AR-12 and its derivatives in controlling prion infection. We tested AR-12 in prion infected neuronal and non-neuronal cell lines. Immunoblotting and confocal microscopy results showed that AR-12 and its analogue AR-14 reduced PrP Sc levels after only 72 hours of treatment. Furthermore, infected cells were cured of PrP Sc after exposure of AR-12 or AR-14 for only two weeks. We partially attribute the influence of the AR compounds on prion propagation to autophagy stimulation, in line with our previous findings that drug-induced stimulation of autophagy has anti-prion effects in vitro and in vivo. Taken together, this study demonstrates that AR-12 and the AR-14 analogue are potential new therapeutic agents for prion diseases and possibly protein misfolding disorders involving prion-like mechanisms.
Veerhuis, Robert; Hoozemans, Jeroen J. M.; Janssen, Ingrid; Boshuizen, Ronald S.; Langeveld, Jan P. M.; Eikelenboom, Piet
2002-01-01
Prion diseases are characterized by accumulation of protease resistant isoforms of prion protein (termed PrP(SC)), glial activation and neurodegeneration. The time course of PrP deposition, appearance of activated microglia, and of neuronal apoptosis in experimentally-induced prion disease suggests
Prion Protein Self-Interactions: a gateway to novel therapeutic strategies?
Rigter, A.
2011-01-01
Transmissible Spongiform Encephalopathies (TSEs) or prion diseases are unique disorders that are not caused by infectious micro-organisms (bacteria or fungi), viruses or parasites, but rather seems to be the result of an infectious protein. TSEs are comprised of fatal neurodegenerative disorders
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrPSc) self-perpetuate by conformational conversion of α-helix-rich PrPC into β sheet enriched form, leading to formation and deposition of PrPSc aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrPSc and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region. PMID:23232499
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W.; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-01-01
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype. PMID:23792955
Takeuchi, Atsuko; Kobayashi, Atsushi; Ironside, James W; Mohri, Shirou; Kitamoto, Tetsuyuki
2013-07-26
To date, all clinical variant Creutzfeldt-Jakob disease (vCJD) patients are homozygous for methionine at polymorphic codon 129 (129M/M) of the prion protein (PrP) gene. However, the appearance of asymptomatic secondary vCJD infection in individuals with a PRNP codon 129 genotype other than M/M and transmission studies using animal models have raised the concern that all humans might be susceptible to vCJD prions, especially via secondary infection. To reevaluate this possibility and to analyze in detail the transmission properties of vCJD prions to transgenic animals carrying distinct codon 129 genotype, we performed intracerebral inoculation of vCJD prions to humanized knock-in mice carrying all possible codon 129 genotypes (129M/M, 129M/V, or 129V/V). All humanized knock-in mouse lines were susceptible to vCJD infection, although the attack rate gradually decreased from 129M/M to 129M/V and to 129V/V. The amount of PrP deposition including florid/amyloid plaques in the brain also gradually decreased from 129M/M to 129M/V and to 129V/V. The biochemical properties of protease-resistant abnormal PrP in the brain and transmissibility of these humanized mouse-passaged vCJD prions upon subpassage into knock-in mice expressing bovine PrP were not affected by the codon 129 genotype. These results indicate that individuals with the 129V/V genotype may be more susceptible to secondary vCJD infection than expected and may lack the neuropathological characteristics observed in vCJD patients with the 129M/M genotype. Besides the molecular typing of protease-resistant PrP in the brain, transmission studies using knock-in mice carrying bovine PrP may aid the differential diagnosis of secondary vCJD infection, especially in individuals with the 129V/V genotype.
Brain delivery of AAV9 expressing an anti-PrP monovalent antibody delays prion disease in mice.
Moda, Fabio; Vimercati, Chiara; Campagnani, Ilaria; Ruggerone, Margherita; Giaccone, Giorgio; Morbin, Michela; Zentilin, Lorena; Giacca, Mauro; Zucca, Ileana; Legname, Giuseppe; Tagliavini, Fabrizio
2012-01-01
Prion diseases are caused by a conformational modification of the cellular prion protein (PrP (C)) into disease-specific forms, termed PrP (Sc), that have the ability to interact with PrP (C) promoting its conversion to PrP (Sc). In vitro studies demonstrated that anti-PrP antibodies inhibit this process. In particular, the single chain variable fragment D18 antibody (scFvD18) showed high efficiency in curing chronically prion-infected cells. This molecule binds the PrP (C) region involved in the interaction with PrP (Sc) thus halting further prion formation. These findings prompted us to test the efficiency of scFvD18 in vivo. A recombinant Adeno-Associated Viral vector serotype 9 was used to deliver scFvD18 to the brain of mice that were subsequently infected by intraperitoneal route with the mouse-adapted scrapie strain RML. We found that the treatment was safe, prolonged the incubation time of scrapie-infected animals and decreased the burden of total proteinase-resistant PrP (Sc) in the brain, suggesting that scFvD18 interferes with prion replication in vivo. This approach is relevant for designing new therapeutic strategies for prion diseases and other disorders characterized by protein misfolding.
Johnson, Christopher J.; Carlson, Christina M.; Morawski, Aaron R.; Manthei, Alyson; Cashman, Neil R.
2015-01-01
Studies to understanding interspecies transmission of transmissible spongiform encephalopathies (TSEs, prion diseases) are challenging in that they typically rely upon lengthy and costly in vivo animal challenge studies. A number of in vitro assays have been developed to aid in measuring prion species barriers, thereby reducing animal use and providing quicker results than animal bioassays. Here, we present the protocol for a rapid in vitroprion conversion assay called the conversion efficiency ratio (CER) assay. In this assay cellular prion protein (PrPC) from an uninfected host brain is denatured at both pH 7.4 and 3.5 to produce two substrates. When the pH 7.4 substrate is incubated with TSE agent, the amount of PrPC that converts to a proteinase K (PK)-resistant state is modulated by the original host’s species barrier to the TSE agent. In contrast, PrPC in the pH 3.5 substrate is misfolded by any TSE agent. By comparing the amount of PK-resistant prion protein in the two substrates, an assessment of the host’s species barrier can be made. We show that the CER assay correctly predicts known prion species barriers of laboratory mice and, as an example, show some preliminary results suggesting that bobcats (Lynx rufus) may be susceptible to white-tailed deer (Odocoileus virginianus) chronic wasting disease agent.
Statistical Mechanics of Prion Diseases
International Nuclear Information System (INIS)
Slepoy, A.; Singh, R. R. P.; Pazmandi, F.; Kulkarni, R. V.; Cox, D. L.
2001-01-01
We present a two-dimensional, lattice based, protein-level statistical mechanical model for prion diseases (e.g., mad cow disease) with concomitant prion protein misfolding and aggregation. Our studies lead us to the hypothesis that the observed broad incubation time distribution in epidemiological data reflect fluctuation dominated growth seeded by a few nanometer scale aggregates, while much narrower incubation time distributions for innoculated lab animals arise from statistical self-averaging. We model ''species barriers'' to prion infection and assess a related treatment protocol
Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich
2015-01-01
Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high Pr...
Comparative Study of Prions in Iatrogenic and Sporadic Creutzfeldt-Jakob Disease
Xiao, Xiangzhu; Yuan, Jue; Qing, Liuting; Cali, Ignazio; Mikol, Jacqueline; Delisle, Marie-Bernadette; Uro-Coste, Emmanuelle; Zeng, Liang; Abouelsaad, Mai; Gazgalis, Dimitris; Martinez, Manuel Camacho; Wang, Gong-Xian; Brown, Paul; Ironside, James W.; Gambetti, Pierluigi; Kong, Qingzhong; Zou, Wen-Quan
2014-01-01
Differentiating iatrogenic Creutzfeldt-Jakob disease (iCJD) from sporadic CJD (sCJD) would be useful for the identification and prevention of human-to-human prion transmission. Currently, the diagnosis of iCJD depends on identification of a recognized source of contamination to which patients have been exposed, in addition to fulfilling basic requirements for the establishment of diagnosis of CJD. Attempts to identify differences in clinical manifestations, neuropathological changes and pathological prion protein (PrPSc) between iCJD and sCJD have been unsuccessful. In the present study, using a variety of more sophisticated methods including sucrose step gradient sedimentation, conformational stability immunoassay, protein misfolding cyclic amplification (PMCA), fragment-mapping, and transmission study, we show no significant differences in gel profiles, oligomeric state, conformational stability and infectivity of PrPSc between iCJD and sCJD. However, using PMCA, we find that convertibility and amplification efficiency of PrPSc is greater in iCJD than in sCJD in a polymorphism-dependent manner. Moreover, two protease-resistant PrP C-terminal fragments (termed PrP-CTF12/13) were detected in all 9 cases of sCJD but not in 6 of 8 cases of iCJD tested in this study. The use of fragment mapping- and PMCA-based assays thus provides a means to distinguish most cases of iCJD from sCJD. PMID:25419482
Molecular dynamics study of the dominant-negative E219K polymorphism in human prion protein
Jahandideh, Samad; Jamalan, Mostafa; Faridounnia, Maryam|info:eu-repo/dai/nl/338666923
2015-01-01
Human prion diseases are associated with misfolding or aggregation of the Human Prion Protein (HuPrP). Missense mutations in the HuPrP gene, contribute to conversion of HuPrP(C) to HuPrP(Sc) and amyloid formation. Based on our previous comprehensive study, three missense mutations, from two
Polymorphisms of the prion protein gene Arabi sheep breed in Iran
African Journals Online (AJOL)
Novin
2011-11-09
Nov 9, 2011 ... Key words: Prion protein gene (Prnp), polymorphisms, susceptibility, scrapie. INTRODUCTION. Scrapie is an invariably fatal .... consists of a DNA denaturation step (5 min at 95°C), followed by 30 amplification cycles ...
Mabbott, Neil A
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrP (Sc), an abnormally folded isoform of the cellular prion protein (PrP (C)), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases.
Johnson, Christopher J.; Morawski, A.R.; Carlson, C.M.; Chang, H.
2013-01-01
Background: Transmissible spongiform encephalopathies (TSEs) affect both domestic sheep (scrapie) and captive and free-ranging cervids (chronic wasting disease; CWD). The geographical range of bighorn sheep (Ovis canadensis; BHS) overlaps with states or provinces that have contained scrapie-positive sheep or goats and areas with present epizootics of CWD in cervids. No TSEs have been documented in BHS, but the susceptibility of this species to TSEs remains unknown. Results: We acquired a library of BHS tissues and found no evidence of preexisting TSEs in these animals. The prion protein gene (Prnp) in all BHS in our library was identical to scrapie-susceptible domestic sheep (A136R 154Q171). Using an in vitro prion protein conversion assay, which has been previously used to assess TSE species barriers and, in our study appears to recollect known species barriers in mice, we assessed the potential transmissibility of TSEs to BHS. As expected based upon Prnp genotype, we observed BHS prion protein conversion by classical scrapie agent and evidence for a species barrier between transmissible mink encephalopathy (TME) and BHS. Interestingly, our data suggest that the species barrier of BHS to white-tailed deer or wapiti CWD agents is likely low. We also used protein misfolding cyclic amplification to confirm that CWD, but not TME, can template prion protein misfolding in A136R 154Q171genotype sheep. Conclusions: Our results indicate the in vitro conversion assay used in our study does mimic the species barrier of mice to the TSE agents that we tested. Based on Prnp genotype and results from conversion assays, BHS are likely to be susceptible to infection by classical scrapie. Despite mismatches in amino acids thought to modulate prion protein conversion, our data indicate that A136R154Q171 genotype sheep prion protein is misfolded by CWD agent, suggesting that these animals could be susceptible to CWD. Further investigation of TSE transmissibility to BHS, including
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp ?/?) mice. So far, six types of Prnp ?/? mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not ...
Madsen-Bouterse, Sally A; Schneider, David A; Zhuang, Dongyue; Dassanayake, Rohana P; Balachandran, Aru; Mitchell, Gordon B; O'Rourke, Katherine I
2016-09-01
Development of mice expressing either ovine (Tg338) or cervid (TgElk) prion protein (PrP) have aided in characterization of scrapie and chronic wasting disease (CWD), respectively. Experimental inoculation of sheep with CWD prions has demonstrated the potential for interspecies transmission but, infection with CWD versus classical scrapie prions may be difficult to differentiate using validated diagnostic platforms. In this study, mouse bioassay in Tg338 and TgElk was utilized to evaluate transmission of CWD versus scrapie prions from small ruminants. Mice (≥5 per homogenate) were inoculated with brain homogenates from clinically affected sheep or goats with naturally acquired classical scrapie, white-tailed deer with naturally acquired CWD (WTD-CWD) or sheep with experimentally acquired CWD derived from elk (sheep-passaged-CWD). Survival time (time to clinical disease) and attack rates (brain accumulation of protease resistant PrP, PrPres) were determined. Inoculation with classical scrapie prions resulted in clinical disease and 100 % attack rates in Tg338, but no clinical disease at endpoint (>300 days post-inoculation, p.i.) and low attack rates (6.8 %) in TgElk. Inoculation with WTD-CWD prions yielded no clinical disease or brain PrPres accumulation in Tg338 at endpoint (>500 days p.i.), but rapid onset of clinical disease (~121 days p.i.) and 100 % attack rate in TgElk. Sheep-passaged-CWD resulted in transmission to both mouse lines with 100 % attack rates at endpoint in Tg338 and an attack rate of ~73 % in TgElk with some culled due to clinical disease. These primary transmission observations demonstrate the potential of bioassay in Tg338 and TgElk to help differentiate possible infection with CWD versus classical scrapie prions in sheep and goats.
Matías-Guiu, Jordi A; Guerrero-Márquez, Carmen; Cabrera-Martín, María Nieves; Gómez-Pinedo, Ulises; Romeral, María; Mayo, Diego; Porta-Etessam, Jesús; Moreno-Ramos, Teresa; Carreras, José Luis; Matías-Guiu, Jorge
2017-05-04
The role of positron emission tomography (PET) in Creutzfeldt-Jakob disease is less defined than in other neurodegenerative diseases. We studied the correlation between the uptake of 18 F-florbetaben and 18 F-fluorodeoxyglucose with pathological prion protein deposition in histopathology in a case. A patient with 80 y old with a rapid neurological deterioration with a confirmed diagnosis of CJD was studied. PET and MRI studies were performed between 13-20 d before the death. A region of interest analysis was performed using Statistical Parametric Mapping. MRI showed atrophy with no other alterations. FDG-PET showed extensive areas of hypometabolism including left frontoparietal lobes as well as bilateral thalamus. Correlation between uptake of 18 F-florbetaben and pathological prion protein deposition was r = 0.786 (p < 0.05). Otherwise, correlation between uptake of 18 F-FDG and pathological prion protein was r = 0.357 (p = 0.385). Immunohistochemistry with β-amyloid did not show amyloid deposition or neuritic plaques. Our study supports the use of FDG-PET in the assessment of CJD. FDG-PET may be especially useful in cases of suspected CJD and negative MRI. Furthermore, this case report provides more evidence about the behavioral of amyloid tracers, and the possibility of a low-affinity binding to other non-amyloid proteins, such as the pathological prion protein, is discussed.
Relationship between magnetism and prion protein
Directory of Open Access Journals (Sweden)
F. Balzano
2010-01-01
Full Text Available The mechanism of conversion of the normal prion protein (PrPC into aggregates of its pathological conformer (PrPSc reamins unclear. The aim of this study was to evaluate the effects induced by exposure of biological samples containing PrPSC to a magnetic field induced prominent molecular changes of samples indicated by the IR spectra located in the region that contains contribution primarily from absorption of amides. This finding suggests the existence of a strong correlation between magnetism and PrPsc and supports a new hypothesis that explains the conversion of normal PrPc to abnormal isoform PrPsc.
Martin, Gary R; Sharkey, Keith A; Jirik, Frank R
2015-05-01
The oral uptake of infectious prions represents a common way to acquire a prion disease; thus, host factors, such as gut inflammation and intestinal "leakiness", have the potential to influence infectivity. For example, the ingestion of nonsteroidal anti-inflammatory drugs (NSAIDs) is known to induce intestinal inflammation and increase intestinal permeability. Previously, we reported that normal cellular prion protein (PrP(C)) expression was increased in experimental colitis, and since the level of PrP(C) expressed is a determinant of prion disease propagation, we hypothesized that NSAID administration prior to the oral inoculation of mice with infectious prions would increase intestinal PrP(C) expression and accelerate the onset of neurological disease. In the long-term experiments, one group of mice was gavaged with indomethacin, followed by a second gavage with brain homogenate containing mouse-adapted scrapie (ME7). Control mice received ME7 brain homogenate alone. Brain and splenic tissues were harvested at several time points for immunoblotting, including at the onset of clinical signs of disease. In a second series of experiments, mice were gavaged with indomethacin to assess the acute effects of this treatment on intestinal PrP(C) expression. Acutely, NSAID treatment reduced intestinal PrP(C) expression, and chronically, there was a modest delay in the onset of neurological disease. In contrast to our hypothesis, brief exposure to an NSAID decreased intestinal PrP(C) expression and led to a modest survival advantage following oral ingestion of infectious prions.
Inactivation of Template-Directed Misfolding of Infectious Prion Protein by Ozone
Ding, Ning; Price, Luke M.; Braithwaite, Shannon L.; Balachandran, Aru; Belosevic, Miodrag
2012-01-01
Misfolded prions (PrPSc) are well known for their resistance to conventional decontamination processes. The potential risk of contamination of the water environment, as a result of disposal of specified risk materials (SRM), has raised public concerns. Ozone is commonly utilized in the water industry for inactivation of microbial contaminants and was tested in this study for its ability to inactivate prions (263K hamster scrapie = PrPSc). Treatment variables included initial ozone dose (7.6 to 25.7 mg/liter), contact time (5 s and 5 min), temperature (4°C and 20°C), and pH (pH 4.4, 6.0, and 8.0). Exposure of dilute suspensions of the infected 263K hamster brain homogenates (IBH) (0.01%) to ozone resulted in the in vitro destruction of the templating properties of PrPSc, as measured by the protein misfolding cyclic amplification (PMCA) assay. The highest levels of prion inactivation (≥4 log10) were observed with ozone doses of 13.0 mg/liter, at pH 4.4 and 20°C, resulting in a CT (the product of residual ozone concentration and contact time) value as low as 0.59 mg · liter−1 min. A comparison of ozone CT requirements among various pathogens suggests that prions are more susceptible to ozone degradation than some model bacteria and protozoa and that ozone treatment may be an effective solution for inactivating prions in water and wastewater. PMID:22138993
Directory of Open Access Journals (Sweden)
Katsufumi Tomobe
2016-05-01
Full Text Available The conformational change from the cellular prion protein (PrPc to scrapie prion protein (PrPsc is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.
Tomobe, Katsufumi; Yamamoto, Eiji; Akimoto, Takuma; Yasui, Masato; Yasuoka, Kenji
2016-05-01
The conformational change from the cellular prion protein (PrPc) to scrapie prion protein (PrPsc) is a key process in prion diseases. The prion protein has buried water molecules which significantly contribute to the stability of the protein; however, there has been no report investigating the influence on the buried hydration sites by a pathogenic mutation not adjacent to the buried hydration sites. Here, we perform molecular dynamics simulations of wild type (WT) PrPc and pathogenic point mutant T188R to investigate conformational changes and the buried hydration sites. In WT-PrPc, four buried hydration sites are identified by residence time and rotational relaxation analysis. However, there are no stable buried hydration sites in one of T188R simulations, which indicates that T188R sometimes makes the buried hydration sites fragile. We also find that fluctuations of subdomains S1-H1-S2 and H1-H2 increase in T188R when the buried hydration sites become unstable. Since the side chain of arginine which is replaced from threonine in T188R is larger than of threonine, the side chain cannot be embedded in the protein, which is one of the causes of the instability of subdomains. These results show correlations between the buried hydration sites and the mutation which is far from them, and provide a possible explanation for the instability by mutation.
Prion protein inhibits microtubule assembly by inducing tubulin oligomerization
International Nuclear Information System (INIS)
Nieznanski, Krzysztof; Podlubnaya, Zoya A.; Nieznanska, Hanna
2006-01-01
A growing body of evidence points to an association of prion protein (PrP) with microtubular cytoskeleton. Recently, direct binding of PrP to tubulin has also been found. In this work, using standard light scattering measurements, sedimentation experiments, and electron microscopy, we show for First time the effect of a direct interaction between these proteins on tubulin polymerization. We demonstrate that full-length recombinant PrP induces a rapid increase in the turbidity of tubulin diluted below the critical concentration for microtubule assembly. This effect requires magnesium ions and is weakened by NaCl. Moreover, the PrP-induced light scattering structures of tubulin are cold-stable. In preparations of diluted tubulin incubated with PrP, electron microscopy revealed the presence of ∼50 nm disc-shaped structures not reported so far. These unique tubulin oligomers may form large aggregates. The effect of PrP is more pronounced under the conditions promoting microtubule formation. In these tubulin samples, PrP induces formation of the above oligomers associated with short protofilaments and sheets of protofilaments into aggregates. Noticeably, this is accompanied by a significant reduction of the number and length of microtubules. Hence, we postulate that prion protein may act as an inhibitor of microtubule assembly by inducing formation of stable tubulin oligomers
Prions (PrPSc) are molecular pathogens that are able to convert the isosequential normal cellular prion protein (PrPC) into a prion. The only demonstrated differences between PrPC and PrPSc is conformational, they are isoforms. A given host can be infected by more than one kind or strain of prion. F...
Accelerating Yeast Prion Biology using Droplet Microfluidics
Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David
2012-02-01
Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.
Variation in the prion protein sequence in Dutch goat breeds
Windig, J.J.; Hoving, R.A.H.; Priem, J.; Bossers, A.; Keulen, van L.J.M.; Langeveld, J.P.M.
2016-01-01
Scrapie is a neurodegenerative disease occurring in goats and sheep. Several haplotypes of the prion protein increase resistance to scrapie infection and may be used in selective breeding to help eradicate scrapie. In this study, frequencies of the allelic variants of the PrP gene are determined
Background: Transmissible spongiform encephalopathies (TSEs) or prion diseases are caused by the propagation of a misfolded form (PrP**d) of the normal cellular prion protein, PrP**c. Recently, we have reported the generation and characterization of PrP**C-deficient cattle (PrP-/-) produced by a seq...
Victoria, Guiliana Soraya; Zurzolo, Chiara
2015-09-02
Several neurodegenerative diseases such as transmissible spongiform encephalopathies, Alzheimer's and Parkinson's diseases are caused by the conversion of cellular proteins to a pathogenic conformer. Despite differences in the primary structure and subcellular localization of these proteins, which include the prion protein, α-synuclein and amyloid precursor protein (APP), striking similarity has been observed in their ability to seed and convert naïve protein molecules as well as transfer between cells. This review aims to cover what is known about the intracellular trafficking of these proteins as well as their degradation mechanisms and highlight similarities in their movement through the endocytic pathway that could contribute to the pathogenic conversion and seeding of these proteins which underlies the basis of these diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
Intraperitoneal Infection of Wild-Type Mice with Synthetically Generated Mammalian Prion.
Directory of Open Access Journals (Sweden)
Xinhe Wang
2015-07-01
Full Text Available The prion hypothesis postulates that the infectious agent in transmissible spongiform encephalopathies (TSEs is an unorthodox protein conformation based agent. Recent successes in generating mammalian prions in vitro with bacterially expressed recombinant prion protein provide strong support for the hypothesis. However, whether the pathogenic properties of synthetically generated prion (rec-Prion recapitulate those of naturally occurring prions remains unresolved. Using end-point titration assay, we showed that the in vitro prepared rec-Prions have infectious titers of around 104 LD50/μg. In addition, intraperitoneal (i.p. inoculation of wild-type mice with rec-Prion caused prion disease with an average survival time of 210-220 days post inoculation. Detailed pathological analyses revealed that the nature of rec-Prion induced lesions, including spongiform change, disease specific prion protein accumulation (PrP-d and the PrP-d dissemination amongst lymphoid and peripheral nervous system tissues, the route and mechanisms of neuroinvasion were all typical of classical rodent prions. Our results revealed that, similar to naturally occurring prions, the rec-Prion has a titratable infectivity and is capable of causing prion disease via routes other than direct intra-cerebral challenge. More importantly, our results established that the rec-Prion caused disease is pathogenically and pathologically identical to naturally occurring contagious TSEs, supporting the concept that a conformationally altered protein agent is responsible for the infectivity in TSEs.
Aulić, Suzana; Masperone, Lara; Narkiewicz, Joanna; Isopi, Elisa; Bistaffa, Edoardo; Ambrosetti, Elena; Pastore, Beatrice; De Cecco, Elena; Scaini, Denis; Zago, Paola; Moda, Fabio; Tagliavini, Fabrizio; Legname, Giuseppe
2017-08-30
The precise molecular mechanism of how misfolded α-synuclein (α-Syn) accumulates and spreads in synucleinopathies is still unknown. Here, we show the role of the cellular prion protein (PrP C ) in mediating the uptake and the spread of recombinant α-Syn amyloids. The in vitro data revealed that the presence of PrP C fosters the higher uptake of α-Syn amyloid fibrils, which was also confirmed in vivo in wild type (Prnp +/+ ) compared to PrP knock-out (Prnp -/- ) mice. Additionally, the presence of α-Syn amyloids blocked the replication of scrapie prions (PrP Sc ) in vitro and ex vivo, indicating a link between the two proteins. Indeed, whilst PrP C is mediating the internalization of α-Syn amyloids, PrP Sc is not able to replicate in their presence. This observation has pathological relevance, since several reported case studies show that the accumulation of α-Syn amyloid deposits in Creutzfeldt-Jakob disease patients is accompanied by a longer disease course.
Proteomics analyses for the global proteins in the brain tissues of different human prion diseases.
Shi, Qi; Chen, Li-Na; Zhang, Bao-Yun; Xiao, Kang; Zhou, Wei; Chen, Cao; Zhang, Xiao-Mei; Tian, Chan; Gao, Chen; Wang, Jing; Han, Jun; Dong, Xiao-Ping
2015-04-01
Proteomics changes of brain tissues have been described in different neurodegenerative diseases including Alzheimer's disease and Parkinson's disease. However, the brain proteomics of human prion disease remains less understood. In the study, the proteomics patterns of cortex and cerebellum of brain tissues of sporadic Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD were analyzed with isobaric tags for relative and absolute quantitation combined with multidimensional liquid chromatography and MS analysis, with the brains from three normal individuals as controls. Global protein profiling, significant pathway, and functional categories were analyzed. In total, 2287 proteins were identified with quantitative information both in cortex and cerebellum regions. Cerebellum tissues appeared to contain more up- and down-regulated proteins (727 proteins) than cortex regions (312 proteins) of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD. Viral myocarditis, Parkinson's disease, Alzheimer's disease, lysosome, oxidative phosphorylation, protein export, and drug metabolism-cytochrome P450 were the most commonly affected pathways of the three kinds of diseases. Almost coincident biological functions were identified in the brain tissues of the three diseases. In all, data here demonstrate that the brain tissues of Creutzfeldt-Jakob disease, fatal familial insomnia, and G114V genetic CJD have obvious proteomics changes at their terminal stages, which show the similarities not only among human prion diseases but also with other neurodegeneration diseases. This is the first study to provide a reference proteome map for human prion diseases and will be helpful for future studies focused on potential biomarkers for the diagnosis and therapy of human prion diseases. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Yuan, Zhen; Yang, Lifeng; Chen, Baian; Zhu, Ting; Hassan, Mohammad Farooque; Yin, Xiaomin; Zhou, Xiangmei; Zhao, Deming
2015-06-01
The formation of neurotoxic prion protein (PrP) oligomers is thought to be a key step in the development of prion diseases. Recently, it was determined that the sonication and shaking of recombinant PrP can convert PrP monomers into β-state oligomers. Herein, we demonstrate that β-state oligomeric PrP can be generated through protein misfolding cyclic amplification from recombinant full-length hamster, human, rabbit, and mutated rabbit PrP, and that these oligomers can be used for subsequent research into the mechanisms of PrP-induced neurotoxicity. We have characterized protein misfolding cyclic amplification-induced monomer-to-oligomer conversion of PrP from three species using western blotting, circular dichroism, size-exclusion chromatography, and resistance to proteinase K (PK) digestion. We have further shown that all of the resulting β-oligomers are toxic to primary mouse cortical neurons independent of the presence of PrP(C) in the neurons, whereas the corresponding monomeric PrP were not toxic. In addition, we found that this toxicity is the result of oligomer-induced apoptosis via regulation of Bcl-2, Bax, and caspase-3 in both wild-type and PrP(-/-) cortical neurons. It is our hope that these results may contribute to our understanding of prion transformation within the brain. We found that β-state oligomeric PrPs can be generated through protein misfolding cyclic amplification (PMCA) from recombinant full-length hamster, human, rabbit, and mutated rabbit PrP. β-oligomers are toxic to primary mouse cortical neurons independent of the presence of PrP(C) in the neurons, while the corresponding monomeric PrPs were not toxic. This toxicity is the result of oligomers-induced apoptosis via regulation of Bcl-2, Bax, and caspase-3. These results may contribute to our understanding of prion transformation within the brain. © 2015 International Society for Neurochemistry.
International Nuclear Information System (INIS)
Haigh, Cathryn L.; Drew, Simon C.
2015-01-01
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation
Energy Technology Data Exchange (ETDEWEB)
Haigh, Cathryn L., E-mail: chaigh@unimelb.edu.au [Department of Pathology, The University of Melbourne, Victoria 3010 (Australia); Drew, Simon C., E-mail: sdrew@unimelb.edu.au [Florey Department of Neuroscience and Mental Health, The University of Melbourne, Victoria 3010 (Australia)
2015-06-05
The protein misfolding cyclic amplification (PMCA) technique has become a widely-adopted method for amplifying minute amounts of the infectious conformer of the prion protein (PrP). PMCA involves repeated cycles of 20 kHz sonication and incubation, during which the infectious conformer seeds the conversion of normally folded protein by a templating interaction. Recently, it has proved possible to create an infectious PrP conformer without the need for an infectious seed, by including RNA and the phospholipid POPG as essential cofactors during PMCA. The mechanism underpinning this de novo prion formation remains unknown. In this study, we first establish by spin trapping methods that cavitation bubbles formed during PMCA provide a radical-rich environment. Using a substrate preparation comparable to that employed in studies of de novo prion formation, we demonstrate by immuno-spin trapping that PrP- and RNA-centered radicals are generated during sonication, in addition to PrP-RNA cross-links. We further show that serial PMCA produces protease-resistant PrP that is oxidatively modified. We suggest a unique confluence of structural (membrane-mimetic hydrophobic/hydrophilic bubble interface) and chemical (ROS) effects underlie the phenomenon of de novo prion formation by PMCA, and that these effects have meaningful biological counterparts of possible relevance to spontaneous prion formation in vivo. - Highlights: • Sonication during PMCA generates free radicals at the surface of cavitation bubbles. • PrP-centered and RNA-centered radicals are formed in addition to PrP-RNA adducts. • De novo prions may result from ROS and structural constraints during cavitation.
Glycoform-selective prion formation in sporadic and familial forms of prion disease
Xiao, X.; Yuan, J.; Haïk, S.; Cali, I.; Zhan, Y.; Moudjou, M.; Li, B.; Laplanche, J.L.; Laude, H.; Langeveld, J.P.M.; Gambetti, P.
2013-01-01
The four glycoforms of the cellular prion protein (PrP(C)) variably glycosylated at the two N-linked glycosylation sites are converted into their pathological forms (PrP(Sc)) in most cases of sporadic prion diseases. However, a prominent molecular characteristic of PrP(Sc) in the recently identified
Directory of Open Access Journals (Sweden)
Carol L Ladner-Keay
Full Text Available The formation of β-sheet rich prion oligomers and fibrils from native prion protein (PrP is thought to be a key step in the development of prion diseases. Many methods are available to convert recombinant prion protein into β-sheet rich fibrils using various chemical denaturants (urea, SDS, GdnHCl, high temperature, phospholipids, or mildly acidic conditions (pH 4. Many of these methods also require shaking or another form of agitation to complete the conversion process. We have identified that shaking alone causes the conversion of recombinant PrP to β-sheet rich oligomers and fibrils at near physiological pH (pH 5.5 to pH 6.2 and temperature. This conversion does not require any denaturant, detergent, or any other chemical cofactor. Interestingly, this conversion does not occur when the water-air interface is eliminated in the shaken sample. We have analyzed shaking-induced conversion using circular dichroism, resolution enhanced native acidic gel electrophoresis (RENAGE, electron microscopy, Fourier transform infrared spectroscopy, thioflavin T fluorescence and proteinase K resistance. Our results show that shaking causes the formation of β-sheet rich oligomers with a population distribution ranging from octamers to dodecamers and that further shaking causes a transition to β-sheet fibrils. In addition, we show that shaking-induced conversion occurs for a wide range of full-length and truncated constructs of mouse, hamster and cervid prion proteins. We propose that this method of conversion provides a robust, reproducible and easily accessible model for scrapie-like amyloid formation, allowing the generation of milligram quantities of physiologically stable β-sheet rich oligomers and fibrils. These results may also have interesting implications regarding our understanding of prion conversion and propagation both within the brain and via techniques such as protein misfolding cyclic amplification (PMCA and quaking induced conversion (QuIC.
Grass Plants Bind, Retain, Uptake, and Transport Infectious Prions
Directory of Open Access Journals (Sweden)
Sandra Pritzkow
2015-05-01
Full Text Available Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrPSc to plants. Small quantities of PrPSc contained in diluted brain homogenate or in excretory materials (urine and feces can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrPSc for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves. These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease.
Insights into the physiological function of cellular prion protein
Directory of Open Access Journals (Sweden)
Martins V.R.
2001-01-01
Full Text Available Prions have been extensively studied since they represent a new class of infectious agents in which a protein, PrPsc (prion scrapie, appears to be the sole component of the infectious particle. They are responsible for transmissible spongiform encephalopathies, which affect both humans and animals. The mechanism of disease propagation is well understood and involves the interaction of PrPsc with its cellular isoform (PrPc and subsequently abnormal structural conversion of the latter. PrPc is a glycoprotein anchored on the cell surface by a glycosylphosphatidylinositol moiety and expressed in most cell types but mainly in neurons. Prion diseases have been associated with the accumulation of the abnormally folded protein and its neurotoxic effects; however, it is not known if PrPc loss of function is an important component. New efforts are addressing this question and trying to characterize the physiological function of PrPc. At least four different mouse strains in which the PrP gene was ablated were generated and the results regarding their phenotype are controversial. Localization of PrPc on the cell membrane makes it a potential candidate for a ligand uptake, cell adhesion and recognition molecule or a membrane signaling molecule. Recent data have shown a potential role for PrPc in the metabolism of copper and moreover that this metal stimulates PrPc endocytosis. Our group has recently demonstrated that PrPc is a high affinity laminin ligand and that this interaction mediates neuronal cell adhesion and neurite extension and maintenance. Moreover, PrPc-caveolin-1 dependent coupling seems to trigger the tyrosine kinase Fyn activation. These data provide the first evidence for PrPc involvement in signal transduction.
Kim, Soochan; Han, Sinsuk; Lee, Ye Eun; Jung, Woong-Jae; Lee, Hyung Soo; Kim, Yong-Sun; Choi, Eun-Kyoung; Kim, Mi-Yeon
2016-01-01
The cellular prion protein is expressed in almost all tissues, including the central nervous system and lymphoid tissues. To investigate the effects of the prion protein in lymphoid cells and spleen structure formation, we used prion protein-deficient (Prnp(0/0)) Zürich I mice generated by inactivation of the Prnp gene. Prnp(0/0) mice had decreased lymphocytes, in particular, CD4 T cells and lymphoid tissue inducer (LTi) cells. Decreased CD4 T cells resulted from impaired expression of CCL19 and CCL21 in the spleen rather than altered chemokine receptor CCR7 expression. Importantly, some of the white pulp regions in spleens from Prnp(0/0) mice displayed impaired T zone structure as a result of decreased LTi cell numbers and altered expression of the lymphoid tissue-organizing genes lymphotoxin-α and CXCR5, although expression of the lymphatic marker podoplanin and CXCL13 by stromal cells was not affected. In addition, CD3(-)CD4(+)IL-7Rα(+) LTi cells were rarely detected in impaired white pulp in spleens of these mice. These data suggest that the prion protein is required to form the splenic white pulp structure and for development of normal levels of CD4 T and LTi cells. Copyright © 2015. Published by Elsevier GmbH.
Vilches, Silvia; Vergara, Cristina; Nicolás, Oriol; Mata, Ágata; Del Río, José A; Gavín, Rosalina
2016-09-01
The biological functions of the cellular prion protein remain poorly understood. In fact, numerous studies have aimed to determine specific functions for the different protein domains. Studies of cellular prion protein (PrP(C)) domains through in vivo expression of molecules carrying internal deletions in a mouse Prnp null background have provided helpful data on the implication of the protein in signalling cascades in affected neurons. Nevertheless, understanding of the mechanisms underlying the neurotoxicity induced by these PrP(C) deleted forms is far from complete. To better define the neurotoxic or neuroprotective potential of PrP(C) N-terminal domains, and to overcome the heterogeneity of results due to the lack of a standardized model, we used neuroblastoma cells to analyse the effects of overexpressing PrP(C) deleted forms. Results indicate that PrP(C) N-terminal deleted forms were properly processed through the secretory pathway. However, PrPΔF35 and PrPΔCD mutants led to death by different mechanisms sharing loss of alpha-cleavage and activation of caspase-3. Our data suggest that both gain-of-function and loss-of-function pathogenic mechanisms may be associated with N-terminal domains and may therefore contribute to neurotoxicity in prion disease. Dissecting the molecular response induced by PrPΔF35 may be the key to unravelling the physiological and pathological functions of the prion protein.
Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich
2015-01-01
ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451
Prion replication without host adaptation during interspecies transmissions.
Bian, Jifeng; Khaychuk, Vadim; Angers, Rachel C; Fernández-Borges, Natalia; Vidal, Enric; Meyerett-Reid, Crystal; Kim, Sehun; Calvi, Carla L; Bartz, Jason C; Hoover, Edward A; Agrimi, Umberto; Richt, Jürgen A; Castilla, Joaquín; Telling, Glenn C
2017-01-31
Adaptation of prions to new species is thought to reflect the capacity of the host-encoded cellular form of the prion protein (PrP C ) to selectively propagate optimized prion conformations from larger ensembles generated in the species of origin. Here we describe an alternate replicative process, termed nonadaptive prion amplification (NAPA), in which dominant conformers bypass this requirement during particular interspecies transmissions. To model susceptibility of horses to prions, we produced transgenic (Tg) mice expressing cognate PrP C Although disease transmission to only a subset of infected TgEq indicated a significant barrier to EqPrP C conversion, the resulting horse prions unexpectedly failed to cause disease upon further passage to TgEq. TgD expressing deer PrP C was similarly refractory to deer prions from diseased TgD infected with mink prions. In both cases, the resulting prions transmitted to mice expressing PrP C from the species of prion origin, demonstrating that transmission barrier eradication of the originating prions was ephemeral and adaptation superficial in TgEq and TgD. Horse prions produced in vitro by protein misfolding cyclic amplification of mouse prions using horse PrP C also failed to infect TgEq but retained tropism for wild-type mice. Concordant patterns of neuropathology and prion deposition in susceptible mice infected with NAPA prions and the corresponding prion of origin confirmed preservation of strain properties. The comparable responses of both prion types to guanidine hydrochloride denaturation indicated this occurs because NAPA precludes selection of novel prion conformations. Our findings provide insights into mechanisms regulating interspecies prion transmission and a framework to reconcile puzzling epidemiological features of certain prion disorders.
A closer look at prion strains: characterization and important implications.
Solforosi, Laura; Milani, Michela; Mancini, Nicasio; Clementi, Massimo; Burioni, Roberto
2013-01-01
Prions are infectious proteins that are responsible for transmissible spongiform encephalopathies (TSEs) and consist primarily of scrapie prion protein (PrP (Sc) ), a pathogenic isoform of the host-encoded cellular prion protein (PrP (C) ). The absence of nucleic acids as essential components of the infectious prions is the most striking feature associated to these diseases. Additionally, different prion strains have been isolated from animal diseases despite the lack of DNA or RNA molecules. Mounting evidence suggests that prion-strain-specific features segregate with different PrP (Sc) conformational and aggregation states. Strains are of practical relevance in prion diseases as they can drastically differ in many aspects, such as incubation period, PrP (Sc) biochemical profile (e.g., electrophoretic mobility and glycoform ratio) and distribution of brain lesions. Importantly, such different features are maintained after inoculation of a prion strain into genetically identical hosts and are relatively stable across serial passages. This review focuses on the characterization of prion strains and on the wide range of important implications that the study of prion strains involves.
Localization of A11-reactive oligomeric species in prion diseases
DEFF Research Database (Denmark)
Aidt, Frederik H; Hasholt, Lis F; Christiansen, Michael
2013-01-01
To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases.......To investigate in prion diseases the in-situ localization of prion protein oligomers sharing a common epitope with amyloid oligomers involved in a range of neurodegenerative diseases....
Protease-sensitive synthetic prions.
Directory of Open Access Journals (Sweden)
David W Colby
2010-01-01
Full Text Available Prions arise when the cellular prion protein (PrP(C undergoes a self-propagating conformational change; the resulting infectious conformer is designated PrP(Sc. Frequently, PrP(Sc is protease-resistant but protease-sensitive (s prions have been isolated in humans and other animals. We report here that protease-sensitive, synthetic prions were generated in vitro during polymerization of recombinant (rec PrP into amyloid fibers. In 22 independent experiments, recPrP amyloid preparations, but not recPrP monomers or oligomers, transmitted disease to transgenic mice (n = 164, denoted Tg9949 mice, that overexpress N-terminally truncated PrP. Tg9949 control mice (n = 174 did not spontaneously generate prions although they were prone to late-onset spontaneous neurological dysfunction. When synthetic prion isolates from infected Tg9949 mice were serially transmitted in the same line of mice, they exhibited sPrP(Sc and caused neurodegeneration. Interestingly, these protease-sensitive prions did not shorten the life span of Tg9949 mice despite causing extensive neurodegeneration. We inoculated three synthetic prion isolates into Tg4053 mice that overexpress full-length PrP; Tg4053 mice are not prone to developing spontaneous neurological dysfunction. The synthetic prion isolates caused disease in 600-750 days in Tg4053 mice, which exhibited sPrP(Sc. These novel synthetic prions demonstrate that conformational changes in wild-type PrP can produce mouse prions composed exclusively of sPrP(Sc.
Molecular pathogenesis of sporadic prion diseases in man
Safar, Jiri G.
2012-01-01
The yeast, fungal and mammalian prions determine heritable and infectious traits that are encoded in alternative conformations of proteins. They cause lethal sporadic, familial and infectious neurodegenerative conditions in man, including Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker syndrome (GSS), kuru, sporadic fatal insomnia (SFI) and likely variable protease-sensitive prionopathy (VPSPr). The most prevalent of human prion diseases is sporadic (s)CJD. Recent advances in amplification and detection of prions led to considerable optimism that early and possibly preclinical diagnosis and therapy might become a reality. Although several drugs have already been tested in small numbers of sCJD patients, there is no clear evidence of any agent’s efficacy. Therefore, it remains crucial to determine the full spectrum of sCJD prion strains and the conformational features in the pathogenic human prion protein governing replication of sCJD prions. Research in this direction is essential for the rational development of diagnostic as well as therapeutic strategies. Moreover, there is growing recognition that fundamental processes involved in human prion propagation – intercellular induction of protein misfolding and seeded aggregation of misfolded host proteins – are of far wider significance. This insight leads to new avenues of research in the ever-widening spectrum of age-related human neurodegenerative diseases that are caused by protein misfolding and that pose a major challenge for healthcare. PMID:22421210
Prions and neuro degenerative diseases | Nair | African Journal of ...
African Journals Online (AJOL)
Prion is a disease-causing agent that is neither bacterial nor fungal nor viral and contains no genetic material. A prion is a protein that occurs normally in a harmless form. By folding into an aberrant shape, the normal prion turns into a rogue agent. It then co-opts other normal prions to become rogue prions. Prions have ...
Bistaffa, Edoardo; Rossi, Martina; De Luca, Chiara M G; Moda, Fabio
2017-01-01
Prions are the infectious agents that cause devastating and untreatable disorders known as Transmissible Spongiform Encephalopathies (TSEs). The pathologic events and the infectious nature of these transmissible agents are not completely understood yet. Due to the difficulties in inactivating prions, working with them requires specific recommendations and precautions. Moreover, with the advent of innovative technologies, such as the Protein Misfolding Cyclic Amplification (PMCA) and the Real Time Quaking-Induced Conversion (RT-QuIC), prions could be amplified in vitro and the infectious features of the amplified products need to be carefully assessed. © 2017 Elsevier Inc. All rights reserved.
Genes contributing to prion pathogenesis
DEFF Research Database (Denmark)
Tamgüney, Gültekin; Giles, Kurt; Glidden, David V
2008-01-01
incubation times, indicating that the conversion reaction may be influenced by other gene products. To identify genes that contribute to prion pathogenesis, we analysed incubation times of prions in mice in which the gene product was inactivated, knocked out or overexpressed. We tested 20 candidate genes...... show that many genes previously implicated in prion replication have no discernible effect on the pathogenesis of prion disease. While most genes tested did not significantly affect survival times, ablation of the amyloid beta (A4) precursor protein (App) or interleukin-1 receptor, type I (Il1r1...
Integrity of Helix 2-Helix 3 Domain of the PrP Protein Is Not Mandatory for Prion Replication*
Salamat, Khalid; Moudjou, Mohammed; Chapuis, Jérôme; Herzog, Laetitia; Jaumain, Emilie; Béringue, Vincent; Rezaei, Human; Pastore, Annalisa; Laude, Hubert; Dron, Michel
2012-01-01
The process of prion conversion is not yet well understood at the molecular level. The regions critical for the conformational change of PrP remain mostly debated and the extent of sequence change acceptable for prion conversion is poorly documented. To achieve progress on these issues, we applied a reverse genetic approach using the Rov cell system. This allowed us to test the susceptibility of a number of insertion mutants to conversion into prion in the absence of wild-type PrP molecules. We were able to propagate several prions with 8 to 16 extra amino acids, including a polyglycine stretch and His or FLAG tags, inserted in the middle of the protease-resistant fragment. These results demonstrate the possibility to increase the length of the loop between helices H2 and H3 up to 4-fold, without preventing prion replication. They also indicate that this loop probably remains unstructured in PrPSc. We also showed that bona fide prions can be produced following insertion of octapeptides in the two C-terminal turns of H2. These insertions do not interfere with the overall fold of the H2-H3 domain indicating that the highly conserved sequence of the terminal part of H2 is not critical for the conversion. Altogether these data showed that the amplitude of modifications acceptable for prion conversion in the core of the globular domain of PrP is much greater than one might have assumed. These observations should help to refine structural models of PrPSc and elucidate the conformational changes underlying prions generation. PMID:22511770
Integrity of helix 2-helix 3 domain of the PrP protein is not mandatory for prion replication.
Salamat, Khalid; Moudjou, Mohammed; Chapuis, Jérôme; Herzog, Laetitia; Jaumain, Emilie; Béringue, Vincent; Rezaei, Human; Pastore, Annalisa; Laude, Hubert; Dron, Michel
2012-06-01
The process of prion conversion is not yet well understood at the molecular level. The regions critical for the conformational change of PrP remain mostly debated and the extent of sequence change acceptable for prion conversion is poorly documented. To achieve progress on these issues, we applied a reverse genetic approach using the Rov cell system. This allowed us to test the susceptibility of a number of insertion mutants to conversion into prion in the absence of wild-type PrP molecules. We were able to propagate several prions with 8 to 16 extra amino acids, including a polyglycine stretch and His or FLAG tags, inserted in the middle of the protease-resistant fragment. These results demonstrate the possibility to increase the length of the loop between helices H2 and H3 up to 4-fold, without preventing prion replication. They also indicate that this loop probably remains unstructured in PrP(Sc). We also showed that bona fide prions can be produced following insertion of octapeptides in the two C-terminal turns of H2. These insertions do not interfere with the overall fold of the H2-H3 domain indicating that the highly conserved sequence of the terminal part of H2 is not critical for the conversion. Altogether these data showed that the amplitude of modifications acceptable for prion conversion in the core of the globular domain of PrP is much greater than one might have assumed. These observations should help to refine structural models of PrP(Sc) and elucidate the conformational changes underlying prions generation.
Grass plants bind, retain, uptake, and transport infectious prions.
Pritzkow, Sandra; Morales, Rodrigo; Moda, Fabio; Khan, Uffaf; Telling, Glenn C; Hoover, Edward; Soto, Claudio
2015-05-26
Prions are the protein-based infectious agents responsible for prion diseases. Environmental prion contamination has been implicated in disease transmission. Here, we analyzed the binding and retention of infectious prion protein (PrP(Sc)) to plants. Small quantities of PrP(Sc) contained in diluted brain homogenate or in excretory materials (urine and feces) can bind to wheat grass roots and leaves. Wild-type hamsters were efficiently infected by ingestion of prion-contaminated plants. The prion-plant interaction occurs with prions from diverse origins, including chronic wasting disease. Furthermore, leaves contaminated by spraying with a prion-containing preparation retained PrP(Sc) for several weeks in the living plant. Finally, plants can uptake prions from contaminated soil and transport them to aerial parts of the plant (stem and leaves). These findings demonstrate that plants can efficiently bind infectious prions and act as carriers of infectivity, suggesting a possible role of environmental prion contamination in the horizontal transmission of the disease. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Lim, Yong-beom; Mays, Charles E; Kim, Younghwan; Titlow, William B; Ryou, Chongsuk
2010-03-01
Branched polyamines are effective in inhibiting prions in a cationic surface charge density dependent manner. However, toxicity associated with branched polyamines, in general, often hampers the successful application of the compounds to treat prion diseases. Here, we report that constitutively maintained cationic properties in branched polyamines reduced the intrinsic toxicity of the compounds while retaining the anti-prion activities. In prion-infected neuroblastoma cells, quaternization of amines in polyethyleneimine (PEI) and polyamidoamine (PAMAM) dendrimers markedly increased the nontoxic concentration ranges of the compounds and still supported, albeit reduced, an appreciable level of anti-prion activity in clearing prions from the infected cells. Furthermore, quaternized PEI was able to degrade prions at acidic pH conditions and inhibit the in vitro prion propagation facilitated by conversion of the normal prion protein isoform to its misfolded counterpart, although such activities were decreased by quaternization. Quaternized PAMAM was least effective in degrading prions but efficiently inhibited prion conversion with the same efficacy as unmodified PAMAM. Our results suggest that quaternization represents an effective strategy for developing nontoxic branched polyamines with potent anti-prion activity. This study highlights the importance of polyamine structural control for developing polyamine-based anti-prion agents and understanding of an action mechanism of quaternized branched polyamines. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
The prion protein and New World primate phylogeny
Directory of Open Access Journals (Sweden)
Igor Schneider
2004-01-01
Full Text Available The PrP C prion protein contains 250 amino acids with some variation among species and is expressed in several cell types. PrP C is converted to PrP Sc by a post-translational process in which it acquires amino acid sequences of three-dimensional conformation of beta-sheets. Variations in the prion protein gene were observed among 16 genera of New World primates (Platyrrhini, and resulted in amino acid substitutions when compared with the human sequence. Seven substitutions not yet described in the literature were found: W -> R at position 31 in Cebuella, T -> A at position 95 in Cacajao and Chiropotes, N-> S at position 100 in Brachyteles, L -> Q at position 130 in Leontopithecus (in the sequence responsible for generating the beta-sheet 1, D -> E at position 144 in Lagothrix (in the sequence responsible for the alpha-helix 1, D-> G at position 147 in Saguinus (also located in the alpha-helix 1 region, and M -> I at position 232 in Alouatta. The phylogenetic trees generated by parsimony, neighbor-joining and Bayesian analyses strongly support the monophyletic status of the platyrrhines, but did not resolve relationships among families. However, the results do corroborate previous findings, which indicate that the three platyrrhine families radiated rapidly from an ancient split.
Identifying transmissible spongiform encephalopathy (TSE) reservoirs that could lead to disease re-emergence is imperative to U.S. scrapie eradication efforts. Transgenic mice expressing the cervid (TgElk) or ovine (Tg338) prion protein have aided characterization of chronic wasting disease (CWD) an...
Aβ seeds and prions: How close the fit?
Rasmussen, Jay; Jucker, Mathias; Walker, Lary C
2017-07-04
The prion paradigm is increasingly invoked to explain the molecular pathogenesis of neurodegenerative diseases involving the misfolding and aggregation of proteins other than the prion protein (PrP). Extensive evidence from in vitro and in vivo studies indicates that misfolded and aggregated Aβ peptide, which is the probable molecular trigger for Alzheimer's disease, manifests all of the key characteristics of canonical mammalian prions. These features include a β-sheet rich architecture, tendency to polymerize into amyloid, templated corruption of like protein molecules, ability to form structurally and functionally variant strains, systematic spread by neuronal transport, and resistance to inactivation by heat and formaldehyde. In addition to Aβ, a growing body of research supports the view that the prion-like molecular transformation of specific proteins drives the onset and course of a remarkable variety of clinicopathologically diverse diseases. As such, the expanded prion paradigm could conceptually unify fundamental and translational investigations of these disorders.
Rozemuller, A.J.M.; Jansen, C.; Carrano, A.; van Haastert, E.S.; Hondius, D.; van der Vies, S.M.; Hoozemans, J.J.M.
2012-01-01
Background: In cases with a long (>1 year) clinical duration of prion disease, the prion protein can form amyloid deposits. These cases do not show accumulation of 4-kDa β-amyloid, which is observed in amyloid deposits in Alzheimer's disease (AD). In AD, amyloid is associated with inflammation and
Prion pathogenesis and secondary lymphoid organs (SLO)
Mabbott, Neil A.
2012-01-01
Prion diseases are subacute neurodegenerative diseases that affect humans and a range of domestic and free-ranging animal species. These diseases are characterized by the accumulation of PrPSc, an abnormally folded isoform of the cellular prion protein (PrPC), in affected tissues. The pathology during prion disease appears to occur almost exclusively within the central nervous system. The extensive neurodegeneration which occurs ultimately leads to the death of the host. An intriguing feature of the prion diseases, when compared with other protein-misfolding diseases, is their transmissibility. Following peripheral exposure, some prion diseases accumulate to high levels within lymphoid tissues. The replication of prions within lymphoid tissue has been shown to be important for the efficient spread of disease to the brain. This article describes recent progress in our understanding of the cellular mechanisms that influence the propagation of prions from peripheral sites of exposure (such as the lumen of the intestine) to the brain. A thorough understanding of these events will lead to the identification of important targets for therapeutic intervention, or alternatively, reveal additional processes that influence disease susceptibility to peripherally-acquired prion diseases. PMID:22895090
Soluble Aβ aggregates can inhibit prion propagation.
Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John
2017-11-01
Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.
Generating Bona Fide Mammalian Prions with Internal Deletions.
Munoz-Montesino, Carola; Sizun, Christina; Moudjou, Mohammed; Herzog, Laetitia; Reine, Fabienne; Chapuis, Jérôme; Ciric, Danica; Igel-Egalon, Angelique; Laude, Hubert; Béringue, Vincent; Rezaei, Human; Dron, Michel
2016-08-01
Mammalian prions are PrP proteins with altered structures causing transmissible fatal neurodegenerative diseases. They are self-perpetuating through formation of beta-sheet-rich assemblies that seed conformational change of cellular PrP. Pathological PrP usually forms an insoluble protease-resistant core exhibiting beta-sheet structures but no more alpha-helical content, loosing the three alpha-helices contained in the correctly folded PrP. The lack of a high-resolution prion structure makes it difficult to understand the dynamics of conversion and to identify elements of the protein involved in this process. To determine whether completeness of residues within the protease-resistant domain is required for prions, we performed serial deletions in the helix H2 C terminus of ovine PrP, since this region has previously shown some tolerance to sequence changes without preventing prion replication. Deletions of either four or five residues essentially preserved the overall PrP structure and mutant PrP expressed in RK13 cells were efficiently converted into bona fide prions upon challenge by three different prion strains. Remarkably, deletions in PrP facilitated the replication of two strains that otherwise do not replicate in this cellular context. Prions with internal deletion were self-propagating and de novo infectious for naive homologous and wild-type PrP-expressing cells. Moreover, they caused transmissible spongiform encephalopathies in mice, with similar biochemical signatures and neuropathologies other than the original strains. Prion convertibility and transfer of strain-specific information are thus preserved despite shortening of an alpha-helix in PrP and removal of residues within prions. These findings provide new insights into sequence/structure/infectivity relationship for prions. Prions are misfolded PrP proteins that convert the normal protein into a replicate of their own abnormal form. They are responsible for invariably fatal neurodegenerative
The many shades of prion strain adaptation.
Baskakov, Ilia V
2014-01-01
In several recent studies transmissible prion disease was induced in animals by inoculation with recombinant prion protein amyloid fibrils produced in vitro. Serial transmission of amyloid fibrils gave rise to a new class of prion strains of synthetic origin. Gradual transformation of disease phenotypes and PrP(Sc) properties was observed during serial transmission of synthetic prions, a process that resembled the phenomenon of prion strain adaptation. The current article discusses the remarkable parallels between phenomena of prion strain adaptation that accompanies cross-species transmission and the evolution of synthetic prions occurring within the same host. Two alternative mechanisms underlying prion strain adaptation and synthetic strain evolution are discussed. The current article highlights the complexity of the prion transmission barrier and strain adaptation and proposes that the phenomenon of prion adaptation is more common than previously thought.
Directory of Open Access Journals (Sweden)
Bencsik Anna A
2010-08-01
Full Text Available Abstract In a recent paper written by Hilbe et al (BMC vet res, 2009, the nature and specificity of the prion protein deposition in the kidney of feline species affected with feline spongiform encephalopathy (FSE were clearly considered doubtful. This article was brought to our attention because we published several years ago an immunodetection of abnormal prion protein in the kidney of a cheetah affected with FSE. At this time we were convinced of its specificity but without having all the possibilities to demonstrate it. As previously published by another group, the presence of abnormal prion protein in some renal glomeruli in domestic cats affected with FSE is indeed generally considered as doubtful mainly because of low intensity detected in this organ and because control kidneys from safe animals present also a weak prion immunolabelling. Here we come back on these studies and thought it would be helpful to relay our last data to the readers of BMC Vet res for future reference on this subject. Here we come back on our material as it is possible to study and demonstrate the specificity of prion immunodetection using the PET-Blot method (Paraffin Embedded Tissue - Blot. It is admitted that this method allows detecting the Proteinase K (PK resistant form of the abnormal prion protein (PrPres without any confusion with unspecific immunoreaction. We re-analysed the kidney tissue versus adrenal gland and brain samples from the same cheetah affected with TSE using this PET-Blot method. The PET-Blot analysis revealed specific PrPres detection within the brain, adrenal gland and some glomeruli of the kidney, with a complete identicalness compared to our previous detection using immunohistochemistry. In conclusion, these new data enable us to confirm with assurance the presence of specific abnormal prion protein in the adrenal gland and in the kidney of the cheetah affected with FSE. It also emphasizes the usefulness for the re-examination of any
Preclinical deposition of pathological prion protein in muscle of experimentally infected primates.
Directory of Open Access Journals (Sweden)
Susanne Krasemann
Full Text Available Prion diseases are transmissible fatal neurodegenerative disorders affecting humans and animals. A central step in disease progression is the accumulation of a misfolded form (PrP(Sc of the host encoded prion protein (PrP(C in neuronal and non-neuronal tissues. The involvement of peripheral tissues in preclinical states increases the risk of accidental transmission. On the other hand, detection of PrP(Sc in non-neuronal easy-accessible compartments such as muscle may offer a novel diagnostic tool. Primate models have proven invaluable to investigate prion diseases. We have studied the deposition of PrP(Sc in muscle and central nervous system of rhesus monkeys challenged with sporadic Creutzfeldt-Jakob disease (sCJD, variant CJD (vCJD and bovine spongiform encephalopathy (BSE in preclinical and clinical stage using biochemical and morphological methods. Here, we show the preclinical presence of PrP(Sc in muscle and central nervous system of rhesus monkeys experimentally infected with vCJD.
Polymorphisms of the prion protein gene Arabi sheep breed in Iran ...
African Journals Online (AJOL)
Ovine scrapie is a neurodegenerative disease caused by polymorphisms of the prion protein gene (Prnp); especially the amino acid residue alterations at codons 136, 154, and 174, in sheep have been found to be associated with susceptibility to scrapie disease. We studied Prnp polymorphisms in local sheep of ...
Directory of Open Access Journals (Sweden)
Jean-Noël Arsac
Full Text Available Transmissible spongiform encephalopathies (TSEs are a group of fatal neurodegenerative diseases associated with a misfolded form of host-encoded prion protein (PrP. Some of them, such as classical bovine spongiform encephalopathy in cattle (BSE, transmissible mink encephalopathy (TME, kuru and variant Creutzfeldt-Jakob disease in humans, are acquired by the oral route exposure to infected tissues. We investigated the possible transmission by the oral route of a panel of strains derived from ruminant prion diseases in a transgenic mouse model (TgOvPrP4 overexpressing the ovine prion protein (A136R154Q171 under the control of the neuron-specific enolase promoter. Sources derived from Nor98, CH1641 or 87V scrapie sources, as well as sources derived from L-type BSE or cattle-passaged TME, failed to transmit by the oral route, whereas those derived from classical BSE and classical scrapie were successfully transmitted. Apart from a possible effect of passage history of the TSE agent in the inocula, this implied the occurrence of subtle molecular changes in the protease-resistant prion protein (PrPres following oral transmission that can raises concerns about our ability to correctly identify sheep that might be orally infected by the BSE agent in the field. Our results provide proof of principle that transgenic mouse models can be used to examine the transmissibility of TSE agents by the oral route, providing novel insights regarding the pathogenesis of prion diseases.
Zabel, Mark D.; Reid, Crystal
2015-01-01
Proteins were described as distinct biological molecules and their significance in cellular processes was recognized as early as the 18th century. At the same time, Spanish shepherds observed a disease that compelled their Merino sheep to pathologically scrape against fences, a defining clinical sign that led to the disease being named scrapie. In the late 19th century, Robert Koch published his postulates for defining causative agents of disease. In the early 20th century, pathologists Creutzfeldt and Jakob described a neurodegenerative disease that would later be included with scrapie into a group of diseases known as transmissible spongiform encephalopathies (TSEs). Later that century, mounting evidence compelled a handful of scientists to betray the prevailing biological dogma governing pathogen replication that Watson and Crick so convincingly explained by cracking the genetic code just two decades earlier. Because TSEs seemed to defy these new rules, J.S. Griffith theorized mechanisms by which a pathogenic protein could encipher its own replication blueprint without a genetic code. Stanley Prusiner called this proteinaceous infectious pathogen a prion. Here we offer a concise account of the discovery of prions, the causative agent of TSEs, in the wider context of protein biochemistry and infectious disease. We highlight the discovery of prions in yeast and discuss the implication of prions as epigenomic carriers of biological and pathological information. We also consider expanding the prion hypothesis to include other proteins whose alternate isoforms confer new biological or pathological properties. PMID:26449713
Directory of Open Access Journals (Sweden)
Maas Elke
2005-10-01
Full Text Available Abstract Background The definite diagnosis of prion diseases such as Creutzfeldt-Jakob disease (CJD in humans or bovine spongiform encephalopathy (BSE in cattle currently relies on the post mortem detection of the pathological form of the prion protein (PrPSc in brain tissue. Infectivity studies indicate that PrPSc may also be present in body fluids, even at presymptomatic stages of the disease, albeit at concentrations well below the detection limits of currently available analytical methods. Results We developed a highly sensitive method for detecting prion protein aggregates that takes advantage of kinetic differences between seeded and unseeded polymerization of prion protein monomers. Detection of the aggregates was carried out by flow cytometry. In the presence of prion seeds, the association of labelled recombinant PrP monomers in plasma and serum proceeds much more efficiently than in the absence of seeds. In a diagnostic model system, synthetic PrP aggregates were detected down to a concentration of approximately 10-8 nM [0.24 fg/ml]. A specific signal was detected in six out of six available serum samples from BSE-positive cattle. Conclusion We have developed a method based on seed-dependent PrP fibril formation that shows promising results in differentiating a small number of BSE-positive serum samples from healthy controls. This method may provide the basis for an ante mortem diagnostic test for prion diseases.
Hara, Hideyuki; Miyata, Hironori; Das, Nandita Rani; Chida, Junji; Yoshimochi, Tatenobu; Uchiyama, Keiji; Watanabe, Hitomi; Kondoh, Gen; Yokoyama, Takashi; Sakaguchi, Suehiro
2018-01-01
Conformational conversion of the cellular isoform of prion protein, PrP C , into the abnormally folded, amyloidogenic isoform, PrP Sc , is a key pathogenic event in prion diseases, including Creutzfeldt-Jakob disease in humans and scrapie and bovine spongiform encephalopathy (BSE) in animals. We previously reported that the octapeptide repeat (OR) region could be dispensable for converting PrP C into PrP Sc after infection with RML prions. We demonstrated that mice transgenically expressing mouse PrP with deletion of the OR region on the PrP knockout background, designated Tg(PrPΔOR)/ Prnp 0 / 0 mice, did not show reduced susceptibility to RML scrapie prions, with abundant accumulation of PrP Sc ΔOR in their brains. We show here that Tg(PrPΔOR)/ Prnp 0 / 0 mice were highly resistant to BSE prions, developing the disease with markedly elongated incubation times after infection with BSE prions. The conversion of PrPΔOR into PrP Sc ΔOR was markedly delayed in their brains. These results suggest that the OR region may have a crucial role in the conversion of PrP C into PrP Sc after infection with BSE prions. However, Tg(PrPΔOR)/ Prnp 0 / 0 mice remained susceptible to RML and 22L scrapie prions, developing the disease without elongated incubation times after infection with RML and 22L prions. PrP Sc ΔOR accumulated only slightly less in the brains of RML- or 22L-infected Tg(PrPΔOR)/ Prnp 0 / 0 mice than PrP Sc in control wild-type mice. Taken together, these results indicate that the OR region of PrP C could play a differential role in the pathogenesis of BSE prions and RML or 22L scrapie prions. IMPORTANCE Structure-function relationship studies of PrP C conformational conversion into PrP Sc are worthwhile to understand the mechanism of the conversion of PrP C into PrP Sc We show here that, by inoculating Tg(PrPΔOR)/ Prnp 0 / 0 mice with the three different strains of RML, 22L, and BSE prions, the OR region could play a differential role in the conversion of
Accumulation and dissemination of prion protein in experimental sheep scrapie in the natural host
Directory of Open Access Journals (Sweden)
Warner Richard
2009-02-01
Full Text Available Abstract Background In order to study the sites of uptake and mechanisms of dissemination of scrapie prions in the natural host under controlled conditions, lambs aged 14 days and homozygous for the VRQ allele of the PrP gene were infected by the oral route. Infection occurred in all lambs with a remarkably short and highly consistent incubation period of approximately 6 months. Challenge of lambs at approximately eight months of age resulted in disease in all animals, but with more variable incubation periods averaging significantly longer than those challenged at 14 days. This model provides an excellent system in which to study the disease in the natural host by virtue of the relatively short incubation period and close resemblance to natural infection. Results Multiple sites of prion uptake were identified, of which the most important was the Peyer's patch of the distal ileum. Neuroinvasion was detected initially in the enteric nervous system prior to infection of the central nervous system. At end stage disease prion accumulation was widespread throughout the entire neuraxis, but vacuolar pathology was absent in most animals that developed disease at 6–7 months of age. Conclusion Initial spread of detectable PrP was consistent with drainage in afferent lymph to dependent lymph nodes. Subsequent accumulation of prions in lymphoid tissue not associated with the gut is consistent with haematogenous spread. In addition to macrophages and follicular dendritic cells, prion containing cells consistent with afferent lymph dendritic cells were identified and are suggested as a likely vehicle for carriage of prions from initial site of uptake to the lymphoreticular system, and as potential carriers of prion protein in blood. It is apparent that spongiform change, the characteristic lesion of scrapie and other prion diseases, is not responsible for the clinical signs in sheep, but may develop in an age dependent manner.
Key points concerning amyloid infectivity and prion-like neuronal invasion
Directory of Open Access Journals (Sweden)
Alba eEspargaró
2016-04-01
Full Text Available Amyloid aggregation has been related to an increasing number of human illnesses, from Alzheimer and Parkinson’s diseases to Creutzfeldt-Jakob disease. Traditionally only prions have been considered as infectious agents with a high capacity of propagation. Although recent publications have showed that many amyloid proteins, including amyloid β-peptide, α-synuclein and tau protein, also propagate in a prion-like manner, the link between propagation of pathological proteins and neurotoxicity has not been evidenced. The extremely low infectivity in natural conditions of the most of non-prion amyloids is far from the spreading capacity displayed by the prions. However, it is important to elucidate the key factors that cause non-prion amyloids become infectious agents. In recent years, important advances in the understanding of the amyloid processes of amyloid-like proteins and unrelated prions (i.e., yeast and fungal prions have yielded essential information that can be applied to shed light on the prion phenomenon in mammals and humans. As shown in this review, recent evidences suggest that there are key factors that could dramatically modulate the prion capacity of proteins in the amyloid conformation. The concentration of nuclei, the presence of oligomers, and the toxicity, resistance and localization of these aggregates could be key factors affecting their spreading. In short, those factors that favor the high concentration of extracellular nuclei or oligomers, characterized by a small size, with a low toxicity could dramatically increase prion propensity; whereas low concentrations of highly toxic intracellular amyloids, with a large size, would prevent infectivity.
Araman, Can; Thompson, Robert E; Wang, Siyao; Hackl, Stefanie; Payne, Richard J; Becker, Christian F W
2017-09-01
The prion protein (PrP) is an N -glycosylated protein attached to the outer leaflet of eukaryotic cell membranes via a glycosylphosphatidylinositol (GPI) anchor. Different prion strains have distinct glycosylation patterns and the extent of glycosylation of potentially pathogenic misfolded prion protein (PrP Sc ) has a major impact on several prion-related diseases (transmissible spongiform encephalopathies, TSEs). Based on these findings it is hypothesized that posttranslational modifications (PTMs) of PrP influence conversion of cellular prion protein (PrP C ) into PrP Sc and, as such, modified PrP variants are critical tools needed to investigate the impact of PTMs on the pathogenesis of TSEs. Here we report a semisynthetic approach to generate PrP variants modified with monodisperse polyethyleneglycol (PEG) units as mimics of N-glycans. Incorporating PEG at glycosylation sites 181 and 197 in PrP induced only small changes to the secondary structure when compared to unmodified, wildtype PrP. More importantly, in vitro aggregation was abrogated for all PEGylated PrP variants under conditions at which wildtype PrP aggregated. Furthermore, the addition of PEGylated PrP as low as 10 mol% to wildtype PrP completely blocked aggregation. A similar effect was observed for synthetic PEGylated PrP segments comprising amino acids 179-231 alone if these were added to wildtype PrP in aggregation assays. This behavior raises the question if large N-glycans interfere with aggregation in vivo and if PEGylated PrP peptides could serve as potential therapeutics.
Defining the conformational features of anchorless, poorly neuroinvasive prions.
Directory of Open Access Journals (Sweden)
Cyrus Bett
Full Text Available Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same infectious prion develop fibrillar or nonfibrillar aggregates, respectively, and show a striking divergence in the disease pathogenesis. To better understand how a prion's physical properties govern the pathogenesis, infectious anchorless prions were passaged in mice expressing anchorless prion protein and the resulting prions were biochemically characterized. Serial passage of anchorless prions led to a significant decrease in the incubation period to terminal disease and altered the biochemical properties, consistent with a transmission barrier effect. After an intraperitoneal exposure, anchorless prions were only weakly neuroinvasive, as prion plaques rarely occurred in the brain yet were abundant in extracerebral sites such as heart and adipose tissue. Anchorless prions consistently showed very high stability in chaotropes or when heated in SDS, and were highly resistant to enzyme digestion. Consistent with the results in mice, anchorless prions from a human patient were also highly stable in chaotropes. These findings reveal that anchorless prions consist of fibrillar and highly stable conformers. The additional finding from our group and others that both anchorless and anchored prion fibrils are poorly neuroinvasive strengthens the hypothesis that a fibrillar prion structure impedes efficient CNS invasion.
Detection of Prion Proteins and TSE Infectivity in the Rendering and Biodiesel Manufacture Processes
Energy Technology Data Exchange (ETDEWEB)
Brown, R.; Keller, B.; Oleschuk, R. [Queen' s University, Kingston, Ontario (Canada)
2007-03-15
This paper addresses emerging issues related to monitoring prion proteins and TSE infectivity in the products and waste streams of rendering and biodiesel manufacture processes. Monitoring is critical to addressing the knowledge gaps identified in 'Biodiesel from Specified Risk Material Tallow: An Appraisal of TSE Risks and their Reduction' (IEA's AMF Annex XXX, 2006) that prevent comprehensive risk assessment of TSE infectivity in products and waste. The most important challenge for monitoring TSE risk is the wide variety of sample types, which are generated at different points in the rendering/biodiesel production continuum. Conventional transmissible spongiform encephalopathy (TSE) assays were developed for specified risk material (SRM) and other biological tissues. These, however, are insufficient to address the diverse sample matrices produced in rendering and biodiesel manufacture. This paper examines the sample types expected in rendering and biodiesel manufacture and the implications of applying TSE assay methods to them. The authors then discuss a sample preparation filtration, which has not yet been applied to these sample types, but which has the potential to provide or significantly improve TSE monitoring. The main improvement will come from transfer of the prion proteins from the sample matrix to a matrix compatible with conventional and emerging bioassays. A second improvement will come from preconcentrating the prion proteins, which means transferring proteins from a larger sample volume into a smaller volume for analysis to provide greater detection sensitivity. This filtration method may also be useful for monitoring other samples, including wash waters and other waste streams, which may contain SRM, including those from abattoirs and on-farm operations. Finally, there is a discussion of emerging mass spectrometric methods, which Prusiner and others have shown to be suitable for detection and characterisation of prion proteins (Stahl
Van der Rest, Guillaume; Rezaei, Human; Halgand, Frédéric
2017-02-01
Prion protein is involved in deadly neurodegenerative diseases. Its pathogenicity is linked to its structural conversion (α-helix to β-strand transition). However, recent studies suggest that prion protein can follow a plurality of conversion pathways, which hints towards different conformers that might coexist in solution. To gain insights on the plasticity of the ovine prion protein (PrP) monomer, wild type (A136, R154, Q171), mutants and deletions of ARQ were studied by traveling wave ion mobility experiments coupled to mass spectrometry. In order to perform the analysis of a large body of data sets, we designed and evaluated the performance of a processing pipeline based on Driftscope peak detection and a homemade script for automated peak assignment, annotation, and quantification on specific multiply charged protein data. Using this approach, we showed that in the gas phase, PrPs are represented by at least three conformer families differing in both charge state distribution and collisional cross-section, in agreement with the work of Hilton et al. (2010). We also showed that this plasticity is borne both by the N- and C-terminal domains. Effect of protein concentration, pH and temperature were also assessed, showing that (1) pH does not affect conformer distributions, (2) protein concentration modifies the conformational landscape of one mutant (I208M) only, and (3) heating leads to other unfolded species and to a modification of the conformer intensity ratios.
