WorldWideScience

Sample records for print copy 273-winter

  1. Late Print Culture’s Social Media Revolution: Authorship, Collaboration and Copy Machines

    Directory of Open Access Journals (Sweden)

    Kate Eichhorn

    2013-05-01

    Full Text Available This article examines the impact of copy machines on late twentieth-century print cultures. Specifically, this article makes a case for “dry copying,” the method of print reproduction perfected by Xerox in the late 1950s, as a unique medium rather than a weak imitation of other printing methods. Following the claim that the widespread availability of copy machines in the late twentieth century represented the arrival of a new medium, this article further examines how understandings of authorship, established with print culture, came undone in the era of the copy machine. Finally, this paper makes a case for understanding copy machines as a form of “social media” that opened up opportunities for writers, readers and publishers to create, share, exchange and comment on texts and images in communities and networks of their own making in the decades preceding the development of the web.

  2. The WIMS-E module W-INTER

    International Nuclear Information System (INIS)

    Roth, M.J.

    1982-06-01

    W-INTER is a module of the WIMS-E scheme for neutronics calculations and has three basic functions. These are to write a standard WIMS-E interface from information read from the codeword input, to copy a standard interface and to print or punch the contents of a standard interface. (U.K.)

  3. Copy-Editing: The Cambridge Handbook.

    Science.gov (United States)

    Butcher, Judith

    This handbook is designed as a reference manual for copy editors who prepare typescript for printing. It deals with the following topics: the copy editor's function; the work to be done at each stage in the production process; some difficult points of spelling, capitalization, and other features collectively known as "house style"; the parts of a…

  4. Hard copies for digital medical images: an overview

    Science.gov (United States)

    Blume, Hartwig R.; Muka, Edward

    1995-04-01

    This paper is a condensed version of an invited overview on the technology of film hard-copies used in radiology. Because the overview was given to an essentially nonmedical audience, the reliance on film hard-copies in radiology is outlined in greater detail. The overview is concerned with laser image recorders generating monochrome prints on silver-halide films. The basic components of laser image recorders are sketched. The paper concentrates on the physical parameters - characteristic function, dynamic range, digitization resolution, modulation transfer function, and noise power spectrum - which define image quality and information transfer capability of the printed image. A preliminary approach is presented to compare the printed image quality with noise in the acquired image as well as with the noise of state-of- the-art cathode-ray-tube display systems. High-performance laser-image- recorder/silver-halide-film/light-box systems are well capable of reproducing acquired radiologic information. Most recently development was begun toward a display function standard for soft-copy display systems to facilitate similarity of image presentation between different soft-copy displays as well as between soft- and hard-copy displays. The standard display function is based on perceptional linearization. The standard is briefly reviewed to encourage the printer industry to adopt it, too.

  5. Examining the concentrations of volatile organic compounds and pollutant gases in printing and copying centers in Khorramabad, Iran in 2015

    Directory of Open Access Journals (Sweden)

    Rajab Rashidi

    2016-12-01

    Full Text Available Background : Given the large amount of gaseous and aerosol pollutants produced by the printing press industry, the indoor and outdoor air quality of such centers in Khorramabad, Iran was assessed. Methods and Materials: In a descriptive study, five gaseous pollutants from among criteria air pollutants (CO, NO, NO2, SO2, O3 and volatile organic compounds (VOCs were measured. Overall, 360 samples were taken from the indoor and outdoor air of printing press centers during the two seasons of summer and winter. In addition to the direct reading sampling method, environmental sampling was also conducted. In the direct reading method, the environmental analyzer device was used to measure criteria gaseous pollutants and the phocheck5000 device was used to measure the VOCs. In the sampling by environmental pumps, SKC activated carbon absorbent tubes were used randomly/continuously during the work hours and periodically for all centers. The samples were prepared using a carbon disulfide solution and were analyzed using a gas chromatograph device. Statistical t-tests were used to analyze the results. Results: The results of the study demonstrated that, the concentrations of the all of the criteria pollutants except for the CO gas and, among the VOCs, the concentrations of benzene and toluene in the air of the printing press centers was higher than the standards set by the EPA for indoor areas. Further, there was a significant difference between the concentrations of benzene and toluene during the summer and winder seasons (p<0.05. In all the measurements carried out in summer and winter, the amount of O3 was significantly higher inside the printing press centers than that of outdoor areas (p<0.05. Conclusion: Although printing press centers cannot be considered as serious hotspots for the emission of pollutants into public places in urban areas, the pollutants produced in these centers, especially O3 can jeopardize the health of the employees of these

  6. Medieval and Renaissance anatomists: the printing and unauthorized copying of illustrations, and the dissemination of ideas.

    Science.gov (United States)

    Lanska, Douglas J; Lanska, John Robert

    2013-01-01

    The vanguard that began to question Galenic anatomical dogma originated in northern Italy in the latter half of the thirteenth century, and not coincidentally this was where human dissection was introduced, which in turn eventually fostered the origins of realistic anatomical illustration in the late fifteenth century. With the advent of the printing press and moveable type at this time, printed books began to supersede hand-copied medieval manuscripts, and labor-intensive techniques were soon developed to integrate text and illustrations on the printed page. The same technology was used to pirate the illustrations of prior authors with varying fidelity. Specific medieval and Renaissance anatomical illustrations can often be traced from their inceptions through different stages of development to the final printed images, and then through subsequent pirated versions in various abridgements or other compendia. The most important milestone in the development of anatomy and anatomical illustration was the publication in 1543 by Andreas Vesalii of De humani corporis fabrica (On the Fabric of the Human Body), commonly referred to simply as the Fabrica. With this work, Vesalii succeeded in coordinating a publication production team (author, artists, block cutters, publisher, and typesetters) to achieve an unprecedented integration of scientific discourse, medical illustration, and typography. However, despite Vesalii's valiant efforts to prevent unauthorized duplication, the illustrations from the Fabrica were extensively plagiarized. Although Vesalii found such piracy frustrating and annoying, the long-term effect was to make Vesalii's ideas known to a wider readership and to help solidify his own revolutionary contributions to anatomy. © 2013 Elsevier B.V. All rights reserved.

  7. 48 CFR 1552.208-70 - Printing.

    Science.gov (United States)

    2010-10-01

    ...” (or “camera-ready copy”) is a final document suitable for printing/duplication. “Desktop Publishing... from desktop publishing is being sent to a typesetting device (i.e., Linotronic) with camera copy being... preparing related illustrative material to a final document (camera-ready copy) using desktop publishing. (2...

  8. 78 FR 22795 - EPAAR Clause for Printing

    Science.gov (United States)

    2013-04-17

    ... printing/duplication. ``Desktop Publishing'' is a method of composition using computers with the final... considered ``printing.'' However, if the output from desktop publishing is being sent to a typesetting device... preparing related illustrative material to a final document (camera-ready copy) using desktop publishing. (2...

  9. 77 FR 60667 - EPAAR Clause for Printing

    Science.gov (United States)

    2012-10-04

    ...'' (or ``camera-ready copy'') is a final document suitable for printing/duplication. ``Desktop Publishing... from desktop publishing is being sent to a typesetting device (i.e., Linotronic) with camera copy being...) using desktop publishing. (2) The contractor may perform a requirement involving the duplication of less...

  10. Modern printers and hard copy devices for documentation in nuclear medicine

    International Nuclear Information System (INIS)

    Mahlstedt, J.

    1987-01-01

    Modern printers in nuclear medicine comprise technologies such as ink jet print, thermo transfer print or electrostatic plotting in combination with a digital processor. For clinical work these machines provide robust light weight copies within a short time thus fulfilling most of the criteria for an ideal documentation. (orig.) [de

  11. The Hegemony of the Copy

    DEFF Research Database (Denmark)

    Graulund, Rune

    2017-01-01

    This essay questions when the creative process leading tothe original can be said to be complete. When does the series of a pupil’sbotched attempts at perfection leading to “the” singular and unique object,text, tool, or artwork we recognise as the original expression of themaster craftsman stop......? Where is the cut-off point between the differentversions (copies) of earlier inferior iterations in the gestation process thatlead to the original, and final, superior original? This essay chiefly examinesthe manner in which text has been copied and stored in one particulartype of object, namely...... that of the book, in order to provide some fairlywell-known arguments regarding pre-mechanical as well as mechanical reproduction.In particular, it examines the differences between manuscriptculture and print culture as we see them expressed in the production (andreproduction) of master copies and subsequent...

  12. Dicty_cDB: SLH273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH273 (Link to dictyBase) - - - Contig-U16280-1 SLH273P (Link to Original site) SLH2...73F 241 SLH273Z 294 SLH273P 535 - - Show SLH273 Library SL (Link to library) Clone ID SLH2... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-D/SLH273Q.Seq.d/ Representative seq. ID SLH2...73P (Link to Original site) Representative DNA sequence >SLH273 (SLH273Q) /CSM/SL/SLH2-D/SLH2...ducing significant alignments: (bits) Value SLH273 (SLH273Q) /CSM/SL/SLH2-D/SLH273Q.Seq.d/ 868 0.0 SSK467 (S

  13. Copyright in Alberta Schools. Information about the Print License with CANCOPY.

    Science.gov (United States)

    Alberta Dept. of Education, Edmonton.

    Issues connected with copyright and the copying of published print materials are discussed in question and answer form for teachers in Alberta (Canada) schools. Twenty-five questions are answered. The Copyright Act gives the copyright owner, usually the author or publisher, the sole right to copy or permit someone to copy his or her work. It also…

  14. Interpolating Spline Curve-Based Perceptual Encryption for 3D Printing Models

    OpenAIRE

    Giao N. Pham; Suk-Hwan Lee; Ki-Ryong Kwon

    2018-01-01

    With the development of 3D printing technology, 3D printing has recently been applied to many areas of life including healthcare and the automotive industry. Due to the benefit of 3D printing, 3D printing models are often attacked by hackers and distributed without agreement from the original providers. Furthermore, certain special models and anti-weapon models in 3D printing must be protected against unauthorized users. Therefore, in order to prevent attacks and illegal copying and to ensure...

  15. 39 CFR 273.10 - Reports.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Reports. 273.10 Section 273.10 Postal Service... REMEDIES ACT § 273.10 Reports. (a) Not later than October 31 of each year, the Postmaster General shall prepare and transmit to the appropriate committees and subcommittees of the Congress an annual report...

  16. Dicty_cDB: VFK273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFK273 (Link to dictyBase) - - - Contig-U16028-1 | Contig-U16311-1 VFK2...73P (Link to Original site) VFK273F 633 VFK273Z 575 VFK273P 1188 - - Show VFK273 Library VF (Link to library) Clone ID VFK2...028-1 | Contig-U16311-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFK2-D/VFK2...73Q.Seq.d/ Representative seq. ID VFK273P (Link to Original site) Representative DNA sequence >VFK273 (VFK2...73Q) /CSM/VF/VFK2-D/VFK273Q.Seq.d/ AAATCTTTATTAATATTTTTCAAAATAAATAAATAAATAAATTAAAAATGAAAGTTTTAT

  17. Erratum: IJSNEM 27(3).

    Science.gov (United States)

    2017-08-01

    The International Journal of Sport Nutrition and Exercise Metabolism 27(3), http://journals.humankinetics.com/toc/ijsnem/27/3 , was incorrectly paginated. The correct page range for this issue is 197-292. The online versions of these articles have been corrected.

  18. Dicty_cDB: VHK273 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHK273 (Link to dictyBase) - - - Contig-U16260-1 - (Link to Original site) VHK2...73F 620 - - - - - - Show VHK273 Library VH (Link to library) Clone ID VHK273 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHK2-D/VHK273Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHK273 (VHK273Q) /CSM/VH/VHK2-D/VHK273Q.Seq.d/ AACTCTCGAGTGCAAAA...27874 ) Dictyostelium discoideum cDNA clone:ddv63k23, 5' ... 1170 0.0 1 ( BJ42787

  19. 40 CFR 273.52 - Waste management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.52 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.52 Waste management. (a) A universal waste transporter must comply with all applicable U.S. Department of...

  20. 7 CFR 273.1 - Household concept.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Household concept. 273.1 Section 273.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM CERTIFICATION OF ELIGIBLE HOUSEHOLDS § 273.1 Household concept...

  1. 40 CFR 273.3 - Applicability-pesticides.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Applicability-pesticides. 273.3... (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.3 Applicability—pesticides. (a) Pesticides covered under this part 273. The requirements of this part apply to persons managing pesticides, as...

  2. 3D Printing of CT Dataset: Validation of an Open Source and Consumer-Available Workflow.

    Science.gov (United States)

    Bortolotto, Chandra; Eshja, Esmeralda; Peroni, Caterina; Orlandi, Matteo A; Bizzotto, Nicola; Poggi, Paolo

    2016-02-01

    The broad availability of cheap three-dimensional (3D) printing equipment has raised the need for a thorough analysis on its effects on clinical accuracy. Our aim is to determine whether the accuracy of 3D printing process is affected by the use of a low-budget workflow based on open source software and consumer's commercially available 3D printers. A group of test objects was scanned with a 64-slice computed tomography (CT) in order to build their 3D copies. CT datasets were elaborated using a software chain based on three free and open source software. Objects were printed out with a commercially available 3D printer. Both the 3D copies and the test objects were measured using a digital professional caliper. Overall, the objects' mean absolute difference between test objects and 3D copies is 0.23 mm and the mean relative difference amounts to 0.55 %. Our results demonstrate that the accuracy of 3D printing process remains high despite the use of a low-budget workflow.

  3. 40 CFR 273.13 - Waste management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.13 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.13 Waste management. (a) Universal waste batteries. A small quantity handler of universal waste must manage...

  4. 40 CFR 273.33 - Waste management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste management. 273.33 Section 273...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.33 Waste management. (a) Universal waste batteries. A large quantity handler of universal waste must manage...

  5. 40 CFR 273.2 - Applicability-batteries.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Applicability-batteries. 273.2 Section...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.2 Applicability—batteries. (a) Batteries covered under 40 CFR part 273. (1) The requirements of this part apply to persons managing batteries, as...

  6. Procurement: Government Printing Office Supply of Microfiche to Libraries Disrupted. Report to the Chairman and Vice Chairman of the Joint Committee on Printing, U.S. Congress.

    Science.gov (United States)

    General Accounting Office, Washington, DC. General Government Div.

    In this report, the General Accounting Office (GAO) responds to a July 8, 1988, inquiry by the Chairman and Vice Chairman of the Joint Committee on Printing about the Government Printing Office's (GPO) efforts to acquire and supply microfiche copies of government documents to approximately 1,400 depository libraries. In August 1987, GPO had…

  7. Inkjet printed ferrite-filled rectangular waveguide X-band isolator

    KAUST Repository

    Farooqui, Muhammad Fahad

    2014-06-01

    For the first time, a rectangular waveguide (RWG) isolator realized through inkjet printing on a ferrite substrate is presented. Yttrium iron garnet (YIG) substrate is used for the realization of the ferrite-filled isolator. Contrary to the substrate integrated waveguide (SIW) approach, all four walls of the waveguide have been inkjet printed on the YIG substrate demonstrating the utility of inkjet printing process for realizing non-planar microwave components. The isolation is achieved by applying an anti-symmetrical DC magnetic bias to the ferrite-filled waveguide which then exhibits a unidirectional mode of operation. The isolator is fed by a microstrip to RWG transition and demonstrates an isolation figure-of-merit (IFM) of more than 51 dB in the operating band from 9.95 GHz to 11.73 GHz with a very high peak IFM of 69 dB. The minimum insertion loss in the operating band is 2.73 dB (including losses from the transitions). The isolator measures 33 mm × 8 mm × 0.4 mm. This work introduces an inkjet printed non-planar microwave device which is easy to fabricate showing the ability of inkjet printing for fabricating complex microwave systems. © 2014 IEEE.

  8. 39 CFR 273.2 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Definitions. 273.2 Section 273.2 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION ADMINISTRATION OF PROGRAM FRAUD CIVIL... representation, certification, affirmation, document, record, or accounting or bookkeeping entry made: (1) With...

  9. 25 CFR 273.53 - Applicable procurement regulations.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Applicable procurement regulations. 273.53 Section 273.53 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT General Contract Requirements § 273.53...

  10. 48 CFR 719.273-6 - Application process.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Application process. 719.273-6 Section 719.273-6 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT...égé Program 719.273-6 Application process. Entities interested in becoming a Mentor firm must...

  11. Flowering time control in European winter wheat

    Directory of Open Access Journals (Sweden)

    Simon Martin Langer

    2014-10-01

    Full Text Available Flowering time is an important trait in wheat breeding as it affects adaptation and yield potential. The aim of this study was to investigate the genetic architecture of flowering time in European winter bread wheat cultivars. To this end a population of 410 winter wheat varieties was evaluated in multi-location field trials and genotyped by a genotyping-by-sequencing approach and candidate gene markers. Our analyses revealed that the photoperiod regulator Ppd-D1 is the major factor affecting flowering time in this germplasm set, explaining 58% of the genotypic variance. Copy number variation at the Ppd-B1 locus was present but explains only 3.2% and thus a comparably small proportion of genotypic variance. By contrast, the plant height loci Rht-B1 and Rht-D1 had no effect on flowering time. The genome-wide scan identified six QTL which each explain only a small proportion of genotypic variance and in addition we identified a number of epistatic QTL, also with small effects. Taken together, our results show that flowering time in European winter bread wheat cultivars is mainly controlled by Ppd-D1 while the fine tuning to local climatic conditions is achieved through Ppd-B1 copy number variation and a larger number of QTL with small effects.

  12. 40 CFR 273.4 - Applicability-Mercury-containing equipment.

    Science.gov (United States)

    2010-07-01

    ... equipment. 273.4 Section 273.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT General § 273.4 Applicability—Mercury...-containing components have been removed. (c) Generation of waste mercury-containing equipment. (1) Used...

  13. An Investigation into the Trueness and Precision of Copy Denture Templates Produced by Rapid Prototyping and Conventional Means.

    Science.gov (United States)

    Davda, K; Osnes, C; Dillon, S; Wu, J; Hyde, P; Keeling, A

    2017-12-01

    To assess the trueness and precision of copy denture templates produced using traditional methods and 3D printing. Six copies of a denture were made using: 1. Conventional technique with silicone putty in an impression tray (CT). 2. Conventional technique with no impression tray (CNT). 3. 3D scanning and printing (3D). Scan trueness and precision was investigated by scanning a denture six times and comparing five scans to the sixth. Then the scans of the six CT, CNT and 3D dentures were compared by aligning, in turn, the copies of each denture to the scanned original. Outcome measures were the mean surface-to-surface distance, standard deviation of that distance and the maximum distance. Student's unpaired t-tests with Bonferroni correction were used to analyse the results. The repeated scans of the original denture showed a scan trueness of 0.013mm (SD 0.002) and precision of 0.013mm (SD 0.002). Trueness: CT templates, 0.168mm (0.047), CNT templates 0.195mm (0.034) and 3D 0.103mm (0.021). Precision: CT templates 0.158mm (0.037), CNT 0.233mm (0.073), 3D 0.090mm (0.017). For each outcome measure the 3D templates demonstrated an improvement which was statistically significant (p⟨0.05). 3D printed copy denture templates reproduced the original with greater trueness and precision than conventional techniques. Copyright© 2017 Dennis Barber Ltd.

  14. 40 CFR 273.36 - Employee training.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Employee training. 273.36 Section 273.36 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED... Employee training. A large quantity handler of universal waste must ensure that all employees are...

  15. 40 CFR 273.16 - Employee training.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Employee training. 273.16 Section 273.16 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED... Employee training. A small quantity handler of universal waste must inform all employees who handle or have...

  16. 48 CFR 852.273-71 - Alternative negotiation techniques.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Alternative negotiation techniques. 852.273-71 Section 852.273-71 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 852.273-71 Alternative negotiation technique...

  17. 39 CFR 273.7 - Concurrence of Attorney General.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Concurrence of Attorney General. 273.7 Section 273... PROGRAM FRAUD CIVIL REMEDIES ACT § 273.7 Concurrence of Attorney General. (a) The Attorney General is... the Attorney General or his designee approves such action in a written statement which specifies: (1...

  18. Implementing traceability using particle randomness-based textile printed tags

    Science.gov (United States)

    Agrawal, T. K.; Koehl, L.; Campagne, C.

    2017-10-01

    This article introduces a random particle-based traceability tag for textiles. The proposed tag not only act as a unique signature for the corresponding textile product but also possess the features such as easy to manufacture and hard to copy. It seeks applications in brand authentication and traceability in textile and clothing (T&C) supply chain. A prototype has been developed by screen printing process, in which micron-scale particles were mixed with the printing paste and printed on cotton fabrics to attain required randomness. To encode the randomness, the image of the developed tag was taken and analyzed using image processing. The randomness of the particles acts as a product key or unique signature which is required to decode the tag. Finally, washing and abrasion resistance tests were conducted to check the durability of the printed tag.

  19. 36 CFR 27.3 - Seashore District.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Seashore District. 27.3 Section 27.3 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR CAPE...' studio, for appropriate small scale home occupations as the making and selling of traditional Cape Cod...

  20. Soft-copy sonography: cost reduction sensitivity analysis in a pediatric hospital.

    Science.gov (United States)

    Don, S; Albertina, M J; Ammann, D

    1998-03-01

    Our objective was to determine whether interpreting sonograms of pediatric patients using soft-copy (computer workstation) instead of laser-printed film could reduce costs for a pediatric radiology department. We used theoretic models of growth to analyze costs. The costs of a sonographic picture archiving and communication system (three interface devices, two workstations, a network server, maintenance expenses, and storage media costs) were compared with the potential savings of eliminating film and increasing technologist efficiency or reducing the number of technologists. The model was based on historic trends and future capitation estimates that will reduce fee-for-service reimbursement. The effects of varying the study volume and reducing technologists' work hours were analyzed. By converting to soft-copy interpretation, we saved 6 min 32 sec per examination by eliminating film processing waiting time, thus reducing examination time from 30 min to 24 min. During an average day of 27 examinations, 176 min were saved. However, 33 min a day were spent retrieving prior studies from long-term storage; thus, 143 extra minutes a day were available for scanning. This improved efficiency could result in five more sonograms a day obtained by converting to soft-copy interpretation, using existing staff and equipment. Alternatively, five examinations a day would equate to one half of a full-time equivalent technologists position. Our analysis of costs considered that the hospital's anticipated growth of sonography and the depreciation of equipment during 5 years resulted in a savings of more than $606,000. Increasing the examinations by just 200 sonograms in the first year and no further growth resulted in a savings of more than $96,000. If the number of sonograms stayed constant, elimination of film printing alone resulted in a loss of approximately $157,000; reduction of one half of a full-time equivalent technologist's position would recuperate approximately $134

  1. 43 CFR 27.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discrimination prohibited. 27.3 Section 27... ISSUED UNDER TITLE II OF PUBLIC LAW 93-153 § 27.3 Discrimination prohibited. (a) General. No person shall... through contractual or other arrangements, subject an individual to discrimination on the grounds of race...

  2. Evaluation of different substrates for inkjet printing of rasagiline mesylate

    DEFF Research Database (Denmark)

    Genina, Natalja; Janßen, Eva Maria; Breitenbach, Armin

    2013-01-01

    The main goal of the present study was to evaluate applicability of the different model substrates, namely orodispersible films (ODFs), porous copy paper sheets, and water impermeable transparency films (TFs) in preparation of the inkjet-printed drug-delivery systems. Rasagiline mesylate (RM...

  3. 40 CFR 265.273 - Waste analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.273 Section 265... FACILITIES Land Treatment § 265.273 Waste analysis. In addition to the waste analyses required by § 265.13... listed as a hazardous waste. As required by § 265.13, the waste analysis plan must include analyses...

  4. 47 CFR 25.273 - Duties regarding space communications transmissions.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Duties regarding space communications transmissions. 25.273 Section 25.273 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Operations § 25.273 Duties regarding space...

  5. Improving the Quality of Backup Process for Publishing Houses and Printing Houses

    Science.gov (United States)

    Proskuriakov, N. E.; Yakovlev, B. S.; Pries, V. V.

    2018-04-01

    The analysis of main types for data threats, used by print media, and their influence on the vitality and security of information is made. The influence of the programs settings for preparing archive files, the types of file managers on the backup process is analysed. We proposed a simple and economical version of the practical implementation of the backup process consisting of 4 components: the command line interpreter, the 7z archiver, the Robocopy utility, and network storage. We recommend that the best option would be to create backup copies, consisting of three local copies of data and two network copies.

  6. 40 CFR 273.54 - Response to releases.

    Science.gov (United States)

    2010-07-01

    ... 273.54 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.54 Response to... other residues from universal wastes. (b) A universal waste transporter must determine whether any...

  7. [Application of rational ant colony optimization to improve the reproducibility degree of laser three-dimensional copy].

    Science.gov (United States)

    Cui, Xiao-Yan; Huo, Zhong-Gang; Xin, Zhong-Hua; Tian, Xiao; Zhang, Xiao-Dong

    2013-07-01

    Three-dimensional (3D) copying of artificial ears and pistol printing are pushing laser three-dimensional copying technique to a new page. Laser three-dimensional scanning is a fresh field in laser application, and plays an irreplaceable part in three-dimensional copying. Its accuracy is the highest among all present copying techniques. Reproducibility degree marks the agreement of copied object with the original object on geometry, being the most important index property in laser three-dimensional copying technique. In the present paper, the error of laser three-dimensional copying was analyzed. The conclusion is that the data processing to the point cloud of laser scanning is the key technique to reduce the error and increase the reproducibility degree. The main innovation of this paper is as follows. On the basis of traditional ant colony optimization, rational ant colony optimization algorithm proposed by the author was applied to the laser three-dimensional copying as a new algorithm, and was put into practice. Compared with customary algorithm, rational ant colony optimization algorithm shows distinct advantages in data processing of laser three-dimensional copying, reducing the error and increasing the reproducibility degree of the copy.

  8. 40 CFR 273.17 - Response to releases.

    Science.gov (United States)

    2010-07-01

    ... 273.17 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.17... of universal wastes and other residues from universal wastes. (b) A small quantity handler of...

  9. 40 CFR 273.37 - Response to releases.