Directory of Open Access Journals (Sweden)
Christine Pampeno
Full Text Available The laminin receptor (LamR is a cell surface receptor for extracellular matrix laminin, whereas the same protein within the cell interacts with ribosomes, nuclear proteins and cytoskeletal fibers. LamR has been shown to be a receptor for several bacteria and viruses. Furthermore, LamR interacts with both cellular and infectious forms of the prion protein, PrP(C and PrP(Sc. Indeed, LamR is a receptor for PrP(C. Whether LamR interacts with PrP(Sc exclusively in a capacity of the PrP receptor, or LamR specifically recognizes prion determinants of PrP(Sc, is unclear. In order to explore whether LamR has a propensity to interact with prions and amyloids, we examined LamR interaction with the yeast prion-forming protein, Sup35. Sup35 is a translation termination factor with no homology or functional relationship to PrP. Plasmids expressing LamR or LamR fused with the green fluorescent protein (GFP were transformed into yeast strain variants differing by the presence or absence of the prion conformation of Sup35, respectively [PSI⁺] and [psi⁻]. Analyses by immunoprecipitation, centrifugal fractionation and fluorescent microscopy reveal interaction between LamR and Sup35 in [PSI⁺] strains. The presence of [PSI⁺] promotes LamR co-precipitation with Sup35 as well as LamR aggregation. In [PSI⁺] cells, LamR tagged with GFP or mCherry forms bright fluorescent aggregates that co-localize with visible [PSI⁺] foci. The yeast prion model will facilitate studying the interaction of LamR with amyloidogenic prions in a safe and easily manipulated system that may lead to a better understanding and treatment of amyloid diseases.
Efficient prion disease transmission through common environmental materials.
Pritzkow, Sandra; Morales, Rodrigo; Lyon, Adam; Concha-Marambio, Luis; Urayama, Akihiko; Soto, Claudio
2018-03-02
Prion diseases are a group of fatal neurodegenerative diseases associated with a protein-based infectious agent, termed prion. Compelling evidence suggests that natural transmission of prion diseases is mediated by environmental contamination with infectious prions. We hypothesized that several natural and man-made materials, commonly found in the environments of wild and captive animals, can bind prions and may act as vectors for disease transmission. To test our hypothesis, we exposed surfaces composed of various common environmental materials ( i.e. wood, rocks, plastic, glass, cement, stainless steel, aluminum, and brass) to hamster-adapted 263K scrapie prions and studied their attachment and retention of infectivity in vitro and in vivo Our results indicated that these surfaces, with the sole exception of brass, efficiently bind, retain, and release prions. Prion replication was studied in vitro using the protein misfolding cyclic amplification technology, and infectivity of surface-bound prions was analyzed by intracerebrally challenging hamsters with contaminated implants. Our results revealed that virtually all prion-contaminated materials transmitted the disease at high rates. To investigate a more natural form of exposure to environmental contamination, we simply housed animals with large contaminated spheres made of the different materials under study. Strikingly, most of the hamsters developed classical clinical signs of prion disease and typical disease-associated brain changes. Our findings suggest that prion contamination of surfaces commonly present in the environment can be a source of disease transmission, thus expanding our understanding of the mechanisms for prion spreading in nature. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Dissociation of recombinant prion autocatalysis from infectivity.
Noble, Geoffrey P; Supattapone, Surachai
2015-01-01
Within the mammalian prion field, the existence of recombinant prion protein (PrP) conformers with self-replicating (ie. autocatalytic) activity in vitro but little to no infectious activity in vivo challenges a key prediction of the protein-only hypothesis of prion replication--that autocatalytic PrP conformers should be infectious. To understand this dissociation of autocatalysis from infectivity, we recently performed a structural and functional comparison between a highly infectious and non-infectious pair of autocatalytic recombinant PrP conformers derived from the same initial prion strain. (1) We identified restricted, C-terminal structural differences between these 2 conformers and provided evidence that these relatively subtle differences prevent the non-infectious conformer from templating the conversion of native PrP(C) substrates containing a glycosylphosphatidylinositol (GPI) anchor. (1) In this article we discuss a model, consistent with these findings, in which recombinant PrP, lacking post-translational modifications and associated folding constraints, is capable of adopting a wide variety of autocatalytic conformations. Only a subset of these recombinant conformers can be adopted by post-translationally modified native PrP(C), and this subset represents the recombinant conformers with high specific infectivity. We examine this model's implications for the generation of highly infectious recombinant prions and the protein-only hypothesis of prion replication.
Lichens: Unexpected anti-prion agents?
Rodriguez, Cynthia M.; Bennett, James P.; Johnson, Christopher J.
2012-01-01
The prion diseases sheep scrapie and cervid chronic wasting disease are transmitted, in part, via an environmental reservoir of infectivity; prions released from infected animals persist in the environment and can cause disease years later. Central to controlling disease transmission is the identification of methods capable of inactivating these agents on the landscape. We have found that certain lichens, common, ubiquitous, symbiotic organisms, possess a serine protease capable of degrading prion protein (PrP) from prion-infected animals. The protease functions against a range of prion strains from various hosts and reduces levels of abnormal PrP by at least two logs. We have now tested more than 20 lichen species from several geographical locations and from various taxa and found that approximately half of these species degrade PrP. Critical next steps include examining the effect of lichens on prion infectivity and cloning the protease responsible for PrP degradation. The impact of lichens on prions in the environment remains unknown. We speculate that lichens could have the potential to degrade prions when they are shed from infected animals onto lichens or into environments where lichens are abundant. In addition, lichens are frequently consumed by cervids and many other animals and the effect of dietary lichens on prion disease transmission should also be considered.
Directory of Open Access Journals (Sweden)
Kai Wang
Full Text Available Yeast prions are self-perpetuating protein aggregates that cause heritable and transmissible phenotypic traits. Among these, [PSI+] and [URE3] stand out as the most studied yeast prions, and result from the self-assembly of the translation terminator Sup35p and the nitrogen catabolism regulator Ure2p, respectively, into insoluble fibrillar aggregates. Protein quality control systems are well known to govern the formation, propagation and transmission of these prions. However, little is known about the implication of the cellular proteolytic machineries in their turnover. We previously showed that the 26S proteasome degrades both the soluble and fibrillar forms of Sup35p and affects [PSI+] propagation. Here, we show that soluble native Ure2p is degraded by the proteasome in an ubiquitin-independent manner. Proteasomal degradation of Ure2p yields amyloidogenic N-terminal peptides and a C-terminal resistant fragment. In contrast to Sup35p, fibrillar Ure2p resists proteasomal degradation. Thus, structural variability within prions may dictate their ability to be degraded by the cellular proteolytic systems.
The 26S Proteasome Degrades the Soluble but Not the Fibrillar Form of the Yeast Prion Ure2p In Vitro
Wang, Kai; Redeker, Virginie; Madiona, Karine; Melki, Ronald; Kabani, Mehdi
2015-01-01
Yeast prions are self-perpetuating protein aggregates that cause heritable and transmissible phenotypic traits. Among these, [PSI +] and [URE3] stand out as the most studied yeast prions, and result from the self-assembly of the translation terminator Sup35p and the nitrogen catabolism regulator Ure2p, respectively, into insoluble fibrillar aggregates. Protein quality control systems are well known to govern the formation, propagation and transmission of these prions. However, little is known about the implication of the cellular proteolytic machineries in their turnover. We previously showed that the 26S proteasome degrades both the soluble and fibrillar forms of Sup35p and affects [PSI +] propagation. Here, we show that soluble native Ure2p is degraded by the proteasome in an ubiquitin-independent manner. Proteasomal degradation of Ure2p yields amyloidogenic N-terminal peptides and a C-terminal resistant fragment. In contrast to Sup35p, fibrillar Ure2p resists proteasomal degradation. Thus, structural variability within prions may dictate their ability to be degraded by the cellular proteolytic systems. PMID:26115123
Silva, Jerson L; Vieira, Tuane C R G; Gomes, Mariana P B; Rangel, Luciana P; Scapin, Sandra M N; Cordeiro, Yraima
2011-03-01
The concept that transmissible spongiform encephalopathies (TSEs) are caused only by proteins has changed the traditional paradigm that disease transmission is due solely to an agent that carries genetic information. The central hypothesis for prion diseases proposes that the conversion of a cellular prion protein (PrP(C)) into a misfolded, β-sheet-rich isoform (PrP(Sc)) accounts for the development of (TSE). There is substantial evidence that the infectious material consists chiefly of a protein, PrP(Sc), with no genomic coding material, unlike a virus particle, which has both. However, prions seem to have other partners that chaperone their activities in converting the PrP(C) into the disease-causing isoform. Nucleic acids (NAs) and glycosaminoglycans (GAGs) are the most probable accomplices of prion conversion. Here, we review the recent experimental approaches that have been employed to characterize the interaction of prion proteins with nucleic acids and glycosaminoglycans. A PrP recognizes many nucleic acids and GAGs with high affinities, and this seems to be related to a pathophysiological role for this interaction. A PrP binds nucleic acids and GAGs with structural selectivity, and some PrP:NA complexes can become proteinase K-resistant, undergoing amyloid oligomerization and conversion to a β-sheet-rich structure. These results are consistent with the hypothesis that endogenous polyanions (such as NAs and GAGs) may accelerate the rate of prion disease progression by acting as scaffolds or lattices that mediate the interaction between PrP(C) and PrP(Sc) molecules. In addition to a still-possible hypothesis that nucleic acids and GAGs, especially those from the host, may modulate the conversion, the recent structural characterization of the complexes has raised the possibility of developing new diagnostic and therapeutic strategies. Copyright © 2010 Elsevier Inc. All rights reserved.
Prion-like domains in RNA binding proteins are essential for building subnuclear paraspeckles
Hennig, Sven; Kong, Geraldine; Mannen, Taro; Sadowska, Agata; Kobelke, Simon; Blythe, Amanda; Knott, Gavin J; Iyer, K Swaminathan; Ho, Diwei; Newcombe, Estella A; Hosoki, Kana; Goshima, Naoki; Kawaguchi, Tetsuya; Hatters, Danny; Trinkle-Mulcahy, Laura; Hirose, Tetsuro; Bond, Charles S; Fox, Archa H
2015-01-01
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule
The Role of the Mammalian Prion Protein in the Control of Sleep
Directory of Open Access Journals (Sweden)
Amber Roguski
2017-11-01
Full Text Available Sleep disruption is a prevalent clinical feature in many neurodegenerative disorders, including human prion diseases where it can be the defining dysfunction, as in the case of the “eponymous” fatal familial insomnia, or an early-stage symptom as in certain types of Creutzfeldt-Jakob disease. It is important to establish the role of the cellular prion protein (PrPC, the key molecule involved in prion pathogenesis, within the sleep-wake system in order to understand fully the mechanisms underlying its contribution to both healthy circadian rhythmicity and sleep dysfunction during disease. Although severe disruption to the circadian rhythm and melatonin release is evident during the pathogenic phases of some prion diseases, untangling whether PrPC plays a role in circadian rhythmicity, as suggested in mice deficient for PrPC expression, is challenging given the lack of basic experimental research. We provide a short review of the small amount of direct literature focused on the role of PrPC in melatonin and circadian rhythm regulation, as well as suggesting mechanisms by which PrPC might exert influence upon noradrenergic and dopaminergic signaling and melatonin synthesis. Future research in this area should focus upon isolating the points of dysfunction within the retino-pineal pathway and further investigate PrPC mediation of pinealocyte GPCR activity.
Prions in Variably Protease-Sensitive Prionopathy: An Update
Zou, W.Q.; Gambetti, P.; Xiao, X.; Yuan, J.; Langeveld, J.P.M.; Pirisinu, L.
2013-01-01
Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably
Abskharon, Romany; Dang, Johnny; Elfarash, Ameer; Wang, Zerui; Shen, Pingping; Zou, Lewis S; Hassan, Sedky; Wang, Fei; Fujioka, Hisashi; Steyaert, Jan; Mulaj, Mentor; Surewicz, Witold K; Castilla, Joaquín; Wohlkonig, Alexandre; Zou, Wen-Quan
2017-10-04
The infectious prion protein (PrP Sc or prion) is derived from its cellular form (PrP C ) through a conformational transition in animal and human prion diseases. Studies have shown that the interspecies conversion of PrP C to PrP Sc is largely swayed by species barriers, which is mainly deciphered by the sequence and conformation of the proteins among species. However, the bank vole PrP C (BVPrP) is highly susceptible to PrP Sc from different species. Transgenic mice expressing BVPrP with the polymorphic isoleucine (109I) but methionine (109M) at residue 109 spontaneously develop prion disease. To explore the mechanism underlying the unique susceptibility and convertibility, we generated soluble BVPrP by co-expression of BVPrP with Quiescin sulfhydryl oxidase (QSOX) in Escherichia coli. Interestingly, rBVPrP-109M and rBVPrP-109I exhibited distinct seeded aggregation pathways and aggregate morphologies upon seeding of mouse recombinant PrP fibrils, as monitored by thioflavin T fluorescence and electron microscopy. Moreover, they displayed different aggregation behaviors induced by seeding of hamster and mouse prion strains under real-time quaking-induced conversion. Our results suggest that QSOX facilitates the formation of soluble prion protein and provide further evidence that the polymorphism at residue 109 of QSOX-induced BVPrP may be a determinant in mediating its distinct convertibility and susceptibility.
A dominant-negative mutant inhibits multiple prion variants through a common mechanism.
Directory of Open Access Journals (Sweden)
Fen Pei
2017-10-01
Full Text Available Prions adopt alternative, self-replicating protein conformations and thereby determine novel phenotypes that are often irreversible. Nevertheless, dominant-negative prion mutants can revert phenotypes associated with some conformations. These observations suggest that, while intervention is possible, distinct inhibitors must be developed to overcome the conformational plasticity of prions. To understand the basis of this specificity, we determined the impact of the G58D mutant of the Sup35 prion on three of its conformational variants, which form amyloids in S. cerevisiae. G58D had been previously proposed to have unique effects on these variants, but our studies suggest a common mechanism. All variants, including those reported to be resistant, are inhibited by G58D but at distinct doses. G58D lowers the kinetic stability of the associated amyloid, enhancing its fragmentation by molecular chaperones, promoting Sup35 resolubilization, and leading to amyloid clearance particularly in daughter cells. Reducing the availability or activity of the chaperone Hsp104, even transiently, reverses curing. Thus, the specificity of inhibition is determined by the sensitivity of variants to the mutant dosage rather than mode of action, challenging the view that a unique inhibitor must be developed to combat each variant.
Current and future molecular diagnostics for prion diseases.
Lehto, Marty T; Peery, Harry E; Cashman, Neil R
2006-07-01
It is now widely held that the infectious agents underlying the transmissible spongiform encephalopathies are prions, which are primarily composed of a misfolded, protease-resistant isoform of the host prion protein. Untreatable prion disorders include some human diseases, such as Creutzfeldt-Jakob disease, and diseases of economically important animals, such as bovine spongiform encephalopathy (cattle) and chronic wasting disease (deer and elk). Detection and diagnosis of prion disease (and presymptomatic incubation) is contingent upon developing novel assays, which exploit properties uniquely possessed by this misfolded protein complex, rather than targeting an agent-specific nucleic acid. This review highlights some of the conventional and disruptive technologies developed to respond to this challenge.
Prion Strain Characterization of a Novel Subtype of Creutzfeldt-Jakob Disease.
Galeno, Roberta; Di Bari, Michele Angelo; Nonno, Romolo; Cardone, Franco; Sbriccoli, Marco; Graziano, Silvia; Ingrosso, Loredana; Fiorini, Michele; Valanzano, Angelina; Pasini, Giulia; Poleggi, Anna; Vinci, Ramona; Ladogana, Anna; Puopolo, Maria; Monaco, Salvatore; Agrimi, Umberto; Zanusso, Gianluigi; Pocchiari, Maurizio
2017-06-01
In 2007, we reported a patient with an atypical form of Creutzfeldt-Jakob disease (CJD) heterozygous for methionine-valine (MV) at codon 129 who showed a novel pathological prion protein (PrP TSE ) conformation with an atypical glycoform (AG) profile and intraneuronal PrP deposition. In the present study, we further characterize the conformational properties of this pathological prion protein (PrP TSE MV AG ), showing that PrP TSE MV AG is composed of multiple conformers with biochemical properties distinct from those of PrP TSE type 1 and type 2 of MV sporadic CJD (sCJD). Experimental transmission of CJD-MV AG to bank voles and gene-targeted transgenic mice carrying the human prion protein gene (TgHu mice) showed unique transmission rates, survival times, neuropathological changes, PrP TSE deposition patterns, and PrP TSE glycotypes that are distinct from those of sCJD-MV1 and sCJD-MV2. These biochemical and experimental data suggest the presence of a novel prion strain in CJD-MV AG IMPORTANCE Sporadic Creutzfeldt-Jakob disease is caused by the misfolding of the cellular prion protein, which assumes two different major conformations (type 1 and type 2) and, together with the methionine/valine polymorphic codon 129 of the prion protein gene, contribute to the occurrence of distinct clinical-pathological phenotypes. Inoculation in laboratory rodents of brain tissues from the six possible combinations of pathological prion protein types with codon 129 genotypes results in the identification of 3 or 4 strains of prions. We report on the identification of a novel strain of Creutzfeldt-Jakob disease isolated from a patient who carried an abnormally glycosylated pathological prion protein. This novel strain has unique biochemical characteristics, does not transmit to humanized transgenic mice, and shows exclusive transmission properties in bank voles. The identification of a novel human prion strain improves our understanding of the pathogenesis of the disease and of
A Neuronal Culture System to Detect Prion Synaptotoxicity.
Directory of Open Access Journals (Sweden)
Cheng Fang
2016-05-01
Full Text Available Synaptic pathology is an early feature of prion as well as other neurodegenerative diseases. Although the self-templating process by which prions propagate is well established, the mechanisms by which prions cause synaptotoxicity are poorly understood, due largely to the absence of experimentally tractable cell culture models. Here, we report that exposure of cultured hippocampal neurons to PrPSc, the infectious isoform of the prion protein, results in rapid retraction of dendritic spines. This effect is entirely dependent on expression of the cellular prion protein, PrPC, by target neurons, and on the presence of a nine-amino acid, polybasic region at the N-terminus of the PrPC molecule. Both protease-resistant and protease-sensitive forms of PrPSc cause dendritic loss. This system provides new insights into the mechanisms responsible for prion neurotoxicity, and it provides a platform for characterizing different pathogenic forms of PrPSc and testing potential therapeutic agents.
The ribosome-associated complex antagonizes prion formation in yeast.
Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M
2015-01-01
The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.
Rebels with a cause: molecular features and physiological consequences of yeast prions.
Garcia, David M; Jarosz, Daniel F
2014-02-01
Prions are proteins that convert between structurally and functionally distinct states, at least one of which is self-perpetuating. The prion fold templates the conversion of native protein, altering its structure and function, and thus serves as a protein-based element of inheritance. Molecular chaperones ensure that these prion aggregates are divided and faithfully passed from mother cells to their daughters. Prions were originally identified as the cause of several rare neurodegenerative diseases in mammals, but the last decade has brought great progress in understanding their broad importance in biology and evolution. Most prion proteins regulate information flow in signaling networks, or otherwise affect gene expression. Consequently, switching into and out of prion states creates diverse new traits – heritable changes based on protein structure rather than nucleic acid. Despite intense study of the molecular mechanisms of this paradigm-shifting, epigenetic mode of inheritance, many key questions remain. Recent studies in yeast that support the view that prions are common, often beneficial elements of inheritance that link environmental stress to the appearance of new traits.
Synthetic prions and other human neurodegenerative proteinopathies.
Le, Nhat Tran Thanh; Narkiewicz, Joanna; Aulić, Suzana; Salzano, Giulia; Tran, Hoa Thanh; Scaini, Denis; Moda, Fabio; Giachin, Gabriele; Legname, Giuseppe
2015-09-02
Transmissible spongiform encephalopathies (TSE) are a heterogeneous group of neurodegenerative disorders. The common feature of these diseases is the pathological conversion of the normal cellular prion protein (PrP(C)) into a β-structure-rich conformer-termed PrP(Sc). The latter can induce a self-perpetuating process leading to amplification and spreading of pathological protein assemblies. Much evidence suggests that PrP(Sc) itself is able to recruit and misfold PrP(C) into the pathological conformation. Recent data have shown that recombinant PrP(C) can be misfolded in vitro and the resulting synthetic conformers are able to induce the conversion of PrP(C) into PrP(Sc)in vivo. In this review we describe the state-of-the-art of the body of literature in this field. In addition, we describe a cell-based assay to test synthetic prions in cells, providing further evidence that synthetic amyloids are able to template conversion of PrP into prion inclusions. Studying prions might help to understand the pathological mechanisms governing other neurodegenerative diseases. Aggregation and deposition of misfolded proteins is a common feature of several neurodegenerative disorders, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and other disorders. Although the proteins implicated in each of these diseases differ, they share a common prion mechanism. Recombinant proteins are able to aggregate in vitro into β-rich amyloid fibrils, sharing some features of the aggregates found in the brain. Several studies have reported that intracerebral inoculation of synthetic aggregates lead to unique pathology, which spread progressively to distal brain regions and reduced survival time in animals. Here, we review the prion-like features of different proteins involved in neurodegenerative disorders, such as α-synuclein, superoxide dismutase-1, amyloid-β and tau. Copyright © 2014 Elsevier B.V. All rights reserved.
Epigenetic dominance of prion conformers.
Directory of Open Access Journals (Sweden)
Eri Saijo
2013-10-01
Full Text Available Although they share certain biological properties with nucleic acid based infectious agents, prions, the causative agents of invariably fatal, transmissible neurodegenerative disorders such as bovine spongiform encephalopathy, sheep scrapie, and human Creutzfeldt Jakob disease, propagate by conformational templating of host encoded proteins. Once thought to be unique to these diseases, this mechanism is now recognized as a ubiquitous means of information transfer in biological systems, including other protein misfolding disorders such as those causing Alzheimer's and Parkinson's diseases. To address the poorly understood mechanism by which host prion protein (PrP primary structures interact with distinct prion conformations to influence pathogenesis, we produced transgenic (Tg mice expressing different sheep scrapie susceptibility alleles, varying only at a single amino acid at PrP residue 136. Tg mice expressing ovine PrP with alanine (A at (OvPrP-A136 infected with SSBP/1 scrapie prions propagated a relatively stable (S prion conformation, which accumulated as punctate aggregates in the brain, and produced prolonged incubation times. In contrast, Tg mice expressing OvPrP with valine (V at 136 (OvPrP-V136 infected with the same prions developed disease rapidly, and the converted prion was comprised of an unstable (U, diffusely distributed conformer. Infected Tg mice co-expressing both alleles manifested properties consistent with the U conformer, suggesting a dominant effect resulting from exclusive conversion of OvPrP-V136 but not OvPrP-A136. Surprisingly, however, studies with monoclonal antibody (mAb PRC5, which discriminates OvPrP-A136 from OvPrP-V136, revealed substantial conversion of OvPrP-A136. Moreover, the resulting OvPrP-A136 prion acquired the characteristics of the U conformer. These results, substantiated by in vitro analyses, indicated that co-expression of OvPrP-V136 altered the conversion potential of OvPrP-A136 from the S to
13C, 15N Resonance Assignment of Parts of the HET-s Prion Protein in its Amyloid Form
International Nuclear Information System (INIS)
Siemer, Ansgar B.; Ritter, Christiane; Steinmetz, Michel O.; Ernst, Matthias; Riek, Roland; Meier, Beat H.
2006-01-01
The partial 15 N and 13 C solid-state NMR resonance assignment of the HET-s prion protein fragment 218-289 in its amyloid form is presented. It is based on experiments measured at MAS frequencies in the range of 20-40 kHz using exclusively adiabatic polarization-transfer schemes. The resonance assignment within each residue is based on two-dimensional 13 C-- 13 C correlation spectra utilizing the DREAM mixing scheme. The sequential linking of the assigned residues used a set of two- and three-dimensional 15 N-- 13 C correlation experiments. Almost all cross peaks visible in the spectra are assigned, but only resonances from 43 of the 78 amino-acid residues could be detected. The missing residues are thought to be highly disordered and/or highly dynamic giving rise to broad resonance lines that escaped detection in the experiments applied. The line widths of the observed resonances are narrow and comparable to line widths observed in micro-crystalline samples. The 43 assigned residues are located in two fragments of about 20 residues
Serra, Fabienne; Müller, Joachim; Gray, John; Lüthi, Ramona; Dudas, Sandor; Czub, Stefanie; Seuberlich, Torsten
2017-03-15
Three different types of bovine spongiform encephalopathy (BSE) are known and supposedly caused by distinct prion strains: the classical (C-) BSE type that was typically found during the BSE epidemic, and two relatively rare atypical BSE types, termed H-BSE and L-BSE. The three BSE types differ in the molecular phenotype of the disease associated prion protein, namely the N-terminally truncated proteinase K (PK) resistant prion protein fragment (PrP res ). In this study, we report and analyze yet another PrP res type (PrP res-2011 ), which was found in severely autolytic brain samples of two cows in the framework of disease surveillance in Switzerland in 2011. Analysis of brain tissues from these animals by PK titration and PK inhibitor assays ruled out the process of autolysis as the cause for the aberrant PrP res profile. Immunochemical characterization of the PrP fragments present in the 2011 cases by epitope mapping indicated that PrP res-2011 corresponds in its primary sequence to the physiologically occurring PrP-C1 fragment. However, high speed centrifugation, sucrose gradient assay and NaPTA precipitation revealed biochemical similarities between PrP res-2011 and the disease-associated prion protein found in BSE affected cattle in terms of detergent insolubility, PK resistance and PrP aggregation. Although it remains to be established whether PrP res-2011 is associated with a transmissible disease, our results point out the need of further research on the role the PrP-C1 aggregation and misfolding in health and disease. Copyright © 2017. Published by Elsevier B.V.
Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks
Acutis, P.L.; Bossers, A.; Priem, J.; Riina, M.V.; Peletto, S.; Mazza, M.; Casalone, C.; Forloni, G.; Ru, G.; Caramelli, M.
2006-01-01
Susceptibility to scrapie in sheep is influenced by polymorphisms of the prion protein (PrP) gene, whereas no strong association between genetics and scrapie has yet been determined in goats due to the limited number of studies on these animals. In this case¿control study on 177 goats from six
S. pombe placed on the prion map
Directory of Open Access Journals (Sweden)
Jacqueline Hayles
2017-02-01
Full Text Available Schizosaccharomyces pombe has been used extensively as a model organism, however it is only recently that the first prion in this organism, a copper transporter protein encoded by ctr4, has been conclusively demonstrated. Prions are found in a wide range of organisms and have been implicated in a number of human neurodegenerative diseases. Research into the biology of prions has been carried out mainly in the budding yeast Saccharomyces cerevisiae, however there are many questions still to be addressed. Now, with the identification of the Ctr4 prion in S. pombe, further work in the two yeasts and comparisons of prion biology in these organisms should lead to a greater understanding of prions and their role in disease.
Yeast prions form infectious amyloid inclusion bodies in bacteria
Directory of Open Access Journals (Sweden)
Espargaró Alba
2012-06-01
Full Text Available Abstract Background Prions were first identified as infectious proteins associated with fatal brain diseases in mammals. However, fungal prions behave as epigenetic regulators that can alter a range of cellular processes. These proteins propagate as self-perpetuating amyloid aggregates being an example of structural inheritance. The best-characterized examples are the Sup35 and Ure2 yeast proteins, corresponding to [PSI+] and [URE3] phenotypes, respectively. Results Here we show that both the prion domain of Sup35 (Sup35-NM and the Ure2 protein (Ure2p form inclusion bodies (IBs displaying amyloid-like properties when expressed in bacteria. These intracellular aggregates template the conformational change and promote the aggregation of homologous, but not heterologous, soluble prionogenic molecules. Moreover, in the case of Sup35-NM, purified IBs are able to induce different [PSI+] phenotypes in yeast, indicating that at least a fraction of the protein embedded in these deposits adopts an infectious prion fold. Conclusions An important feature of prion inheritance is the existence of strains, which are phenotypic variants encoded by different conformations of the same polypeptide. We show here that the proportion of infected yeast cells displaying strong and weak [PSI+] phenotypes depends on the conditions under which the prionogenic aggregates are formed in E. coli, suggesting that bacterial systems might become useful tools to generate prion strain diversity.
Molecular Modeling of Prion Transmission to Humans
Directory of Open Access Journals (Sweden)
Etienne Levavasseur
2014-10-01
Full Text Available Using different prion strains, such as the variant Creutzfeldt-Jakob disease agent and the atypical bovine spongiform encephalopathy agents, and using transgenic mice expressing human or bovine prion protein, we assessed the reliability of protein misfolding cyclic amplification (PMCA to model interspecies and genetic barriers to prion transmission. We compared our PMCA results with in vivo transmission data characterized by attack rates, i.e., the percentage of inoculated mice that developed the disease. Using 19 seed/substrate combinations, we observed that a significant PMCA amplification was only obtained when the mouse line used as substrate is susceptible to the corresponding strain. Our results suggest that PMCA provides a useful tool to study genetic barriers to transmission and to study the zoonotic potential of emerging prion strains.
Degradation of the disease-associated prion protein by a serine protease from lichens
Johnson, C.J.; Bennett, J.P.; Biro, S.M.; Duque-Velasquez, J.C.; Rodriguez, C.M.; Bessen, R.A.; Rocke, T.E.; Bartz, Jason C.
2011-01-01
The disease-associated prion protein (PrP(TSE)), the probable etiological agent of the transmissible spongiform encephalopathies (TSEs), is resistant to degradation and can persist in the environment. Lichens, mutualistic symbioses containing fungi, algae, bacteria and occasionally cyanobacteria, are ubiquitous in the environment and have evolved unique biological activities allowing their survival in challenging ecological niches. We investigated PrP(TSE) inactivation by lichens and found acetone extracts of three lichen species (Parmelia sulcata, Cladonia rangiferina and Lobaria pulmonaria) have the ability to degrade prion protein (PrP) from TSE-infected hamsters, mice and deer. Immunoblots measuring PrP levels and protein misfolding cyclic amplification indicated at least two logs of reductions in PrP(TSE). Degradative activity was not found in closely related lichen species or in algae or a cyanobacterium that inhabit lichens. Degradation was blocked by Pefabloc SC, a serine protease inhibitor, but not inhibitors of other proteases or enzymes. Additionally, we found that PrP levels in PrP(TSE)-enriched preps or infected brain homogenates are also reduced following exposure to freshly-collected P. sulcata or an aqueous extract of the lichen. Our findings indicate that these lichen extracts efficiently degrade PrP(TSE) and suggest that some lichens could have potential to inactivate TSE infectivity on the landscape or be a source for agents to degrade prions. Further work to clone and characterize the protease, assess its effect on TSE infectivity and determine which organism or organisms present in lichens produce or influence the protease activity is warranted.
Stewart, Paula; Campbell, Lauren; Skogtvedt, Susan; Griffin, Karen A.; Arnemo, Jon M.; Tryland, Morten; Girling, Simon; Miller, Michael W.; Tranulis, Michael A.; Goldmann, Wilfred
2012-01-01
Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE) during the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD) remains an open question. Variation in the host-encoded prion protein (PrPC) largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrPC protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo) and pine marten (Martes martes) were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus) and mountain lion (Puma concolor) from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter. PMID:23236380
Directory of Open Access Journals (Sweden)
Paula Stewart
Full Text Available Mammalian species vary widely in their apparent susceptibility to prion diseases. For example, several felid species developed prion disease (feline spongiform encephalopathy or FSE during the bovine spongiform encephalopathy (BSE epidemic in the United Kingdom, whereas no canine BSE cases were detected. Whether either of these or other groups of carnivore species can contract other prion diseases (e.g. chronic wasting disease or CWD remains an open question. Variation in the host-encoded prion protein (PrP(C largely explains observed disease susceptibility patterns within ruminant species, and may explain interspecies differences in susceptibility as well. We sequenced and compared the open reading frame of the PRNP gene encoding PrP(C protein from 609 animal samples comprising 29 species from 22 genera of the Order Carnivora; amongst these samples were 15 FSE cases. Our analysis revealed that FSE cases did not encode an identifiable disease-associated PrP polymorphism. However, all canid PrPs contained aspartic acid or glutamic acid at codon 163 which we propose provides a genetic basis for observed susceptibility differences between canids and felids. Among other carnivores studied, wolverine (Gulo gulo and pine marten (Martes martes were the only non-canid species to also express PrP-Asp163, which may impact on their prion diseases susceptibility. Populations of black bear (Ursus americanus and mountain lion (Puma concolor from Colorado showed little genetic variation in the PrP protein and no variants likely to be highly resistant to prions in general, suggesting that strain differences between BSE and CWD prions also may contribute to the limited apparent host range of the latter.
Defining the Conformational Features of Anchorless, Poorly Neuroinvasive Prions
Bett, C.; Kurt, T.D.; Lucero, M.; Trejo, M.; Rozemuller, A.J.M.; Kong, Q.Z.; Nilsson, K.P.R.; Masliah, E.; Oldstone, M.B.; Sigurdson, C.J.
2013-01-01
Infectious prions cause diverse clinical signs and form an extraordinary range of structures, from amorphous aggregates to fibrils. How the conformation of a prion dictates the disease phenotype remains unclear. Mice expressing GPI-anchorless or GPI-anchored prion protein exposed to the same
Thellung, Stefano; Gatta, Elena; Pellistri, Francesca; Villa, Valentina; Corsaro, Alessandro; Nizzari, Mario; Robello, Mauro; Florio, Tullio
2017-10-01
Glia over-stimulation associates with amyloid deposition contributing to the progression of central nervous system neurodegenerative disorders. Here we analyze the molecular mechanisms mediating microglia-dependent neurotoxicity induced by prion protein (PrP)90-231, an amyloidogenic polypeptide corresponding to the protease-resistant portion of the pathological prion protein scrapie (PrP Sc ). PrP90-231 neurotoxicity is enhanced by the presence of microglia within neuronal culture, and associated to a rapid neuronal [Ca ++ ] i increase. Indeed, while in "pure" cerebellar granule neuron cultures, PrP90-231 causes a delayed intracellular Ca ++ entry mediated by the activation of NMDA receptors; when neuron and glia are co-cultured, a transient increase of [Ca ++ ] i occurs within seconds after treatment in both granule neurons and glial cells, then followed by a delayed and sustained [Ca ++ ] i raise, associated with the induction of the expression of inducible nitric oxide synthase and phagocytic NADPH oxidase. [Ca ++ ] i fast increase in neurons is dependent on the activation of multiple pathways since it is not only inhibited by the blockade of voltage-gated channel activity and NMDA receptors but also prevented by the inhibition of nitric oxide and PGE 2 release from glial cells. Thus, Ca ++ homeostasis alteration, directly induced by PrP90-231 in cerebellar granule cells, requires the activation of NMDA receptors, but is greatly enhanced by soluble molecules released by activated glia. In glia-enriched cerebellar granule cultures, the activation of inducible nitric oxide (iNOS) and NADPH oxidase represents the main mechanism of toxicity since their pharmacological inhibition prevented PrP90-231 neurotoxicity, whereas NMDA blockade by D(-)-2-amino-5-phosphonopentanoic acid is ineffective; conversely, in pure cerebellar granule cultures, NMDA blockade but not iNOS inhibition strongly reduced PrP90-231 neurotoxicity. These data indicate that amyloidogenic peptides
β-sheet-like formation during the mechanical unfolding of prion protein
Tao, Weiwei; Yoon, Gwonchan; Cao, Penghui; Eom, Kilho; Park, Harold S.
2015-09-01
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrPC, whose misfolded form PrPSc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.
β-sheet-like formation during the mechanical unfolding of prion protein
Energy Technology Data Exchange (ETDEWEB)
Tao, Weiwei; Cao, Penghui; Park, Harold S., E-mail: parkhs@bu.edu [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Yoon, Gwonchan [Department of Mechanical Engineering, Boston University, Boston, Massachusetts 02215 (United States); Department of Mechanical Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Eom, Kilho [Biomechanics Laboratory, College of Sport Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)
2015-09-28
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP{sup C}, whose misfolded form PrP{sup Sc} can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220.
β-sheet-like formation during the mechanical unfolding of prion protein
International Nuclear Information System (INIS)
Tao, Weiwei; Cao, Penghui; Park, Harold S.; Yoon, Gwonchan; Eom, Kilho
2015-01-01
Single molecule experiments and simulations have been widely used to characterize the unfolding and folding pathways of different proteins. However, with few exceptions, these tools have not been applied to study prion protein, PrP C , whose misfolded form PrP Sc can induce a group of fatal neurodegenerative diseases. Here, we apply novel atomistic modeling based on potential energy surface exploration to study the constant force unfolding of human PrP at time scales inaccessible with standard molecular dynamics. We demonstrate for forces around 100 pN, prion forms a stable, three-stranded β-sheet-like intermediate configuration containing residues 155-214 with a lifetime exceeding hundreds of nanoseconds. A mutant without the disulfide bridge shows lower stability during the unfolding process but still forms the three-stranded structure. The simulations thus not only show the atomistic details of the mechanically induced structural conversion from the native α-helical structure to the β-rich-like form but also lend support to the structural theory that there is a core of the recombinant PrP amyloid, a misfolded form reported to induce transmissible disease, mapping to C-terminal residues ≈160-220
Uchiyama, Keiji; Miyata, Hironori; Yano, Masashi; Yamaguchi, Yoshitaka; Imamura, Morikazu; Muramatsu, Naomi; Das, Nandita Rani; Chida, Junji; Hara, Hideyuki; Sakaguchi, Suehiro
2014-01-01
Prion infection induces conformational conversion of the normal prion protein PrPC, into the pathogenic isoform PrPSc, in prion diseases. It has been shown that PrP-knockout (Prnp0/0) mice transgenically reconstituted with a mouse-hamster chimeric PrP lacking N-terminal residues 23-88, or Tg(MHM2Δ23-88)/Prnp 0/0 mice, neither developed the disease nor accumulated MHM2ScΔ23-88 in their brains after inoculation with RML prions. In contrast, RML-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice developed the disease with abundant accumulation of MHM2ScΔ23-88 in their brains. These results indicate that MHM2Δ23-88 itself might either lose or greatly reduce the converting capacity to MHM2ScΔ23-88, and that the co-expressing wild-type PrPC can stimulate the conversion of MHM2Δ23-88 to MHM2ScΔ23-88 in trans. In the present study, we confirmed that Tg(MHM2Δ23-88)/Prnp 0/0 mice remained resistant to RML prions for up to 730 days after inoculation. However, we found that Tg(MHM2Δ23-88)/Prnp 0/0 mice were susceptible to 22L prions, developing the disease with prolonged incubation times and accumulating MHM2ScΔ23-88 in their brains. We also found accelerated conversion of MHM2Δ23-88 into MHM2ScΔ23-88 in the brains of RML- and 22L-inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice. However, wild-type PrPSc accumulated less in the brains of these inoculated Tg(MHM2Δ23-88)/Prnp 0/+ mice, compared with RML- and 22L-inoculated Prnp 0/+ mice. These results show that MHM2Δ23-88 itself can convert into MHM2ScΔ23-88 without the help of the trans-acting PrPC, and that, irrespective of prion strains inoculated, the co-expressing wild-type PrPC stimulates the conversion of MHM2Δ23-88 into MHM2ScΔ23-88, but to the contrary, the co-expressing MHM2Δ23-88 disturbs the conversion of wild-type PrPC into PrPSc.
Directory of Open Access Journals (Sweden)
Achim Thomzig
2007-05-01
Full Text Available Prion infectivity and its molecular marker, the pathological prion protein PrP(Sc, accumulate in the central nervous system and often also in lymphoid tissue of animals or humans affected by transmissible spongiform encephalopathies. Recently, PrP(Sc was found in tissues previously considered not to be invaded by prions (e.g., skeletal muscles. Here, we address the question of whether prions target the skin and show widespread PrP(Sc deposition in this organ in hamsters perorally or parenterally challenged with scrapie. In hamsters fed with scrapie, PrP(Sc was detected before the onset of symptoms, but the bulk of skin-associated PrP(Sc accumulated in the clinical phase. PrP(Sc was localized in nerve fibres within the skin but not in keratinocytes, and the deposition of PrP(Sc in skin showed no dependence from the route of infection and lymphotropic dissemination. The data indicated a neurally mediated centrifugal spread of prions to the skin. Furthermore, in a follow-up study, we examined sheep naturally infected with scrapie and detected PrP(Sc by Western blotting in skin samples from two out of five animals. Our findings point to the skin as a potential reservoir of prions, which should be further investigated in relation to disease transmission.
Logical design of anti-prion agents using NAGARA
Energy Technology Data Exchange (ETDEWEB)
Ma, Biao; Yamaguchi, Keiichi; Fukuoka, Mayuko [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Kuwata, Kazuo, E-mail: kuwata@gifu-u.ac.jp [United Graduate School of Drug Discovery and Medical Information Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Department of Gene and Development, Graduate School of Medicine, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan)
2016-01-22
To accelerate the logical drug design procedure, we created the program “NAGARA,” a plugin for PyMOL, and applied it to the discovery of small compounds called medical chaperones (MCs) that stabilize the cellular form of a prion protein (PrP{sup C}). In NAGARA, we constructed a single platform to unify the docking simulation (DS), free energy calculation by molecular dynamics (MD) simulation, and interfragment interaction energy (IFIE) calculation by quantum chemistry (QC) calculation. NAGARA also enables large-scale parallel computing via a convenient graphical user interface. Here, we demonstrated its performance and its broad applicability from drug discovery to lead optimization with full compatibility with various experimental methods including Western blotting (WB) analysis, surface plasmon resonance (SPR), and nuclear magnetic resonance (NMR) measurements. Combining DS and WB, we discovered anti-prion activities for two compounds and tegobuvir (TGV), a non-nucleoside non-structural protein NS5B polymerase inhibitor showing activity against hepatitis C virus genotype 1. Binding profiles predicted by MD and QC are consistent with those obtained by SPR and NMR. Free energy analyses showed that these compounds stabilize the PrP{sup C} conformation by decreasing the conformational fluctuation of the PrP{sup C}. Because TGV has been already approved as a medicine, its extension to prion diseases is straightforward. Finally, we evaluated the affinities of the fragmented regions of TGV using QC and found a clue for its further optimization. By repeating WB, MD, and QC recursively, we were able to obtain the optimum lead structure. - Highlights: • NAGARA integrates docking simulation, molecular dynamics, and quantum chemistry. • We found many compounds, e.g., tegobuvir (TGV), that exhibit anti-prion activities. • We obtained insights into the action mechanism of TGV as a medical chaperone. • Using QC, we obtained useful information for optimization of the
Relaño-Ginés, Aroa; Lehmann, Sylvain; Crozet, Carole
2014-01-01
Scientific advances in stem cell biology and adult neurogenesis have raised the hope that neurodegenerative disorders could benefit from stem cell-based therapy. Adult neurogenesis might be part of the physiological regenerative process, however it might become impaired by the disease's mechanism and therefore contribute to neurodegeneration. In prion disorders this endogenous repair system has rarely been studied. Whether adult neurogenesis plays a role or not in brain repair or in the propagation of prion pathology remains unclear. We have recently investigated the status of adult neural stem cells isolated from prion-infected mice. We were able to show that neural stem cells accumulate and replicate prions thus resulting in an alteration of their neuronal destiny. We also reproduced these results in adult neural stem cells, which were infected in vitro. The fact that endogenous adult neurogenesis could be altered by the accumulation of misfolded prion protein represents another great challenge. Inhibiting prion propagation in these cells would thus help the endogenous neurogenesis to compensate for the injured neuronal system. Moreover, understanding the endogenous modulation of the neurogenesis system would help develop effective neural stem cell-based therapies.
An ancient conserved role for prion protein in learning and memory
Directory of Open Access Journals (Sweden)
Patricia L. A. Leighton
2018-01-01
Full Text Available The misfolding of cellular prion protein (PrPC to form PrP Scrapie (PrPSc is an exemplar of toxic gain-of-function mechanisms inducing propagated protein misfolding and progressive devastating neurodegeneration. Despite this, PrPC function in the brain is also reduced and subverted during prion disease progression; thus understanding the normal function of PrPC in healthy brains is key. Disrupting PrPC in mice has led to a myriad of controversial functions that sometimes map onto disease symptoms, including a proposed role in memory or learning. Intriguingly, PrPC interaction with amyloid beta (Aβ oligomers at synapses has also linked its function to Alzheimer's disease and dementia in recent years. We set out to test the involvement of PrPC in memory using a disparate animal model, the zebrafish. Here we document an age-dependent memory decline in prp2−/− zebrafish, pointing to a conserved and ancient role of PrPC in memory. Specifically, we found that aged (3-year-old prp2−/− fish performed poorly in an object recognition task relative to age-matched prp2+/+ fish or 1-year-old prp2−/− fish. Further, using a novel object approach (NOA test, we found that aged (3-year-old prp2−/− fish approached the novel object more than either age-matched prp2+/+ fish or 1-year-old prp2−/− fish, but did not have decreased anxiety when we tested them in a novel tank diving test. Taken together, the results of the NOA and novel tank diving tests suggest an altered cognitive appraisal of the novel object in the 3-year-old prp2−/− fish. The learning paradigm established here enables a path forward to study PrPC interactions of relevance to Alzheimer's disease and prion diseases, and to screen for candidate therapeutics for these diseases. The findings underpin a need to consider the relative contributions of loss- versus gain-of-function of PrPC during Alzheimer's and prion diseases, and have implications upon the prospects of several
Production, purification and oxidative folding of the mouse recombinant prion protein
Czech Academy of Sciences Publication Activity Database
Pavlíček, A.; Bednárová, Lucie; Holada, K.
2007-01-01
Roč. 52, č. 4 (2007), s. 391-397 ISSN 0015-5632 R&D Projects: GA ČR GD310/05/H533 Grant - others:GA ČR(CZ) GA310/04/0419 Institutional research plan: CEZ:AV0Z40550506 Keywords : recombinant prion protein * production * purification * folding Subject RIV: CE - Biochemistry Impact factor: 0.989, year: 2007 http://www.biomed.cas.cz/mbu/folia/
Prion protein β2-α2 loop conformational landscape.
Caldarulo, Enrico; Barducci, Alessandro; Wüthrich, Kurt; Parrinello, Michele
2017-09-05
In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal "cellular" prion protein ([Formula: see text]) is transformed into amyloid aggregates representing the "scrapie form" of the protein ([Formula: see text]). Continued research on this system is of keen interest, since new information on the physiological function of [Formula: see text] in healthy organisms is emerging, as well as new data on the mechanism of the transformation of [Formula: see text] to [Formula: see text] In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of [Formula: see text] The focus of the data analysis was on an 11-residue polypeptide segment in mouse [Formula: see text](121-231) that includes the [Formula: see text]2-[Formula: see text]2 loop of residues 167-170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse [Formula: see text] and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on [Formula: see text], providing quantitative insights into the nature of the structural transition-related function of the [Formula: see text]2-[Formula: see text]2 loop.
Structure-based view on [PSI(+)] prion properties.
Bondarev, Stanislav A; Zhouravleva, Galina A; Belousov, Mikhail V; Kajava, Andrey V
2015-01-01
Yeast [PSI(+)] prion is one of the most suitable and well characterized system for the investigation of the prion phenomenon. However, until recently, the lack of data on the 3D arrangement of Sup35p prion fibrils hindered progress in this area. The recent arrival in this field of new experimental techniques led to the parallel and in-register superpleated β-structure as a consensus model for Sup35p fibrils. Here, we analyzed the effect of amino acid substitutions of the Sup35 protein through the prism of this structural model. Application of a newly developed computational approach, called ArchCandy, gives us a better understanding of the effect caused by mutations on the fibril forming potential of Sup35 protein. This bioinformatics tool can be used for the design of new mutations with desired modification of prion properties. Thus, we provide examples of how today, having progress toward elucidation of the structural arrangement of Sup35p fibrils, researchers can advance more efficiently to a better understanding of prion [PSI(+)] stability and propagation.
Moore, Roger A; Head, Mark W; Ironside, James W; Ritchie, Diane L; Zanusso, Gianluigi; Choi, Young Pyo; Pyo Choi, Young; Priola, Suzette A
2016-02-01
Sporadic Creutzfeldt-Jakob disease (sCJD) is the most prevalent of the human prion diseases, which are fatal and transmissible neurodegenerative diseases caused by the infectious prion protein (PrP(Sc)). The origin of sCJD is unknown, although the initiating event is thought to be the stochastic misfolding of endogenous prion protein (PrP(C)) into infectious PrP(Sc). By contrast, human growth hormone-associated cases of iatrogenic CJD (iCJD) in the United Kingdom (UK) are associated with exposure to an exogenous source of PrP(Sc). In both forms of CJD, heterozygosity at residue 129 for methionine (M) or valine (V) in the prion protein gene may affect disease phenotype, onset and progression. However, the relative contribution of each PrP(C) allotype to PrP(Sc) in heterozygous cases of CJD is unknown. Using mass spectrometry, we determined that the relative abundance of PrP(Sc) with M or V at residue 129 in brain specimens from MV cases of sCJD was highly variable. This result is consistent with PrP(C) containing an M or V at residue 129 having a similar propensity to misfold into PrP(Sc) thus causing sCJD. By contrast, PrP(Sc) with V at residue 129 predominated in the majority of the UK human growth hormone associated iCJD cases, consistent with exposure to infectious PrP(Sc) containing V at residue 129. In both types of CJD, the PrP(Sc) allotype ratio had no correlation with CJD type, age at clinical onset, or disease duration. Therefore, factors other than PrP(Sc) allotype abundance must influence the clinical progression and phenotype of heterozygous cases of CJD.
Implications of prion adaptation and evolution paradigm for human neurodegenerative diseases.
Kabir, M Enamul; Safar, Jiri G
2014-01-01
There is a growing body of evidence indicating that number of human neurodegenerative diseases, including Alzheimer disease, Parkinson disease, fronto-temporal dementias, and amyotrophic lateral sclerosis, propagate in the brain via prion-like intercellular induction of protein misfolding. Prions cause lethal neurodegenerative diseases in humans, the most prevalent being sporadic Creutzfeldt-Jakob disease (sCJD); they self-replicate and spread by converting the cellular form of prion protein (PrP(C)) to a misfolded pathogenic conformer (PrP(Sc)). The extensive phenotypic heterogeneity of human prion diseases is determined by polymorphisms in the prion protein gene, and by prion strain-specific conformation of PrP(Sc). Remarkably, even though informative nucleic acid is absent, prions may undergo rapid adaptation and evolution in cloned cells and upon crossing the species barrier. In the course of our investigation of this process, we isolated distinct populations of PrP(Sc) particles that frequently co-exist in sCJD. The human prion particles replicate independently and undergo competitive selection of those with lower initial conformational stability. Exposed to mutant substrate, the winning PrP(Sc) conformers are subject to further evolution by natural selection of the subpopulation with the highest replication rate due to the lowest stability. Thus, the evolution and adaptation of human prions is enabled by a dynamic collection of distinct populations of particles, whose evolution is governed by the selection of progressively less stable, faster replicating PrP(Sc) conformers. This fundamental biological mechanism may explain the drug resistance that some prions gained after exposure to compounds targeting PrP(Sc). Whether the phenotypic heterogeneity of other neurodegenerative diseases caused by protein misfolding is determined by the spectrum of misfolded conformers (strains) remains to be established. However, the prospect that these conformers may evolve and
Prion disease tempo determined by host-dependent substrate reduction
Mays, C.E.; Kim, C.; Haldiman, T.; Merwe, v.d. J.; Lau, A.; Yang, J.; Grams, J.; Bari, Di M.A.; Nonno, R.; Telling, G.C.; Kong, Q.; Langeveld, J.P.M.; McKenzie, D.; Westaway, D.; Safar, J.G.
2014-01-01
The symptoms of prion infection can take years or decades to manifest following the initial exposure. Molecular markers of prion disease include accumulation of the misfolded prion protein (PrPSc), which is derived from its cellular precursor (PrPC), as well as downregulation of the PrP-like Shadoo
Comparative syntheses of peptide thioesters derived from mouse and human prion proteins
Czech Academy of Sciences Publication Activity Database
Šebestík, Jaroslav; Zawada, Zbigniew; Šafařík, Martin; Hlaváček, Jan
2011-01-01
Roč. 41, Suppl. 1 (2011), S78-S79 ISSN 0939-4451. [International Congress on Amino Acids, Peptides and Proteins /12./. 01.08.2011-05.08.2011, Beijing] R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : peptide thioesters * ligation * prions * C-domain Subject RIV: CC - Organic Chemistry
Moreno, Julie A.; Telling, Glenn C.
2018-01-01
Prions represent a new paradigm of protein-mediated information transfer. In the case of mammals, prions are the cause of fatal, transmissible neurodegenerative diseases, sometimes referred to as transmissible spongiform encephalopathies (TSE’s), which frequently occur as epidemics. An increasing body of evidence indicates that the canonical mechanism of conformational corruption of cellular prion protein (PrPC) by the pathogenic isoform (PrPSc) that is the basis of prion formation in TSE’s, is common to a spectrum of proteins associated with various additional human neurodegenerative disorders, including the more common Alzheimer’s and Parkinson’s diseases. The peerless infectious properties of TSE prions, and the unparalleled tools for their study, therefore enable elucidation of mechanisms of template-mediated conformational propagation that are generally applicable to these related disease states. Many unresolved issues remain including the exact molecular nature of the prion, the detailed cellular and molecular mechanisms of prion propagation, and the means by which prion diseases can be both genetic and infectious. In addition, we know little about the mechanism by which neurons degenerate during prion diseases. Tied to this, the physiological role of the normal form of the prion protein remains unclear and it is uncertain whether or not loss of this function contributes to prion pathogenesis. The factors governing the transmission of prions between species remain unclear, in particular the means by which prion strains and PrP primary structure interact to affect inter-species prion transmission. Despite all these unknowns, advances in our understanding of prions have occurred because of their transmissibility to experimental animals and the development of transgenic (Tg) mouse models has done much to further our understanding about various aspects of prion biology. In this review we will focus on advances in our understanding of prion biology that
Pros and cons of a prion-like pathogenesis in Parkinson's disease
Directory of Open Access Journals (Sweden)
Brotchie Jonathan M
2011-06-01
Full Text Available Abstract Background Parkinson's disease (PD is a slowly progressive neurodegenerative disorder which affects widespread areas of the brainstem, basal ganglia and cerebral cortex. A number of proteins are known to accumulate in parkinsonian brains including ubiquitin and α-synuclein. Prion diseases are sporadic, genetic or infectious disorders with various clinical and histopathological features caused by prion proteins as infectious proteinaceous particles transmitting a misfolded protein configuration through brain tissue. The most important form is Creutzfeldt-Jakob disease which is associated with a self-propagating pathological precursor form of the prion protein that is physiologically widely distributed in the central nervous system. Discussion It has recently been found that α-synuclein may behave similarly to the prion precursor and propagate between cells. The post-mortem proof of α-synuclein containing Lewy bodies in embryonic dopamine cells transplants in PD patient suggests that the misfolded protein might be transmitted from the diseased host to donor neurons reminiscent of prion behavior. The involvement of the basal ganglia and brainstem in the degenerative process are other congruencies between Parkinson's and Creutzfeldt-Jakob disease. However, a number of issues advise caution before categorizing Parkinson's disease as a prion disorder, because clinical appearance, brain imaging, cerebrospinal fluid and neuropathological findings exhibit fundamental differences between both disease entities. Most of all, infectiousness, a crucial hallmark of prion diseases, has never been observed in PD so far. Moreover, the cellular propagation of the prion protein has not been clearly defined and it is, therefore, difficult to assess the molecular similarities between the two disease entities. Summary At the current state of knowledge, the molecular pathways of transmissible pathogenic proteins are not yet fully understood. Their exact
Pin1 and neurodegeneration: a new player for prion disorders?
Directory of Open Access Journals (Sweden)
Elisa Isopi
2015-07-01
Full Text Available Pin1 is a peptidyl-prolyl isomerase that catalyzes the cis/trans conversion of phosphorylated proteins at serine or threonine residues which precede a proline. The peptidyl-prolyl isomerization induces a conformational change of the proteins involved in cell signaling process. Pin1 dysregulation has been associated with some neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Huntington's disease. Proline-directed phosphorylation is a common regulator of these pathologies and a recent work showed that it is also involved in prion disorders. In fact, prion protein phosphorylation at the Ser-43-Pro motif induces prion protein conversion into a disease-associated form. Furthermore, phosphorylation at Ser-43-Pro has been observed to increase in the cerebral spinal fluid of sporadic Creutzfeldt-Jakob Disease patients. These findings provide new insights into the pathogenesis of prion disorders, suggesting Pin1 as a potential new player in the disease. In this paper, we review the mechanisms underlying Pin1 involvement in the aforementioned neurodegenerative pathologies focusing on the potential role of Pin1 in prion disorders.
Directory of Open Access Journals (Sweden)
Kourosh Bamdad
2016-12-01
Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion: Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.
Genetic human prion disease modelled in PrP transgenic Drosophila.
Thackray, Alana M; Cardova, Alzbeta; Wolf, Hanna; Pradl, Lydia; Vorberg, Ina; Jackson, Walker S; Bujdoso, Raymond
2017-09-20
Inherited human prion diseases, such as fatal familial insomnia (FFI) and familial Creutzfeldt-Jakob disease (fCJD), are associated with autosomal dominant mutations in the human prion protein gene PRNP and accumulation of PrP Sc , an abnormal isomer of the normal host protein PrP C , in the brain of affected individuals. PrP Sc is the principal component of the transmissible neurotoxic prion agent. It is important to identify molecular pathways and cellular processes that regulate prion formation and prion-induced neurotoxicity. This will allow identification of possible therapeutic interventions for individuals with, or at risk from, genetic human prion disease. Increasingly, Drosophila has been used to model human neurodegenerative disease. An important unanswered question is whether genetic prion disease with concomitant spontaneous prion formation can be modelled in Drosophila We have used pUAST/PhiC31-mediated site-directed mutagenesis to generate Drosophila transgenic for murine or hamster PrP (prion protein) that carry single-codon mutations associated with genetic human prion disease. Mouse or hamster PrP harbouring an FFI (D178N) or fCJD (E200K) mutation showed mild Proteinase K resistance when expressed in Drosophila Adult Drosophila transgenic for FFI or fCJD variants of mouse or hamster PrP displayed a spontaneous decline in locomotor ability that increased in severity as the flies aged. Significantly, this mutant PrP-mediated neurotoxic fly phenotype was transferable to recipient Drosophila that expressed the wild-type form of the transgene. Collectively, our novel data are indicative of the spontaneous formation of a PrP-dependent neurotoxic phenotype in FFI- or CJD-PrP transgenic Drosophila and show that inherited human prion disease can be modelled in this invertebrate host. © 2017 The Author(s).
Direct Detection of Soil-Bound Prions
Genovesi, Sacha; Leita, Liviana; Sequi, Paolo; Andrighetto, Igino; Sorgato, M. Catia; Bertoli, Alessandro
2007-01-01
Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrPSc) of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challanged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures. PMID:17957252
Direct detection of soil-bound prions.
Directory of Open Access Journals (Sweden)
Sacha Genovesi
Full Text Available Scrapie and chronic wasting disease are contagious prion diseases affecting sheep and cervids, respectively. Studies have indicated that horizontal transmission is important in sustaining these epidemics, and that environmental contamination plays an important role in this. In the perspective of detecting prions in soil samples from the field by more direct methods than animal-based bioassays, we have developed a novel immuno-based approach that visualises in situ the major component (PrP(Sc of prions sorbed onto agricultural soil particles. Importantly, the protocol needs no extraction of the protein from soil. Using a cell-based assay of infectivity, we also report that samples of agricultural soil, or quartz sand, acquire prion infectivity after exposure to whole brain homogenates from prion-infected mice. Our data provide further support to the notion that prion-exposed soils retain infectivity, as recently determined in Syrian hamsters intracerebrally or orally challenged with contaminated soils. The cell approach of the potential infectivity of contaminated soil is faster and cheaper than classical animal-based bioassays. Although it suffers from limitations, e.g. it can currently test only a few mouse prion strains, the cell model can nevertheless be applied in its present form to understand how soil composition influences infectivity, and to test prion-inactivating procedures.
Experimental Models of Inherited PrP Prion Diseases.
Watts, Joel C; Prusiner, Stanley B
2017-11-01
The inherited prion protein (PrP) prion disorders, which include familial Creutzfeldt-Jakob disease, Gerstmann-Sträussler-Scheinker disease, and fatal familial insomnia, constitute ∼10%-15% of all PrP prion disease cases in humans. Attempts to generate animal models of these disorders using transgenic mice expressing mutant PrP have produced variable results. Although many lines of mice develop spontaneous signs of neurological illness with accompanying prion disease-specific neuropathological changes, others do not. Furthermore, demonstrating the presence of protease-resistant PrP species and prion infectivity-two of the hallmarks of the PrP prion disorders-in the brains of spontaneously sick mice has proven particularly challenging. Here, we review the progress that has been made toward developing accurate mouse models of the inherited PrP prion disorders. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.
Prion protein β2–α2 loop conformational landscape
Caldarulo, Enrico; Wüthrich, Kurt; Parrinello, Michele
2017-01-01
In transmissible spongiform encephalopathies (TSEs), which are lethal neurodegenerative diseases that affect humans and a wide range of other mammalian species, the normal “cellular” prion protein (PrPC) is transformed into amyloid aggregates representing the “scrapie form” of the protein (PrPSc). Continued research on this system is of keen interest, since new information on the physiological function of PrPC in healthy organisms is emerging, as well as new data on the mechanism of the transformation of PrPC to PrPSc. In this paper we used two different approaches: a combination of the well-tempered ensemble (WTE) and parallel tempering (PT) schemes and metadynamics (MetaD) to characterize the conformational free-energy surface of PrPC. The focus of the data analysis was on an 11-residue polypeptide segment in mouse PrPC(121–231) that includes the β2–α2 loop of residues 167–170, for which a correlation between structure and susceptibility to prion disease has previously been described. This study includes wild-type mouse PrPC and a variant with the single-residue replacement Y169A. The resulting detailed conformational landscapes complement in an integrative manner the available experimental data on PrPC, providing quantitative insights into the nature of the structural transition-related function of the β2–α2 loop. PMID:28827331
Differential effects of divalent cations on elk prion protein fibril formation and stability
Misfolding of the normally folded prion protein of mammals (PrPC) into infectious fibrils causes a variety of different diseases, from scrapie in sheep to bovine spongiform encephalopathy in cattle to chronic wasting disease (CWD) in deer and elk. The misfolded form of PrPC, termed PrPSc, or in this...
Choi, Yeong-Gon; Kim, Jae-Il; Choi, Eun-Kyoung; Carp, Richard I; Kim, Yong-Sun
2016-01-01
Previous studies have shown that the Nε-carboxymethyl group is linked to not only one or more N-terminal Lys residues but also to one or more Lys residues of the protease-resistant core region of the pathogenic prion isoform (PrPSc) in prion-infected brains. Using an anti-advanced glycation end product (AGE) antibody, we detected nonenzymatically glycated PrPSc (AGE-PrPSc) in prion-infected brains following concentration by a series of ultracentrifugation steps with a sucrose cushion. In the present study, the levels of in vitro nonenzymatic glycation of PrPSc using sucrose were investigated to determine whether sucrose cushion can artificially and nonenzymatically induce in vitro glycation during ultracentrifugation. The first insoluble pellet fraction following the first ultracentrifugation (PU1st) collected from 263K scrapie-infected brains was incubated with sucrose, glucose or colloidal silica coated with polyvinylpyrrolidone (percoll). None of the compounds in vitro resulted in AGE-PrPSc. Nonetheless, glucose and percoll produced AGEs in vitro from other proteins within PU1st of the infected brains. This reaction could lead to the AGE-modified polymer(s) of nonenzymatic glycation-prone protein(s). This study showed that PrPSc is not nonenzymatically glycated in vitro with sucrose, glucose or percoll and that AGE-modified PrPSc can be isolated and enriched from prion-infected brains.
Prion disease. The characteristics and diagnostic points in Japan
International Nuclear Information System (INIS)
Sanjo, Nobuo; Mizusawa, Hidehiro
2010-01-01
Prion disease develops when normal prion proteins change into transmissible abnormal prion proteins and the converted proteins accumulate in the brain. The Japanese Creutzfeldt-Jakob Disease (CJD) Surveillance Committee has identified 1,320 patients with prion diseases in the 10 years since 1999 (classified into 3 types: sporadic, 77.2%; hereditary, 16.7%; and environmentally acquired, 6.1%). Compared with patients in other countries, a relatively larger number of Japanese patients characteristically have dura mater graft-associated CJD and hereditary prion diseases. All the environmentally acquired cases, except 1 case of variant CJD, were acquired from dura grafts. Although most patients were diagnosed with a classical subtype of sporadic CJD (sCJD), whose features include rapidly progressing dementia, myoclonus, hyperintensity in the cerebral cortex and basal ganglia in diffusion-weighted magnetic resonance imaging, and periodic synchronous discharge in electroencephalography, the number of cases with atypical symptoms, such as MM2 (0.8%), MV2 (0.2%), VV1 (0%), and VV2 (0.2%) subtypes of sCJD cases, was not negligible. Appropriate diagnosis should be made based on clinical features, neuroradiological findings, cerebrospinal fluid (CSF) findings (14-3-3 and total tau proteins), and genetic analysis of polymorphisms. Hereditary prion diseases are classified into 3 major phenotypes: familial CJD (fCJD); Gerstmann-Straeussler-Scheinker disease (GSS), which mainly presents as spinocerebellar ataxia; and fatal familial insomnia. Many mutations of the prion protein gene have been identified, but V1801 (fCJD), P102L (GSS), and E200K (fCJD) mutations were the most common among the fCJD cases in Japan. Without a family history, genetic testing is necessary to distinguish even seemingly ''sporadic'' CJD from fCJD. Accurate diagnosis is important for clarification of the pathological process, prevention of secondary infection, and also psychological support. (author)
Translational errors as an early event in prion conversion.
Hatin, I; Bidou, L; Cullin, C; Rousset, J P
2001-01-01
A prion is an infectious, altered form of a cellular protein which can self-propagate and affect normal phenotype. Prion conversion has been observed for mammalian and yeast proteins but molecular mechanisms that trigger this process remain unclear. Up to now, only post-translational models have been explored. In this work, we tested the hypothesis that co-translational events may be implicated in the conformation changes of the Ure2p protein of Saccharomyces cerevisiae. This protein can adopt a prion conformation leading to an [URE3] phenotype which can be easily assessed and quantified. We analyzed the effect of two antibiotics, known to affect translation, on [URE3] conversion frequency. For cells treated with G418 we observed a parallel increase of translational errors rate and frequency of [URE3] conversion. By contrast, cycloheximide which was not found to affect translational fidelity, has no influence on the induction of [URE3] phenotype. These results raise the possibility that the mechanism of prion conversion might not only involve alternative structures of strictly identical molecules but also aberrant proteins resulting from translational errors.
Leliveld, S Rutger; Stitz, Lothar; Korth, Carsten
2008-06-10
A misfolded conformation of the prion protein (PrP), PrP (Sc), is the essential component of prions, the infectious agents that cause transmissible neurodegenerative diseases. Insertional mutations that lead to an increase in the number of octarepeats (ORs) in PrP are linked to familial human prion disease. In this study, we investigated how expansion of the OR domain causes PrP to favor a prion-like conformation. Therefore, we compared the conformational and aggregation modulating properties of wild-type versus expanded OR domains, either as a fusion construct with the protein G B1 domain (GB1-OR) or as an integral part of full-length mouse PrP (MoPrP). Using circular dichroism spectroscopy, we first demonstrated that ORs are not unfolded but exist as an ensemble of three distinct conformers: polyproline helix-like, beta-turn, and "Trp-related". Domain expansion had little effect on the conformation of GB1-OR fusion proteins. When part of MoPrP however, OR domain expansion changed PrP's folding landscape, not by hampering the production of native alpha-helical monomers but by greatly reducing the propensity to form amyloid and by altering the assembly of misfolded, beta-rich aggregates. These features may relate to subtle pH-dependent conformational differences between wild-type and mutant monomers. In conclusion, we propose that PrP insertional mutations are pathogenic because they enhance specific misfolding pathways of PrP rather than by undermining native folding. This idea was supported by a trial bioassay in transgenic mice overexpressing wild-type MoPrP, where intracerebral injection of recombinant MoPrP with an expanded OR domain but not wild-type MoPrP caused prion disease.
2007-06-01
is not known. Obtaining structural information on the misfolded isoform of prion may lead to preventative therapies and treatments of prion diseases...the misfolded prion isoform may allow for the development of drug therapies or early detection systems for prion diseases, or illuminate mechanistic...showing fluorescence intensity as a function of time and energy for 2,6-p-toluidinonapththalene adsorbed to egg L-α- lecithin vesicles. The steady
International Nuclear Information System (INIS)
Kim, Chan-Lan; Umetani, Atsushi; Matsui, Toshio; Ishiguro, Naotaka; Shinagawa, Morikazu; Horiuchi, Motohiro
2004-01-01
We established a panel of monoclonal antibodies (mAbs) against prion protein (PrP) by immunizing PrP gene-ablated mice with the pathogenic isoform of prion protein (PrP Sc ) or recombinant prion protein (rPrP). The mAbs could be divided into at least 10 groups by fine epitope analyses using mutant rPrPs and pepspot analysis. Seven linear epitopes, lying within residues 56-90, 119-127, 137-143, 143-149, 147-151, 163-169, and 219-229, were defined by seven groups of mAbs, although the remaining three groups of mAbs recognized discontinuous epitopes. We attempted to examine whether any of these epitopes are located on the accessible surface of PrP Sc . However, no mAbs reacted with protease-treated PrP Sc purified from scrapie-affected mice, even when PrP Sc was dispersed into a detergent-lipid protein complex, to reduce the size of PrP Sc aggregates. In contrast, denaturation of PrP Sc by guanidine hydrochloride efficiently exposed all of the epitopes. This suggests that any epitope recognized by this panel of mAbs is buried within the PrP Sc aggregates. Alternatively, if the corresponding region(s) are on the surface of PrP Sc , the region(s) may be folded into conformations to which the mAbs cannot bind. The reactivity of a panel of mAb also showed that the state of PrP Sc aggregation influenced the denaturation process, and the sensitivity to denaturation appeared to vary between epitopes. Our results demonstrate that this new panel of well-characterized mAbs will be valuable for studying the biochemistry and biophysics of PrP molecules as well as for the immuno-diagnosis of prion diseases
{sup 13}C, {sup 15}N Resonance Assignment of Parts of the HET-s Prion Protein in its Amyloid Form
Energy Technology Data Exchange (ETDEWEB)
Siemer, Ansgar B. [Physical Chemistry (Switzerland); Ritter, Christiane [Salk Institute, Structural Biology Laboratory (United States); Steinmetz, Michel O. [Paul Scherrer Institut, Biomolecular Research, Structural Biology (Switzerland); Ernst, Matthias [Physical Chemistry (Switzerland); Riek, Roland [Salk Institute, Structural Biology Laboratory (United States); Meier, Beat H. [Physical Chemistry (Switzerland)
2006-02-15
The partial {sup 15}N and {sup 13}C solid-state NMR resonance assignment of the HET-s prion protein fragment 218-289 in its amyloid form is presented. It is based on experiments measured at MAS frequencies in the range of 20-40 kHz using exclusively adiabatic polarization-transfer schemes. The resonance assignment within each residue is based on two-dimensional {sup 13}C--{sup 13}C correlation spectra utilizing the DREAM mixing scheme. The sequential linking of the assigned residues used a set of two- and three-dimensional {sup 15}N--{sup 13}C correlation experiments. Almost all cross peaks visible in the spectra are assigned, but only resonances from 43 of the 78 amino-acid residues could be detected. The missing residues are thought to be highly disordered and/or highly dynamic giving rise to broad resonance lines that escaped detection in the experiments applied. The line widths of the observed resonances are narrow and comparable to line widths observed in micro-crystalline samples. The 43 assigned residues are located in two fragments of about 20 residues.
Prion Replication Elicits Cytopathic Changes in Differentiated Neurosphere Cultures
Iwamaru, Yoshifumi; Takenouchi, Takato; Imamura, Morikazu; Shimizu, Yoshihisa; Miyazawa, Kohtaro; Mohri, Shirou; Yokoyama, Takashi
2013-01-01
The molecular mechanisms of prion-induced cytotoxicity remain largely obscure. Currently, only a few cell culture models have exhibited the cytopathic changes associated with prion infection. In this study, we introduced a cell culture model based on differentiated neurosphere cultures isolated from the brains of neonatal prion protein (PrP)-null mice and transgenic mice expressing murine PrP (dNP0 and dNP20 cultures). Upon exposure to mouse Chandler prions, dNP20 cultures supported the de novo formation of abnormal PrP and the resulting infectivity, as assessed by bioassays. Furthermore, this culture was susceptible to various prion strains, including mouse-adapted scrapie, bovine spongiform encephalopathy, and Gerstmann-Sträussler-Scheinker syndrome prions. Importantly, a subset of the cells in the infected culture that was mainly composed of astrocyte lineage cells consistently displayed late-occurring, progressive signs of cytotoxicity as evidenced by morphological alterations, decreased cell viability, and increased lactate dehydrogenase release. These signs of cytotoxicity were not observed in infected dNP0 cultures, suggesting the requirement of endogenous PrP expression for prion-induced cytotoxicity. Degenerated cells positive for glial fibrillary acidic protein accumulated abnormal PrP and exhibited features of apoptotic death as assessed by active caspase-3 and terminal deoxynucleotidyltransferase nick-end staining. Furthermore, caspase inhibition provided partial protection from prion-mediated cell death. These results suggest that differentiated neurosphere cultures can provide an in vitro bioassay for mouse prions and permit the study of the molecular basis for prion-induced cytotoxicity at the cellular level. PMID:23740992
Prion infections and anti-PrP antibodies trigger converging neurotoxic pathways.