    Science.gov (United States)

    2010-07-01

    ... 273.37 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.37... of universal wastes and other residues from universal wastes. (b) A large quantity handler of...

  10. EARLY PRINTED CYRILLIC BOOKS OF THE MAKSYMOVYCH SCIENTIFIC LIBRARY OF THE TARAS SHEVCHENKO NATIONAL UNIVERSITY OF KYIV: THE NEW RESEARCH

    Directory of Open Access Journals (Sweden)

    Д. В. Лукін

    2017-10-01

    Full Text Available The article describes the latest research activities on early printed cyrillic books of the Maksymovych Scientific Library, being conducted in 2016-2017. The main attention is paid to the identification of early print editions and the publication of “provenientia”, marginalia, hand-written notes which reveal the origins and history of use of the certain printed documents. The several early Kievan prints are mentioned as well as personalities and locations which are connected with during their long history of use. The latest investigation of two copies of Didactic Gospel, printed in1606 inKrylos, is described. One of them, which was indentified recently, has its origin in TranscarpathianUkraine, while the second copy was donated to the church in Podillya region in 1624, and reappeared much later in private collection of Nikolai Maklakov (1805–1881. A brief description of the scientific project “The interaction of Ukrainian and Belarusian printed book traditions from the 16th till the beginning of the 19th century” is included. The article has its practical purpose in filling the gap in knowledge of certain parts of ukrainian early printed book heritage, which may be valuable to bibliogists and codicologists, dealing with cyrillic prints and manuscripts respectively.

  11. 7 CFR 273.6 - Social security numbers.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Social security numbers. 273.6 Section 273.6... normally uses the Receipt of Application for a Social Security Number, Form SSA-5028, as evidence that an... security numbers. (a) Requirements for participation. The State agency shall require that a household...

  12. 48 CFR 852.273-70 - Late offers.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Late offers. 852.273-70... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 852.273-70 Late offers. As prescribed in 873.110(a), insert the following provision: Late Offers (JAN 2003) This provision replaces...

  13. 33 CFR 273.17 - Annual budget request.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Annual budget request. 273.17... DEFENSE AQUATIC PLANT CONTROL § 273.17 Annual budget request. The Aquatic Plant Control Program is a... to utilize within the budget year taking into account the foreseeable availability of local funds to...

  14. 48 CFR 719.273-10 - Internal controls.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Internal controls. 719.273...égé Program 719.273-10 Internal controls. (a) OSDBU will oversee the Program and will work in... objectives. OSDBU will establish internal controls as checks and balances applicable to the Program. These...

  15. Sub anno domini 1465... In casa de’ figliuoli di Aldo. Origin and advancements of the printing press in Italy through the exemplars of the Bagnacavallo ‘Giuseppe Taroni’ library

    Directory of Open Access Journals (Sweden)

    Federica Fabbri

    2016-11-01

    Full Text Available The paper contains the descriptions of the ancient books owned by the Public Library ‘Giuseppe Taroni’ in Bagnacavallo, which were selected for the exhibition Sub anno domini 1465... In casa de’ figliuoli di Aldo to celebrate the printing of the first book in Italy by Konrad Sweynheym and Arnold Pannartz with datation included in the colophon (Subiaco, 1465 and the fifth centenary of Aldus Manutius’ death, the major Italian printer and publisher of the Renaissance age (1449-52?-1515. Among the exhibited copies the one belonging to the Roman edition of 1470 of the work of the Christian scholar Lactantius, the only one copy printed by Sweynheym and Pannartz owned by the Library in Bagnacavallo, and a selection of books printed by Aldus Manutius and his heirs, among which the only copy found in this library of a book printed by Aldus The Elder, belonging to Institutiones Grammaticae of 1514.

  16. A three-component system incorporating Ppd-D1, copy number variation at Ppd-B1, and numerous small-effect quantitative trait loci facilitates adaptation of heading time in winter wheat cultivars of worldwide origin.

    Science.gov (United States)

    Würschum, Tobias; Langer, Simon M; Longin, C Friedrich H; Tucker, Matthew R; Leiser, Willmar L

    2018-06-01

    The broad adaptability of heading time has contributed to the global success of wheat in a diverse array of climatic conditions. Here, we investigated the genetic architecture underlying heading time in a large panel of 1,110 winter wheat cultivars of worldwide origin. Genome-wide association mapping, in combination with the analysis of major phenology loci, revealed a three-component system that facilitates the adaptation of heading time in winter wheat. The photoperiod sensitivity locus Ppd-D1 was found to account for almost half of the genotypic variance in this panel and can advance or delay heading by many days. In addition, copy number variation at Ppd-B1 was the second most important source of variation in heading, explaining 8.3% of the genotypic variance. Results from association mapping and genomic prediction indicated that the remaining variation is attributed to numerous small-effect quantitative trait loci that facilitate fine-tuning of heading to the local climatic conditions. Collectively, our results underpin the importance of the two Ppd-1 loci for the adaptation of heading time in winter wheat and illustrate how the three components have been exploited for wheat breeding globally. © 2018 John Wiley & Sons Ltd.

  17. Scanners for analytic print measurement: the devil in the details

    Science.gov (United States)

    Zeise, Eric K.; Williams, Don; Burns, Peter D.; Kress, William C.

    2007-01-01

    Inexpensive and easy-to-use linear and area-array scanners have frequently substituted as colorimeters and densitometers for low-frequency (i.e., large area) hard copy image measurement. Increasingly, scanners are also being used for high spatial frequency, image microstructure measurements, which were previously reserved for high performance microdensitometers. In this paper we address characteristics of flatbed reflection scanners in the evaluation of print uniformity, geometric distortion, geometric repeatability and the influence of scanner MTF and noise on analytic measurements. Suggestions are made for the specification and evaluation of scanners to be used in print image quality standards that are being developed.

  18. The good gift: a comparison of the Eli Lilly presentation copies of Aequanimitas.

    Science.gov (United States)

    Kimbrough, R C

    1995-08-01

    The Eli Lilly Pharmaceutical Company of Indianapolis, Indiana distributed some 150,000 copies of the third edition of Sir William Osler's Aequanimitas to graduating medical students between 1932 and 1953. Bibliophiles have considered these volumes identical. However, there were at least seven different printings in English and one in Spanish and one in Portuguese. The size of the book and type of paper changed over the years. The title page, spine information, and printing information also changed. A congratulatory letter from Eli Lilly and Company was placed in the front of each book. These letters have many differences. Thus, the volumes are not identical and the recognition of these differences opens a new field for research and collecting.

  19. Future of laser electrophotographic technology for color document printing

    Science.gov (United States)

    Shahin, Michael M.

    1997-04-01

    Recent years have witnessed the development of laser electrophotography as one of the major technologies for document printing, serving a wide range of market applications. With the evolution of color and market demand for color hard copy, electrophotography is again taking center stage to serve the customer need in quality, cost and convenience. Today, electrophotographic technology is used to offer products for color document printing for desktop, mid-volume and high-speed applications. Total cost of ownership, convenience and quality today favor the use of this technology over alternatives in many applications. Development of higher speed color electrophotographic engines demands very high speed, Raster Input Processors and pre-press applications that are expected to become available in the market during the next five years. This presentation will cover the changing environment of office communication and the continuing role of electrophotography in color document printing.

  20. Analisis Isi Daya Tarik Pesan Iklan Berdasarkan Elemen Print Ad pada Iklan Sabun Mandi di Majalah Femina

    Directory of Open Access Journals (Sweden)

    Nadya Istighfarina

    2017-07-01

    Full Text Available One of mass media in Indonesia that used for advertising is Femina magazine. The target audience of Femina is women and because of its target audience, so Femina being potential magazine for cosmetics and toiletries product to advertise. One of toiletries product is soap. In copywriting, print ad has an element that consist of headline, subheadline, body copy and ilustration. An advertisement has an appealing point that consist of informational, emotional and combination to attract the readers. The aim of this research is to identify domination of appealing point by print ad element in soap advertisement on Femina magazine period of Jauari 2014- August 2016. Method of this research using quantitative descriptive content analysis. Total object of this research are 27 advertisement. The result of this research showing that domination of using headline in advertisement is provocative headline with percentage 44,44%, advertisement tend to not using subheadline with percentage 51,85%, domination of body copy in advertisement is use picture- caption copy with percentage 48,15%, advertisement tend to using photography ilustration technique with percentage 96,29% and domination of appealing point is using informational appealing point with percentage 48,15%. Salah satu media massa yang terdapat di Indonesia yang digunakan untuk sarana beriklan adalah majalah wanita Femina. Karena target pembaca Femina adalah untuk wanita, maka Femina adalah majalah berpotensial bagi para produk kecantikan dan toiletries untuk beriklan. Salah satu produk toiletries adalah sabun mandi. Dalam penulisan iklan (print ad memiliki elemen yang terdiri dari headline, subheadline, body copy dan ilustrasi serta mengandung suatu daya tarik agar menarik perhatian pembaca yang terdiri dari daya tarik rasional, emosional dan kombinasi. Tujuan penelitian adalah untuk mengetahui dominasi daya tarik pesan berdasarkan elemen print ad pada iklan produk sabun mandi di majalah Femina periode

  1. Rare copy of "Life of Saint Volo-dymyr" (Kyiv, 1670 from the manuscript Corpus of Lives of the Saints as a source for the 17th century Kyiv hagiography study

    Directory of Open Access Journals (Sweden)

    Bondar N. P.

    2017-01-01

    Full Text Available In the article a rare copy of an old-printed edition of “Life of Saint Volodymyr”, published circa 1670 in the Kyiv-Pechersk Lavra printing-house is characterized. The copy was included to Corpus of Lives of the Saints of the17th-18th centuries from the collection of Church and Archeological museum of Kyiv Ecclesiastical Academy (Fond 301, Unit 416L. According to the modern advances of codicology, archeology, filigranology it became possible to critically review the data of descriptions, which brought new results. The approximate dating of the old-printed edition, which has no title and imprint, is confirmed. The publishing history of “Life of Saint Volodymyr” is analyzed. The research of the copy is accompanied by the complex description of overall manuscript hagiography codex, the analysis of its content, specifics, ownership notes and paper filigrees. Archeographic analysis of Corpus of Lives of the Saints was combined with study of formation of Ukrainian hagiography complex of the second half of the 17th - the early 18th centuries.

  2. Automotive advertising copy test. Final report. [Mileage estimates

    Energy Technology Data Exchange (ETDEWEB)

    1984-10-01

    The purpose of this research project was to explore the following issues: (1) mileage recall/recognition of miles per gallon/highway mileage estimates in print ads by advertisement readers; (2) determine consumer expectations and believability of advertised mileage guidelines; (3) measure recall/comprehension of mileage disclaimers; and (4) determine how consumers utilize published mileage estimates. The evidence from this study points to a public which is quite familiar with the EPA mileage estimates, in terms of using them as guidelines and in finding them to be helpful. Most adults also appear to be knowledgeable about factors which can affect car performance and, therefore, anticipate that, within certain tolerances, their actual mileage will differ from the EPA estimates. Although the consumer has been educated regarding fuel estimates, there is a very strong suggestion from this research that typical automobile print advertising does a less than an effective job in generating awareness of specific EPA estimates as well as their attendant disclaimer. Copy strategy and execution have a critical impact on recall of the EPA mileage estimates. 18 tables.

  3. 25 CFR 273.16 - Powers and duties of Indian Education Committee.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Powers and duties of Indian Education Committee. 273.16 Section 273.16 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Application Process § 273.16...

  4. Relevance of 19th century continuous tone photomechanical printing techniques to digitally generated imagery

    Science.gov (United States)

    Hoskins, Stephen; Thirkell, Paul

    2003-01-01

    Collotype and Woodburytype are late 19th early 20th century continuous tone methods of reproducing photography in print, which do not have an underlying dot structure. The aesthetic and tactile qualities produced by these methods at their best, have never been surpassed. Woodburytype is the only photomechanical print process using a printing matrix and ink, that is capable of rendering true continuous tone; it also has the characteristic of rendering a photographic image by mapping a three-dimensional surface topography. Collotype"s absence of an underlying dot structure enables an image to be printed in as many colours as desired without creating any form of interference structure. Research at the Centre for Fine Print Research, UWE Bristol aims to recreate these processes for artists and photographers and assess their potential to create a digitally generated image printed in full colour and continuous tone that will not fade or deteriorate. Through this research the Centre seeks to provide a context in which the development of current four-colour CMYK printing may be viewed as an expedient rather than a logical route for the development of colour printing within the framework of digitally generated hard copy paper output.

  5. College Students' Perceptions of the C-Print Speech-to-Text Transcription System.

    Science.gov (United States)

    Elliot, L B; Stinson, M S; McKee, B G; Everhart, V S; Francis, P J

    2001-01-01

    C-Print is a real-time speech-to-text transcription system used as a support service with deaf students in mainstreamed classes. Questionnaires were administered to 36 college students in 32 courses in which the C-Print system was used in addition to interpreting and note taking. Twenty-two of these students were also interviewed. Questionnaire items included student ratings of lecture comprehension. Student ratings indicated good comprehension with C-Print, and the mean rating was significantly higher than that for understanding of the interpreter. Students also rated the hard copy printout provided by C-Print as helpful, and they reported that they used these notes more frequently than the handwritten notes from a paid student note taker. Interview results were consistent with those for the questionnaire. Questionnaire and interview responses regarding use of C-Print as the only support service indicated that this arrangement would be acceptable to many students, but not to others. Communication characteristics were related to responses to the questionnaire. Students who were relatively proficient in reading and writing English, and in speech-reading, responded more favorably to C-Print.