Directory of Open Access Journals (Sweden)
Uli S Herrmann
2015-02-01
Full Text Available Prions induce lethal neurodegeneration and consist of PrPSc, an aggregated conformer of the cellular prion protein PrPC. Antibody-derived ligands to the globular domain of PrPC (collectively termed GDL are also neurotoxic. Here we show that GDL and prion infections activate the same pathways. Firstly, both GDL and prion infection of cerebellar organotypic cultured slices (COCS induced the production of reactive oxygen species (ROS. Accordingly, ROS scavenging, which counteracts GDL toxicity in vitro and in vivo, prolonged the lifespan of prion-infected mice and protected prion-infected COCS from neurodegeneration. Instead, neither glutamate receptor antagonists nor inhibitors of endoplasmic reticulum calcium channels abolished neurotoxicity in either model. Secondly, antibodies against the flexible tail (FT of PrPC reduced neurotoxicity in both GDL-exposed and prion-infected COCS, suggesting that the FT executes toxicity in both paradigms. Thirdly, the PERK pathway of the unfolded protein response was activated in both models. Finally, 80% of transcriptionally downregulated genes overlapped between prion-infected and GDL-treated COCS. We conclude that GDL mimic the interaction of PrPSc with PrPC, thereby triggering the downstream events characteristic of prion infection.
Currently, there is a lack of pathologic landmarks to describe the progression of prion disease in vivo. The goal of this work was to determine the temporal relationship between the transport of misfolded prion protein from the brain to the retina, the accumulation of PrPSc in the retina, the respon...
CWDPRNP: A tool for cervid prion sequence analysis in program R
Miller, William L.; Walter, W. David
2017-01-01
Chronic wasting disease is a fatal, neurological disease caused by an infectious prion protein, which affects economically and ecologically important members of the family Cervidae. Single nucleotide polymorphisms within the prion protein gene have been linked to differential susceptibility to the disease in many species. Wildlife managers are seeking to determine the frequencies of disease-associated alleles and genotypes and delineate spatial genetic patterns. The CWDPRNP package, implemented in program R, provides a unified framework for analyzing prion protein gene variability and spatial structure.
The N-terminal, polybasic region is critical for prion protein neuroprotective activity.
Directory of Open Access Journals (Sweden)
Jessie A Turnbaugh
Full Text Available Several lines of evidence suggest that the normal form of the prion protein, PrP(C, exerts a neuroprotective activity against cellular stress or toxicity. One of the clearest examples of such activity is the ability of wild-type PrP(C to suppress the spontaneous neurodegenerative phenotype of transgenic mice expressing a deleted form of PrP (Δ32-134, called F35. To define domains of PrP involved in its neuroprotective activity, we have analyzed the ability of several deletion mutants of PrP (Δ23-31, Δ23-111, and Δ23-134 to rescue the phenotype of Tg(F35 mice. Surprisingly, all of these mutants displayed greatly diminished rescue activity, although Δ23-31 PrP partially suppressed neuronal loss when expressed at very high levels. Our results pinpoint the N-terminal, polybasic domain as a critical determinant of PrP(C neuroprotective activity, and suggest that identification of molecules interacting with this region will provide important clues regarding the normal function of the protein. Small molecule ligands targeting this region may also represent useful therapeutic agents for treatment of prion diseases.
Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.
Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D
2011-11-01
Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.
Directory of Open Access Journals (Sweden)
Julie Jodoin
2009-08-01
Full Text Available Previously, we have shown the loss of anti-Bax function in Creutzfeldt Jakob disease (CJD-associated prion protein (PrP mutants that are unable to generate cytosolic PrP (CyPrP. To determine if the anti-Bax function of PrP modulates the manifestation of prion diseases, we further investigated the anti-Bax function of eight familial Gerstmann-Sträussler-Scheinker Syndrome (GSS-associated PrP mutants. These PrP mutants contained their respective methionine ((M or valine ((V at codon 129. All of the mutants lost their ability to prevent Bax-mediated chromatin condensation or DNA fragmentation in primary human neurons. In the breast carcinoma MCF-7 cells, the F198S(V, D202N(V, P102L(V and Q217R(V retained, whereas the P102L(M, P105L(V, Y145stop(M and Q212P(M PrP mutants lost their ability to inhibit Bax-mediated condensed chromatin. The inhibition of Bax-mediated condensed chromatin depended on the ability of the mutants to generate cytosolic PrP. However, except for the P102L(V, none of the mutants significantly inhibited Bax-mediated caspase activation. These results show that the cytosolic PrP generated from the GSS mutants is not as efficient as wild type PrP in inhibiting Bax-mediated cell death. Furthermore, these results indicate that the anti-Bax function is also disrupted in GSS-associated PrP mutants and is not associated with the difference between CJD and GSS.
Immunohistochemical detection of prion protein in lymphoid tissues of sheep with natural scrapie
Keulen, van L.J.M.; Schreuder, B.E.C.; Meloen, R.H.; Mooij-Harkes, G.; Vromans, M.E.W.; Langeveld, J.P.M.
1996-01-01
The scrapie-associated form of the prion protein (PrP(Sc)) accumulates in the brain and lymphoid tissues of sheep with scrapie. In order to assess whether detecting PrP(Sc) in lymphoid tissue could he used as a diagnostic test for scrapie, we studied the localization and distribution of PrP(Sc) in
Amano, Yuko; Kimura, Noriyuki; Hanaoka, Takuya; Aso, Yasuhiro; Hirano, Teruyuki; Murai, Hiroyuki; Satoh, Katsuya; Matsubara, Etsuro
2015-01-01
Here we report a genetically confirmed case of Creutzfeldt-Jakob disease with a prion protein gene codon 180 mutation presenting atypical magnetic resonance imaging findings. The present case exhibited an acute onset and lateralized neurologic signs, and progressive cognitive impairment. No myoclonus or periodic synchronous discharges on electroencephalography were observed. Diffusion-weighted images revealed areas of high signal intensity in the right frontal and temporal cortices at onset that extended to the whole cortex and basal ganglia of the right cerebral hemisphere at 3 months. Although the cerebrospinal fluid (CSF) was initially negative for neuron specific enolase, tau protein, 14-3-3 protein, and abnormal prion protein, the CSF was positive for these brain-derived proteins at 3 months after onset.
Antimicrobial Activity of Human Prion Protein Is Mediated by Its N-Terminal Region
Pasupuleti, Mukesh; Roupe, Markus; Rydeng?rd, Victoria; Surewicz, Krystyna; Surewicz, Witold K.; Chalupka, Anna; Malmsten, Martin; S?rensen, Ole E.; Schmidtchen, Artur
2009-01-01
BACKGROUND: Cellular prion-related protein (PrP(c)) is a cell-surface protein that is ubiquitously expressed in the human body. The multifunctionality of PrP(c), and presence of an exposed cationic and heparin-binding N-terminus, a feature characterizing many antimicrobial peptides, made us hypothesize that PrP(c) could exert antimicrobial activity. METHODOLOGY AND PRINCIPAL FINDINGS: Intact recombinant PrP exerted antibacterial and antifungal effects at normal and low pH. Studies employing r...
Cytosolic PrP Can Participate in Prion-Mediated Toxicity
Thackray, Alana M.; Zhang, Chang; Arndt, Tina
2014-01-01
ABSTRACT Prion diseases are characterized by a conformational change in the normal host protein PrPC. While the majority of mature PrPC is tethered to the plasma membrane by a glycosylphosphatidylinositol anchor, topological variants of this protein can arise during its biosynthesis. Here we have generated Drosophila transgenic for cytosolic ovine PrP in order to investigate its toxic potential in flies in the absence or presence of exogenous ovine prions. While cytosolic ovine PrP expressed in Drosophila was predominantly detergent insoluble and showed resistance to low concentrations of proteinase K, it was not overtly detrimental to the flies. However, Drosophila transgenic for cytosolic PrP expression exposed to classical or atypical scrapie prion inocula showed a faster decrease in locomotor activity than similar flies exposed to scrapie-free material. The susceptibility to classical scrapie inocula could be assessed in Drosophila transgenic for panneuronal expression of cytosolic PrP, whereas susceptibility to atypical scrapie required ubiquitous PrP expression. Significantly, the toxic phenotype induced by ovine scrapie in cytosolic PrP transgenic Drosophila was transmissible to recipient PrP transgenic flies. These data show that while cytosolic PrP expression does not adversely affect Drosophila, this topological PrP variant can participate in the generation of transmissible scrapie-induced toxicity. These observations also show that PrP transgenic Drosophila are susceptible to classical and atypical scrapie prion strains and highlight the utility of this invertebrate host as a model of mammalian prion disease. IMPORTANCE During prion diseases, the host protein PrPC converts into an abnormal conformer, PrPSc, a process coupled to the generation of transmissible prions and neurotoxicity. While PrPC is principally a glycosylphosphatidylinositol-anchored membrane protein, the role of topological variants, such as cytosolic PrP, in prion-mediated toxicity and
The POM monoclonals: a comprehensive set of antibodies to non-overlapping prion protein epitopes.
Directory of Open Access Journals (Sweden)
Magdalini Polymenidou
Full Text Available PrP(Sc, a misfolded and aggregated form of the cellular prion protein PrP(C, is the only defined constituent of the transmissible agent causing prion diseases. Expression of PrP(C in the host organism is necessary for prion replication and for prion neurotoxicity. Understanding prion diseases necessitates detailed structural insights into PrP(C and PrP(Sc. Towards this goal, we have developed a comprehensive collection of monoclonal antibodies denoted POM1 to POM19 and directed against many different epitopes of mouse PrP(C. Three epitopes are located within the N-terminal octarepeat region, one is situated within the central unstructured region, and four epitopes are discontinuous within the globular C-proximal domain of PrP(C. Some of these antibodies recognize epitopes that are resilient to protease digestion in PrP(Sc. Other antibodies immunoprecipitate PrP(C, but not PrP(Sc. A third group was found to immunoprecipitate both PrP isoforms. Some of the latter antibodies could be blocked with epitope-mimicking peptides, and incubation with an excess of these peptides allowed for immunochromatography of PrP(C and PrP(Sc. Amino-proximal antibodies were found to react with repetitive PrP(C epitopes, thereby vastly increasing their avidity. We have also created functional single-chain miniantibodies from selected POMs, which retained the binding characteristics despite their low molecular mass. The POM collection, thus, represents a unique set of reagents allowing for studies with a variety of techniques, including western blotting, ELISA, immunoprecipitation, conformation-dependent immunoassays, and plasmon surface plasmon resonance-based assays.
Combined copper/zinc attachment to prion protein
Hodak, Miroslav; Bernholc, Jerry
2013-03-01
Misfolding of prion protein (PrP) is responsible for diseases such as ``mad-cow disease'' in cattle and Creutzfeldt-Jacob in humans. Extensive experimental investigation has established that this protein strongly interacts with copper ions, and this ability has been linked to its still unknown function. Attachment of other metal ions (zinc, iron, manganese) have been demonstrated as well, but none of them could outcompete copper. Recent finding, however, indicates that at intermediate concentrations both copper and zinc ions can attach to the PrP at the octarepeat region, which contains high affinity metal binding sites. Based on this evidence, we have performed density functional theory simulations to investigate the combined Cu/Zn attachment. We consider all previously reported binding modes of copper at the octarepeat region and examine a possibility simultaneous Cu/Zn attachment. We find that this can indeed occur for only one of the known binding sites, when copper changes its coordination mode to allow for attachment of zinc ion. The implications of the simultaneous attachment on neural function remain to be explored.
Directory of Open Access Journals (Sweden)
Walker S Jackson
Full Text Available Prion diseases induce neurodegeneration in specific brain areas for undetermined reasons. A thorough understanding of the localization of the disease-causing molecule, the prion protein (PrP, could inform on this issue but previous studies have generated conflicting conclusions. One of the more intriguing disagreements is whether PrP is synthesized by astrocytes. We developed a knock-in reporter mouse line in which the coding sequence of the PrP expressing gene (Prnp, was replaced with that for green fluorescent protein (GFP. Native GFP fluorescence intensity varied between and within brain regions. GFP was present in astrocytes but did not increase during reactive gliosis induced by scrapie prion infection. Therefore, reactive gliosis associated with prion diseases does not cause an acceleration of local PrP production. In addition to aiding in Prnp gene activity studies, this reporter mouse line will likely prove useful for analysis of chimeric animals produced by stem cell and tissue transplantation experiments.
Ovine recombinant PrP as an inhibitor of ruminant prion propagation in vitro.
Workman, Rob G; Maddison, Ben C; Gough, Kevin C
2017-07-04
Prion diseases are fatal and incurable neurodegenerative diseases of humans and animals. Despite years of research, no therapeutic agents have been developed that can effectively manage or reverse disease progression. Recently it has been identified that recombinant prion proteins (rPrP) expressed in bacteria can act as inhibitors of prion replication within the in vitro prion replication system protein misfolding cyclic amplification (PMCA). Here, within PMCA reactions amplifying a range of ruminant prions including distinct Prnp genotypes/host species and distinct prion strains, recombinant ovine VRQ PrP displayed consistent inhibition of prion replication and produced IC50 values of 122 and 171 nM for ovine scrapie and bovine BSE replication, respectively. These findings illustrate the therapeutic potential of rPrPs with distinct TSE diseases.
Prion pathogenesis is unaltered in the absence of SIRPα-mediated "don't-eat-me" signaling.
Directory of Open Access Journals (Sweden)
Mario Nuvolone
Full Text Available Prion diseases are neurodegenerative conditions caused by misfolding of the prion protein, leading to conspicuous neuronal loss and intense microgliosis. Recent experimental evidence point towards a protective role of microglia against prion-induced neurodegeneration, possibly through elimination of prion-containing apoptotic bodies. The molecular mechanisms by which microglia recognize and eliminate apoptotic cells in the context of prion diseases are poorly defined. Here we investigated the possible involvement of signal regulatory protein α (SIRPα, a key modulator of host cell phagocytosis; SIRPα is encoded by the Sirpa gene that is genetically linked to the prion gene Prnp. We found that Sirpa transcripts are highly enriched in microglia cells within the brain. However, Sirpa mRNA levels were essentially unaltered during the course of experimental prion disease despite upregulation of other microglia-enriched transcripts. To study the involvement of SIRPα in prion pathogenesis in vivo, mice expressing a truncated SIRPα protein unable to inhibit phagocytosis were inoculated with rodent-adapted scrapie prions of the 22L strain. Homozygous and heterozygous Sirpa mutants and wild-type mice experienced similar incubation times after inoculation with either of two doses of 22L prions. Moreover, the extent of neuronal loss, microgliosis and abnormal prion protein accumulation was not significantly affected by Sirpa genotypes. Collectively, these data indicate that SIRPα-mediated phagocytosis is not a major determinant in prion disease pathogenesis. It will be important to search for additional candidates mediating prion phagocytosis, as this mechanism may represent an important target of antiprion therapies.
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
Energy Technology Data Exchange (ETDEWEB)
Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)
2011-02-25
Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells
International Nuclear Information System (INIS)
Tsuji, Toshikazu; Kawai-Noma, Shigeko; Pack, Chan-Gi; Terajima, Hideki; Yajima, Junichiro; Nishizaka, Takayuki; Kinjo, Masataka; Taguchi, Hideki
2011-01-01
Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.
Cell type-specific neuroprotective activity of untranslocated prion protein.
Directory of Open Access Journals (Sweden)
Elena Restelli
2010-10-01
Full Text Available A key pathogenic role in prion diseases was proposed for a cytosolic form of the prion protein (PrP. However, it is not clear how cytosolic PrP localization influences neuronal viability, with either cytotoxic or anti-apoptotic effects reported in different studies. The cellular mechanism by which PrP is delivered to the cytosol of neurons is also debated, and either retrograde transport from the endoplasmic reticulum or inefficient translocation during biosynthesis has been proposed. We investigated cytosolic PrP biogenesis and effect on cell viability in primary neuronal cultures from different mouse brain regions.Mild proteasome inhibition induced accumulation of an untranslocated form of cytosolic PrP in cortical and hippocampal cells, but not in cerebellar granules. A cyclopeptolide that interferes with the correct insertion of the PrP signal sequence into the translocon increased the amount of untranslocated PrP in cortical and hippocampal cells, and induced its synthesis in cerebellar neurons. Untranslocated PrP boosted the resistance of cortical and hippocampal neurons to apoptotic insults but had no effect on cerebellar cells.These results indicate cell type-dependent differences in the efficiency of PrP translocation, and argue that cytosolic PrP targeting might serve a physiological neuroprotective function.
Role of galectin-3 in prion infections of the CNS
International Nuclear Information System (INIS)
Mok, Simon W.F.; Riemer, Constanze; Madela, Kazimierz; Hsu, Daniel K.; Liu, Fu-Tong; Gueltner, Sandra; Heise, Ines; Baier, Michael
2007-01-01
Galectin-3 is a multi-functional protein and participates in mediating inflammatory reactions. The pronounced overexpression of galectin-3 in prion-infected brain tissue prompted us to study the role of this protein in a murine prion model. Immunofluorescence double-labelling identified microglia as the major cell type expressing galectin-3. Ablation of galectin-3 did not affect PrP Sc -deposition and development of gliosis. However, galectin-3 -/- -mice showed prolonged survival times upon intracerebral and peripheral scrapie infections. Moreover, protein levels of the lysosomal activation marker LAMP-2 were markedly reduced in prion-infected galectin-3 -/- -mice suggesting a role of galectin-3 in regulation of lysosomal functions. Lower mRNA levels of Beclin-1 and Atg5 in prion-infected wild-type and galectin-3 -/- -mice indicated an impairment of autophagy although autophagosome formation was unchanged. The results point towards a detrimental role of galectin-3 in prion infections of the CNS and suggest that endo-/lysosomal dysfunction in combination with reduced autophagy may contribute to disease development
Bergasa-Caceres, Fernando; Rabitz, Herschel A.
2013-06-01
A model of protein folding kinetics is applied to study the effects of macromolecular crowding on protein folding rate and stability. Macromolecular crowding is found to promote a decrease of the entropic cost of folding of proteins that produces an increase of both the stability and the folding rate. The acceleration of the folding rate due to macromolecular crowding is shown to be a topology-dependent effect. The model is applied to the folding dynamics of the murine prion protein (121-231). The differential effect of macromolecular crowding as a function of protein topology suffices to make non-native configurations relatively more accessible.
Secretin receptor involvement in prion-infected cells and animals.
Kimura, Tomohiro; Nishizawa, Keiko; Oguma, Ayumi; Nishimura, Yuki; Sakasegawa, Yuji; Teruya, Kenta; Nishijima, Ichiko; Doh-ura, Katsumi
2015-07-08
The cellular mechanisms behind prion biosynthesis and metabolism remain unclear. Here we show that secretin signaling via the secretin receptor regulates abnormal prion protein formation in prion-infected cells. Animal studies demonstrate that secretin receptor deficiency slightly, but significantly, prolongs incubation time in female but not male mice. This gender-specificity is consistent with our finding that prion-infected cells are derived from females. Therefore, our results provide initial insights into the reasons why age of disease onset in certain prion diseases is reported to occur slightly earlier in females than males. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Anti-prion activity of Brilliant Blue G.
Directory of Open Access Journals (Sweden)
Yoshifumi Iwamaru
Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.
Chronic wasting disease prion infection of differentiated neurospheres.
Iwamaru, Yoshifumi; Mathiason, Candace K; Telling, Glenn C; Hoover, Edward A
2017-07-04
A possible strategy to develop more diverse cell culture systems permissive to infection with naturally occurring prions is to exploit culture of neurospheres from transgenic mice expressing the normal prion protein (PrP) of the native host species. Accordingly, we developed differentiated neurosphere cultures from the cervid PrP-expressing mice to investigate whether this in vitro system would support replication of non-adapted cervid-origin chronic wasting disease (CWD) prions. Here we report the successful amplification of disease-associated PrP in differentiated neurosphere cultures within 3 weeks after exposure to CWD prions from both white-tailed deer or elk. This neurosphere culture system provides a new in vitro tool that can be used to assess non-adapted CWD prion propagation and transmission.
Using small molecule reagents to help distinguish among prion structural models
The only demonstrated difference between infectious prions (PrPSc) and the isosequential normal cellular prion protein (PrPC) is conformation. The structure of PrPC has been determined by a variety of instrumental techniques. The structure of prions remains uncertain. Recent instrumental analysis h...
The prion protein constitutively controls neuronal store-operated Ca2+ entry through Fyn kinase
Directory of Open Access Journals (Sweden)
Agnese eDe Mario
2015-10-01
Full Text Available The prion protein (PrPC is a cell surface glycoprotein mainly expressed in neurons, whose misfolded isoforms generate the prion responsible for incurable neurodegenerative disorders. Whereas PrPC involvement in prion propagation is well established, PrPC physiological function is still enigmatic despite suggestions that it could act in cell signal transduction by modulating phosphorylation cascades and Ca2+ homeostasis. Because PrPC binds neurotoxic protein aggregates with high-affinity, it has also been proposed that PrPC acts as receptor for amyloid-β (Aβ oligomers associated with Alzheimer’s disease (AD, and that PrPC-Aβ binding mediates AD-related synaptic dysfunctions following activation of the tyrosine kinase Fyn.Here, use of gene-encoded Ca2+ probes targeting different cell domains in primary cerebellar granule neurons expressing, or not, PrPC allowed us to investigate whether PrPC regulates store-operated Ca2+ entry (SOCE and the implication of Fyn in this control. Our findings show that PrPC attenuates SOCE, and Ca2+ accumulation in the cytosol and mitochondria, by constitutively restraining Fyn activation and tyrosine phosphorylation of STIM1, a key molecular component of SOCE. This data establishes the existence of a PrPC-Fyn-SOCE triad in neurons.We also demonstrate that treating cerebellar granule and cortical neurons with soluble Aβ(1-42 oligomers abrogates the control of PrPC over Fyn and SOCE, suggesting a PrPC-dependent mechanism for Aβ-induced neuronal Ca2+ dyshomeostasis.
Synthetic prions with novel strain-specified properties.
Moda, Fabio; Le, Thanh-Nhat T; Aulić, Suzana; Bistaffa, Edoardo; Campagnani, Ilaria; Virgilio, Tommaso; Indaco, Antonio; Palamara, Luisa; Andréoletti, Olivier; Tagliavini, Fabrizio; Legname, Giuseppe
2015-12-01
Prions are infectious proteins that possess multiple self-propagating structures. The information for strains and structural specific barriers appears to be contained exclusively in the folding of the pathological isoform, PrP(Sc). Many recent studies determined that de novo prion strains could be generated in vitro from the structural conversion of recombinant (rec) prion protein (PrP) into amyloidal structures. Our aim was to elucidate the conformational diversity of pathological recPrP amyloids and their biological activities, as well as to gain novel insights in characterizing molecular events involved in mammalian prion conversion and propagation. To this end we generated infectious materials that possess different conformational structures. Our methodology for the prion conversion of recPrP required only purified rec full-length mouse (Mo) PrP and common chemicals. Neither infected brain extracts nor amplified PrP(Sc) were used. Following two different in vitro protocols recMoPrP converted to amyloid fibrils without any seeding factor. Mouse hypothalamic GT1 and neuroblastoma N2a cell lines were infected with these amyloid preparations as fast screening methodology to characterize the infectious materials. Remarkably, a large number of amyloid preparations were able to induce the conformational change of endogenous PrPC to harbor several distinctive proteinase-resistant PrP forms. One such preparation was characterized in vivo habouring a synthetic prion with novel strain specified neuropathological and biochemical properties.
Analysis of nucleic acid chaperoning by the prion protein and its inhibition by oligonucleotides.
Guichard, Cécile; Ivanyi-Nagy, Roland; Sharma, Kamal Kant; Gabus, Caroline; Marc, Daniel; Mély, Yves; Darlix, Jean-Luc
2011-10-01
Prion diseases are unique neurodegenerative illnesses associated with the conversion of the cellular prion protein (PrP(C)) into the aggregated misfolded scrapie isoform, named PrP(Sc). Recent studies on the physiological role of PrP(C) revealed that this protein has probably multiple functions, notably in cell-cell adhesion and signal transduction, and in assisting nucleic acid folding. In fact, in vitro findings indicated that the human PrP (huPrP) possesses nucleic acid binding and annealing activities, similarly to nucleic acid chaperone proteins that play essential roles in cellular DNA and RNA metabolism. Here, we show that a peptide, representing the N-terminal domain of huPrP, facilitates nucleic acid annealing by two parallel pathways nucleated through the stem termini. We also show that PrP of human or ovine origin facilitates DNA strand exchange, ribozyme-directed cleavage of an RNA template and RNA trans-splicing in a manner similar to the nucleocapsid protein of HIV-1. In an attempt to characterize inhibitors of PrP-chaperoning in vitro we discovered that the thioaptamer 5'-GACACAAGCCGA-3' was extensively inhibiting the PrP chaperoning activities. At the same time a recently characterized methylated oligoribonucleotide inhibiting the chaperoning activity of the HIV-1 nucleocapsid protein was poorly impairing the PrP chaperoning activities.
Genesis of mammalian prions: from non-infectious amyloid fibrils to a transmissible prion disease.
Directory of Open Access Journals (Sweden)
Natallia Makarava
2011-12-01
Full Text Available The transmissible agent of prion disease consists of a prion protein in its abnormal, β-sheet rich state (PrP(Sc, which is capable of replicating itself according to the template-assisted mechanism. This mechanism postulates that the folding pattern of a newly recruited polypeptide chain accurately reproduces that of a PrP(Sc template. Here we report that authentic PrP(Sc and transmissible prion disease can be generated de novo in wild type animals by recombinant PrP (rPrP amyloid fibrils, which are structurally different from PrP(Sc and lack any detectable PrP(Sc particles. When induced by rPrP fibrils, a long silent stage that involved two serial passages preceded development of the clinical disease. Once emerged, the prion disease was characterized by unique clinical, neuropathological, and biochemical features. The long silent stage to the disease was accompanied by significant transformation in neuropathological properties and biochemical features of the proteinase K-resistant PrP material (PrPres before authentic PrP(Sc evolved. The current work illustrates that transmissible prion diseases can be induced by PrP structures different from that of authentic PrP(Sc and suggests that a new mechanism different from the classical templating exists. This new mechanism designated as "deformed templating" postulates that a change in the PrP folding pattern from the one present in rPrP fibrils to an alternative specific for PrP(Sc can occur. The current work provides important new insight into the mechanisms underlying genesis of the transmissible protein states and has numerous implications for understanding the etiology of neurodegenerative diseases.
LENUS (Irish Health Repository)
Barry, Andrew E
2011-05-18
Synthetic amyloid-β protein (Aβ) oligomers bind with high affinity to cellular prion protein (PrP(C)), but the role of this interaction in mediating the disruption of synaptic plasticity by such soluble Aβ in vitro is controversial. Here we report that intracerebroventricular injection of Aβ-containing aqueous extracts of Alzheimer\\'s disease (AD) brain robustly inhibits long-term potentiation (LTP) without significantly affecting baseline excitatory synaptic transmission in the rat hippocampus in vivo. Moreover, the disruption of LTP was abrogated by immunodepletion of Aβ. Importantly, intracerebroventricular administration of antigen-binding antibody fragment D13, directed to a putative Aβ-binding site on PrP(C), prevented the inhibition of LTP by AD brain-derived Aβ. In contrast, R1, a Fab directed to the C terminus of PrP(C), a region not implicated in binding of Aβ, did not significantly affect the Aβ-mediated inhibition of LTP. These data support the pathophysiological significance of SDS-stable Aβ dimer and the role of PrP(C) in mediating synaptic plasticity disruption by soluble Aβ.
Speldewinde, Shaun H.; Tuite, Mick F.
2017-01-01
Mammalian and fungal prions arise de novo; however, the mechanism is poorly understood in molecular terms. One strong possibility is that oxidative damage to the non-prion form of a protein may be an important trigger influencing the formation of its heritable prion conformation. We have examined the oxidative stress-induced formation of the yeast [PSI+] prion, which is the altered conformation of the Sup35 translation termination factor. We used tandem affinity purification (TAP) and mass spectrometry to identify the proteins which associate with Sup35 in a tsa1 tsa2 antioxidant mutant to address the mechanism by which Sup35 forms the [PSI+] prion during oxidative stress conditions. This analysis identified several components of the cortical actin cytoskeleton including the Abp1 actin nucleation promoting factor, and we show that deletion of the ABP1 gene abrogates oxidant-induced [PSI+] prion formation. The frequency of spontaneous [PSI+] prion formation can be increased by overexpression of Sup35 since the excess Sup35 increases the probability of forming prion seeds. In contrast to oxidant-induced [PSI+] prion formation, overexpression-induced [PSI+] prion formation was only modestly affected in an abp1 mutant. Furthermore, treating yeast cells with latrunculin A to disrupt the formation of actin cables and patches abrogated oxidant-induced, but not overexpression-induced [PSI+] prion formation, suggesting a mechanistic difference in prion formation. [PIN+], the prion form of Rnq1, localizes to the IPOD (insoluble protein deposit) and is thought to influence the aggregation of other proteins. We show Sup35 becomes oxidized and aggregates during oxidative stress conditions, but does not co-localize with Rnq1 in an abp1 mutant which may account for the reduced frequency of [PSI+] prion formation. PMID:28369054
Prions amplify through degradation of the VPS10P sorting receptor sortilin.
Uchiyama, Keiji; Tomita, Mitsuru; Yano, Masashi; Chida, Junji; Hara, Hideyuki; Das, Nandita Rani; Nykjaer, Anders; Sakaguchi, Suehiro
2017-06-01
Prion diseases are a group of fatal neurodegenerative disorders caused by prions, which consist mainly of the abnormally folded isoform of prion protein, PrPSc. A pivotal pathogenic event in prion disease is progressive accumulation of prions, or PrPSc, in brains through constitutive conformational conversion of the cellular prion protein, PrPC, into PrPSc. However, the cellular mechanism by which PrPSc is progressively accumulated in prion-infected neurons remains unknown. Here, we show that PrPSc is progressively accumulated in prion-infected cells through degradation of the VPS10P sorting receptor sortilin. We first show that sortilin interacts with PrPC and PrPSc and sorts them to lysosomes for degradation. Consistently, sortilin-knockdown increased PrPSc accumulation in prion-infected cells. In contrast, overexpression of sortilin reduced PrPSc accumulation in prion-infected cells. These results indicate that sortilin negatively regulates PrPSc accumulation in prion-infected cells. The negative role of sortilin in PrPSc accumulation was further confirmed in sortilin-knockout mice infected with prions. The infected mice had accelerated prion disease with early accumulation of PrPSc in their brains. Interestingly, sortilin was reduced in prion-infected cells and mouse brains. Treatment of prion-infected cells with lysosomal inhibitors, but not proteasomal inhibitors, increased the levels of sortilin. Moreover, sortilin was reduced following PrPSc becoming detectable in cells after infection with prions. These results indicate that PrPSc accumulation stimulates sortilin degradation in lysosomes. Taken together, these results show that PrPSc accumulation of itself could impair the sortilin-mediated sorting of PrPC and PrPSc to lysosomes for degradation by stimulating lysosomal degradation of sortilin, eventually leading to progressive accumulation of PrPSc in prion-infected cells.
Comparative syntheses of peptides and peptide thioesters derived from mouse and human prion proteins
Czech Academy of Sciences Publication Activity Database
Šebestík, Jaroslav; Zawada, Zbigniew; Šafařík, Martin; Hlaváček, Jan
2012-01-01
Roč. 43, č. 3 (2012), s. 1297-1309 ISSN 0939-4451 R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein segments * classical synthesis * chemical ligation synthesis * peptide thioesters Subject RIV: CC - Organic Chemistry Impact factor: 3.914, year: 2012
N-terminal peptides from unprocessed prion proteins enter cells by macropinocytosis
International Nuclear Information System (INIS)
Magzoub, Mazin; Sandgren, Staffan; Lundberg, Pontus; Oglecka, Kamila; Lilja, Johanna; Wittrup, Anders; Goeran Eriksson, L.E.; Langel, Ulo; Belting, Mattias; Graeslund, Astrid
2006-01-01
A peptide derived from the N-terminus of the unprocessed bovine prion protein (bPrPp), incorporating the hydrophobic signal sequence (residues 1-24) and a basic domain (KKRPKP, residues 25-30), internalizes into mammalian cells, even when coupled to a sizeable cargo, and therefore functions as a cell-penetrating peptide (CPP). Confocal microscopy and co-localization studies indicate that the internalization of bPrPp is mainly through macropinocytosis, a fluid-phase endocytosis process, initiated by binding to cell-surface proteoglycans. Electron microscopy studies show internalized bPrPp-DNA-gold complexes residing in endosomal vesicles. bPrPp induces expression of a complexed luciferase-encoding DNA plasmid, demonstrating the peptide's ability to transport the cargo across the endosomal membrane and into the cytosol and nucleus. The novel CPP activity of the unprocessed N-terminal domain of PrP could be important for the retrotranslocation of partly processed PrP and for PrP trafficking inside or between cells, with implications for the infectivity associated with prion diseases
The cellular prion protein (PrPC) is a highly conserved protein, which is anchored to the outer surface of the plasma membrane. Even though its physiological function has already been investigated in different cell or mouse models where PrPC expression is either up-regulated or depleted, its exact p...
Campeau, Jody L; Wu, Gengshu; Bell, John R; Rasmussen, Jay; Sim, Valerie L
2013-01-01
Prion diseases are infectious neurodegenerative diseases associated with the accumulation of protease-resistant prion protein, neuronal loss, spongiform change and astrogliosis. In the mouse model, the loss of dendritic spines is one of the earliest pathological changes observed in vivo, occurring 4-5 weeks after the first detection of protease-resistant prion protein in the brain. While there are cell culture models of prion infection, most do not recapitulate the neuropathology seen in vivo. Only the recently developed prion organotypic slice culture assay has been reported to undergo neuronal loss and the development of some aspects of prion pathology, namely small vacuolar degeneration and tubulovesicular bodies. Given the rapid replication of prions in this system, with protease-resistant prion protein detectable by 21 days, we investigated whether the dendritic spine loss and altered dendritic morphology seen in prion disease might also develop within the lifetime of this culture system. Indeed, six weeks after first detection of protease-resistant prion protein in tga20 mouse cerebellar slice cultures infected with RML prion strain, we found a statistically significant loss of Purkinje cell dendritic spines and altered dendritic morphology in infected cultures, analogous to that seen in vivo. In addition, we found a transient but statistically significant increase in Purkinje cell dendritic spine density during infection, at the time when protease-resistant prion protein was first detectable in culture. Our findings support the use of this slice culture system as one which recapitulates prion disease pathology and one which may facilitate study of the earliest stages of prion disease pathogenesis.
International Nuclear Information System (INIS)
Cui, P.X.; Lian, F.L.; Wang, Y.; Wen, Yi; Chu, W.S.; Zhao, H.F.; Zhang, S.; Li, J.; Lin, D.H.; Wu, Z.Y.
2014-01-01
Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrP C ) to the post-translationally modified form (PrP Sc ) is thought to be relevant to Cu 2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrP C ) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases. - Highlights: ► The first structure of the metal ion binding site in RaPrP fifth copper-binding site. ► Quantitative determination by XANES spectroscopy combined with ab initio calculations. ► Provide a proof of the roles of copper in prion conformation conversions. ► Provide a proof of the molecular mechanisms of prion-involved diseases
Small stress molecules inhibit aggregation and neurotoxicity of prion peptide 106-126
International Nuclear Information System (INIS)
Kanapathipillai, Mathumai; Ku, Sook Hee; Girigoswami, Koyeli; Park, Chan Beum
2008-01-01
In prion diseases, the posttranslational modification of host-encoded prion protein PrP c yields a high β-sheet content modified protein PrP sc , which further polymerizes into amyloid fibrils. PrP106-126 initiates the conformational changes leading to the conversion of PrP c to PrP sc . Molecules that can defunctionalize such peptides can serve as a potential tool in combating prion diseases. In microorganisms during stressed conditions, small stress molecules (SSMs) are formed to prevent protein denaturation and maintain protein stability and function. The effect of such SSMs on PrP106-126 amyloid formation is explored in the present study using turbidity, atomic force microscopy (AFM), and cellular toxicity assay. Turbidity and AFM studies clearly depict that the SSMs-ectoine and mannosylglyceramide (MGA) inhibit the PrP106-126 aggregation. Our study also connotes that ectoine and MGA offer strong resistance to prion peptide-induced toxicity in human neuroblastoma cells, concluding that such molecules can be potential inhibitors of prion aggregation and toxicity
Fragger: a protein fragment picker for structural queries.
Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J
2017-01-01
Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
Glypican-1 mediates both prion protein lipid raft association and disease isoform formation.