  6. Copy number and haplotype variation at the VRN-A1 and central FR-A2 loci are associated with frost tolerance in hexaploid wheat.

    Science.gov (United States)

    Zhu, Jie; Pearce, Stephen; Burke, Adrienne; See, Deven Robert; Skinner, Daniel Z; Dubcovsky, Jorge; Garland-Campbell, Kimberly

    2014-05-01

    The interaction between VRN - A1 and FR - A2 largely affect the frost tolerance of hexaploid wheat. Frost tolerance is critical for wheat survival during cold winters. Natural variation for this trait is mainly associated with allelic differences at the VERNALIZATION 1 (VRN1) and FROST RESISTANCE 2 (FR2) loci. VRN1 regulates the transition between vegetative and reproductive stages and FR2, a locus including several tandemly duplicated C-REPEAT BINDING FACTOR (CBF) transcription factors, regulates the expression of Cold-regulated genes. We identified sequence and copy number variation at these two loci among winter and spring wheat varieties and characterized their association with frost tolerance. We identified two FR-A2 haplotypes-'FR-A2-S' and 'FR-A2-T'-distinguished by two insertion/deletions and ten single nucleotide polymorphisms within the CBF-A12 and CBF-A15 genes. Increased copy number of CBF-A14 was frequently associated with the FR-A2-T haplotype and with higher CBF14 transcript levels in response to cold. Factorial ANOVAs revealed significant interactions between VRN1 and FR-A2 for frost tolerance in both winter and spring panels suggesting a crosstalk between vernalization and cold acclimation pathways. The model including these two loci and their interaction explained 32.0 and 20.7 % of the variation in frost tolerance in the winter and spring panels, respectively. The interaction was validated in a winter wheat F 4:5 population segregating for both genes. Increased VRN-A1 copy number was associated with improved frost tolerance among varieties carrying the FR-A2-T allele but not among those carrying the FR-A2-S allele. These results suggest that selection of varieties carrying the FR-A2-T allele and three copies of the recessive vrn-A1 allele would be a good strategy to improve frost tolerance in wheat.

  7. 26 CFR 1.273-1 - Life or terminable interests.

    Science.gov (United States)

    2010-04-01

    ....273-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Items Not Deductible § 1.273-1 Life or terminable interests. Amounts paid as income to the holder of a life or a terminable interest acquired by gift, bequest, or inheritance shall not...

  8. 49 CFR 192.273 - General.

    Science.gov (United States)

    2010-10-01

    ... Other Regulations Relating to Transportation (Continued) PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) PIPELINE SAFETY TRANSPORTATION OF NATURAL AND OTHER GAS BY PIPELINE: MINIMUM FEDERAL SAFETY STANDARDS Joining of Materials Other Than by Welding § 192.273...

  9. Interpolating Spline Curve-Based Perceptual Encryption for 3D Printing Models

    Directory of Open Access Journals (Sweden)

    Giao N. Pham

    2018-02-01

    Full Text Available With the development of 3D printing technology, 3D printing has recently been applied to many areas of life including healthcare and the automotive industry. Due to the benefit of 3D printing, 3D printing models are often attacked by hackers and distributed without agreement from the original providers. Furthermore, certain special models and anti-weapon models in 3D printing must be protected against unauthorized users. Therefore, in order to prevent attacks and illegal copying and to ensure that all access is authorized, 3D printing models should be encrypted before being transmitted and stored. A novel perceptual encryption algorithm for 3D printing models for secure storage and transmission is presented in this paper. A facet of 3D printing model is extracted to interpolate a spline curve of degree 2 in three-dimensional space that is determined by three control points, the curvature coefficients of degree 2, and an interpolating vector. Three control points, the curvature coefficients, and interpolating vector of the spline curve of degree 2 are encrypted by a secret key. The encrypted features of the spline curve are then used to obtain the encrypted 3D printing model by inverse interpolation and geometric distortion. The results of experiments and evaluations prove that the entire 3D triangle model is altered and deformed after the perceptual encryption process. The proposed algorithm is responsive to the various formats of 3D printing models. The results of the perceptual encryption process is superior to those of previous methods. The proposed algorithm also provides a better method and more security than previous methods.

  10. A modified stratified model for the 3C 273 jet

    International Nuclear Information System (INIS)

    Liu Wenpo; Shen Zhiqiang

    2009-01-01

    We present a modified stratified jet model to interpret the observed spectral energy distributions of knots in the 3C 273 jet. Based on the hypothesis of the single index of the particle energy spectrum at injection and identical emission processes among all the knots, the observed difference of spectral shape among different 3C 273 knots can be understood as a manifestation of the deviation of the equivalent Doppler factor of stratified emission regions in an individual knot from a characteristic one. The summed spectral energy distributions of all ten knots in the 3C 273 jet can be well fitted by two components: a low-energy component (radio to optical) dominated by synchrotron radiation and a high-energy component (UV, X-ray and γ-ray) dominated by inverse Compton scattering of the cosmic microwave background. This gives a consistent spectral index of α = 0.88 (S v ∝ v -α ) and a characteristic Doppler factor of 7.4. Assuming the average of the summed spectrum as the characteristic spectrum of each knot in the 3C 273 jet, we further get a distribution of Doppler factors. We discuss the possible implications of these results for the physical properties in the 3C 273 jet. Future GeV observations with GLAST could separate the γ-ray emission of 3C 273 from the large scale jet and the small scale jet (i.e. the core) through measuring the GeV spectrum.

  11. Winter-to-winter variations in indoor radon

    International Nuclear Information System (INIS)

    Mose, D.G.; Mushrush, G.W.; Kline, S.W.

    1989-01-01

    Indoor radon concentrations in northern Virginia and central Maryland show a strong dependence on weather. Winter tends to be associated with higher than average indoor radon, and summer with lower than average. However, compared to the winter of 1986-1987, the winter of 1987-1988 was warmer and drier. Consequently, winter-to-winter indoor radon decreased by about 25%. This winter-to-winter decrease is unexpectedly large, and simulates winter-to-summer variations that have been reported

  12. Bio-inspired color sketch for eco-friendly printing

    Science.gov (United States)

    Safonov, Ilia V.; Tolstaya, Ekaterina V.; Rychagov, Michael N.; Lee, Hokeun; Kim, Sang Ho; Choi, Donchul

    2012-01-01

    Saving of toner/ink consumption is an important task in modern printing devices. It has a positive ecological and social impact. We propose technique for converting print-job pictures to a recognizable and pleasant color sketches. Drawing a "pencil sketch" from a photo relates to a special area in image processing and computer graphics - non-photorealistic rendering. We describe a new approach for automatic sketch generation which allows to create well-recognizable sketches and to preserve partly colors of the initial picture. Our sketches contain significantly less color dots then initial images and this helps to save toner/ink. Our bio-inspired approach is based on sophisticated edge detection technique for a mask creation and multiplication of source image with increased contrast by this mask. To construct the mask we use DoG edge detection, which is a result of blending of initial image with its blurred copy through the alpha-channel, which is created from Saliency Map according to Pre-attentive Human Vision model. Measurement of percentage of saved toner and user study proves effectiveness of proposed technique for toner saving in eco-friendly printing mode.

  13. 40 CFR 273.8 - Applicability-household and conditionally exempt small quantity generator waste.

    Science.gov (United States)

    2010-07-01

    ... conditionally exempt small quantity generator waste. 273.8 Section 273.8 Protection of Environment ENVIRONMENTAL....8 Applicability—household and conditionally exempt small quantity generator waste. (a) Persons... universal wastes defined at § 273.9; and/or (2) Conditionally exempt small quantity generator wastes that...

  14. 25 CFR 273.38 - Equal quality and standard of education.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Equal quality and standard of education. 273.38 Section... EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Funding Provisions § 273.38 Equal quality and standard of education. Contracts with State education agencies or school districts...

  15. The precision and reliability evaluation of 3-dimensional printed damaged bone and prosthesis models by stereo lithography appearance.

    Science.gov (United States)

    Zou, Yun; Han, Qing; Weng, Xisheng; Zou, Yongwei; Yang, Yingying; Zhang, Kesong; Yang, Kerong; Xu, Xiaolin; Wang, Chenyu; Qin, Yanguo; Wang, Jincheng

    2018-02-01

    Recently, clinical application of 3D printed model was increasing. However, there was no systemic study for confirming the precision and reliability of 3D printed model. Some senior clinical doctors mistrusted its reliability in clinical application. The purpose of this study was to evaluate the precision and reliability of stereolithography appearance (SLA) 3D printed model.Some related parameters were selected to research the reliability of SLA 3D printed model. The computed tomography (CT) data of bone/prosthesis and model were collected and 3D reconstructed. Some anatomical parameters were measured and statistical analysis was performed; the intraclass correlation coefficient (ICC) was used to was used to evaluate the similarity between the model and real bone/prosthesis. the absolute difference (mm) and relative difference (%) were conducted. For prosthesis model, the 3-dimensional error was measured.There was no significant difference in the anatomical parameters except max height (MH) of long bone. All the ICCs were greater than 0.990. The maximum absolute and relative difference were 0.45 mm and 1.10%; The 3-dimensional error analysis showed that positive/minus distance were 0.273 mm/0.237 mm.The application of SLA 3D printed model in diagnosis and treatment process of complex orthopedic disease was reliable and precise.

  16. Estimating the Probability of Traditional Copying, Conditional on Answer-Copying Statistics.

    Science.gov (United States)

    Allen, Jeff; Ghattas, Andrew

    2016-06-01

    Statistics for detecting copying on multiple-choice tests produce p values measuring the probability of a value at least as large as that observed, under the null hypothesis of no copying. The posterior probability of copying is arguably more relevant than the p value, but cannot be derived from Bayes' theorem unless the population probability of copying and probability distribution of the answer-copying statistic under copying are known. In this article, the authors develop an estimator for the posterior probability of copying that is based on estimable quantities and can be used with any answer-copying statistic. The performance of the estimator is evaluated via simulation, and the authors demonstrate how to apply the formula using actual data. Potential uses, generalizability to other types of cheating, and limitations of the approach are discussed.

  17. [Johann Misch Astrophilus' book "Medicina Pauperum" in Hungarian. Copy of a lost or hidden book from 1660].

    Science.gov (United States)

    Kiss, István; Tavaszy, Mariann; Kiss, Gergely

    2011-07-03

    Doctors and pharmacies in the 15th Century only used handwritten copies of the prescription collections available in their time. At the beginning of book printing the publishing of prescription collections immediately became popular. They could be found on the pages of medical and pharmaceutical books of many various editions with different structure and origin, as the forerunner of the official pharmacopoeias. From the 16th Century onwards books with the title "Medicina Pauperum" were published which helped the educated people to tend to themselves, the household, the servants and their immediate surroundings case of an illness. The first work specifically on the topic or of genre of the "Medicina Pauperum" according to our knowledge appeared in Hungarian in the year 1660 and currently seems to survived only in fragments under the title of "Medicina Pauperum", from an unknown author. A rare incident occurred in the present days as a "book" believed to be lost for us turned up from thin air. It is a "copied" manuscript in the size of 97×139 mm attached to the ribs with hemp cord, cropped around and in an unbound state. The book known before only in fractions is now available entirety handwritten on 318 pages, distributed to seven distinct parts. The research of its origin suggests that the author lived and worked in Nagyszombat and was called Johann Misch Astrophilus. The identification of the printing office was possible thanks to the examination of the initials and the gaudily, as well as the fonts and the watermark. By these results the printing very likely occurred in the Brewer Printing Press in Lőcse. For the possibility of more extensive research and value preservation the manuscript was bounded. The facsimile edition contains the magnified and digitalized pages of the original one and is published in numbered issues.

  18. 49 CFR 40.273 - What is the effect of a cancelled alcohol test?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What is the effect of a cancelled alcohol test? 40.273 Section 40.273 Transportation Office of the Secretary of Transportation PROCEDURES FOR TRANSPORTATION WORKPLACE DRUG AND ALCOHOL TESTING PROGRAMS Problems in Alcohol Testing § 40.273 What is the...

  19. CKD273, a new proteomics classifier assessing CKD and its prognosis.

    Directory of Open Access Journals (Sweden)

    Ángel Argilés

    Full Text Available National Kidney Foundation CKD staging has allowed uniformity in studies on CKD. However, early diagnosis and predicting progression to end stage renal disease are yet to be improved. Seventy six patients with different levels of CKD, including outpatients and dialysed patients were studied for transcriptome, metabolome and proteome description. High resolution urinary proteome analysis was blindly performed in the 53 non-anuric out of the 76 CKD patients. In addition to routine clinical parameters, CKD273, a urinary proteomics-based classifier and its peptides were quantified. The baseline values were analyzed with regard to the clinical parameters and the occurrence of death or renal death during follow-up (3.6 years as the main outcome measurements. None of the patients with CKD2730.55. Unsupervised clustering analysis of the CKD273 peptides separated the patients into two main groups differing in CKD associated parameters. Among the 273 biomarkers, peptides derived from serum proteins were relatively increased in patients with lower glomerular filtration rate, while collagen-derived peptides were relatively decreased (p<0.05; Spearman. CKD273 was different in the groups with different renal function (p<0.003. The CKD273 classifier separated CKD patients according to their renal function and informed on the likelihood of experiencing adverse outcome. Recently defined in a large population, CKD273 is the first proteomic-based classifier successfully tested for prognosis of CKD progression in an independent cohort.

  20. 3D-printing of undisturbed soil imaged by X-ray

    Science.gov (United States)

    Bacher, Matthias; Koestel, John; Schwen, Andreas

    2014-05-01

    The unique pore structures in Soils are altered easily by water flow. Each sample has a different morphology and the results of repetitions vary as well. Soil macropores in 3D-printed durable material avoid erosion and have a known morphology. Therefore potential and limitations of reproducing an undisturbed soil sample by 3D-printing was evaluated. We scanned an undisturbed soil column of Ultuna clay soil with a diameter of 7 cm by micro X-ray computer tomography at a resolution of 51 micron. A subsample cube of 2.03 cm length with connected macropores was cut out from this 3D-image and printed in five different materials by a 3D-printing service provider. The materials were ABS, Alumide, High Detail Resin, Polyamide and Prime Grey. The five print-outs of the subsample were tested on their hydraulic conductivity by using the falling head method. The hydrophobicity was tested by an adapted sessile drop method. To determine the morphology of the print-outs and compare it to the real soil also the print-outs were scanned by X-ray. The images were analysed with the open source program ImageJ. The five 3D-image print-outs copied from the subsample of the soil column were compared by means of their macropore network connectivity, porosity, surface volume, tortuosity and skeleton. The comparison of pore morphology between the real soil and the print-outs showed that Polyamide reproduced the soil macropore structure best while Alumide print-out was the least detailed. Only the largest macropore was represented in all five print-outs. Printing residual material or printing aid material remained in and clogged the pores of all print-out materials apart from Prime Grey. Therefore infiltration was blocked in these print-outs and the materials are not suitable even though the 3D-printed pore shapes were well reproduced. All of the investigated materials were insoluble. The sessile drop method showed angles between 53 and 85 degrees. Prime Grey had the fastest flow rate; the

  1. A 3D Printing Model Watermarking Algorithm Based on 3D Slicing and Feature Points

    Directory of Open Access Journals (Sweden)

    Giao N. Pham

    2018-02-01

    Full Text Available With the increase of three-dimensional (3D printing applications in many areas of life, a large amount of 3D printing data is copied, shared, and used several times without any permission from the original providers. Therefore, copyright protection and ownership identification for 3D printing data in communications or commercial transactions are practical issues. This paper presents a novel watermarking algorithm for 3D printing models based on embedding watermark data into the feature points of a 3D printing model. Feature points are determined and computed by the 3D slicing process along the Z axis of a 3D printing model. The watermark data is embedded into a feature point of a 3D printing model by changing the vector length of the feature point in OXY space based on the reference length. The x and y coordinates of the feature point will be then changed according to the changed vector length that has been embedded with a watermark. Experimental results verified that the proposed algorithm is invisible and robust to geometric attacks, such as rotation, scaling, and translation. The proposed algorithm provides a better method than the conventional works, and the accuracy of the proposed algorithm is much higher than previous methods.

  2. Multiply to conquer: Copy number variations at Ppd-B1 and Vrn-A1 facilitate global adaptation in wheat.

    Science.gov (United States)

    Würschum, Tobias; Boeven, Philipp H G; Langer, Simon M; Longin, C Friedrich H; Leiser, Willmar L

    2015-07-29

    Copy number variation was found to be a frequent type of DNA polymorphism in the human genome often associated with diseases but its importance in crops and the effects on agronomic traits are still largely unknown. Here, we employed a large worldwide panel of 1110 winter wheat varieties to assess the frequency and the geographic distribution of copy number variants at the Photoperiod-B1 (Ppd-B1) and the Vernalization-A1 (Vrn-A1) loci as well as their effects on flowering time under field conditions. We identified a novel four copy variant of Vrn-A1 and based on the phylogenetic relationships among the lines show that the higher copy variants at both loci are likely to have arisen independently multiple times. In addition, we found that the frequency of the different copy number variants at both loci reflects the environmental conditions in the varieties' region of origin and based on multi-location field trials show that Ppd-B1 copy number has a substantial effect on the fine-tuning of flowering time. In conclusion, our results show the importance of copy number variation at Ppd-B1 and Vrn-A1 for the global adaptation of wheat making it a key factor for wheat success in a broad range of environments and in a wider context substantiate the significant role of copy number variation in crops.

  3. Dissemination and preservation of French print and electronic theses

    OpenAIRE

    Paillassard , Pierrette; Schöpfel , Joachim; Stock , Christiane

    2007-01-01

    International audience; How do you discover and locate a French thesis, how do you get hold of a paper copy and how do you access the full text of electronic theses and dissertations (ETDS)? What are the catalogues and databases referencing theses? Where are the archives, and are they open? What is the legal environment that rules the emerging structures and tools? This paper presents the former database for print theses “Téléthèses” that merged with the national academic union catalogue “Sud...

  4. Gauge field copies

    International Nuclear Information System (INIS)

    Bollini, C.G.; Giambiagi, J.J.; Tiomno, J.

    1979-01-01

    The construction of field strength copies without any gauge constraint is discussed. Several examples are given, one of which is not only a field strength copy but also (at the same time) a 'current copy'. (author) [pt

  5. 48 CFR 719.273-1 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... 719.273-1 Federal Acquisition Regulations System AGENCY FOR INTERNATIONAL DEVELOPMENT SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS The U.S. Agency for International Development (USAID) Mentor-ProtégÃ... developmental assistance to Protégé entities, fostering the establishment of long-term business relationships...

  6. Cbs (Contrastrain Based Schedulling Adalah Faktor Penentu Keberhasilan Perusahanan Printing

    Directory of Open Access Journals (Sweden)

    Hendra Achmadi

    2010-06-01

    Full Text Available In a highly competitive industry faces today ranging from small or home-based printing to using machine that can print offset a hundred thousand copies per hour. But, the increasing competition resulted in requiring a faster production time from order entry, print proff until the production process to delivery to customers. Often times in case of orders which will result in the concurrent PPIC will experience vertigo in the setting of production schedules which have concurrent delivery time. Often will end up with no receipt of orders due to difficulties in the production schedule, especially if the orders require the same offset machine and cylinder wear the same length, while the number of cylinders is limited. Therefore, the printing company should be able to do so in the conduct of a penetration timing of production can easily be simulated and implemented on the ground. CBS (Base Constraint scheduling is a technique to do the scheduling of production so that production can be carried out smoothly and quickly that fulfill the promise made to customers. In scheduling, there are several techniques that can be used are: FCFS (First Came First Serve, EDD (Earliest Date, and LCLS (Last Came Last Serve. So, it is required to be able to do way better scheduling to get results quickly in this fast changing schedules.

  7. Packaging Printing Today

    OpenAIRE

    Stanislav Bolanča; Igor Majnarić; Kristijan Golubović

    2015-01-01

    Printing packaging covers today about 50% of all the printing products. Among the printing products there are printing on labels, printing on flexible packaging, printing on folding boxes, printing on the boxes of corrugated board, printing on glass packaging, synthetic and metal ones. The mentioned packaging are printed in flexo printing technique, offset printing technique, intaglio halftone process, silk – screen printing, ink ball printing, digital printing and hybrid printing process. T...

  8. An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273 (ApJ, 496, L9 [1998])

    Science.gov (United States)

    Xia, X.-Y.; Boller, Th.; Wu, H.; Deng, Z.-G.; Gao, Y.; Zou, Z.-L.; Mao, S.; Börner, G.

    1998-11-01

    In the Letter ``An X-Ray Luminous, Dwarf Seyfert Companion of Markarian 273'' by X.-Y. Xia, Th. Boller, H. Wu, Z.-G. Deng, Y. Gao, Z.-L. Zou, S. Mao, and G. Börner (ApJ, 496, L9 [1998]), an observational error occurred that invalidates some of our conclusions. Since Mrk 273x was essentially invisible (B~21) in our acqusition image, in order to position the slit on the faint Mrk 273x, a slit rotation had to be applied. Unfortunately, the amount of rotation was applied incorrectly. As a result, the spectrum obtained (shown in Fig. 2) was not for the intended target, Mrk 273x, but for an object very close to, but northeast of, Mrk 273. A new spectrum of Mrk 273x indicates that Mrk 273x is at redshift 0.458, not at 0.0378 as quoted in the Letter. The larger redshift implies that both the optical and X-ray luminosity have to be revised upward by a factor of ~170. Mrk 273x is therefore not a dwarf galaxy optically. The X-ray properties of Mrk 273x remain the same except that its soft X-ray luminosity now reaches ~1044 ergs s-1 for H0=50 km s-1 Mpc-1. The new observations will be presented in a subsequent paper (X.-Y. Xia et al., in preparation [1998]) in order to make corrections and shed further insights on the objects in the Mrk 273 field.

  9. 48 CFR 719.273-9 - Obligations under the Mentor-Protégé Program.

    Science.gov (United States)

    2010-10-01

    ... Mentor-Protégé Program. 719.273-9 Section 719.273-9 Federal Acquisition Regulations System AGENCY FOR... Development (USAID) Mentor-Protégé Program 719.273-9 Obligations under the Mentor-Protégé Program. (a) A Mentor or Protégé may voluntarily withdraw from the Program. However, in no event shall such withdrawal...

  10. Print Quality of Ink Jet Printed PVC Foils

    Directory of Open Access Journals (Sweden)

    Nemanja Kašiković

    2015-09-01

    Full Text Available Digital printing technique is used for a wide variety of substrates, one of which are PVC foils. Samples used in this research were printed by digital ink jet printing technique using Mimaki JV22 printing machine and J-Eco Subly Nano inks. As printing substrates, two different types of materials were used (ORACAL 640 - Print Vinyl and LG Hausys LP2712. A test card consisting of fields of CMYK colours was created and printed, varying the number of ink layers applied. Samples were exposed to light after the printing process. Spectrophotometric measurements were conducted before and after the light treatment. Based on spectrophotometricaly obtained data, colour differences ΔE2000 were calculated. Results showed that increasing number of layers, as well as the right choice of substrates, can improve the behaviour of printed product during exploitation.

  11. Scaling up Copy Detection

    OpenAIRE

    Li, Xian; Dong, Xin Luna; Lyons, Kenneth B.; Meng, Weiyi; Srivastava, Divesh

    2015-01-01

    Recent research shows that copying is prevalent for Deep-Web data and considering copying can significantly improve truth finding from conflicting values. However, existing copy detection techniques do not scale for large sizes and numbers of data sources, so truth finding can be slowed down by one to two orders of magnitude compared with the corresponding techniques that do not consider copying. In this paper, we study {\\em how to improve scalability of copy detection on structured data}. Ou...

  12. 40 CFR 273.55 - Off-site shipments.

    Science.gov (United States)

    2010-07-01

    ....55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.55 Off-site... universal waste being shipped off-site meets the Department of Transportation's definition of hazardous...

  13. Packaging Printing Today

    Directory of Open Access Journals (Sweden)

    Stanislav Bolanča

    2015-12-01

    Full Text Available Printing packaging covers today about 50% of all the printing products. Among the printing products there are printing on labels, printing on flexible packaging, printing on folding boxes, printing on the boxes of corrugated board, printing on glass packaging, synthetic and metal ones. The mentioned packaging are printed in flexo printing technique, offset printing technique, intaglio halftone process, silk – screen printing, ink ball printing, digital printing and hybrid printing process. The possibilities of particular printing techniques for optimal production of the determined packaging were studied in the paper. The problem was viewed from the technological and economical aspect. The possible printing quality and the time necessary for the printing realization were taken as key parameters. An important segment of the production and the way of life is alocation value and it had also found its place in this paper. The events in the field of packaging printing in the whole world were analyzed. The trends of technique developments and the printing technology for packaging printing in near future were also discussed.

  14. The Multi-component X-ray Emission of 3C 273

    Science.gov (United States)

    Soldi, S.; Türler, M.; Paltani, S.; Courvoisier, T. J.-L.

    2009-05-01

    3C 273 is the brightest quasar in the sky and among the most extensively observed and studied AGN, therefore one of the most suitable targets for a long-term, multi-frequency study. The superposition of a thermal Comptonisation component, similar to that observed in Seyfert galaxies, and of a non-thermal component, related to the jet emission, seems to explain some of the spectral and timing properties of the X-ray emission of 3C 273. Yet, during some observations this dichotomy has not been observed and the variability properties could also be consistent with a single-component scenario, characterised by two parameters varying independently. In order to understand the nature of the X-ray emission in 3C 273, a series of observations up to 80-100 keV, possibly catching the source in different flux states, are essential. Simbol-X will be able to study the emission of 3C 273 in the broad 0.5-80 keV band with high sensitivity, allowing us to disentangle the emission from different spectral components, with 20-30 ks long observations. In addition, the shape and the origin of the high-energy emission of this quasar will be further constrained thanks to the AGILE and Fermi satellites, monitoring the γ-ray sky in the MeV-GeV energy domain.