Directory of Open Access Journals (Sweden)
David R Taylor
2009-11-01
Full Text Available In prion diseases, the cellular form of the prion protein, PrP(C, undergoes a conformational conversion to the infectious isoform, PrP(Sc. PrP(C associates with lipid rafts through its glycosyl-phosphatidylinositol (GPI anchor and a region in its N-terminal domain which also binds to heparan sulfate proteoglycans (HSPGs. We show that heparin displaces PrP(C from rafts and promotes its endocytosis, suggesting that heparin competes with an endogenous raft-resident HSPG for binding to PrP(C. We then utilised a transmembrane-anchored form of PrP (PrP-TM, which is targeted to rafts solely by its N-terminal domain, to show that both heparin and phosphatidylinositol-specific phospholipase C can inhibit its association with detergent-resistant rafts, implying that a GPI-anchored HSPG targets PrP(C to rafts. Depletion of the major neuronal GPI-anchored HSPG, glypican-1, significantly reduced the raft association of PrP-TM and displaced PrP(C from rafts, promoting its endocytosis. Glypican-1 and PrP(C colocalised on the cell surface and both PrP(C and PrP(Sc co-immunoprecipitated with glypican-1. Critically, treatment of scrapie-infected N2a cells with glypican-1 siRNA significantly reduced PrP(Sc formation. In contrast, depletion of glypican-1 did not alter the inhibitory effect of PrP(C on the beta-secretase cleavage of the Alzheimer's amyloid precursor protein. These data indicate that glypican-1 is a novel cellular cofactor for prion conversion and we propose that it acts as a scaffold facilitating the interaction of PrP(C and PrP(Sc in lipid rafts.
Directory of Open Access Journals (Sweden)
Kohtaro Miyazawa
Full Text Available In our previous study, we demonstrated the propagation of mouse-passaged scrapie isolates with long incubation periods (L-type derived from natural Japanese sheep scrapie cases in murine hypothalamic GT1-7 cells, along with disease-associated prion protein (PrPSc accumulation. We here analyzed the susceptibility of GT1-7 cells to scrapie prions by exposure to infected mouse brains at different passages, following interspecies transmission. Wild-type mice challenged with a natural sheep scrapie case (Kanagawa exhibited heterogeneity of transmitted scrapie prions in early passages, and this mixed population converged upon one with a short incubation period (S-type following subsequent passages. However, when GT1-7 cells were challenged with these heterologous samples, L-type prions became dominant. This study demonstrated that the susceptibility of GT1-7 cells to L-type prions was at least 105 times higher than that to S-type prions and that L-type prion-specific biological characteristics remained unchanged after serial passages in GT1-7 cells. This suggests that a GT1-7 cell culture model would be more useful for the economical and stable amplification of L-type prions at the laboratory level. Furthermore, this cell culture model might be used to selectively propagate L-type scrapie prions from a mixed prion population.
Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.
2014-02-01
Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.
Unraveling the key to the resistance of canids to prion diseases.
Directory of Open Access Journals (Sweden)
Natalia Fernández-Borges
2017-11-01
Full Text Available One of the characteristics of prions is their ability to infect some species but not others and prion resistant species have been of special interest because of their potential in deciphering the determinants for susceptibility. Previously, we developed different in vitro and in vivo models to assess the susceptibility of species that were erroneously considered resistant to prion infection, such as members of the Leporidae and Equidae families. Here we undertake in vitro and in vivo approaches to understand the unresolved low prion susceptibility of canids. Studies based on the amino acid sequence of the canine prion protein (PrP, together with a structural analysis in silico, identified unique key amino acids whose characteristics could orchestrate its high resistance to prion disease. Cell- and brain-based PMCA studies were performed highlighting the relevance of the D163 amino acid in proneness to protein misfolding. This was also investigated by the generation of a novel transgenic mouse model carrying this substitution and these mice showed complete resistance to disease despite intracerebral challenge with three different mouse prion strains (RML, 22L and 301C known to cause disease in wild-type mice. These findings suggest that dog D163 amino acid is primarily, if not totally, responsible for the prion resistance of canids.
Structural determinants of phenotypic diversity and replication rate of human prions.
Directory of Open Access Journals (Sweden)
Jiri G Safar
2015-04-01
Full Text Available The infectious pathogen responsible for prion diseases is the misfolded, aggregated form of the prion protein, PrPSc. In contrast to recent progress in studies of laboratory rodent-adapted prions, current understanding of the molecular basis of human prion diseases and, especially, their vast phenotypic diversity is very limited. Here, we have purified proteinase resistant PrPSc aggregates from two major phenotypes of sporadic Creutzfeldt-Jakob disease (sCJD, determined their conformational stability and replication tempo in vitro, as well as characterized structural organization using recently emerged approaches based on hydrogen/deuterium (H/D exchange coupled with mass spectrometry. Our data clearly demonstrate that these phenotypically distant prions differ in a major way with regard to their structural organization, both at the level of the polypeptide backbone (as indicated by backbone amide H/D exchange data as well as the quaternary packing arrangements (as indicated by H/D exchange kinetics for histidine side chains. Furthermore, these data indicate that, in contrast to previous observations on yeast and some murine prion strains, the replication rate of sCJD prions is primarily determined not by conformational stability but by specific structural features that control the growth rate of prion protein aggregates.
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Correlation of cellular factors and differential scrapie prion permissiveness in ovine microglia
Prion diseases are fatal neurodegenerative disorders by which the native cellular prion protein (PrP-C) is misfolded into an accumulating, disease-associated isoform (PrP-D). To improve the understanding of prion pathogenesis and develop effective treatments, it is essential to elucidate factors con...
Head, Mark W; Ironside, James W
2012-07-01
Creutzfeldt-Jakob disease is a fatal neurodegenerative disease that primarily affects the central nervous system. In this respect, it can be considered alongside the more frequently occurring neurodegenerative diseases, such as Alzheimer's disease. Creutzfeldt-Jakob disease is perhaps the paradigmatic protein misfolding disorder, so comparisons between the mechanisms involved in Creutzfeldt-Jakob disease and other neurodegenerative diseases associated with protein misfolding (such as the tauopathies and synucleinopathies) may also be informative. Like many of these diseases, Creutzfeldt-Jakob disease occurs sporadically or can, more rarely, be associated with mutations. However, Creutzfeldt-Jakob disease can also be acquired and is experimentally transmissible. These properties have had profound public health implications and made the disease of interest to virologists, in addition to those interested in protein misfolding disorders and neurodegeneration. The possible causes for the pronounced phenotypic variation among different forms of Creutzfeldt-Jakob disease are beginning to become understood, and these appear to depend in large measure on the genetics of the host (specifically the sequence of the prion protein gene, PRNP) and the epigenetic aspects of the agent (thought to be a misfolded and aggregated form of the PRNP gene product, termed a prion). This review will examine whether this model in its present form has sufficient complexity and subtlety to account for the clinicopathological variation evident in Creutzfeldt-Jakob disease and will outline the ways in which a more complete and informative molecular definition of human prions are currently being sought. Copyright © 2012 John Wiley & Sons, Ltd.
Prion diseases: immunotargets and therapy
Directory of Open Access Journals (Sweden)
Burchell JT
2016-06-01
Full Text Available Jennifer T Burchell, Peter K Panegyres Neurodegenerative Disorders Research Pty Ltd, West Perth, Western Australia, Australia Abstract: Transmissible spongiform encephathalopathies or prion diseases are a group of neurological disorders characterized by neuronal loss, spongiform degeneration, and activation of astrocytes or microglia. These diseases affect humans and animals with an extremely high prevalence in some species such as deer and elk in North America. Although rare in humans, they result in a devastatingly swift neurological progression with dementia and ataxia. Patients usually die within a year of diagnosis. Prion diseases are familial, sporadic, iatrogenic, or transmissible. Human prion diseases include Kuru, sporadic, iatrogenic, and familial forms of Creutzfeldt–Jakob disease, variant Creutzfeldt–Jakob disease, Gerstmann–Sträussler–Scheinker disease, and fatal familial insomnia. The causative agent is a misfolded version of the physiological prion protein called PrPSc in the brain. There are a number of therapeutic options currently under investigation. A number of small molecules have had some success in delaying disease progression in animal models and mixed results in clinical trials, including pentosan polysulfate, quinacrine, and amphotericin B. More promisingly, immunotherapy has reported success in vitro and in vivo in animal studies and clinical trials. The three main branches of immunotherapy research are focus on antibody vaccines, dendritic cell vaccines, and adoptive transfer of physiological prion protein-specific CD4+ T-lymphocytes. Vaccines utilizing antibodies generally target disease-specific epitopes that are only exposed in the misfolded PrPSc conformation. Vaccines utilizing antigen-loaded dendritic cell have the ability to bypass immune tolerance and prime CD4+ cells to initiate an immune response. Adoptive transfer of CD4+ T-cells is another promising target as this cell type can orchestrate the
RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY
Directory of Open Access Journals (Sweden)
A. Y. Prosekov
2016-01-01
Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Directory of Open Access Journals (Sweden)
Kazunori Sano
Full Text Available INTRODUCTION: The definitive diagnosis of genetic prion diseases (gPrD requires pathological confirmation. To date, diagnosis has relied upon the finding of the biomarkers 14-3-3 protein and total tau (t-tau protein in the cerebrospinal fluid (CSF, but many researchers have reported that these markers are not sufficiently elevated in gPrD, especially in Gerstmann-Sträussler-Scheinker syndrome (GSS. We recently developed a new in vitro amplification technology, designated "real-time quaking-induced conversion (RT-QUIC", to detect the abnormal form of prion protein in CSF from sporadic Creutzfeldt-Jakob disease (sCJD patients. In the present study, we aimed to investigate the presence of biomarkers and evaluate RT-QUIC assay in patients with gPrD, as the utility of RT-QUIC as a diagnostic tool in gPrD has yet to be determined. METHOD/PRINCIPAL FINDINGS: 56 CSF samples were obtained from gPrD patients, including 20 cases of GSS with P102L mutation, 12 cases of fatal familial insomnia (FFI; D178N, and 24 cases of genetic CJD (gCJD, comprising 22 cases with E200K mutation and 2 with V203I mutation. We subjected all CSF samples to RT-QUIC assay, analyzed 14-3-3 protein by Western blotting, and measured t-tau protein using an ELISA kit. The detection sensitivities of RT-QUIC were as follows: GSS (78%, FFI (100%, gCJD E200K (87%, and gCJD V203I (100%. On the other hand the detection sensitivities of biomarkers were considerably lower: GSS (11%, FFI (0%, gCJD E200K (73%, and gCJD V203I (67%. Thus, RT-QUIC had a much higher detection sensitivity compared with testing for biomarkers, especially in patients with GSS and FFI. CONCLUSION/SIGNIFICANCE: RT-QUIC assay is more sensitive than testing for biomarkers in gPrD patients. RT-QUIC method would thus be useful as a diagnostic tool when the patient or the patient's family does not agree to genetic testing, or to confirm the diagnosis in the presence of a positive result for genetic testing.
Completion of autobuilt protein models using a database of protein fragments
International Nuclear Information System (INIS)
Cowtan, Kevin
2012-01-01
Two developments in the process of automated protein model building in the Buccaneer software are described: the use of a database of protein fragments in improving the model completeness and the assembly of disconnected chain fragments into complete molecules. Two developments in the process of automated protein model building in the Buccaneer software are presented. A general-purpose library for protein fragments of arbitrary size is described, with a highly optimized search method allowing the use of a larger database than in previous work. The problem of assembling an autobuilt model into complete chains is discussed. This involves the assembly of disconnected chain fragments into complete molecules and the use of the database of protein fragments in improving the model completeness. Assembly of fragments into molecules is a standard step in existing model-building software, but the methods have not received detailed discussion in the literature
Energy Technology Data Exchange (ETDEWEB)
Krasnoslobodtsev, Alexey V., E-mail: akrasnos@unomaha.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Department of Physics, University of Nebraska Omaha, Omaha, NE 68182 (United States); Deckert-Gaudig, Tanja [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Zhang, Yuliang [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States); Deckert, Volker [IPHT-Leibniz Institute of Photonic Technology, Albert-Einstein-Str. 9, D-07745 Jena (Germany); Institute for Physical Chemistry and Abbe Center of Photonics, University of Jena, Helmholtzweg 4, D-07743 Jena (Germany); Lyubchenko, Yuri L., E-mail: ylyubchenko@unmc.edu [Department of Pharmaceutical Sciences, University of Nebraska Medical Center, 986025 Nebraska Medical Center, Omaha, NE 68198 (United States)
2016-06-15
Aggregation of prion proteins is the cause of various prion related diseases. The infectious form of prions, amyloid aggregates, exist as multiple strains. The strains are thought to represent structurally different prion protein molecules packed into amyloid aggregates, but the knowledge on the structure of different types of aggregates is limited. Here we report on the use of AFM (Atomic Force Microscopy) and TERS (Tip-Enhanced Raman Scattering) to study morphological heterogeneity and access underlying conformational features of individual amyloid aggregates. Using AFM we identified the morphology of amyloid fibrils formed by the peptide (CGNNQQNY) from the yeast prion protein Sup35 that is critically involved in the aggregation of the full protein. TERS results demonstrate that morphologically different amyloid fibrils are composed of a distinct set of conformations. Fibrils formed at pH 5.6 are composed of a mixture of peptide conformations (β-sheets, random coil and α-helix) while fibrils formed in pH~2 solution primarily have β-sheets. Additionally, peak positions in the amide III region of the TERS spectra suggested that peptides have parallel arrangement of β-sheets for pH~2 fibrils and antiparallel arrangement for fibrils formed at pH 5.6. We also developed a methodology for detailed analysis of the peptide secondary structure by correlating intensity changes of Raman bands in different regions of TERS spectra. Such correlation established that structural composition of peptides is highly localized with large contribution of unordered secondary structures on a fibrillar surface. - Highlights: • Amyloid polymorphs were characterized by AFM and TERS. • A mixture of peptide secondary structures in fibrils were identified using TERS. • TERS recognizes packing arrangement (parallel versus antiparallel) of peptides. • TERS is a powerful tool for high resolution structural analysis of fibrils.
Directory of Open Access Journals (Sweden)
Victoria Lewis
Full Text Available There is increasing evidence of molecular and cellular links between Alzheimer's disease (AD and prion diseases. The cellular prion protein, PrP(C, modulates the post-translational processing of the AD amyloid precursor protein (APP, through its inhibition of the β-secretase BACE1, and oligomers of amyloid-β bind to PrP(C which may mediate amyloid-β neurotoxicity. In addition, the APP intracellular domain (AICD, which acts as a transcriptional regulator, has been reported to control the expression of PrP(C. Through the use of transgenic mice, cell culture models and manipulation of APP expression and processing, this study aimed to clarify the role of AICD in regulating PrP(C. Over-expression of the three major isoforms of human APP (APP(695, APP(751 and APP(770 in cultured neuronal and non-neuronal cells had no effect on the level of endogenous PrP(C. Furthermore, analysis of brain tissue from transgenic mice over-expressing either wild type or familial AD associated mutant human APP revealed unaltered PrP(C levels. Knockdown of endogenous APP expression in cells by siRNA or inhibition of γ-secretase activity also had no effect on PrP(C levels. Overall, we did not detect any significant difference in the expression of PrP(C in any of the cell or animal-based paradigms considered, indicating that the control of cellular PrP(C levels by AICD is not as straightforward as previously suggested.
Infectious prion diseases in humans: cannibalism, iatrogenicity and zoonoses.
Haïk, Stéphane; Brandel, Jean-Philippe
2014-08-01
In contrast with other neurodegenerative disorders associated to protein misfolding, human prion diseases include infectious forms (also called transmitted forms) such as kuru, iatrogenic Creutzfeldt-Jakob disease and variant Creutzfeldt-Jakob disease. The transmissible agent is thought to be solely composed of the abnormal isoform (PrP(Sc)) of the host-encoded prion protein that accumulated in the central nervous system of affected individuals. Compared to its normal counterpart, PrP(Sc) is β-sheet enriched and aggregated and its propagation is based on an autocatalytic conversion process. Increasing evidence supports the view that conformational variations of PrP(Sc) encoded the biological properties of the various prion strains that have been isolated by transmission studies in experimental models. Infectious forms of human prion diseases played a pivotal role in the emergence of the prion concept and in the characterization of the very unconventional properties of prions. They provide a unique model to understand how prion strains are selected and propagate in humans. Here, we review and discuss how genetic factors interplay with strain properties and route of transmission to influence disease susceptibility, incubation period and phenotypic expression in the light of the kuru epidemics due to ritual endocannibalism, the various series iatrogenic diseases secondary to extractive growth hormone treatment or dura mater graft and the epidemics of variant Creutzfeldt-Jakob disease linked to dietary exposure to the agent of bovine spongiform encephalopathy. Copyright © 2014 Elsevier B.V. All rights reserved.
Prion Amplification and Hierarchical Bayesian Modeling Refine Detection of Prion Infection
Wyckoff, A. Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J.; Pulford, Bruce; Wild, Margaret; Antolin, Michael; Vercauteren, Kurt; Zabel, Mark
2015-02-01
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Prion amplification and hierarchical Bayesian modeling refine detection of prion infection.
Wyckoff, A Christy; Galloway, Nathan; Meyerett-Reid, Crystal; Powers, Jenny; Spraker, Terry; Monello, Ryan J; Pulford, Bruce; Wild, Margaret; Antolin, Michael; VerCauteren, Kurt; Zabel, Mark
2015-02-10
Prions are unique infectious agents that replicate without a genome and cause neurodegenerative diseases that include chronic wasting disease (CWD) of cervids. Immunohistochemistry (IHC) is currently considered the gold standard for diagnosis of a prion infection but may be insensitive to early or sub-clinical CWD that are important to understanding CWD transmission and ecology. We assessed the potential of serial protein misfolding cyclic amplification (sPMCA) to improve detection of CWD prior to the onset of clinical signs. We analyzed tissue samples from free-ranging Rocky Mountain elk (Cervus elaphus nelsoni) and used hierarchical Bayesian analysis to estimate the specificity and sensitivity of IHC and sPMCA conditional on simultaneously estimated disease states. Sensitivity estimates were higher for sPMCA (99.51%, credible interval (CI) 97.15-100%) than IHC of obex (brain stem, 76.56%, CI 57.00-91.46%) or retropharyngeal lymph node (90.06%, CI 74.13-98.70%) tissues, or both (98.99%, CI 90.01-100%). Our hierarchical Bayesian model predicts the prevalence of prion infection in this elk population to be 18.90% (CI 15.50-32.72%), compared to previous estimates of 12.90%. Our data reveal a previously unidentified sub-clinical prion-positive portion of the elk population that could represent silent carriers capable of significantly impacting CWD ecology.
Sequestration of Sup35 by aggregates of huntingtin fragments causes toxicity of [PSI+] yeast.
Zhao, Xiaohong; Park, Yang-Nim; Todor, Horia; Moomau, Christine; Masison, Daniel; Eisenberg, Evan; Greene, Lois E
2012-07-06
Expression of huntingtin fragments with 103 glutamines (HttQ103) is toxic in yeast containing either the [PIN(+)] prion, which is the amyloid form of Rnq1, or [PSI(+)] prion, which is the amyloid form of Sup35. We find that HttQP103, which has a polyproline region at the C-terminal end of the polyQ repeat region, is significantly more toxic in [PSI(+)] yeast than in [PIN(+)], even though HttQP103 formed multiple aggregates in both [PSI(+)] and [PIN(+)] yeast. This toxicity was only observed in the strong [PSI(+)] variant, not the weak [PSI(+)] variant, which has more soluble Sup35 present than the strong variant. Furthermore, expression of the MC domains of Sup35, which retains the C-terminal domain of Sup35, but lacks the N-terminal prion domain, almost completely rescued HttQP103 toxicity, but was less effective in rescuing HttQ103 toxicity. Therefore, the toxicity of HttQP103 in yeast containing the [PSI(+)] prion is primarily due to sequestration of the essential protein, Sup35.
Background: The Rocky Mountain elk (Cervus elaphus nelsoni) prion protein gene exhibits amino acid polymorphism at codon 132, with 132L (leucine) and 132M (methionine) allelic variants present in the population. We have previously shown that following experimental oral challenge with chronic wasting...
A new mutation in the prion protein gene: A patient with dementia and white matter changes
Van Harten, B.; Van Gool, W.A.; Van Langen, I.M.; Deekman, J.M.; Meijerink, P.H.S.; Weinstein, H.C.
2000-01-01
The authors describe the clinical characteristics, MRI abnormalities, and molecular findings in a patient with a novel variant of a two-octarepeat insertion mutation in the prion protein gene. This patient presented with moderately progressive dementia of presenile onset and gait ataxia. MRI showed
Saccharomyces cerevisiae: a sexy yeast with a prion problem.
Kelly, Amy C; Wickner, Reed B
2013-01-01
Yeast prions are infectious proteins that spread exclusively by mating. The frequency of prions in the wild therefore largely reflects the rate of spread by mating counterbalanced by prion growth slowing effects in the host. We recently showed that the frequency of outcross mating is about 1% of mitotic doublings with 23-46% of total matings being outcrosses. These findings imply that even the mildest forms of the [PSI+], [URE3] and [PIN+] prions impart > 1% growth/survival detriment on their hosts. Our estimate of outcrossing suggests that Saccharomyces cerevisiae is far more sexual than previously thought and would therefore be more responsive to the adaptive effects of natural selection compared with a strictly asexual yeast. Further, given its large effective population size, a growth/survival detriment of > 1% for yeast prions should strongly select against prion-infected strains in wild populations of Saccharomyces cerevisiae.
... with facebook share with twitter share with linkedin Prion Diseases Prion diseases are a related group of ... deer and elk. Why Is the Study of Prion Diseases a Priority for NIAID? Much about TSE ...
Molecular architecture of human prion protein amyloid: a parallel, in-register beta-structure.
Cobb, Nathan J; Sönnichsen, Frank D; McHaourab, Hassane; Surewicz, Witold K
2007-11-27
Transmissible spongiform encephalopathies (TSEs) represent a group of fatal neurodegenerative diseases that are associated with conformational conversion of the normally monomeric and alpha-helical prion protein, PrP(C), to the beta-sheet-rich PrP(Sc). This latter conformer is believed to constitute the main component of the infectious TSE agent. In contrast to high-resolution data for the PrP(C) monomer, structures of the pathogenic PrP(Sc) or synthetic PrP(Sc)-like aggregates remain elusive. Here we have used site-directed spin labeling and EPR spectroscopy to probe the molecular architecture of the recombinant PrP amyloid, a misfolded form recently reported to induce transmissible disease in mice overexpressing an N-terminally truncated form of PrP(C). Our data show that, in contrast to earlier, largely theoretical models, the con formational conversion of PrP(C) involves major refolding of the C-terminal alpha-helical region. The core of the amyloid maps to C-terminal residues from approximately 160-220, and these residues form single-molecule layers that stack on top of one another with parallel, in-register alignment of beta-strands. This structural insight has important implications for understanding the molecular basis of prion propagation, as well as hereditary prion diseases, most of which are associated with point mutations in the region found to undergo a refolding to beta-structure.
Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.
Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A
2016-12-01
Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD
In 2006, a case of H-type bovine spongiform encephalopathy (BSE-H) was diagnosed in a cow that was associated with a heritable polymorphism in the bovine prion protein gene (PRNP) resulting in a lysine for glutamine amino acid substitution at codon 211 (called E211K) of the prion protein. Although t...
Kraus, Allison; Raymond, Gregory J; Race, Brent; Campbell, Katrina J; Hughson, Andrew G; Anson, Kelsie J; Raymond, Lynne D; Caughey, Byron
2017-11-01
Accumulation of fibrillar protein aggregates is a hallmark of many diseases. While numerous proteins form fibrils by prion-like seeded polymerization in vitro , only some are transmissible and pathogenic in vivo To probe the structural features that confer transmissibility to prion protein (PrP) fibrils, we have analyzed synthetic PrP amyloids with or without the human prion disease-associated P102L mutation. The formation of infectious prions from PrP molecules in vitro has required cofactors and/or unphysiological denaturing conditions. Here, we demonstrate that, under physiologically compatible conditions without cofactors, the P102L mutation in recombinant hamster PrP promoted prion formation when seeded by minute amounts of scrapie prions in vitro Surprisingly, combination of the P102L mutation with charge-neutralizing substitutions of four nearby lysines promoted spontaneous prion formation. When inoculated into hamsters, both of these types of synthetic prions initiated substantial accumulation of prion seeding activity and protease-resistant PrP without transmissible spongiform encephalopathy (TSE) clinical signs or notable glial activation. Our evidence suggests that PrP's centrally located proline and lysine residues act as conformational switches in the in vitro formation of transmissible PrP amyloids. IMPORTANCE Many diseases involve the damaging accumulation of specific misfolded proteins in thread-like aggregates. These threads (fibrils) are capable of growing on the ends by seeding the refolding and incorporation of the normal form of the given protein. In many cases such aggregates can be infectious and propagate like prions when transmitted from one individual host to another. Some transmitted aggregates can cause fatal disease, as with human iatrogenic prion diseases, while other aggregates appear to be relatively innocuous. The factors that distinguish infectious and pathogenic protein aggregates from more innocuous ones are poorly understood
Chapuis, Jérôme; Moudjou, Mohammed; Reine, Fabienne; Herzog, Laetitia; Jaumain, Emilie; Chapuis, Céline; Quadrio, Isabelle; Boulliat, Jacques; Perret-Liaudet, Armand; Dron, Michel; Laude, Hubert; Rezaei, Human; Béringue, Vincent
2016-02-05
Mammalian prions are proteinaceous pathogens responsible for a broad range of fatal neurodegenerative diseases in humans and animals. These diseases can occur spontaneously, such as Creutzfeldt-Jakob disease (CJD) in humans, or be acquired or inherited. Prions are primarily formed of macromolecular assemblies of the disease-associated prion protein PrP(Sc), a misfolded isoform of the host-encoded prion protein PrP(C). Within defined host-species, prions can exist as conformational variants or strains. Based on both the M/V polymorphism at codon 129 of PrP and the electrophoretic signature of PrP(Sc) in the brain, sporadic CJD is classified in different subtypes, which may encode different strains. A transmission barrier, the mechanism of which remains unknown, limits prion cross-species propagation. To adapt to the new host, prions have the capacity to 'mutate' conformationally, leading to the emergence of a variant with new biological properties. Here, we transmitted experimentally one rare subtype of human CJD, designated cortical MM2 (129 MM with type 2 PrP(Sc)), to transgenic mice overexpressing either human or the VRQ allele of ovine PrP(C). In marked contrast with the reported absence of transmission to knock-in mice expressing physiological levels of human PrP, this subtype transmitted faithfully to mice overexpressing human PrP, and exhibited unique strain features. Onto the ovine PrP sequence, the cortical MM2 subtype abruptly evolved on second passage, thereby allowing emergence of a pair of strain variants with distinct PrP(Sc) biochemical characteristics and differing tropism for the central and lymphoid tissues. These two strain components exhibited remarkably distinct replicative properties in cell-free amplification assay, allowing the 'physical' cloning of the minor, lymphotropic component, and subsequent isolation in ovine PrP mice and RK13 cells. Here, we provide in-depth assessment of the transmissibility and evolution of one rare subtype of
The Structural Architecture of an Infectious Mammalian Prion Using Electron Cryomicroscopy.
Directory of Open Access Journals (Sweden)
Ester Vázquez-Fernández
2016-09-01
Full Text Available The structure of the infectious prion protein (PrPSc, which is responsible for Creutzfeldt-Jakob disease in humans and bovine spongiform encephalopathy, has escaped all attempts at elucidation due to its insolubility and propensity to aggregate. PrPSc replicates by converting the non-infectious, cellular prion protein (PrPC into the misfolded, infectious conformer through an unknown mechanism. PrPSc and its N-terminally truncated variant, PrP 27-30, aggregate into amorphous aggregates, 2D crystals, and amyloid fibrils. The structure of these infectious conformers is essential to understanding prion replication and the development of structure-based therapeutic interventions. Here we used the repetitive organization inherent to GPI-anchorless PrP 27-30 amyloid fibrils to analyze their structure via electron cryomicroscopy. Fourier-transform analyses of averaged fibril segments indicate a repeating unit of 19.1 Å. 3D reconstructions of these fibrils revealed two distinct protofilaments, and, together with a molecular volume of 18,990 Å3, predicted the height of each PrP 27-30 molecule as ~17.7 Å. Together, the data indicate a four-rung β-solenoid structure as a key feature for the architecture of infectious mammalian prions. Furthermore, they allow to formulate a molecular mechanism for the replication of prions. Knowledge of the prion structure will provide important insights into the self-propagation mechanisms of protein misfolding.
Cross-seeding of prions by aggregated α-synuclein leads to transmissible spongiform encephalopathy.
Directory of Open Access Journals (Sweden)
Elizaveta Katorcha
2017-08-01
Full Text Available Aggregation of misfolded proteins or peptides is a common feature of neurodegenerative diseases including Alzheimer's, Parkinson's, Huntington's, prion and other diseases. Recent years have witnessed a growing number of reports of overlap in neuropathological features that were once thought to be unique to only one neurodegenerative disorder. However, the origin for the overlap remains unclear. One possibility is that diseases with mixed brain pathologies might arise from cross-seeding of one amyloidogenic protein by aggregated states of unrelated proteins. In the current study we examined whether prion replication can be induced by cross-seeding by α-synuclein or Aβ peptide. We found that α-synuclein aggregates formed in cultured cells or in vitro display cross-seeding activity and trigger misfolding of the prion protein (PrPC in serial Protein Misfolding Cyclic Amplification reactions, producing self-replicating PrP states characterized by a short C-terminal proteinase K (PK-resistant region referred to as PrPres. Non-fibrillar α-synuclein or fibrillar Aβ failed to cross-seed misfolding of PrPC. Remarkably, PrPres triggered by aggregated α-synuclein in vitro propagated in animals and, upon serial transmission, produced PrPSc and clinical prion disease characterized by spongiosis and astrocytic gliosis. The current study demonstrates that aggregated α-synuclein is potent in cross-seeding of prion protein misfolding and aggregation in vitro, producing self-replicating states that can lead to transmissible prion diseases upon serial passaging in wild type animals. In summary, the current work documents direct cross-seeding between unrelated amyloidogenic proteins associated with different neurodegenerative diseases. This study suggests that early interaction between unrelated amyloidogenic proteins might underlie the etiology of mixed neurodegenerative proteinopathies.
Effect of metal ions on de novo aggregation of full-length prion protein
International Nuclear Information System (INIS)
Giese, Armin; Levin, Johannes; Bertsch, Uwe; Kretzschmar, Hans
2004-01-01
It is well established that the prion protein (PrP) contains metal ion binding sites with specificity for copper. Changes in copper levels have been suggested to influence incubation time in experimental prion disease. Therefore, we studied the effect of heavy metal ions (Cu 2+ , Mn 2+ , Ni 2+ , Co 2+ , and Zn 2+ ) in vitro in a model system that utilizes changes in the concentration of SDS to induce structural conversion and aggregation of recombinant PrP. To quantify and characterize PrP aggregates, we used fluorescently labelled PrP and cross-correlation analysis as well as scanning for intensely fluorescent targets in a confocal single molecule detection system. We found a specific strong pro-aggregatory effect of Mn 2+ at low micromolar concentrations that could be blocked by nanomolar concentration of Cu 2+ . These findings suggest that metal ions such as copper and manganese may also affect PrP conversion in vivo
Reduction of prion infectivity in packed red blood cells
International Nuclear Information System (INIS)
Morales, Rodrigo; Buytaert-Hoefen, Kimberley A.; Gonzalez-Romero, Dennisse; Castilla, Joaquin; Hansen, Eric T.; Hlavinka, Dennis; Goodrich, Raymond P.; Soto, Claudio
2008-01-01
The link between a new variant form of Creutzfeldt-Jakob disease (vCJD) and the consumption of prion contaminated cattle meat as well as recent findings showing that vCJD can be transmitted by blood transfusion have raised public health concerns. Currently, a reliable test to identify prions in blood samples is not available. The purpose of this study was to evaluate the possibility to remove scrapie prion protein (PrP Sc ) and infectivity from red blood cell (RBC) suspensions by a simple washing procedure using a cell separation and washing device. The extent of prion removal was assessed by Western blot, PMCA and infectivity bioassays. Our results revealed a substantial removal of infectious prions (≥3 logs of infectivity) by all techniques used. These data suggest that a significant amount of infectivity present in RBC preparations can be removed by a simple washing procedure. This technology may lead to increased safety of blood products and reduce the risk of further propagation of prion diseases.
Czech Academy of Sciences Publication Activity Database
Zawada, Zbigniew; Šebestík, Jaroslav; Bouř, Petr; Hlaváček, Jan; Stibor, Ivan
2008-01-01
Roč. 14, č. 8 (2008), s. 76-77 ISSN 1075-2617. [European Peptide Symposium /30./. 31.08.2008-05.09.2008, Helsinki] R&D Projects: GA ČR GA203/07/1517 Institutional research plan: CEZ:AV0Z40550506 Keywords : prion protein * neurodegenerative diseases * chemical synthesis * ligation conditions Subject RIV: CC - Organic Chemistry
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.; Al-Talla, Zeyad; Guo, Xianrong; Al-Ghamdi, Suliman; Al-Masri, Harbi Tomah
2013-01-01
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Utilizing NMR and EPR spectroscopy to probe the role of copper in prion diseases
Emwas, Abdul-Hamid M.
2013-02-24
Copper is an essential nutrient for the normal development of the brain and nervous system, although the hallmark of several neurological diseases is a change in copper concentrations in the brain and central nervous system. Prion protein (PrP) is a copper-binding, cell-surface glycoprotein that exists in two alternatively folded conformations: a normal isoform (PrPC) and a disease-associated isoform (PrPSc). Prion diseases are a group of lethal neurodegenerative disorders that develop as a result of conformational conversion of PrPC into PrPSc. The pathogenic mechanism that triggers this conformational transformation with the subsequent development of prion diseases remains unclear. It has, however, been shown repeatedly that copper plays a significant functional role in the conformational conversion of prion proteins. In this review, we focus on current research that seeks to clarify the conformational changes associated with prion diseases and the role of copper in this mechanism, with emphasis on the latest applications of NMR and EPR spectroscopy to probe the interactions of copper with prion proteins. Copyright © 2013 John Wiley & Sons, Ltd.
Conformational detection of prion protein with biarsenical labeling and FlAsH fluorescence
International Nuclear Information System (INIS)
Coleman, Bradley M.; Nisbet, Rebecca M.; Han, Sen; Cappai, Roberto; Hatters, Danny M.; Hill, Andrew F.
2009-01-01
Prion diseases are associated with the misfolding of the host-encoded cellular prion protein (PrP C ) into a disease associated form (PrP Sc ). Recombinant PrP can be refolded into either an α-helical rich conformation (α-PrP) resembling PrP C or a β-sheet rich, protease resistant form similar to PrP Sc . Here, we generated tetracysteine tagged recombinant PrP, folded this into α- or β-PrP and determined the levels of FlAsH fluorescence. Insertion of the tetracysteine tag at three different sites within the 91-111 epitope readily distinguished β-PrP from α-PrP upon FlAsH labeling. Labelling of tetracysteine tagged PrP in the α-helical form showed minimal fluorescence, whereas labeling of tagged PrP in the β-sheet form showed high fluorescence indicating that this region is exposed upon conversion. This highlights a region of PrP that can be implicated in the development of diagnostics and is a novel, protease free mechanism for distinguishing PrP Sc from PrP C . This technique may also be applied to any protein that undergoes conformational change and/or misfolding such as those involved in other neurodegenerative disorders including Alzheimer's, Huntington's and Parkinson's diseases.
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp−/−) mice. So far, six types of Prnp−/− mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not fully reveal PrP functions. Recently, varieties of Prnp−/− cell lines established from Prnp−/− mice have contributed to the analysis of PrP functions. In this mini-review, we focus on Prnp−/− cell lines and summarize currently available Prnp−/− cell lines and their characterizations. In addition, we introduce the recent advances in the methodology of cell line generation with knockout or knockdown of the PrP gene. We also discuss how these cell lines have provided valuable insights into PrP functions and show future perspectives. PMID:25642423
Optimization of Aryl Amides that Extend Survival in Prion-Infected Mice.
Giles, Kurt; Berry, David B; Condello, Carlo; Dugger, Brittany N; Li, Zhe; Oehler, Abby; Bhardwaj, Sumita; Elepano, Manuel; Guan, Shenheng; Silber, B Michael; Olson, Steven H; Prusiner, Stanley B
2016-09-01
Developing therapeutics for neurodegenerative diseases (NDs) prevalent in the aging population remains a daunting challenge. With the growing understanding that many NDs progress by conformational self-templating of specific proteins, the prototypical prion diseases offer a platform for ND drug discovery. We evaluated high-throughput screening hits with the aryl amide scaffold and explored the structure-activity relationships around three series differing in their N-aryl core: benzoxazole, benzothiazole, and cyano. Potent anti-prion compounds were advanced to pharmacokinetic studies, and the resulting brain-penetrant leads from each series, together with a related N-aryl piperazine lead, were escalated to long-term dosing and efficacy studies. Compounds from each of the four series doubled the survival of mice infected with a mouse-passaged prion strain. Treatment with aryl amides altered prion strain properties, as evidenced by the distinct patterns of neuropathological deposition of prion protein and associated astrocytic gliosis in the brain; however, none of the aryl amide compounds resulted in drug-resistant prion strains, in contrast to previous studies on compounds with the 2-aminothiazole (2-AMT) scaffold. As seen with 2-AMTs and other effective anti-prion compounds reported to date, the novel aryl amides reported here were ineffective in prolonging the survival of transgenic mice infected with human prions. Most encouraging is our discovery that aryl amides show that the development of drug resistance is not an inevitable consequence of efficacious anti-prion therapeutics. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.