  15. Prediction of Chronic Kidney Disease Stage 3 by CKD273, a Urinary Proteomic Biomarker

    DEFF Research Database (Denmark)

    Pontillo, Claudia; Zhang, Zhen-Yu; Schanstra, Joost P

    2017-01-01

    Introduction: CKD273 is a urinary biomarker, which in advanced chronic kidney disease predicts further deterioration. We investigated whether CKD273 can also predict a decline of estimated glomerular filtration rate (eGFR) to ... threshold (P = 0.086). Discussion: In conclusion, while accounting for baseline eGFR, albuminuria, and covariables, CKD273 adds to the prediction of stage 3 chronic kidney disease, at which point intervention remains an achievable therapeutic target....

  16. The ethics of 3D printing copies of bodies donated for medical education and research: What is there to worry about?

    Directory of Open Access Journals (Sweden)

    Jon Cornwall

    2016-01-01

    Full Text Available Many emerging technologies have the potential to revolutionise aspects of everyday life. At every turn, new examples of technological advances surround us, from self-driving cars through to gene therapy and genomic medicine. The rapid development and integration of 3D printing is another example of a new technology having a major impact on society. Objects can now be printed as near - perfect reproductions by anyone with a moderately capable computer and enough money to purchase a 3D printer. Everyday items, furniture, household appliances, and even guns can now be reproduced. Even human body parts, from cadavers donated to medical science, are now being 3D printed and used for the purpose of medical education and research.

  17. Customized three-dimensional printed optical phantoms with user defined absorption and scattering

    Science.gov (United States)

    Pannem, Sanjana; Sweer, Jordan; Diep, Phuong; Lo, Justine; Snyder, Michael; Stueber, Gabriella; Zhao, Yanyu; Tabassum, Syeda; Istfan, Raeef; Wu, Junjie; Erramilli, Shyamsunder; Roblyer, Darren M.

    2016-03-01

    The use of reliable tissue-simulating phantoms spans multiple applications in spectroscopic imaging including device calibration and testing of new imaging procedures. Three-dimensional (3D) printing allows for the possibility of optical phantoms with arbitrary geometries and spatially varying optical properties. We recently demonstrated the ability to 3D print tissue-simulating phantoms with customized absorption (μa) and reduced scattering (μs`) by incorporating nigrosin, an absorbing dye, and titanium dioxide (TiO2), a scattering agent, to acrylonitrile butadiene styrene (ABS) during filament extrusion. A physiologically relevant range of μa and μs` was demonstrated with high repeatability. We expand our prior work here by evaluating the effect of two important 3D-printing parameters, percent infill and layer height, on both μa and μs`. 2 cm3 cubes were printed with percent infill ranging from 10% to 100% and layer height ranging from 0.15 to 0.40 mm. The range in μa and μs` was 27.3% and 19.5% respectively for different percent infills at 471 nm. For varying layer height, the range in μa and μs` was 27.8% and 15.4% respectively at 471 nm. These results indicate that percent infill and layer height substantially alter optical properties and should be carefully controlled during phantom fabrication. Through the use of inexpensive hobby-level printers, the fabrication of optical phantoms may advance the complexity and availability of fully customizable phantoms over multiple spatial scales. This technique exhibits a wider range of adaptability than other common methods of fabricating optical phantoms and may lead to improved instrument characterization and calibration.

  18. Computerized micrographics in processing hard-copy records for an epidemiologic study

    International Nuclear Information System (INIS)

    Robie, D.M.; Fry, S.A.

    1983-01-01

    The availability of computers with increasing capabilities has made feasibile epidemiologic studies involving large populations such as those utilized to evaluate the health effects of occupational exposure to radiation. However, the storage and retrieval of data from the large numbers of hard-copy personnel, health physics, employment medical, historical or anecdotal documents that are the bases of such studies pose major logistics problems to investigators. The potential value of such records to epidemiologic studies depends, not only on their accuracy and completeness, but also on ease of accessibility. To address the latter problem, we are using a stand-alone user-oriented electronic filing system that records, stores, and secures hard-copy documents micrographically. This system is controlled by a computer that provides retrieval of a document image and printed copy (if desired) in less than 30 seconds from a maximum of eight fields. One thousand documents are randomly filmed and indexed on computer storage diskettes in two hours. Manual sorting and filing of the same number of documents takes over a day. At present two thousand documents can be recorded on each microfilm roll and 85,000 documents indexed on each diskette. Simultaneous searching for documents can be done using up to ten terminals while indexing is being done at the main terminal. The micrographics system provides the space-saving and security advantages of microfilm with the speed of computerized data retrieval

  19. 40 CFR 273.14 - Labeling/marking.

    Science.gov (United States)

    2010-07-01

    ... distributed; and (2) The words “Universal Waste-Pesticide(s)” or “Waste-Pesticide(s);” (c) A container, tank... administered or recognized by a state; and (2) The words “Universal Waste-Pesticide(s)” or “Waste-Pesticide(s...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.14...

  20. 40 CFR 273.34 - Labeling/marking.

    Science.gov (United States)

    2010-07-01

    ... distributed; and (2) The words “Universal Waste—Pesticide(s)” or “Waste—Pesticide(s);” (c) A container, tank...) The words “Universal Waste—Pesticide(s)” or “Waste—Pesticide(s).” (d) (1) Mercury-containing equipment...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.34...

  1. 25 CFR 273.72 - Appeal from decision to cancel contract for cause.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Appeal from decision to cancel contract for cause. 273.72 Section 273.72 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND... decision to cancel contract for cause. A contractor may appeal the decision of a Bureau official to cancel...

  2. 40 CFR 273.18 - Off-site shipments.

    Science.gov (United States)

    2010-07-01

    ....18 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Small Quantity Handlers of Universal Waste § 273.18... universal waste. (c) If a universal waste being offered for off-site transportation meets the definition of...

  3. 40 CFR 273.38 - Off-site shipments.

    Science.gov (United States)

    2010-07-01

    ....38 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Large Quantity Handlers of Universal Waste § 273.38... universal waste. (c) If a universal waste being offered for off-site transportation meets the definition of...

  4. An embedded circumnuclear disk in Mrk 273

    NARCIS (Netherlands)

    Klockner, HR; Baan, WA

    Radio observations using very long baseline interferometry (VLBI) and the Westerbork interferometer have been carried out to study the hydroxyl Megamaser emission in Mrk 273 at different spatial resolutions. Line and continuum observations were carried out by the European VLBI network (EVN) at 1.6

  5. Original Copies

    DEFF Research Database (Denmark)

    Sørensen, Tim Flohr

    2013-01-01

    of similarity by looking at artefactual similarity as the results of prototyping and as a production of simulacra. In this light, the concept of copying turns out to be more than simply a matter of trying to imitate an exotic or prestigious original, and it fundamentally raises the question how different a copy...

  6. 7 CFR 273.9 - Income and deductions.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM CERTIFICATION OF ELIGIBLE HOUSEHOLDS § 273.9 Income and...) Payments under Title I (VISTA, University Year for Action, etc.) of the Domestic Volunteer Service Act of...

  7. Quantum copying: A review

    Directory of Open Access Journals (Sweden)

    Mark Hillery

    2000-07-01

    Full Text Available Quantum information is stored in two-level quantum systems known as qubits. The no-cloning theorem states that the state of an unknown qubit cannot be copied. This is in contrast to classical information which can be copied. If one drops the requirement that the copies be perfect it is possible to design quantum copiers. This paper presents a short review of the theory of quantum copying.

  8. 40 CFR 273.53 - Storage time limits.

    Science.gov (United States)

    2010-07-01

    ...) STANDARDS FOR UNIVERSAL WASTE MANAGEMENT Standards for Universal Waste Transporters § 273.53 Storage time limits. (a) A universal waste transporter may only store the universal waste at a universal waste transfer facility for ten days or less. (b) If a universal waste transporter stores universal waste for...

  9. Development of a 3D-Printed Robotic Prosthetic Arm

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Martinez, M.; Garcia-Miquel, A.; Vidal Martinez, N.

    2016-07-01

    Current prostheses are not affordable to the general public. 3D printing technology may allow low-cost production of such devices, making them more readily accessible to people in need. This contribution presents the set-up and the considerations that have to be taken into account to develop a functional artificial upper limb prototype. The robotic prosthetic arm reported herein was produced entirely using 3D printing technology to demonstrate its feasibility on a limited budget. The project was developed to integrate two different functional modes: a prosthetic application and a remote application. The prosthetic application is intended to emulate existing prosthetic devices using myoelectric sensors. The remote application is conceived as a tool for prevention, by providing the general public with a device that could carry out activities that entail a risk of severe physical injury. This is achieved using a hand-tracking system that allows the robotic arm to copy the user’s movements remotely and in real time. The outcome of the validation tests has been considerably successful for both applications and the total costs are on target. (Author)

  10. Digital Textile Printing

    OpenAIRE

    Moltchanova, Julia

    2011-01-01

    Rapidly evolving technology of digital printing opens new opportunities on many markets. One of them is the printed fabric market where printing companies as well as clients benefit from new printing methods. This thesis focuses on the digital textile printing technology and its implementation for fabric-on-demand printing service in Finland. The purpose of this project was to study the technology behind digital textile printing, areas of application of this technology, the requirements ...

  11. Automating Registration of Digital Preservation Copies: The Place of Registries in the Digitization Workflow

    Directory of Open Access Journals (Sweden)

    William Carney

    2008-03-01

    Full Text Available I would like to thank LIBER and EBLIDA for inviting me to present this paper on the role of registries in the digitization workflow. During the past 18 months, OCLC has been working on a project to synchronize WorldCat with mass digitization projects, which we will begin to pilot shortly. The concept is to educate WorldCat about the millions of new digital manifestations for print items being produced. During the past 35 years, librarians have built a comprehensive representation of print materials and holdings in WorldCat item-by-item. However, as we move into a more digital world through the production of born-digital materials and the high-volume reformatting of our print heritage, it is impractical to catalog these new manifestations via traditional workflows. The OCLC eContent Synchronization program is one example of how OCLC is moving to address the need to ingest metadata representing digital works on an industrial scale. Through strategic alliances with key digital content producers and automated processing, new digital surrogate records will be created to increase the visibility of and access to content at the point of need. While the eContent Synchronization program is an important initiative for visibility and access, of equal importance is the process of registering the existence of the preservation copies of these digital items.

  12. A laser printing based approach for printed electronics

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, T.; Hu, M.; Guo, Q.; Zhang, W.; Yang, J., E-mail: jyang@eng.uwo.ca [Department of Mechanical and Materials Engineering, Western University, London N6A 3K7 (Canada); Liu, Y.; Lau, W. [Chengdu Green Energy and Green Manufacturing Technology R& D Center, 355 Tengfei Road, 620107 Chengdu (China); Wang, X. [Department of Mechanical and Materials Engineering, Western University, London N6A 3K7 (Canada); Lanzhou Institute of Chemical Physics, Chinese Academy of Sciences, Lanzhou 730000 (China)

    2016-03-07

    Here we report a study of printing of electronics using an office use laser printer. The proposed method eliminates those critical disadvantages of solvent-based printing techniques by taking the advantages of electroless deposition and laser printing. The synthesized toner acts as a catalyst for the electroless copper deposition as well as an adhesion-promoting buffer layer between the substrate and deposited copper. The easy metallization of printed patterns and strong metal-substrate adhesion make it an especially effective method for massive production of flexible printed circuits. The proposed process is a high throughput, low cost, efficient, and environmentally benign method for flexible electronics manufacturing.

  13. A laser printing based approach for printed electronics

    International Nuclear Information System (INIS)

    Zhang, T.; Hu, M.; Guo, Q.; Zhang, W.; Yang, J.; Liu, Y.; Lau, W.; Wang, X.

    2016-01-01

    Here we report a study of printing of electronics using an office use laser printer. The proposed method eliminates those critical disadvantages of solvent-based printing techniques by taking the advantages of electroless deposition and laser printing. The synthesized toner acts as a catalyst for the electroless copper deposition as well as an adhesion-promoting buffer layer between the substrate and deposited copper. The easy metallization of printed patterns and strong metal-substrate adhesion make it an especially effective method for massive production of flexible printed circuits. The proposed process is a high throughput, low cost, efficient, and environmentally benign method for flexible electronics manufacturing.

  14. The Art of Copying

    DEFF Research Database (Denmark)

    Christensen, Hans Dam

    2017-01-01

    This article discusses copies within the field of art museums by way of mapping strategies for copy practices. This mapping leans heavily towards parts of the writings of Jacques Derrida (1930–2004). Against the backdrop of this theoretical premise, the article distinguishes five main strategies....... An informational copy is just as unique as an original object of art, and at the same time, it defines the original and is itself defined by this opposition. Lastly, the strategy for the imagined relation between original and copy follows. This strategy is dependent upon several of the previous approaches, and...

  15. The production of anatomical teaching resources using three-dimensional (3D) printing technology.

    Science.gov (United States)

    McMenamin, Paul G; Quayle, Michelle R; McHenry, Colin R; Adams, Justin W

    2014-01-01

    The teaching of anatomy has consistently been the subject of societal controversy, especially in the context of employing cadaveric materials in professional medical and allied health professional training. The reduction in dissection-based teaching in medical and allied health professional training programs has been in part due to the financial considerations involved in maintaining bequest programs, accessing human cadavers and concerns with health and safety considerations for students and staff exposed to formalin-containing embalming fluids. This report details how additive manufacturing or three-dimensional (3D) printing allows the creation of reproductions of prosected human cadaver and other anatomical specimens that obviates many of the above issues. These 3D prints are high resolution, accurate color reproductions of prosections based on data acquired by surface scanning or CT imaging. The application of 3D printing to produce models of negative spaces, contrast CT radiographic data using segmentation software is illustrated. The accuracy of printed specimens is compared with original specimens. This alternative approach to producing anatomically accurate reproductions offers many advantages over plastination as it allows rapid production of multiple copies of any dissected specimen, at any size scale and should be suitable for any teaching facility in any country, thereby avoiding some of the cultural and ethical issues associated with cadaver specimens either in an embalmed or plastinated form. © 2014 American Association of Anatomists.

  16. Robust Adaptable Video Copy Detection

    DEFF Research Database (Denmark)

    Assent, Ira; Kremer, Hardy

    2009-01-01

    in contrast). Our query processing combines filtering and indexing structures for efficient multistep computation of video copies under this model. We show that our model successfully identifies altered video copies and does so more reliably than existing models.......Video copy detection should be capable of identifying video copies subject to alterations e.g. in video contrast or frame rates. We propose a video copy detection scheme that allows for adaptable detection of videos that are altered temporally (e.g. frame rate change) and/or visually (e.g. change...

  17. 8 CFR 273.5 - General criteria used for reduction, refund, or waiver of fines.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false General criteria used for reduction, refund, or waiver of fines. 273.5 Section 273.5 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY..., liquidated damages, and user fee payment records; and, (3) The existence of any extenuating circumstances. ...

  18. Comparing image quality of print-on-demand books and photobooks from web-based vendors

    Science.gov (United States)

    Phillips, Jonathan; Bajorski, Peter; Burns, Peter; Fredericks, Erin; Rosen, Mitchell

    2010-01-01

    Because of the emergence of e-commerce and developments in print engines designed for economical output of very short runs, there are increased business opportunities and consumer options for print-on-demand books and photobooks. The current state of these printing modes allows for direct uploading of book files via the web, printing on nonoffset printers, and distributing by standard parcel or mail delivery services. The goal of this research is to assess the image quality of print-on-demand books and photobooks produced by various Web-based vendors and to identify correlations between psychophysical results and objective metrics. Six vendors were identified for one-off (single-copy) print-on-demand books, and seven vendors were identified for photobooks. Participants rank ordered overall quality of a subset of individual pages from each book, where the pages included text, photographs, or a combination of the two. Observers also reported overall quality ratings and price estimates for the bound books. Objective metrics of color gamut, color accuracy, accuracy of International Color Consortium profile usage, eye-weighted root mean square L*, and cascaded modulation transfer acutance were obtained and compared to the observer responses. We introduce some new methods for normalizing data as well as for strengthening the statistical significance of the results. Our approach includes the use of latent mixed-effect models. We found statistically significant correlation with overall image quality and some of the spatial metrics, but correlations between psychophysical results and other objective metrics were weak or nonexistent. Strong correlation was found between psychophysical results of overall quality assessment and estimated price associated with quality. The photobook set of vendors reached higher image-quality ratings than the set of print-on-demand vendors. However, the photobook set had higher image-quality variability.

  19. 48 CFR 719.273 - The U.S. Agency for International Development (USAID) Mentor-Protégé Program.

    Science.gov (United States)

    2010-10-01

    ... International Development (USAID) Mentor-Protégé Program. 719.273 Section 719.273 Federal Acquisition.... Agency for International Development (USAID) Mentor-Protégé Program 719.273 The U.S. Agency for International Development (USAID) Mentor-Protégé Program. ...

  20. The best printing methods to print satellite images

    Directory of Open Access Journals (Sweden)

    G.A. Yousif

    2011-12-01

    In this paper different printing systems were used to print an image of SPOT-4 satellite, caver part of Sharm Elshekh area, Sinai, Egypt, on the same type of paper as much as possible, especially in the photography. This step is followed by measuring the experimental data, and analyzed colors to determine the best printing systems for satellite image printing data. The laser system is the more printing system where produce a wider range of color and highest densities of ink and access much color detail. Followed by the offset system which it recorded the best dot gain. Moreover, the study shows that it can use the advantages of each method according to the satellite image color and quantity to be produced.

  1. Hard-copy versus soft-copy with and without simple image manipulation for detection of pulmonary nodules and masses

    International Nuclear Information System (INIS)

    Kosuda, S.; Kaji, T.; Iwasaki, Y.; Kusano, S.; Kobayashi, H.; Watanabe, M.

    2000-01-01

    To compare interpretation performance on soft-copy presentations, with and without simple image manipulation, and on unmodified hard-copy presentations with regard to detection of pulmonary nodules and masses. Material and Methods: Fifty chest digital radiograph combinations of patients with a total of 60 nodules, 32 of which were 2.0 cm in diameter, were selected for the study. Three readers evaluated three separate image formats: unmodified hard- and soft-copies, and soft-copies with simple image manipulation of lung and mediastinum window settings, and zooming. The screen display was 1600x1200 pixels with 8 bits/pixel. Results: The sensitivity, accuracy, detectability, and Az value of the soft-copy systems were clearly inferior to hard-copy evaluation. The mean Az values were 0.921 for unmodified hard-copy, 0.820 for image-manipulated soft-copy, and 0.781 for unmodified soft-copy. Conclusion: Soft-copy interpretations were not as sensitive in detecting pulmonary nodules and masses as hard-copy evaluation

  2. Rapid and convenient method for preparing masters for microcontact printing with 1-12 μm features

    International Nuclear Information System (INIS)

    Zilch, Lloyd W.; Husseini, Ghaleb A.; Lua, Y.-Y.; Lee, Michael V.; Gertsch, Kevin R.; Cannon, Bennion R.; Perry, Robert M.; Sevy, Eric T.; Asplund, Matthew C.; Woolley, Adam T.; Linford, Matthew R.

    2004-01-01

    Mechanical scribing can be employed to create surfaces with recessed features. Through replica molding elastomeric copies of these scribed surfaces are created that function as stamps for microcontact printing. It is shown that this new method for creating masters for microcontact printing can be performed with a computer-controlled milling machine (CNC), making this method particularly straightforward and accessible to a large technical community that does not need to work in a particle free environment. Thus, no clean room, or other specialized equipment is required, as is commonly needed to prepare masters. Time-of-flight secondary ion mass spectrometry confirms surface pattering by this method. Finally, it is shown that feature size in the scribed master can be controlled by varying the force on the tip during scribing

  3. Digital printing

    Science.gov (United States)

    Sobotka, Werner K.

    1997-02-01

    Digital printing is described as a tool to replace conventional printing machines completely. Still this goal was not reached until now with any of the digital printing technologies to be described in the paper. Productivity and costs are still the main parameters and are not really solved until now. Quality in digital printing is no problem anymore. Definition of digital printing is to transfer digital datas directly on the paper surface. This step can be carried out directly or with the use of an intermediate image carrier. Keywords in digital printing are: computer- to-press; erasable image carrier; image carrier with memory. Digital printing is also the logical development of the new digital area as it is pointed out in Nicholas Negropotes book 'Being Digital' and also the answer to networking and Internet technologies. Creating images text and color in one country and publishing the datas in another country or continent is the main advantage. Printing on demand another big advantage and last but not least personalization the last big advantage. Costs and being able to coop with this new world of prepress technology is the biggest disadvantage. Therefore the very optimistic growth rates for the next few years are really nonexistent. The development of complete new markets is too slow and the replacing of old markets is too small.

  4. Recent trends in print portals and Web2Print applications

    Science.gov (United States)

    Tuijn, Chris

    2009-01-01

    For quite some time now, the printing business has been under heavy pressure because of overcapacity, dropping prices and the delocalization of the production to low income countries. To survive in this competitive world, printers have to invest in tools that, on one hand, reduce the production costs and, on the other hand, create additional value for their customers (print buyers). The creation of customer portals on top of prepress production systems allowing print buyers to upload their content, approve the uploaded pages based on soft proofs (rendered by the underlying production system) and further follow-up the generation of the printed material, has been illustrative in this respect. These developments resulted in both automation for the printer and added value for the print buyer. Many traditional customer portals assume that the printed products have been identified before they are presented to the print buyer in the portal environment. The products are, in this case, typically entered by the printing organization in a so-called MISi system after the official purchase order has been received from the print buyer. Afterwards, the MIS system then submits the product to the customer portal. Some portals, however, also support the initiation of printed products by the print buyer directly. This workflow creates additional flexibility but also makes things much more complex. We here have to distinguish between special products that are defined ad-hoc by the print buyer and standardized products that are typically selected out of catalogs. Special products are most of the time defined once and the level of detail required in terms of production parameters is quite high. Systems that support such products typically have a built-in estimation module, or, at least, a direct connection to an MIS system that calculates the prices and adds a specific mark-up to calculate a quote. Often, the markup is added by an account manager on a customer by customer basis; in this

  5. High-voltage power supplies for traveling wave tube WV-273A; Vysokovol`tnye istochniki pitaniya dlya LBV UV-273A

    Energy Technology Data Exchange (ETDEWEB)

    Lebedev, N I; Fateev, A A

    1996-12-31

    Paper presents a description of two modifications of high-volt power sources described for preamplifier on UV-273A type travelling wave tube (TWT). Power source where anode power circuit contains semiconducting high-volt switch on thyristors was designed to average pulse mode of TWT operation. Time of switching-in this power circuit constitutes 20 mcs. 2 refs.

  6. 39 CFR 273.6 - Evaluation by reviewing official.

    Science.gov (United States)

    2010-07-01

    ... supports the allegations of liability; (4) An estimate of the amount of money or the value of property or...)(4) and (5) of this section, the Reviewing Official recommends be demanded from the person alleged to... PROGRAM FRAUD CIVIL REMEDIES ACT § 273.6 Evaluation by reviewing official. (a) Based upon the...

  7. Internet printing

    Science.gov (United States)

    Rahgozar, M. Armon; Hastings, Tom; McCue, Daniel L.

    1997-04-01

    The Internet is rapidly changing the traditional means of creation, distribution and retrieval of information. Today, information publishers leverage the capabilities provided by Internet technologies to rapidly communicate information to a much wider audience in unique customized ways. As a result, the volume of published content has been astronomically increasing. This, in addition to the ease of distribution afforded by the Internet has resulted in more and more documents being printed. This paper introduces several axes along which Internet printing may be examined and addresses some of the technological challenges that lay ahead. Some of these axes include: (1) submission--the use of the Internet protocols for selecting printers and submitting documents for print, (2) administration--the management and monitoring of printing engines and other print resources via Web pages, and (3) formats--printing document formats whose spectrum now includes HTML documents with simple text, layout-enhanced documents with Style Sheets, documents that contain audio, graphics and other active objects as well as the existing desktop and PDL formats. The format axis of the Internet Printing becomes even more exciting when one considers that the Web documents are inherently compound and the traversal into the various pieces may uncover various formats. The paper also examines some imaging specific issues that are paramount to Internet Printing. These include formats and structures for representing raster documents and images, compression, fonts rendering and color spaces.

  8. Digital Inkjet Textile Printing

    OpenAIRE

    Wang, Meichun

    2017-01-01

    Digital inkjet textile printing is an emerging technology developed with the rise of the digital world. It offers a possibility to print high-resolution images with unlimited color selection on fabrics. Digital inkjet printing brings a revolutionary chance for the textile printing industry. The history of textile printing shows the law how new technology replaces the traditional way of printing. This indicates the future of digital inkjet textile printing is relatively positive. Differen...

  9. Printed photodetectors

    International Nuclear Information System (INIS)

    Pace, Giuseppina; Grimoldi, Andrea; Sampietro, Marco; Natali, Dario; Caironi, Mario

    2015-01-01

    Photodetectors convert light pulses into electrical signals and are fundamental building blocks for any opto-electronic system adopting light as a probe or information carrier. They have widespread technological applications, from telecommunications to sensors in industrial, medical and civil environments. Further opportunities are plastic short-range communications systems, interactive large-area surfaces and light-weight, flexible, digital imagers. These applications would greatly benefit from the cost-effective fabrication processes enabled by printing technology. While organic semiconductors are the most investigated materials for printed photodetectors, and are the main focus of the present review, there are notable examples of other inorganic or hybrid printable semiconductors for opto-electronic systems, such as quantum-dots and nanowires. Here we propose an overview on printed photodetectors, including three-terminal phototransistors. We first give a brief account of the working mechanism of these light sensitive devices, and then we review the recent progress achieved with scalable printing techniques such as screen-printing, inkjet and other non-contact technologies in the development of all-printed or hybrid systems. (paper)

  10. Printed photodetectors

    Science.gov (United States)

    Pace, Giuseppina; Grimoldi, Andrea; Sampietro, Marco; Natali, Dario; Caironi, Mario

    2015-10-01

    Photodetectors convert light pulses into electrical signals and are fundamental building blocks for any opto-electronic system adopting light as a probe or information carrier. They have widespread technological applications, from telecommunications to sensors in industrial, medical and civil environments. Further opportunities are plastic short-range communications systems, interactive large-area surfaces and light-weight, flexible, digital imagers. These applications would greatly benefit from the cost-effective fabrication processes enabled by printing technology. While organic semiconductors are the most investigated materials for printed photodetectors, and are the main focus of the present review, there are notable examples of other inorganic or hybrid printable semiconductors for opto-electronic systems, such as quantum-dots and nanowires. Here we propose an overview on printed photodetectors, including three-terminal phototransistors. We first give a brief account of the working mechanism of these light sensitive devices, and then we review the recent progress achieved with scalable printing techniques such as screen-printing, inkjet and other non-contact technologies in the development of all-printed or hybrid systems.