Phosphatidylinositol-glycan-phospholipase D is involved in neurodegeneration in prion disease.
Directory of Open Access Journals (Sweden)
Jae-Kwang Jin
Full Text Available PrPSc is formed from a normal glycosylphosphatidylinositol (GPI-anchored prion protein (PrPC by a posttranslational modification. Most GPI-anchored proteins have been shown to be cleaved by GPI phospholipases. Recently, GPI-phospholipase D (GPI-PLD was shown to be a strictly specific enzyme for GPI anchors. To investigate the involvement of GPI-PLD in the processes of neurodegeneration in prion diseases, we examined the mRNA and protein expression levels of GPI-PLD in the brains of a prion animal model (scrapie, and in both the brains and cerebrospinal fluids (CSF of sporadic and familial Creutzfeldt-Jakob disease (CJD patients. We found that compared with controls, the expression of GPI-PLD was dramatically down-regulated in the brains of scrapie-infected mice, especially in the caveolin-enriched membrane fractions. Interestingly, the observed decrease in GPI-PLD expression levels began at the same time that PrPSc began to accumulate in the infected brains and this decrease was also observed in both the brain and CSF of CJD patients; however, no differences in expression were observed in either the brains or CSF specimens from Alzheimer's disease patients. Taken together, these results suggest that the down-regulation of GPI-PLD protein may be involved in prion propagation in the brains of prion diseases.
Wang, Hui; Tian, Chan; Sun, Jing; Chen, Li-Na; Lv, Yan; Yang, Xiao-Dong; Xiao, Kang; Wang, Jing; Chen, Cao; Shi, Qi; Shao, Qi-Xiang; Dong, Xiao-Ping
2017-08-01
Polo-like kinase 3 (PLK3) is the main cause of cell cycle reentry-related neuronal apoptosis which has been implicated in the pathogenesis of prion diseases. Previous work also showed the regulatory activity of exogenous PLK3 on the degradation of PrP (prion protein) mutants and pathogenic PrP Sc ; however, the precise mechanisms remain unknown. In this study, we identified that the overexpression of PLK3-mediated degradation of PrP mutant and PrP Sc was repressed by lysosome rather than by proteasomal and macroautophagy inhibitors. Core components of chaperone-mediated autophagy (CMA) effectors, lysosome-associated membrane protein type 2A (LAMP2a), and heat shock cognate protein 70 (Hsc70) are markedly decreased in the HEK293T cells expressing PrP mutant and scrapie-infected cell line SMB-S15. Meanwhile, PrP mutant showed ability to interact with LAMP2a and Hsc70. Overexpression of PLK3 sufficiently increased the cellular levels of LAMP2a and Hsc70, accompanying with declining the accumulations of PrP mutant and PrP Sc . The kinase domain (KD) of PLK3 was responsible for elevating LAMP2a and Hsc70. Knockdown of endogenous PLK3 enhanced the activity of macroautophagy in the cultured cells. Moreover, time-dependent reductions of LAMP2a and Hsc70 were also observed in the brain tissues of hamster-adapted scrapie agent 263K-infected hamsters, indicating an impairment of CMA during prion infection. Those data indicate that the overexpression of PLK3-mediated degradation of abnormal PrP is largely dependent on CMA pathway.
Fungal prion HET-s as a model for structural complexity and self-propagation in prions.
Wan, William; Stubbs, Gerald
2014-04-08
The highly ordered and reproducible structure of the fungal prion HET-s makes it an excellent model system for studying the inherent properties of prions, self-propagating infectious proteins that have been implicated in a number of fatal diseases. In particular, the HET-s prion-forming domain readily folds into a relatively complex two-rung β-solenoid amyloid. The faithful self-propagation of this fold involves a diverse array of inter- and intramolecular structural features. These features include a long flexible loop connecting the two rungs, buried polar residues, salt bridges, and asparagine ladders. We have used site-directed mutagenesis and X-ray fiber diffraction to probe the relative importance of these features for the formation of β-solenoid structure, as well as the cumulative effects of multiple mutations. Using fibrillization kinetics and chemical stability assays, we have determined the biophysical effects of our mutations on the assembly and stability of the prion-forming domain. We have found that a diversity of structural features provides a level of redundancy that allows robust folding and stability even in the face of significant sequence alterations and suboptimal environmental conditions. Our findings provide fundamental insights into the structural interactions necessary for self-propagation. Propagation of prion structure seems to require an obligatory level of complexity that may not be reproducible in short peptide models.
Mammalian prions: tolerance to sequence changes-how far?
Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel
2013-01-01
Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.
Escandón-Vargas, Kevin; Zorrilla-Vaca, Andrés; Corral-Prado, Raúl Heli
2016-02-24
Prion diseases are rare neurodegenerative disorders occurring worldwide and affecting both humans and animals. Herein, we present the case of a patient diagnosed with definite sporadic Creutzfeldt-Jakob disease in Cali, Colombia. Besides neurological examination, 14-3-3 and tau proteins were valuable tools supporting the diagnosis. We also present a brief perspective of the prion diseases reported in Colombia to date. Although the incidence of prion diseases is unknown in Colombia, our literature review revealed that one case of scrapie in 1981 and 29 human sporadic cases of Creutzfeldt-Jakob disease have been documented and published in our country.
Inactivation of animal and human prions by hydrogen peroxide gas plasma sterilization.
Rogez-Kreuz, C; Yousfi, R; Soufflet, C; Quadrio, I; Yan, Z-X; Huyot, V; Aubenque, C; Destrez, P; Roth, K; Roberts, C; Favero, M; Clayette, P
2009-08-01
Prions cause various transmissible spongiform encephalopathies. They are highly resistant to the chemical and physical decontamination and sterilization procedures routinely used in healthcare facilities. The decontamination procedures recommended for the inactivation of prions are often incompatible with the materials used in medical devices. In this study, we evaluated the use of low-temperature hydrogen peroxide gas plasma sterilization systems and other instrument-processing procedures for inactivating human and animal prions. We provide new data concerning the efficacy of hydrogen peroxide against prions from in vitro or in vivo tests, focusing on the following: the efficiency of hydrogen peroxide sterilization and possible interactions with enzymatic or alkaline detergents, differences in the efficiency of this treatment against different prion strains, and the influence of contaminating lipids. We found that gaseous hydrogen peroxide decreased the infectivity of prions and/or the level of the protease-resistant form of the prion protein on different surface materials. However, the efficiency of this treatment depended strongly on the concentration of hydrogen peroxide and the delivery system used in medical devices, because these effects were more pronounced for the new generation of Sterrad technology. The Sterrad NX sterilizer is 100% efficient (0% transmission and no protease-resistant form of the prion protein signal detected on the surface of the material for the mouse-adapted bovine spongiform encephalopathy 6PB1 strain and a variant Creutzfeldt-Jakob disease strain). Thus, gaseous or vaporized hydrogen peroxide efficiently inactivates prions on the surfaces of medical devices.
Directory of Open Access Journals (Sweden)
Hanae Takatsuki, PhD
2016-10-01
Full Text Available Human prion diseases are neurodegenerative disorders caused by abnormally folded prion proteins in the central nervous system. These proteins can be detected using the quaking-induced conversion assay. Compared with other bioassays, this assay is extremely sensitive and was used in the present study to determine prion distribution in sporadic Creutzfeldt-Jakob disease patients at autopsy. Although infectivity of the sporadic form is thought to be restricted within the central nervous system, results showed that prion-seeding activities reach 106/g from a 50% seeding dose in non-neuronal tissues, suggesting that prion-seeding activity exists in non-neural organs, and we suggested that non-neural tissues of 106/g SD50 did not exist the infectivity.
Infectivity versus Seeding in Neurodegenerative Diseases Sharing a Prion-Like Mechanism
Directory of Open Access Journals (Sweden)
Natalia Fernández-Borges
2013-01-01
Full Text Available Prions are considered the best example to prove that the biological information can be transferred protein to protein through a conformational change. The term “prion-like” is used to describe molecular mechanisms that share similarities with the mammalian prion protein self-perpetuating aggregation and spreading characteristics. Since prions are presumably composed only of protein and are infectious, the more similar the mechanisms that occur in the different neurodegenerative diseases, the more these processes will resemble an infection. In vitro and in vivo experiments carried out during the last decade in different neurodegenerative disorders such as Alzheimer's disease (AD, Parkinson's diseases (PD, and amyotrophic lateral sclerosis (ALS have shown a convergence toward a unique mechanism of misfolded protein propagation. In spite of the term “infection” that could be used to explain the mechanism governing the diversity of the pathological processes, other concepts as “seeding” or “de novo induction” are being used to describe the in vivo propagation and transmissibility of misfolded proteins. The current studies are demanding an extended definition of “disease-causing agents” to include those already accepted as well as other misfolded proteins. In this new scenario, “seeding” would be a type of mechanism by which an infectious agent can be transmitted but should not be used to define a whole “infection” process.
Cheng, Keding; Sloan, Angela; Avery, Kristen M; Coulthart, Michael; Carpenter, Michael; Knox, J David
2014-01-01
Real-time quaking-induced conversion (RT-QuIC), a highly specific and sensitive assay able to detect low levels of the disease-inducing isoform of the prion protein (PrP(d)) in brain tissue biopsies and cerebral spinal fluid, has great potential to become a method for diagnosing prion disease ante mortem. In order to standardize the assay method for routine analysis, an understanding of how physical and chemical factors affect the stability of the recombinant prion protein (rPrP) substrate and the RT-QuIC assay's sensitivity, specificity, and reproducibility is required. In this study, using sporadic Creutzfeldt-Jakob Disease brain homogenate to seed the reactions and an in vitro-expressed recombinant prion protein, hamster rPrP, as the substrate, the following factors affecting the RT-QuIC assay were examined: salt and substrate concentrations, substrate storage, and pH. Results demonstrated that both the generation of the quality and quantities of rPrP substrate critical to the reaction, as well as the RT-QuIC reaction itself required strict adherence to specific physical and chemical conditions. Once optimized, the RT-QuIC assay was confirmed to be a very specific and sensitive assay method for sCJD detection. Findings in this study indicate that further optimization and standardization of RT-QuIC assay is required before it can be adopted as a routine diagnostic test.
Sporn, Zachary A; Hines, Justin K
2015-01-01
Yeast prions are heritable protein-based elements, most of which are formed of amyloid aggregates that rely on the action of molecular chaperones for transmission to progeny. Prions can form distinct amyloid structures, known as 'strains' in mammalian systems, that dictate both pathological progression and cross-species infection barriers. In yeast these same amyloid structural polymorphisms, called 'variants', dictate the intensity of prion-associated phenotypes and stability in mitosis. We recently reported that [PSI(+)] prion variants differ in the fundamental domain requirements for one chaperone, the Hsp40/J-protein Sis1, which are mutually exclusive between 2 different yeast prions, demonstrating a functional plurality for Sis1. Here we extend that analysis to incorporate additional data that collectively support the hypothesis that Sis1 has multiple functional roles that can be accomplished by distinct sets of domains. These functions are differentially required by distinct prions and prion variants. We also present new data regarding Hsp104-mediated prion elimination and show that some Sis1 functions, but not all, are conserved in the human homolog Hdj1/DNAJB1. Importantly, of the 10 amyloid-based prions indentified to date in Saccharomyces cerevisiae, the chaperone requirements of only 4 are known, leaving a great diversity of amyloid structures, and likely modes of amyloid-chaperone interaction, largely unexplored.
Methods and Protocols for Developing Prion Vaccines.
Marciniuk, Kristen; Taschuk, Ryan; Napper, Scott
2016-01-01
Prion diseases denote a distinct form of infectivity that is based in the misfolding of a self-protein (PrP(C)) into a pathological, infectious conformation (PrP(Sc)). Efforts to develop vaccines for prion diseases have been complicated by the potential dangers that are associated with induction of immune responses against a self-protein. As a consequence, there is considerable appeal for vaccines that specifically target the misfolded prion conformation. Such conformation-specific immunotherapy is made possible through the identification of vaccine targets (epitopes) that are exclusively presented as a consequence of misfolding. An immune response directed against these targets, termed disease-specific epitopes (DSEs), has the potential to spare the function of the native form of the protein while clearing, or neutralizing, the infectious isomer. Although identification of DSEs represents a critical first step in the induction of conformation-specific immune responses, substantial efforts are required to translate these targets into functional vaccines. Due to the poor immunogenicity that is inherent to self-proteins, and that is often associated with short peptides, substantial efforts are required to overcome tolerance-to-self and maximize the resultant immune response following DSE-based immunization. This often includes optimization of target sequences in terms of immunogenicity and development of effective formulation and delivery strategies for the associated peptides. Further, these vaccines must satisfy additional criteria from perspectives of specificity (PrP(C) vs. PrP(Sc)) and safety (antibody-induced template-driven misfolding of PrP(C)). The emphasis of this report is on the steps required to translate DSEs into prion vaccines and subsequent evaluation of the resulting immune responses.
Enzymatic Digestion of Chronic Wasting Disease Prions Bound to Soil
SAUNDERS, SAMUEL E.; BARTZ, JASON C.; VERCAUTEREN, KURT C.; BARTELT-HUNT, SHANNON L.
2010-01-01
Chronic wasting disease (CWD) and sheep scrapie can be transmitted via indirect environmental routes, and it is known that soil can serve as a reservoir of prion infectivity. Given the strong interaction between the prion protein (PrP) and soil, we hypothesized that binding to soil enhances prion resistance to enzymatic digestion, thereby facilitating prion longevity in the environment and providing protection from host degradation. We characterized the performance of a commercially available subtilisin enzyme, the Prionzyme, to degrade soil-bound and unbound CWD and HY TME PrP as a function of pH, temperature, and treatment time. The subtilisin enzyme effectively degraded PrP adsorbed to a wide range of soils and soil minerals below the limits of detection. Signal loss occurred rapidly at high pH (12.5) and within 7 d under conditions representative of the natural environment (pH 7.4, 22°C). We observed no apparent difference in enzyme effectiveness between bound and unbound CWD PrP. Our results show that although adsorbed prions do retain relative resistance to enzymatic digestion compared with other brain homogenate proteins, they can be effectively degraded when bound to soil. Our results also suggest a topical application of a subtilisin enzyme solution may be an effective decontamination method to limit disease transmission via environmental ‘hot spots’ of prion infectivity. PMID:20450190
Directory of Open Access Journals (Sweden)
Ciriaco Ligios
Full Text Available Prions have been documented in extra-neuronal and extra-lymphatic tissues of humans and various ruminants affected by Transmissible Spongiform Encephalopathy (TSE. The presence of prion infectivity detected in cervid and ovine blood tempted us to reason that kidney, the organ filtrating blood derived proteins, may accumulate disease associated PrP(Sc. We collected and screened kidneys of experimentally, naturally scrapie-affected and control sheep for renal deposition of PrP(Sc from distinct, geographically separated flocks. By performing Western blot, PET blot analysis and immunohistochemistry we found intraepithelial (cortex, medulla and papilla and occasional interstitial (papilla deposition of PrP(Sc in kidneys of scrapie-affected sheep. Interestingly, glomerula lacked detectable signals indicative of PrP(Sc. PrP(Sc was also detected in kidneys of subclinical sheep, but to significantly lower degree. Depending on the stage of the disease the incidence of PrP(Sc in kidney varied from approximately 27% (subclinical to 73.6% (clinical in naturally scrapie-affected sheep. Kidneys from flocks without scrapie outbreak were devoid of PrP(Sc. Here we demonstrate unexpectedly frequent deposition of high levels of PrP(Sc in ovine kidneys of various flocks. Renal deposition of PrP(Sc is likely to be a pre-requisite enabling prionuria, a possible co-factor of horizontal prion-transmission in sheep.
Takatsuki, Hanae; Fuse, Takayuki; Nakagaki, Takehiro; Mori, Tsuyoshi; Mihara, Ban; Takao, Masaki; Iwasaki, Yasushi; Yoshida, Mari; Murayama, Shigeo; Atarashi, Ryuichiro; Nishida, Noriyuki; Satoh, Katsuya
2016-10-01
Human prion diseases are neurodegenerative disorders caused by abnormally folded prion proteins in the central nervous system. These proteins can be detected using the quaking-induced conversion assay. Compared with other bioassays, this assay is extremely sensitive and was used in the present study to determine prion distribution in sporadic Creutzfeldt-Jakob disease patients at autopsy. Although infectivity of the sporadic form is thought to be restricted within the central nervous system, results showed that prion-seeding activities reach 10 6 /g from a 50% seeding dose in non-neuronal tissues, suggesting that prion-seeding activity exists in non-neural organs, and we suggested that non-neural tissues of 10 6 /g SD50 did not exist the infectivity. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Prion protein expression regulates embryonic stem cell pluripotency and differentiation.
Directory of Open Access Journals (Sweden)
Alberto Miranda
2011-04-01
Full Text Available Cellular prion protein (PRNP is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs. Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB differentiation in mouse Prnp-null (KO and WT embryonic stem cell (ESC lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5 in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel and SPRN (Shadoo, whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.
Inactivation of prion infectivity by ionizing rays
Energy Technology Data Exchange (ETDEWEB)
Gominet, M. [Ionisos, ZI les Chatinieres, F01120 Dagneux (France); Vadrot, C.; Austruy, G. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France); Darbord, J.C. [Paris V University, Central Pharmacy of Hospitals, 4 avenue de l' Observatoire, F-75006, Paris (France)], E-mail: darbord@pharmacie.univ-paris5.fr
2007-11-15
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination.
Inactivation of prion infectivity by ionizing rays
International Nuclear Information System (INIS)
Gominet, M.; Vadrot, C.; Austruy, G.; Darbord, J.C.
2007-01-01
Inactivation of prion deposits on medical devices or prion contamination in pharmaceutical raw materials is considered as impossible by using gamma irradiation. Early, the guideline WHO/CDS/CSR/APH/2000 has described irradiation as an ineffective process. But, in 2003, S. Miekka et al. noted radiation inactivation of prions in a particular application to purify human albumin, shown by the physical denaturation of the infectious protein (PrP). The aim of our study was to determine the inactivation of prions with a scrapie model (strain C506M3) by irradiating standardised preparations. Results: Gamma irradiation was partially effective, showing a 4-5 log reduction on exposure to 50 kGy. A characteristic effect-dose curve was not observed (25, 50 and 100 kGy), only an increase in the incubation period of the murine disease (229 days with 25 kGy to 290 days with 100 kGy) compared with 170 days without irradiation. Since the inactivation was not a total one, the observed effect is significant. It is proposed that further work be undertaken with the model to investigate the application of gamma radiation known levels of prion contamination
Unaltered Prion Pathogenesis in a Mouse Model of High-Fat Diet-Induced Insulin Resistance.
Directory of Open Access Journals (Sweden)
Caihong Zhu
Full Text Available Epidemiological, clinical, and experimental animal studies suggest a strong correlation between insulin resistance and Alzheimer's disease. In fact, type-2 diabetes is considered an important risk factor of developing Alzheimer's disease. In addition, impaired insulin signaling in the Alzheimer's disease brain may promote Aβ production, impair Aβ clearance and induce tau hyperphosphorylation, thereby leading to deterioration of the disease. The pathological prion protein, PrPSc, deposits in the form of extracellular aggregates and leads to dementia, raising the question as to whether prion pathogenesis may also be affected by insulin resistance. We therefore established high-fat diet-induced insulin resistance in tga20 mice, which overexpress the prion protein. We then inoculated the insulin-resistant mice with prions. We found that insulin resistance in tga20 mice did not affect prion disease progression, PrPSc deposition, astrogliosis or microglial activation, and had no effect on survival. Our study demonstrates that in a mouse model, insulin resistance does not significantly contribute to prion pathogenesis.
Collins, Steven J; Tumpach, Carolin; Groveman, Bradley R; Drew, Simon C; Haigh, Cathryn L
2018-03-24
Neurogenesis continues in the post-developmental brain throughout life. The ability to stimulate the production of new neurones requires both quiescent and actively proliferating pools of neural stem cells (NSCs). Actively proliferating NSCs ensure that neurogenic demand can be met, whilst the quiescent pool makes certain NSC reserves do not become depleted. The processes preserving the NSC quiescent pool are only just beginning to be defined. Herein, we identify a switch between NSC proliferation and quiescence through changing intracellular redox signalling. We show that N-terminal post-translational cleavage products of the prion protein (PrP) induce a quiescent state, halting NSC cellular growth, migration, and neurite outgrowth. Quiescence is initiated by the PrP cleavage products through reducing intracellular levels of reactive oxygen species. First, inhibition of redox signalling results in increased mitochondrial fission, which rapidly signals quiescence. Thereafter, quiescence is maintained through downstream increases in the expression and activity of superoxide dismutase-2 that reduces mitochondrial superoxide. We further observe that PrP is predominantly cleaved in quiescent NSCs indicating a homeostatic role for this cascade. Our findings provide new insight into the regulation of NSC quiescence, which potentially could influence brain health throughout adult life.
Spreading of a prion domain from cell-to-cell by vesicular transport in Caenorhabditis elegans.
Directory of Open Access Journals (Sweden)
Carmen I Nussbaum-Krammer
2013-03-01
Full Text Available Prion proteins can adopt self-propagating alternative conformations that account for the infectious nature of transmissible spongiform encephalopathies (TSEs and the epigenetic inheritance of certain traits in yeast. Recent evidence suggests a similar propagation of misfolded proteins in the spreading of pathology of neurodegenerative diseases including Alzheimer's or Parkinson's disease. Currently there is only a limited number of animal model systems available to study the mechanisms that underlie the cell-to-cell transmission of aggregation-prone proteins. Here, we have established a new metazoan model in Caenorhabditis elegans expressing the prion domain NM of the cytosolic yeast prion protein Sup35, in which aggregation and toxicity are dependent upon the length of oligopeptide repeats in the glutamine/asparagine (Q/N-rich N-terminus. NM forms multiple classes of highly toxic aggregate species and co-localizes to autophagy-related vesicles that transport the prion domain from the site of expression to adjacent tissues. This is associated with a profound cell autonomous and cell non-autonomous disruption of mitochondrial integrity, embryonic and larval arrest, developmental delay, widespread tissue defects, and loss of organismal proteostasis. Our results reveal that the Sup35 prion domain exhibits prion-like properties when expressed in the multicellular organism C. elegans and adapts to different requirements for propagation that involve the autophagy-lysosome pathway to transmit cytosolic aggregation-prone proteins between tissues.
2013-01-01
The molecular pathogenic mechanisms of prion diseases are far from clear. Genomic analyses have revealed genetic biomarkers potentially involved in prion neuropathology in naturally scrapie-infected sheep, a good animal model of infectious prionopathies. However, these biomarkers must be validated in independent studies at different stages of the disease. The gene and protein expression profiles and protein distribution of six potential genetic biomarkers (i.e., CAPN6, COL1A2, COL3A1, GALA1, MT2A and MTNR1B) are presented here for both the early and terminal stages of scrapie in five different brain regions. Gene transcription changes were confirmed in the medulla oblongata, and the expression profiles were generally similar in other central nervous system regions. The changes were more substantial in clinical animals compared to preclinical animals. The expression of the CAPN6 protein increased in the spinal cord and cerebellum of the clinical and preclinical brains. The distribution of the GALA1 was identified in glial cells from the cerebellum of scrapie-infected animals, GALA1 protein expression was increased in clinical animals in the majority of regions, and the increase of MT2A was in agreement with previous reports. The downregulation of MTNR1B was especially marked in the Purkinje cells. Finally, although collagen genes were downregulated the protein immunostaining did not reveal significant changes between the scrapie-infected and control animals. In conclusion, this study of gene transcription and protein expression and distribution confirm CAPN6, GALA1, MTNR1B and MT2A as potential targets for further prion disease research. PMID:23497022
Codon 129 polymorphism of prion protein gene in is not a risk factor for Alzheimer's disease
Directory of Open Access Journals (Sweden)
Jerusa Smid
2013-07-01
Full Text Available Interaction of prion protein and amyloid-b oligomers has been demonstrated recently. Homozygosity at prion protein gene (PRNP codon 129 is associated with higher risk for Creutzfeldt-Jakob disease. This polymorphism has been addressed as a possible risk factor in Alzheimer disease (AD. Objective To describe the association between codon 129 polymorphisms and AD. Methods We investigated the association of codon 129 polymorphism of PRNP in 99 AD patients and 111 controls, and the association between this polymorphism and cognitive performance. Other polymorphisms of PRNP and additive effect of apolipoprotein E gene (ApoE were evaluated. Results Codon 129 genotype distribution in AD 45.5% methionine (MM, 42.2% methionine valine (MV, 12.1% valine (VV; and 39.6% MM, 50.5% MV, 9.9% VV among controls (p>0.05. There were no differences of cognitive performance concerning codon 129. Stratification according to ApoE genotype did not reveal difference between groups. Conclusion Codon 129 polymorphism is not a risk factor for AD in Brazilian patients.
Loss of prion protein induces a primed state of type I interferon-responsive genes
DEFF Research Database (Denmark)
Malachin, Giulia; Reiten, Malin R.; Salvesen, Øyvind
2017-01-01
The cellular prion protein (PrPC) has been extensively studied because of its pivotal role in prion diseases; however, its functions remain incompletely understood. A unique line of goats has been identified that carries a nonsense mutation that abolishes synthesis of PrPC. In these animals, the Pr...... genotypes. About 70% of these were classified as interferon-responsive genes. In goats without PrPC, the majority of type I interferon-responsive genes were in a primed, modestly upregulated state, with fold changes ranging from 1.4 to 3.7. Among these were ISG15, DDX58 (RIG-1), MX1, MX2, OAS1, OAS2...... and DRAM1, all of which have important roles in pathogen defense, cell proliferation, apoptosis, immunomodulation and DNA damage response. Our data suggest that PrPC contributes to the fine-tuning of resting state PBMCs expression level of type I interferon-responsive genes. The molecular mechanism...
Genomic assessment of the evolution of the prion protein gene family in vertebrates.
Harrison, Paul M; Khachane, Amit; Kumar, Manish
2010-05-01
Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long
A prion (PrPSc) is a conformer of a normal cellular prion protein (PrPC). Although they are isosequential, PrPSc is an infectious protein able to convert PrPC into the prion conformation and thereby propagate an infection. PrPC is monomeric while PrPSc is a multimer. PrPSc can adopt more than one co...
Fragment-Based Protein-Protein Interaction Antagonists of a Viral Dimeric Protease.
Gable, Jonathan E; Lee, Gregory M; Acker, Timothy M; Hulce, Kaitlin R; Gonzalez, Eric R; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J; Craik, Charles S
2016-04-19
Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi's sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose-response determination was performed as a confirmation screen, and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed by NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80 % of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogues. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
SCEDS: protein fragments for molecular replacement in Phaser
Energy Technology Data Exchange (ETDEWEB)
McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)
2013-11-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.
SCEDS: protein fragments for molecular replacement in Phaser
International Nuclear Information System (INIS)
McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.
2013-01-01
Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser
Directory of Open Access Journals (Sweden)
Mauricio Torres
2010-12-01
Full Text Available Prion-related disorders (PrDs are fatal neurodegenerative disorders characterized by progressive neuronal impairment as well as the accumulation of an abnormally folded and protease resistant form of the cellular prion protein, termed PrP(RES. Altered endoplasmic reticulum (ER homeostasis is associated with the occurrence of neurodegeneration in sporadic, infectious and familial forms of PrDs. The ER operates as a major intracellular calcium store, playing a crucial role in pathological events related to neuronal dysfunction and death. Here we investigated the possible impact of PrP misfolding on ER calcium homeostasis in infectious and familial models of PrDs. Neuro2A cells chronically infected with scrapie prions showed decreased ER-calcium content that correlated with a stronger upregulation of UPR-inducible chaperones, and a higher sensitivity to ER stress-induced cell death. Overexpression of the calcium pump SERCA stimulated calcium release and increased the neurotoxicity observed after exposure of cells to brain-derived infectious PrP(RES. Furthermore, expression of PrP mutants that cause hereditary Creutzfeldt-Jakob disease or fatal familial insomnia led to accumulation of PrP(RES and their partial retention at the ER, associated with a drastic decrease of ER calcium content and higher susceptibility to ER stress. Finally, similar results were observed when a transmembrane form of PrP was expressed, which is proposed as a neurotoxic intermediate. Our results suggest that alterations in calcium homeostasis and increased susceptibility to ER stress are common pathological features of both infectious and familial PrD models.
Aims: Chronic wasting disease (CWD) is a naturally-occurring, fatal neurodegenerative disease of cervids. We previously demonstrated that disease-associated prion protein (PrPSc) can be detected in the brain and retina from pigs challenged intracranially or orally with the CWD agent. In that study,...
Role of the Disulfide Bond in Prion Protein Amyloid Formation: A Thermodynamic and Kinetic Analysis.
Honda, Ryo
2018-02-27
Prion diseases are associated with the structural conversion of prion protein (PrP) to a β-sheet-rich aggregate, PrP Sc . Previous studies have indicated that a reduction of the disulfide bond linking C179 and C214 of PrP yields an amyloidlike β-rich aggregate in vitro. To gain mechanistic insights into the reduction-induced aggregation, here I characterized how disulfide bond reduction modulates the protein folding/misfolding landscape of PrP, by examining 1) the equilibrium stabilities of the native (N) and aggregated states relative to the unfolded (U) state, 2) the transition barrier separating the U and aggregated states, and 3) the final structure of amyloidlike misfolded aggregates. Kinetic and thermodynamic experiments revealed that disulfide bond reduction decreases the equilibrium stabilities of both the N and aggregated states by ∼3 kcal/mol, without changing either the amyloidlike aggregate structure, at least at the secondary structural level, or the transition barrier of aggregation. Therefore, disulfide bond reduction modulates the protein folding/misfolding landscape by entropically stabilizing disordered states, including the U and transition state of aggregation. This also indicates that the equilibrium stability of the N state, but not the transition barrier of aggregation, is the dominant factor determining the reduction-induced aggregation of PrP. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
O’Connor, Tracy; Aguzzi, Adriano
2013-01-01
Prion colonization of secondary lymphoid organs (SLOs) is a critical step preceding neuroinvasion in prion pathogenesis. Follicular dendritic cells (FDCs), which depend on both tumor necrosis factor receptor 1 (TNFR1) and lymphotoxin β receptor (LTβR) signaling for maintenance, are thought to be the primary sites of prion accumulation in SLOs. However, prion titers in RML-infected TNFR1−/− lymph nodes and rates of neuroinvasion in TNFR1−/− mice remain high despite the absence of mature FDCs. Recently, we discovered that TNFR1-independent prion accumulation in lymph nodes relies on LTβR signaling. Loss of LTβR signaling in TNFR1−/− lymph nodes coincided with the de-differentiation of high endothelial venules (HEVs)—the primary sites of lymphocyte entry into lymph nodes. These findings suggest that HEVs are the sites through which prions initially invade lymph nodes from the bloodstream. Identification of HEVs as entry portals for prions clarifies a number of previous observations concerning peripheral prion pathogenesis. However, a number of questions still remain: What is the mechanism by which prions are taken up by HEVs? Which cells are responsible for delivering prions to lymph nodes? Are HEVs the main entry site for prions into lymph nodes or do alternative routes also exist? These questions and others are considered in this article. PMID:23357827
Khalifé, Manal; Reine, Fabienne; Paquet-Fifield, Sophie; Castille, Johan; Herzog, Laetitia; Vilotte, Marthe; Moudjou, Mohammed; Moazami-Goudarzi, Katayoun; Makhzami, Samira; Passet, Bruno; Andréoletti, Olivier; Vilette, Didier; Laude, Hubert; Béringue, Vincent; Vilotte, Jean-Luc
2016-02-01
Mammalian prions are proteinaceous infectious agents composed of misfolded assemblies of the host-encoded, cellular prion protein (PrP). Physiologically, the N-terminal polybasic region of residues 23 to 31 of PrP has been shown to be involved in its endocytic trafficking and interactions with glycosaminoglycans or putative ectodomains of membrane-associated proteins. Several recent reports also describe this PrP region as important for the toxicity of mutant prion proteins and the efficiency of prion propagation, both in vitro and in vivo. The question remains as to whether the latter observations made with mouse PrP and mouse prions would be relevant to other PrP species/prion strain combinations given the dramatic impact on prion susceptibility of minimal amino acid substitutions and structural variations in PrP. Here, we report that transgenic mouse lines expressing ovine PrP with a deletion of residues 23 to 26 (KKRP) or mutated in this N-terminal region (KQHPH instead of KKRPK) exhibited a variable, strain-dependent susceptibility to prion infection with regard to the proportion of affected mice and disease tempo relative to findings in their wild-type counterparts. Deletion has no major effect on 127S scrapie prion pathogenesis, whereas mutation increased by almost 3-fold the survival time of the mice. Deletion marginally affected the incubation time of scrapie LA19K and ovine bovine spongiform encephalopathy (BSE) prions, whereas mutation caused apparent resistance to disease. Recent reports suggested that the N-terminal polybasic region of the prion protein could be a therapeutic target to prevent prion propagation or toxic signaling associated with more common neurodegenerative diseases such as Alzheimer's disease. Mutating or deleting this region in ovine PrP completes the data previously obtained with the mouse protein by identifying the key amino acid residues involved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Cohen, Mark; Appleby, Brian; Safar, Jiri G
2016-01-01
Vast evidence on human prions demonstrates that variable disease phenotypes, rates of propagation, and targeting of distinct brain structures are determined by unique conformers (strains) of pathogenic prion protein (PrP(Sc)). Recent progress in the development of advanced biophysical tools that inventory structural characteristics of amyloid beta (Aβ) in the brain cortex of phenotypically diverse Alzheimer's disease (AD) patients, revealed unique spectrum of oligomeric particles in the cortex of rapidly progressive cases, implicating these structures in variable rates of propagation in the brain, and in distict disease manifestation. Since only ∼30% of phenotypic diversity of AD can be explained by polymorphisms in risk genes, these and transgenic bioassay data argue that structurally distinct Aβ particles play a major role in the diverse pathogenesis of AD, and may behave as distinct prion-like strains encoding diverse phenotypes. From these observations and our growing understanding of prions, there is a critical need for new strain-specific diagnostic strategies for misfolded proteins causing these elusive disorders. Since targeted drug therapy can induce mutation and evolution of prions into new strains, effective treatments of AD will require drugs that enhance clearance of pathogenic conformers, reduce the precursor protein, or inhibit the conversion of precursors into prion-like states.
The expanding universe of prion diseases.
Watts, Joel C; Balachandran, Aru; Westaway, David
2006-03-01
Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C). Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE) the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD) and sporadic fatal insomnia (sFI), bovine amyloidotic spongiform encephalopathy (BASE), and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD) of North American deer (Odocoileus Specis) and Rocky Mountain elk (Cervus elaphus nelsoni) is undergoing a dramatic spread across North America. While amplification (BSE) and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk) can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
The real-time quaking-induced conversion (RT-QuIC) is a rapid, specific, and sensitive prion seeding activity detection assay that uses recombinant prion protein (rPrPSen) to detect sub-infectious levels of the abnormal isoforms of the prion protein (PrPSc). Although RT-QuIC has been successfully us...
Iacono, Diego; Ferrari, Sergio; Gelati, Matteo; Zanusso, Gianluigi; Mariotto, Sara; Monaco, Salvatore
2015-01-01
Sporadic Creutzfeldt-Jakob disease (sCJD), the most frequent human prion disorder, is characterized by remarkable phenotypic variability, which is influenced by the conformation of the pathologic prion protein and the methionine/valine polymorphic codon 129 of the prion protein gene. While the etiology of sCJD remains unknown, it has been hypothesized that environmental exposure to prions might occur through conjunctival/mucosal contact, oral ingestion, inhalation, or simultaneous involvement of the olfactory and enteric systems. We studied 21 subjects with definite sCJD to assess neuropathological involvement of the dorsal motor nucleus of the vagus and other medullary nuclei and to evaluate possible associations with codon 129 genotype and prion protein conformation. The present data show that prion protein deposition was detected in medullary nuclei of distinct sCJD subtypes, either valine homozygous or heterozygous at codon 129. These findings suggest that an "environmental exposure" might occur, supporting the hypothesis that external sources of contamination could contribute to sCJD in susceptible hosts. Furthermore, these novel data could shed the light on possible causes of sCJD through a "triple match" hypothesis that identify environmental exposure, host genotype, and direct exposure of specific anatomical regions as possible pathogenetic factors.
The Endoplasmic Reticulum Chaperone GRP78/BiP Modulates Prion Propagation in vitro and in vivo.
Park, Kyung-Won; Eun Kim, Gyoung; Morales, Rodrigo; Moda, Fabio; Moreno-Gonzalez, Ines; Concha-Marambio, Luis; Lee, Amy S; Hetz, Claudio; Soto, Claudio
2017-03-23
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR). GRP78, also called BiP, is a master regulator of the UPR, reducing ER stress levels and apoptosis due to an enhancement of the cellular folding capacity. Here, we studied the role of GRP78 in prion diseases using several in vivo and in vitro approaches. Our results show that a reduction in the expression of this molecular chaperone accelerates prion pathogenesis in vivo. In addition, we observed that prion replication in cell culture was inversely related to the levels of expression of GRP78 and that both proteins interact in the cellular context. Finally, incubation of PrP Sc with recombinant GRP78 led to the dose-dependent reduction of protease-resistant PrP Sc in vitro. Our results uncover a novel role of GRP78 in reducing prion pathogenesis, suggesting that modulating its levels/activity may offer a novel opportunity for designing therapeutic approaches for these diseases. These findings may also have implications for other diseases involving the accumulation of misfolded proteins.
Haldiman, T.; Kim, C.; Cohen, Y.; Chen, W.; Blevins, J.; Qing, L.; Cohen, M.L.; Langeveld, J.P.M.; Telling, G.C.; Kong, Q.; Safar, J.G.
2013-01-01
The unique phenotypic characteristics of mammalian prions are thought to be encoded in the conformation of pathogenic prion proteins (PrPSc). The molecular mechanism responsible for the adaptation, mutation, and evolution of prions observed in cloned cells and upon crossing the species barrier
Ubiquitin Ligase gp78 Targets Unglycosylated Prion Protein PrP for Ubiquitylation and Degradation
Shao, Jia; Choe, Vitnary; Cheng, Haili; Tsai, Yien Che; Weissman, Allan M.; Luo, Shiwen; Rao, Hai
2014-01-01
Prion protein PrP is a central player in several devastating neurodegenerative disorders, including mad cow disease and Creutzfeltd-Jacob disease. Conformational alteration of PrP into an aggregation-prone infectious form PrPSc can trigger pathogenic events. How levels of PrP are regulated is poorly understood. Human PrP is known to be degraded by the proteasome, but the specific proteolytic pathway responsible for PrP destruction remains elusive. Here, we demonstrate that the ubiquitin ligas...
Directory of Open Access Journals (Sweden)
Hu Shen-rong
2013-12-01
Full Text Available Objective To investigate the 23 bp and 12 bp insertion/deletion (indel mutations within the bovine prion protein (PRNP gene in Chinese dairy cows, and to detect the associations of two indel mutations with BSE susceptibility and milk performance.
The roles of the conserved tyrosine in the β2-α2 loop of the prion protein.
Huang, Danzhi; Caflisch, Amedeo
2015-01-01
Prions cause neurodegenerative diseases for which no cure exists. Despite decades of research activities the function of the prion protein (PrP) in mammalians is not known. Moreover, little is known on the molecular mechanisms of the self-assembly of the PrP from its monomeric state (cellular PrP, PrP(C)) to the multimeric state. The latter state includes the toxic species (scrapie PrP, PrP(Sc)) knowledge of which would facilitate the development of drugs against prion diseases. Here we analyze the role of a tyrosine residue (Y169) which is strictly conserved in mammalian PrPs. Nuclear magnetic resonance (NMR) spectroscopy studies of many mammalian PrP(C) proteins have provided evidence of a conformational equilibrium between a 3(10)-helical turn and a type I β turn conformation in the β2-α2 loop (residues 165-175). In vitro cell-free experiments of the seeded conversion of PrP(C) indicate that non-aromatic residues at position 169 reduce the formation of proteinase K-resistant PrP. Recent molecular dynamics (MD) simulations of monomeric PrP and several single-point mutants show that Y169 stabilizes the 3(10)-helical turn conformation more than single-point mutants at position 169 or residues in contact with it. In the 3(10)-helical turn conformation the hydrophobic and aggregation-prone segment 169-YSNQNNF-175 is buried and thus not-available for self-assembly. From the combined analysis of simulation and experimental results it emerges that Y169 is an aggregation gatekeeper with a twofold role. Mutations related to 3 human prion diseases are interpreted on the basis of the gatekeeper role in the monomeric state. Another potential role of the Y169 side chain is the stabilization of the ordered aggregates, i.e., reduction of frangibility of filamentous protofibrils and fibrils, which is likely to reduce the generation of toxic species.
Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.
Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg
2017-06-19
Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Infectivity-associated PrP(Sc) and disease duration-associated PrP(Sc) of mouse BSE prions.
Miyazawa, Kohtaro; Okada, Hiroyuki; Masujin, Kentaro; Iwamaru, Yoshifumi; Yokoyama, Takashi
2015-01-01
Disease-related prion protein (PrP(Sc)), which is a structural isoform of the host-encoded cellular prion protein, is thought to be a causative agent of transmissible spongiform encephalopathies. However, the specific role of PrP(Sc) in prion pathogenesis and its relationship to infectivity remain controversial. A time-course study of prion-affected mice was conducted, which showed that the prion infectivity was not simply proportional to the amount of PrP(Sc) in the brain. Centrifugation (20,000 ×g) of the brain homogenate showed that most of the PrP(Sc) was precipitated into the pellet, and the supernatant contained only a slight amount of PrP(Sc). Interestingly, mice inoculated with the obtained supernatant showed incubation periods that were approximately 15 d longer than those of mice inoculated with the crude homogenate even though both inocula contained almost the same infectivity. Our results suggest that a small population of fine PrP(Sc) may be responsible for prion infectivity and that large, aggregated PrP(Sc) may contribute to determining prion disease duration.
Hsp40s specify functions of Hsp104 and Hsp90 protein chaperone machines.
Directory of Open Access Journals (Sweden)
Michael Reidy
2014-10-01
Full Text Available Hsp100 family chaperones of microorganisms and plants cooperate with the Hsp70/Hsp40/NEF system to resolubilize and reactivate stress-denatured proteins. In yeast this machinery also promotes propagation of prions by fragmenting prion polymers. We previously showed the bacterial Hsp100 machinery cooperates with the yeast Hsp40 Ydj1 to support yeast thermotolerance and with the yeast Hsp40 Sis1 to propagate [PSI+] prions. Here we find these Hsp40s similarly directed specific activities of the yeast Hsp104-based machinery. By assessing the ability of Ydj1-Sis1 hybrid proteins to complement Ydj1 and Sis1 functions we show their C-terminal substrate-binding domains determined distinctions in these and other cellular functions of Ydj1 and Sis1. We find propagation of [URE3] prions was acutely sensitive to alterations in Sis1 activity, while that of [PIN+] prions was less sensitive than [URE3], but more sensitive than [PSI+]. These findings support the ideas that overexpressing Ydj1 cures [URE3] by competing with Sis1 for interaction with the Hsp104-based disaggregation machine, and that different prions rely differently on activity of this machinery, which can explain the various ways they respond to alterations in chaperone function.
Modulation of prion polymerization and toxicity by rationally designed peptidomimetics.
Srivastava, Ankit; Sharma, Sakshi; Sadanandan, Sandhya; Gupta, Sakshi; Singh, Jasdeep; Gupta, Sarika; Haridas, V; Kundu, Bishwajit
2017-01-01
Misfolding and aggregation of cellular prion protein is associated with a large array of neurological disorders commonly called the transmissible spongiform encephalopathies. Designing inhibitors against prions has remained a daunting task owing to limited information about mechanism(s) of their pathogenic self-assembly. Here, we explore the anti-prion properties of a combinatorial library of bispidine-based peptidomimetics (BPMs) that conjugate amino acids with hydrophobic and aromatic side chains. Keeping the bispidine unit unaltered, a series of structurally diverse BPMs were synthesized and tested for their prion-modulating properties. Administration of Leu- and Trp-BPMs delayed and completely inhibited the amyloidogenic conversion of human prion protein (HuPrP), respectively. We found that each BPM induced the HuPrP to form unique oligomeric nanostructures differing in their biophysical properties, cellular toxicities and response to conformation-specific antibodies. While Leu-BPMs were found to stabilize the oligomers, Trp-BPMs effected transient oligomerization, resulting in the formation of non-toxic, non-fibrillar aggregates. Yet another aromatic residue, Phe, however, accelerated the aggregation process in HuPrP. Molecular insights obtained through MD (molecular dynamics) simulations suggested that each BPM differently engages a conserved Tyr 169 residue at the α2-β2 loop of HuPrP and affects the stability of α2 and α3 helices. Our results demonstrate that this new class of molecules having chemical scaffolds conjugating hydrophobic/aromatic residues could effectively modulate prion aggregation and toxicity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Incunabular Immunological Events in Prion Trafficking
Michel, Brady; Meyerett-Reid, Crystal; Johnson, Theodore; Ferguson, Adam; Wyckoff, Christy; Pulford, Bruce; Bender, Heather; Avery, Anne; Telling, Glenn; Dow, Steven; Zabel, Mark D.
2012-01-01
While prions probably interact with the innate immune system immediately following infection, little is known about this initial confrontation. Here we investigated incunabular events in lymphotropic and intranodal prion trafficking by following highly enriched, fluorescent prions from infection sites to draining lymph nodes. We detected biphasic lymphotropic transport of prions from the initial entry site upon peripheral prion inoculation. Prions arrived in draining lymph nodes cell autonomously within two hours of intraperitoneal administration. Monocytes and dendritic cells (DCs) required Complement for optimal prion delivery to lymph nodes hours later in a second wave of prion trafficking. B cells constituted the majority of prion-bearing cells in the mediastinal lymph node by six hours, indicating intranodal prion reception from resident DCs or subcapsulary sinus macrophages or directly from follicular conduits. These data reveal novel, cell autonomous prion lymphotropism, and a prominent role for B cells in intranodal prion movement. PMID:22679554
Cholesterol Balance in Prion Diseases and Alzheimer’s Disease
Hannaoui, Samia; Shim, Su Yeon; Cheng, Yo Ching; Corda, Erica; Gilch, Sabine
2014-01-01
Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI) anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD): whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD. PMID:25419621
Cholesterol Balance in Prion Diseases and Alzheimer’s Disease
Directory of Open Access Journals (Sweden)
Samia Hannaoui
2014-11-01
Full Text Available Prion diseases are transmissible and fatal neurodegenerative disorders of humans and animals. They are characterized by the accumulation of PrPSc, an aberrantly folded isoform of the cellular prion protein PrPC, in the brains of affected individuals. PrPC is a cell surface glycoprotein attached to the outer leaflet of the plasma membrane by a glycosyl-phosphatidyl-inositol (GPI anchor. Specifically, it is associated with lipid rafts, membrane microdomains enriched in cholesterol and sphinoglipids. It has been established that inhibition of endogenous cholesterol synthesis disturbs lipid raft association of PrPC and prevents PrPSc accumulation in neuronal cells. Additionally, prion conversion is reduced upon interference with cellular cholesterol uptake, endosomal export, or complexation at the plasma membrane. Altogether, these results demonstrate on the one hand the importance of cholesterol for prion propagation. On the other hand, growing evidence suggests that prion infection modulates neuronal cholesterol metabolism. Similar results were reported in Alzheimer’s disease (AD: whereas amyloid β peptide formation is influenced by cellular cholesterol, levels of cholesterol in the brains of affected individuals increase during the clinical course of the disease. In this review, we summarize commonalities of alterations in cholesterol homeostasis and discuss consequences for neuronal function and therapy of prion diseases and AD.
How do PrPSc Prions Spread between Host Species, and within Hosts?
Directory of Open Access Journals (Sweden)
Neil A. Mabbott
2017-11-01
Full Text Available Prion diseases are sub-acute neurodegenerative diseases that affect humans and some domestic and free-ranging animals. Infectious prion agents are considered to comprise solely of abnormally folded isoforms of the cellular prion protein known as PrPSc. Pathology during prion disease is restricted to the central nervous system where it causes extensive neurodegeneration and ultimately leads to the death of the host. The first half of this review provides a thorough account of our understanding of the various ways in which PrPSc prions may spread between individuals within a population, both horizontally and vertically. Many natural prion diseases are acquired peripherally, such as by oral exposure, lesions to skin or mucous membranes, and possibly also via the nasal cavity. Following peripheral exposure, some prions accumulate to high levels within the secondary lymphoid organs as they make their journey from the site of infection to the brain, a process termed neuroinvasion. The replication of PrPSc prions within secondary lymphoid organs is important for their efficient spread to the brain. The second half of this review describes the key tissues, cells and molecules which are involved in the propagation of PrPSc prions from peripheral sites of exposure (such as the lumen of the intestine to the brain. This section also considers how additional factors such as inflammation and aging might influence prion disease susceptibility.
Previous investigations aimed at determining whether the mammalian prion protein actually facilitates tangible molecular aspects of either a discrete or pleiotropic functional niche have been debated, especially given the apparent absence of overt behavioral or physiological phenotypes associated wi...
The dual role of fragments in fragment-assembly methods for de novo protein structure prediction
Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.
2013-01-01
In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594
The expanding universe of prion diseases.
Directory of Open Access Journals (Sweden)
2006-03-01
Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases-including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep-have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
The expanding universe of prion diseases.
Directory of Open Access Journals (Sweden)
Joel C Watts
2006-03-01
Full Text Available Prions cause fatal and transmissible neurodegenerative disease. These etiological infectious agents are formed in greater part from a misfolded cell-surface protein called PrP(C. Several mammalian species are affected by the diseases, and in the case of "mad cow disease" (BSE the agent has a tropism for humans, with negative consequences for agribusiness and public health. Unfortunately, the known universe of prion diseases is expanding. At least four novel prion diseases--including human diseases variant Creutzfeldt-Jakob disease (vCJD and sporadic fatal insomnia (sFI, bovine amyloidotic spongiform encephalopathy (BASE, and Nor98 of sheep--have been identified in the last ten years, and chronic wasting disease (CWD of North American deer (Odocoileus Specis and Rocky Mountain elk (Cervus elaphus nelsoni is undergoing a dramatic spread across North America. While amplification (BSE and dissemination (CWD, commercial sourcing of cervids from the wild and movement of farmed elk can be attributed to human activity, the origins of emergent prion diseases cannot always be laid at the door of humankind. Instead, the continued appearance of new outbreaks in the form of "sporadic" disease may be an inevitable outcome in a situation where the replicating pathogen is host-encoded.
PrP(Sc-specific antibodies with the ability to immunodetect prion oligomers.
Directory of Open Access Journals (Sweden)
Mourad Tayebi
Full Text Available The development of antibodies with binding capacity towards soluble oligomeric forms of PrPSc recognised in the aggregation process in early stage of the disease would be of paramount importance in diagnosing prion diseases before extensive neuropathology has ensued. As blood transfusion appears to be efficient in the transmission of the infectious prion agent, there is an urgent need to develop reagents that would specifically recognize oligomeric forms of the abnormally folded prion protein, PrPSc.To that end, we show that anti-PrP monoclonal antibodies (called PRIOC mAbs derived from mice immunised with native PrP-coated microbeads are able to immunodetect oligomers/multimers of PrPSc. Oligomer-specific immunoreactivity displayed by these PRIOC mAbs was demonstrated as large aggregates of immunoreactive deposits in prion-permissive neuroblastoma cell lines but not in equivalent non-infected or prn-p(0/0 cell lines. In contrast, an anti-monomer PrP antibody displayed diffuse immunoreactivity restricted to the cell membrane. Furthermore, our PRIOC mAbs did not display any binding with monomeric recombinant and cellular prion proteins but strongly detected PrPSc oligomers as shown by a newly developed sensitive and specific ELISA. Finally, PrioC antibodies were also able to bind soluble oligomers formed of Aβ and α-synuclein. These findings demonstrate the potential use of anti-prion antibodies that bind PrPSc oligomers, recognised in early stage of the disease, for the diagnosis of prion diseases in blood and other body fluids.
Directory of Open Access Journals (Sweden)
Irantzu ePallares
2016-01-01
Full Text Available Prion-like proteins can switch between a soluble intrinsically disordered conformation and a highly ordered amyloid assembly. This conformational promiscuity is encoded in specific sequence regions, known as prion domains (PrDs. Prions are best known as the causative factors of neurological diseases in mammals. However, bioinformatics analyses reveal that proteins bearing PrDs are present in all kingdoms of life, including bacteria, thus supporting the idea that they serve conserved beneficial cellular functions. Despite the proportion of predicted prion-like proteins in bacterial proteomes is generally low, pathogenic species seem to have a higher prionic load, suggesting that these malleable proteins may favor pathogenic traits. In the present work, we performed a stringent computational analysis of the Clostridium botulinum pathogen proteome in the search for prion-like proteins. A total of 54 candidates were predicted for this anaerobic bacterium, including the transcription termination Rho factor. This RNA-binding protein has been shown to play a crucial role in bacterial adaptation to changing environments. We show here that the predicted disordered PrD domain of this RNA-binding protein contains an inner, highly polar, asparagine-rich short sequence able to spontaneously self-assemble into amyloid-like structures, bearing thus the potential to induce a Rho factor conformational switch that might rewire gene expression in response to environmental conditions.
PrP Knockout Cells Expressing Transmembrane PrP Resist Prion Infection.
Marshall, Karen E; Hughson, Andrew; Vascellari, Sarah; Priola, Suzette A; Sakudo, Akikazu; Onodera, Takashi; Baron, Gerald S
2017-01-15
Glycosylphosphatidylinositol (GPI) anchoring of the prion protein (PrP C ) influences PrP C misfolding into the disease-associated isoform, PrP res , as well as prion propagation and infectivity. GPI proteins are found in cholesterol- and sphingolipid-rich membrane regions called rafts. Exchanging the GPI anchor for a nonraft transmembrane sequence redirects PrP C away from rafts. Previous studies showed that nonraft transmembrane PrP C variants resist conversion to PrP res when transfected into scrapie-infected N2a neuroblastoma cells, likely due to segregation of transmembrane PrP C and GPI-anchored PrP res in distinct membrane environments. Thus, it remained unclear whether transmembrane PrP C might convert to PrP res if seeded by an exogenous source of PrP res not associated with host cell rafts and without the potential influence of endogenous expression of GPI-anchored PrP C To further explore these questions, constructs containing either a C-terminal wild-type GPI anchor signal sequence or a nonraft transmembrane sequence containing a flexible linker were expressed in a cell line derived from PrP knockout hippocampal neurons, NpL2. NpL2 cells have physiological similarities to primary neurons, representing a novel and advantageous model for studying transmissible spongiform encephalopathy (TSE) infection. Cells were infected with inocula from multiple prion strains and in different biochemical states (i.e., membrane bound as in brain microsomes from wild-type mice or purified GPI-anchorless amyloid fibrils). Only GPI-anchored PrP C supported persistent PrP res propagation. Our data provide strong evidence that in cell culture GPI anchor-directed membrane association of PrP C is required for persistent PrP res propagation, implicating raft microdomains as a location for conversion. Mechanisms of prion propagation, and what makes them transmissible, are poorly understood. Glycosylphosphatidylinositol (GPI) membrane anchoring of the prion protein (PrP C
Advancing prion science: guidance for the National Prion Research Program
National Research Council Canada - National Science Library
Erdtmann, Rick; Sivitz, Laura
2004-01-01
...€™s National Prion Research Program (NPRP). Transmissible spongiform encephalopathies (TSEs), also called prion diseases, are invariably fatal neurodegenerative infectious diseases that include bovine spongiform encephalopathy...
Jansen, Casper; Voet, Willem; Head, Mark W.; Parchi, Piero; Yull, Helen; Verrips, Aad; Wesseling, Pieter; Meulstee, Jan; Baas, Frank; van Gool, Willem A.; Ironside, James W.; Rozemuller, Annemieke J. M.
2011-01-01
Human prion diseases can be sporadic, inherited or acquired by infection and show considerable phenotypic heterogeneity. We describe the clinical, histopathological and pathological prion protein (PrP(Sc)) characteristics of a Dutch family with a novel 7-octapeptide repeat insertion (7-OPRI) in
Directory of Open Access Journals (Sweden)
Silvio Notari
2010-01-01
Full Text Available Variant Creutzfeldt-Jakob disease (vCJD is a prion disease thought to be acquired by the consumption of prion-contaminated beef products. To date, over 200 cases have been identified around the world, but mainly in the United Kingdom. Three cases have been identified in the United States; however, these subjects were likely exposed to prion infection elsewhere. Here we report on the first of these subjects.Neuropathological and genetic examinations were carried out using standard procedures. We assessed the presence and characteristics of protease-resistant prion protein (PrP(res in brain and 23 other organs and tissues using immunoblots performed directly on total homogenate or following sodium phosphotungstate precipitation to increase PrP(res detectability. The brain showed a lack of typical spongiform degeneration and had large plaques, likely stemming from the extensive neuronal loss caused by the long duration (32 months of the disease. The PrP(res found in the brain had the typical characteristics of the PrP(res present in vCJD. In addition to the brain and other organs known to be prion positive in vCJD, such as the lymphoreticular system, pituitary and adrenal glands, and gastrointestinal tract, PrP(res was also detected for the first time in the dura mater, liver, pancreas, kidney, ovary, uterus, and skin.Our results indicate that the number of organs affected in vCJD is greater than previously realized and further underscore the risk of iatrogenic transmission in vCJD.
Signal Transduction by a Fungal NOD-Like Receptor Based on Propagation of a Prion Amyloid Fold
Daskalov, A.; Habenstein, B.; Martinez, D.; Debets, A.J.M.; Sabate, R.; Loquet, A.; Saupe, S.J.
2015-01-01
In the fungus Podospora anserina, the [Het-s] prion induces programmed cell death by activating the HET-S pore-forming protein. The HET-s ß-solenoid prion fold serves as a template for converting the HET-S prion-forming domain into the same fold. This conversion, in turn, activates the HET-S
Hsp70/Hsp90 organising protein (hop): beyond interactions with chaperones and prion proteins.
Baindur-Hudson, Swati; Edkins, Adrienne L; Blatch, Gregory L
2015-01-01
The Hsp70/Hsp90 organising protein (Hop), also known as stress-inducible protein 1 (STI1), has received considerable attention for diverse cellular functions in both healthy and diseased states. There is extensive evidence that intracellular Hop is a co-chaperone of the major chaperones Hsp70 and Hsp90, playing an important role in the productive folding of Hsp90 client proteins. Consequently, Hop is implicated in a number of key signalling pathways, including aberrant pathways leading to cancer. However, Hop is also secreted and it is now well established that Hop also serves as a receptor for the prion protein, PrP(C). The intracellular and extracellular forms of Hop most likely represent two different isoforms, although the molecular determinants of these divergent functions are yet to be identified. There is also a growing body of research that reports the involvement of Hop in cellular activities that appear independent of either chaperones or PrP(C). While Hop has been shown to have various cellular functions, its biological function remains elusive. However, recent knockout studies in mammals suggest that Hop has an important role in embryonic development. This review provides a critical overview of the latest molecular, cellular and biological research on Hop, critically evaluating its function in healthy systems and how this function is adapted in diseases states.
A probabilistic fragment-based protein structure prediction algorithm.
Directory of Open Access Journals (Sweden)
David Simoncini
Full Text Available Conformational sampling is one of the bottlenecks in fragment-based protein structure prediction approaches. They generally start with a coarse-grained optimization where mainchain atoms and centroids of side chains are considered, followed by a fine-grained optimization with an all-atom representation of proteins. It is during this coarse-grained phase that fragment-based methods sample intensely the conformational space. If the native-like region is sampled more, the accuracy of the final all-atom predictions may be improved accordingly. In this work we present EdaFold, a new method for fragment-based protein structure prediction based on an Estimation of Distribution Algorithm. Fragment-based approaches build protein models by assembling short fragments from known protein structures. Whereas the probability mass functions over the fragment libraries are uniform in the usual case, we propose an algorithm that learns from previously generated decoys and steers the search toward native-like regions. A comparison with Rosetta AbInitio protocol shows that EdaFold is able to generate models with lower energies and to enhance the percentage of near-native coarse-grained decoys on a benchmark of [Formula: see text] proteins. The best coarse-grained models produced by both methods were refined into all-atom models and used in molecular replacement. All atom decoys produced out of EdaFold's decoy set reach high enough accuracy to solve the crystallographic phase problem by molecular replacement for some test proteins. EdaFold showed a higher success rate in molecular replacement when compared to Rosetta. Our study suggests that improving low resolution coarse-grained decoys allows computational methods to avoid subsequent sampling issues during all-atom refinement and to produce better all-atom models. EdaFold can be downloaded from http://www.riken.jp/zhangiru/software.html [corrected].
Honda, Ryo
2018-04-12
Transmissible spongiform encephalopathy is associated with misfolding of prion protein (PrP) into an amyloid β-rich aggregate. Previous studies have indicated that PrP interacts with Alzheimer's disease amyloid-β peptide (Aβ), but it remains elusive how this interaction impacts on the misfolding of PrP. This study presents the first in vitro evidence that Aβ induces PrP-amyloid formation at submicromolar concentrations. Interestingly, systematic mutagenesis of PrP revealed that Aβ requires no specific amino acid sequences in PrP, and induces the misfolding of other unrelated proteins (insulin and lysozyme) into amyloid fibrils in a manner analogous to PrP. This unanticipated nonspecific amyloidogenic effect of Aβ indicates that this peptide might be involved in widespread protein aggregation, regardless of the amino acid sequences of target proteins, and exacerbate the pathology of many neurodegenerative diseases. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J
2015-05-15
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.
Natural and synthetic prion structure from X-ray fiber diffraction
Energy Technology Data Exchange (ETDEWEB)
Wille, Holger; Bian, Wen; McDonald, Michele; Kendall, Amy; Colby, David W.; Bloch, Lillian; Ollesch, Julian; Borovinskiy, Alexander L.; Cohen, Fred E.; Prusiner, Stanley B.; Stubbs, Gerald; (Vanderbilt); (UCSF)
2009-10-21
A conformational isoform of the mammalian prion protein (PrP{sup Sc}) is the sole component of the infectious pathogen that causes the prion diseases. We have obtained X-ray fiber diffraction patterns from infectious prions that show cross-{beta} diffraction: meridional intensity at 4.8 {angstrom} resolution, indicating the presence of {beta} strands running approximately at right angles to the filament axis and characteristic of amyloid structure. Some of the patterns also indicated the presence of a repeating unit along the fiber axis, corresponding to four {beta}-strands. We found that recombinant (rec) PrP amyloid differs substantially from highly infectious brain-derived prions, both in structure as demonstrated by the diffraction data, and in heterogeneity as shown by electron microscopy. In addition to the strong 4.8 {angstrom} meridional reflection, the recPrP amyloid diffraction is characterized by strong equatorial intensity at approximately 10.5 {angstrom}, absent from brain-derived prions, and indicating the presence of stacked {beta}-sheets. Synthetic prions recovered from transgenic mice inoculated with recPrP amyloid displayed structural characteristics and homogeneity similar to those of naturally occurring prions. The relationship between the structural differences and prion infectivity is uncertain, but might be explained by any of several hypotheses: only a minority of recPrP amyloid possesses a replication-competent conformation, the majority of recPrP amyloid has to undergo a conformational maturation to acquire replication competency, or inhibitory forms of recPrP amyloid interfere with replication during the initial transmission.
Okada, Hiroyuki; Masujin, Kentaro; Miyazawa, Kohtaro; Iwamaru, Yoshihumi; Imamura, Morikazu; Matsuura, Yuichi; Arai, Shozo; Fukuda, Shigeo; Murayama, Yuichi; Yokoyama, Takashi
2017-11-01
H-type bovine spongiform encephalopathy (H-BSE) is an atypical form of BSE in cattle. During passaging of H-BSE in transgenic bovinized (TgBoPrP) mice, a novel phenotype of BSE, termed BSE-SW emerged and was characterized by a short incubation time and host weight loss. To investigate the biological and biochemical properties of the BSE-SW prion, a transmission study was conducted in cattle, which were inoculated intracerebrally with brain homogenate from BSE-SW-infected TgBoPrP mice. The disease incubation period was approximately 15 months. The animals showed characteristic neurological signs of dullness, and severe spongiform changes and a widespread, uniform distribution of disease-associated prion protein (PrP Sc ) were observed throughout the brain of infected cattle. Immunohistochemical PrP Sc staining of the brain revealed the presence of intraglial accumulations and plaque-like deposits. No remarkable differences were identified in vacuolar lesion scores, topographical distribution patterns, and staining types of PrP Sc in the brains of BSE-SW- vs H-BSE-infected cattle. PrP Sc deposition was detected in the ganglia, vagus nerve, spinal nerve, cauda equina, adrenal medulla, and ocular muscle. Western blot analysis revealed that the specific biochemical properties of the BSE-SW prion, with an additional 10- to 12-kDa fragment, were well maintained after transmission. These findings indicated that the BSE-SW prion has biochemical properties distinct from those of H-BSE in cattle, although clinical and pathologic features of BSW-SW in cattle are indistinguishable from those of H-BSE. The results suggest that the 2 infectious agents, BSE-SW and H-BSE, are closely related strains.
Directory of Open Access Journals (Sweden)
Lewis Victoria
2012-04-01
Full Text Available Abstract Background Prion disease transmission and pathogenesis are linked to misfolded, typically protease resistant (PrPres conformers of the normal cellular prion protein (PrPC, with the former posited to be the principal constituent of the infectious 'prion'. Unexplained discrepancies observed between detectable PrPres and infectivity levels exemplify the complexity in deciphering the exact biophysical nature of prions and those host cell factors, if any, which contribute to transmission efficiency. In order to improve our understanding of these important issues, this study utilized a bioassay validated cell culture model of prion infection to investigate discordance between PrPres levels and infectivity titres at a subcellular resolution. Findings Subcellular fractions enriched in lipid rafts or endoplasmic reticulum/mitochondrial marker proteins were equally highly efficient at prion transmission, despite lipid raft fractions containing up to eight times the levels of detectable PrPres. Brain homogenate infectivity was not differentially enhanced by subcellular fraction-specific co-factors, and proteinase K pre-treatment of selected fractions modestly, but equally reduced infectivity. Only lipid raft associated infectivity was enhanced by sonication. Conclusions This study authenticates a subcellular disparity in PrPres and infectivity levels, and eliminates simultaneous divergence of prion strains as the explanation for this phenomenon. On balance, the results align best with the concept that transmission efficiency is influenced more by intrinsic characteristics of the infectious prion, rather than cellular microenvironment conditions or absolute PrPres levels.
Secretion of intact proteins and peptide fragments by lysosomal pathways of protein degradation
International Nuclear Information System (INIS)
Isenman, L.D.; Dice, J.F.
1989-01-01
We report that degradation of proteins microinjected into human fibroblasts is accompanied by release into the culture medium of peptide fragments and intact proteins as well as single amino acids. For the nine proteins and polypeptides microinjected, acid-precipitable radioactivity, i.e. peptide fragments and/or intact proteins, ranged from 10 to 67% of the total released radioactivity. Peptide fragments and/or intact protein accounted for 60% of the radioactivity released into the medium by cells microinjected with ribonuclease A. Two major radiolabeled peptide fragments were found, and one was of an appropriate size to function as an antigen in antigen-presenting cells. The peptides released from microinjected ribonuclease A were derived from lysosomal pathways of proteolysis based on several lines of evidence. Previous studies have shown that microinjected ribonuclease A is degraded to single amino acids entirely within lysosomes. We show that release of free amino acids and peptide fragments and/or intact protein was equivalently stimulated by serum deprivation and equivalently inhibited by NH4Cl. We also show that lysosomal degradation of endocytosed [3H]ribonuclease A was accompanied by the release of two peptide fragments similar in size and charge to those from microinjected [ 3 H]ribonuclease A. These findings demonstrate that degradation within lysosomes occurs in a manner that spares specific peptides; they also suggest a previously unsuspected pathway by which cells can secrete cytosol-derived polypeptides
Directory of Open Access Journals (Sweden)
Yuzuru Taguchi
Full Text Available Prion diseases are fatal infectious neurodegenerative disorders in man and animals associated with the accumulation of the pathogenic isoform PrP(Sc of the host-encoded prion protein (PrP(c. A profound conformational change of PrP(c underlies formation of PrP(Sc and prion propagation involves conversion of PrP(c substrate by direct interaction with PrP(Sc template. Identifying the interfaces and modalities of inter-molecular interactions of PrPs will highly advance our understanding of prion propagation in particular and of prion-like mechanisms in general. To identify the region critical for inter-molecular interactions of PrP, we exploited here dominant-negative inhibition (DNI effects of conversion-incompetent, internally-deleted PrP (ΔPrP on co-expressed conversion-competent PrP. We created a series of ΔPrPs with different lengths of deletions in the region between first and second α-helix (H1∼H2 which was recently postulated to be of importance in prion species barrier and PrP fibril formation. As previously reported, ΔPrPs uniformly exhibited aberrant properties including detergent insolubility, limited protease digestion resistance, high-mannose type N-linked glycans, and intracellular localization. Although formerly controversial, we demonstrate here that ΔPrPs have a GPI anchor attached. Surprisingly, despite very similar biochemical and cell-biological properties, DNI efficiencies of ΔPrPs varied significantly, dependant on location and inversely correlated with the size of deletion. This data demonstrates that H1∼H2 and the region C-terminal to it are critically important for efficient DNI. It also suggests that this region is involved in PrP-PrP interaction and conversion of PrP(C into PrP(Sc. To reconcile the paradox of how an intracellular PrP can exert DNI, we demonstrate that ΔPrPs are subject to both proteasomal and lysosomal/autophagic degradation pathways. Using autophagy pathways ΔPrPs obtain access to the locale
Investigating the conformational stability of prion strains through a kinetic replication model.
Directory of Open Access Journals (Sweden)
Mattia Zampieri
2009-07-01
Full Text Available Prion proteins are known to misfold into a range of different aggregated forms, showing different phenotypic and pathological states. Understanding strain specificities is an important problem in the field of prion disease. Little is known about which PrP(Sc structural properties and molecular mechanisms determine prion replication, disease progression and strain phenotype. The aim of this work is to investigate, through a mathematical model, how the structural stability of different aggregated forms can influence the kinetics of prion replication. The model-based results suggest that prion strains with different conformational stability undergoing in vivo replication are characterizable in primis by means of different rates of breakage. A further role seems to be played by the aggregation rate (i.e. the rate at which a prion fibril grows. The kinetic variability introduced in the model by these two parameters allows us to reproduce the different characteristic features of the various strains (e.g., fibrils' mean length and is coherent with all experimental observations concerning strain-specific behavior.
Kabani, Mehdi; Melki, Ronald
2016-05-01
In the yeast Saccharomyces cerevisiae, an ensemble of structurally and functionally diverse cytoplasmic proteins has the ability to form self-perpetuating protein aggregates (e.g. prions) which are the vectors of heritable non-Mendelian phenotypic traits. Whether harboring these prions is deleterious-akin to mammalian degenerative disorders-or beneficial-as epigenetic modifiers of gene expression-for yeasts has been intensely debated and strong arguments were made in support of both views. We recently reported that the yeast prion protein Sup35p is exported via extracellular vesicles (EV), both in its soluble and aggregated infectious states. Herein, we discuss the possible implications of this observation and propose several hypotheses regarding the roles of EV in both vertical and horizontal propagation of 'good' and 'bad' yeast prions.
Directory of Open Access Journals (Sweden)
James B Stanton
Full Text Available Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C to disease-associated prion protein (PrP(Sc. Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772, which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ and Rov9 cultures (VRQ-ovinized RK13 cells. We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C expression is not the mechanism of PrP(Sc inhibition. PrP(Sc accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc activity was independent of anti-pestivirus activity. The anti-PrP(Sc selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.
Didonna, Alessandro; Vaccari, Lisa; Bek, Alpan; Legname, Giuseppe
2011-03-16
Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrP(Sc)) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrP(C), into nascent PrP(Sc). The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level.
2011-01-01
Prion diseases are a group of fatal neurodegenerative disorders characterized by the accumulation of prions in the central nervous system. The pathogenic prion (PrPSc) possesses the capability to convert the host-encoded cellular isoform of the prion protein, PrPC, into nascent PrPSc. The present work aims at providing novel insight into cellular response upon prion infection evidenced by synchrotron radiation infrared microspectroscopy (SR-IRMS). This non-invasive, label-free analytical technique was employed to investigate the biochemical perturbations undergone by prion infected mouse hypothalamic GT1-1 cells at the cellular and subcellular level. A decrement in total cellular protein content upon prion infection was identified by infrared (IR) whole-cell spectra and validated by bicinchoninic acid assay and single-cell volume analysis by atomic force microscopy (AFM). Hierarchical cluster analysis (HCA) of IR data discriminated between infected and uninfected cells and allowed to deduce an increment of lysosomal bodies within the cytoplasm of infected GT1-1 cells, a hypothesis further confirmed by SR-IRMS at subcellular spatial resolution and fluorescent microscopy. The purpose of this work, therefore, consists of proposing IRMS as a powerful multiscreening platform, drawing on the synergy with conventional biological assays and microscopy techniques in order to increase the accuracy of investigations performed at the single-cell level. PMID:22778865
Neuroinflammation in Alzheimer's disease and prion disease
Eikelenboom, P.; Bate, C.; van Gool, W. A.; Hoozemans, J. J. M.; Rozemuller, J. M.; Veerhuis, R.; Williams, A.
2002-01-01
Alzheimer's disease (AD) and prion disease are characterized neuropathologically by extracellular deposits of Abeta and PrP amyloid fibrils, respectively. In both disorders, these cerebral amyloid deposits are co-localized with a broad variety of inflammation-related proteins (complement factors,
Residue preference mapping of ligand fragments in the Protein Data Bank.
Wang, Lirong; Xie, Zhaojun; Wipf, Peter; Xie, Xiang-Qun
2011-04-25
The interaction between small molecules and proteins is one of the major concerns for structure-based drug design because the principles of protein-ligand interactions and molecular recognition are not thoroughly understood. Fortunately, the analysis of protein-ligand complexes in the Protein Data Bank (PDB) enables unprecedented possibilities for new insights. Herein, we applied molecule-fragmentation algorithms to split the ligands extracted from PDB crystal structures into small fragments