  11. 3D printing PLGA: a quantitative examination of the effects of polymer composition and printing parameters on print resolution.

    Science.gov (United States)

    Guo, Ting; Holzberg, Timothy R; Lim, Casey G; Gao, Feng; Gargava, Ankit; Trachtenberg, Jordan E; Mikos, Antonios G; Fisher, John P

    2017-04-12

    In the past few decades, 3D printing has played a significant role in fabricating scaffolds with consistent, complex structure that meet patient-specific needs in future clinical applications. Although many studies have contributed to this emerging field of additive manufacturing, which includes material development and computer-aided scaffold design, current quantitative analyses do not correlate material properties, printing parameters, and printing outcomes to a great extent. A model that correlates these properties has tremendous potential to standardize 3D printing for tissue engineering and biomaterial science. In this study, we printed poly(lactic-co-glycolic acid) (PLGA) utilizing a direct melt extrusion technique without additional ingredients. We investigated PLGA with various lactic acid:glycolic acid (LA:GA) molecular weight ratios and end caps to demonstrate the dependence of the extrusion process on the polymer composition. Micro-computed tomography was then used to evaluate printed scaffolds containing different LA:GA ratios, composed of different fiber patterns, and processed under different printing conditions. We built a statistical model to reveal the correlation and predominant factors that determine printing precision. Our model showed a strong linear relationship between the actual and predicted precision under different combinations of printing conditions and material compositions. This quantitative examination establishes a significant foreground to 3D print biomaterials following a systematic fabrication procedure. Additionally, our proposed statistical models can be applied to couple specific biomaterials and 3D printing applications for patient implants with particular requirements.

  12. 3D printing PLGA: a quantitative examination of the effects of polymer composition and printing parameters on print resolution

    Science.gov (United States)

    Guo, Ting; Holzberg, Timothy R; Lim, Casey G; Gao, Feng; Gargava, Ankit; Trachtenberg, Jordan E; Mikos, Antonios G; Fisher, John P

    2018-01-01

    In the past few decades, 3D printing has played a significant role in fabricating scaffolds with consistent, complex structure that meet patient-specific needs in future clinical applications. Although many studies have contributed to this emerging field of additive manufacturing, which includes material development and computer-aided scaffold design, current quantitative analyses do not correlate material properties, printing parameters, and printing outcomes to a great extent. A model that correlates these properties has tremendous potential to standardize 3D printing for tissue engineering and biomaterial science. In this study, we printed poly(lactic-co-glycolic acid) (PLGA) utilizing a direct melt extrusion technique without additional ingredients. We investigated PLGA with various lactic acid: glycolic acid (LA:GA) molecular weight ratios and end caps to demonstrate the dependence of the extrusion process on the polymer composition. Micro-computed tomography was then used to evaluate printed scaffolds containing different LA:GA ratios, composed of different fiber patterns, and processed under different printing conditions. We built a statistical model to reveal the correlation and predominant factors that determine printing precision. Our model showed a strong linear relationship between the actual and predicted precision under different combinations of printing conditions and material compositions. This quantitative examination establishes a significant foreground to 3D print biomaterials following a systematic fabrication procedure. Additionally, our proposed statistical models can be applied to couple specific biomaterials and 3D printing applications for patient implants with particular requirements. PMID:28244880

  13. Characterization of the Copy Number and Variants of Deformed Wing Virus (DWV in the Pairs of Honey Bee Pupa and Infesting Varroa destructor or Tropilaelaps mercedesae

    Directory of Open Access Journals (Sweden)

    Yunfei Wu

    2017-08-01

    Full Text Available Recent honey bee colony losses, particularly during the winter, have been shown to be associated with the presence of both ectoparasitic mites and Deformed Wing Virus (DWV. Whilst the role of Varroa destructor mites as a viral vector is well established, the role of Tropilaelaps mercedesae mites in viral transmission has not been fully investigated. In this study, we tested the effects that V. destructor and T. mercedesae infestation have on fluctuation of the DWV copy number and alteration of the virus variants in honey bees by characterizing individual pupae and their infesting mites. We observed that both mite species were associated with increased viral copy number in honey bee pupae. We found a positive correlation between DWV copy number in pupae and copy number in infesting mites, and the same DWV type A variant was present in either low or high copy number in both honey bee pupae and infesting V. destructor. These data also suggest that variant diversity is similar between honey bee pupae and the mites that infest them. These results support a previously proposed hypothesis that DWV suppresses the honey bee immune system when virus copy number reaches a specific threshold, promoting greater replication.

  14. 31 CFR 27.3 - Assessment of civil penalties.

    Science.gov (United States)

    2010-07-01

    ..., Tobacco and Firearms,” “Bureau of the Public Debt,” “Bureau of Engraving and Printing,” “Comptroller of the Currency,” “Federal Law Enforcement Training Center,” “Financial Crimes Enforcement Network... Engraving and Printing,” “Comptroller of the Currency,” “Director of the Federal Law Enforcement Training...

  15. A Graphic Overlay Method for Selection of Osteotomy Site in Chronic Radial Head Dislocation: An Evaluation of 3D-printed Bone Models.

    Science.gov (United States)

    Kim, Hui Taek; Ahn, Tae Young; Jang, Jae Hoon; Kim, Kang Hee; Lee, Sung Jae; Jung, Duk Young

    2017-03-01

    Three-dimensional (3D) computed tomography imaging is now being used to generate 3D models for planning orthopaedic surgery, but the process remains time consuming and expensive. For chronic radial head dislocation, we have designed a graphic overlay approach that employs selected 3D computer images and widely available software to simplify the process of osteotomy site selection. We studied 5 patients (2 traumatic and 3 congenital) with unilateral radial head dislocation. These patients were treated with surgery based on traditional radiographs, but they also had full sets of 3D CT imaging done both before and after their surgery: these 3D CT images form the basis for this study. From the 3D CT images, each patient generated 3 sets of 3D-printed bone models: 2 copies of the preoperative condition, and 1 copy of the postoperative condition. One set of the preoperative models was then actually osteotomized and fixed in the manner suggested by our graphic technique. Arcs of rotation of the 3 sets of 3D-printed bone models were then compared. Arcs of rotation of the 3 groups of bone models were significantly different, with the models osteotomized accordingly to our graphic technique having the widest arcs. For chronic radial head dislocation, our graphic overlay approach simplifies the selection of the osteotomy site(s). Three-dimensional-printed bone models suggest that this approach could improve range of motion of the forearm in actual surgical practice. Level IV-therapeutic study.

  16. Winters fuels report

    International Nuclear Information System (INIS)

    1995-01-01

    The outlook for distillate fuel oil this winter is for increased demand and a return to normal inventory patterns, assuming a resumption of normal, cooler weather than last winter. With industrial production expected to grow slightly from last winter's pace, overall consumption is projected to increase 3 percent from last winter, to 3.4 million barrels per day during the heating season (October 1, 1995-March 31, 1996). Much of the supply win come from stock drawdowns and refinery production. Estimates for the winter are from the Energy Information Administration's (EIA) 4th Quarter 1995 Short-Tenn Energy Outlook (STEO) Mid-World Oil Price Case forecast. Inventories in place on September 30, 1995, of 132 million barrels were 9 percent below the unusually high year-earlier level. Inventories of high-sulfur distillate fuel oil, the principal type used for heating, were 13 percent lower than a year earlier. Supply problems are not anticipated because refinery production and the ready availability of imports should be adequate to meet demand. Residential heating off prices are expected to be somewhat higher than last winter's, as the effects of lower crude oil prices are offset by lower distillate inventories. Heating oil is forecast to average $0.92 per gallon, the highest price since the winter of 1992-93. Diesel fuel (including tax) is predicted to be slightly higher than last year at $1.13 per gallon. This article focuses on the winter assessment for distillate fuel oil, how well last year's STEO winter outlook compared to actual events, and expectations for the coming winter. Additional analyses include regional low-sulfur and high-sulfur distillate supply, demand, and prices, and recent trends in distillate fuel oil inventories

  17. 25 CFR 273.18 - Additional requirements for education plan.

    Science.gov (United States)

    2010-04-01

    ... EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Application Process § 273.18... of employees for each special program and number of Indian employees for that program. (k) State the...) Program goals and objectives related to the learning needs of potential target students. (2) Procedures...

  18. Winter to winter recurrence of atmospheric circulation anomalies over East Asia and its impact on winter surface air temperature anomalies.

    Science.gov (United States)

    Zhao, Xia; Yang, Guang

    2017-01-01

    The persistence of atmospheric circulation anomalies over East Asia shows a winter to winter recurrence (WTWR) phenomenon. Seasonal variations in sea level pressure anomalies and surface wind anomalies display significantly different characteristics between WTWR and non-WTWR years. The WTWR years are characterized by the recurrence of both a strong (weak) anomalous Siberian High and an East Asian winter monsoon over two successive winters without persistence through the intervening summer. However, anomalies during the non-WTWR years have the opposite sign between the current and ensuing winters. The WTWR of circulation anomalies contributes to that of surface air temperature anomalies (SATAs), which is useful information for improving seasonal and interannual climate predictions over East Asia and China. In the positive (negative) WTWR years, SATAs are cooler (warmer) over East Asia in two successive winters, but the signs of the SATAs are opposite in the preceding and subsequent winters during the non-WTWR years.

  19. Local copying of orthogonal entangled quantum states

    International Nuclear Information System (INIS)

    Anselmi, Fabio; Chefles, Anthony; Plenio, Martin B

    2004-01-01

    In classical information theory one can, in principle, produce a perfect copy of any input state. In quantum information theory, the no cloning theorem prohibits exact copying of non-orthogonal states. Moreover, if we wish to copy multiparticle entangled states and can perform only local operations and classical communication (LOCC), then further restrictions apply. We investigate the problem of copying orthogonal, entangled quantum states with an entangled blank state under the restriction to LOCC. Throughout, the subsystems have finite dimension D. We show that if all of the states to be copied are non-maximally entangled, then novel LOCC copying procedures based on entanglement catalysis are possible. We then study in detail the LOCC copying problem where both the blank state and at least one of the states to be copied are maximally entangled. For this to be possible, we find that all the states to be copied must be maximally entangled. We obtain a necessary and sufficient condition for LOCC copying under these conditions. For two orthogonal, maximally entangled states, we provide the general solution to this condition. We use it to show that for D = 2, 3, any pair of orthogonal, maximally entangled states can be locally copied using a maximally entangled blank state. However, we also show that for any D which is not prime, one can construct pairs of such states for which this is impossible

  20. Replicas in Cultural Heritage: 3d Printing and the Museum Experience

    Science.gov (United States)

    Ballarin, M.; Balletti, C.; Vernier, P.

    2018-05-01

    3D printing has seen a recent massive diffusion for several applications, not least the field of Cultural Heritage. Being used for different purposes, such as study, analysis, conservation or access in museum exhibitions, 3D printed replicas need to undergo a process of validation also in terms of metrical precision and accuracy. The Laboratory of Photogrammetry of Iuav University of Venice has started several collaborations with Italian museum institutions firstly for the digital acquisition and then for the physical reproduction of objects of historical and artistic interest. The aim of the research is to analyse the metric characteristics of the printed model in relation to the original data, and to optimize the process that from the survey leads to the physical representation of an object. In fact, this could be acquired through different methodologies that have different precisions (multi-image photogrammetry, TOF laser scanner, triangulation based laser scanner), and it always involves a long processing phase. It should not be forgotten that the digital data have to undergo a series of simplifications, which, on one hand, eliminate the noise introduced by the acquisition process, but on the other one, they can lead to discrepancies between the physical copy and the original geometry. In this paper we will show the results obtained on a small archaeological find that was acquired and reproduced for a museum exhibition intended for blind and partially sighted people.

  1. Printing Insecurity? The Security Implications of 3D-Printing of Weapons.

    Science.gov (United States)

    Walther, Gerald

    2015-12-01

    In 2013, the first gun printed out of plastic by a 3D-printer was successfully fired in the U.S. This event caused a major media hype about the dangers of being able to print a gun. Law enforcement agencies worldwide were concerned about this development and the potentially huge security implications of these functional plastic guns. As a result, politicians called for a ban of these weapons and a control of 3D-printing technology. This paper reviews the security implications of 3D-printing technology and 3D guns. It argues that current arms control and transfer policies are adequate to cover 3D-printed guns as well. However, while this analysis may hold up currently, progress in printing technology needs to be monitored to deal with future dangers pre-emptively.

  2. Patterns, correlates, and reduction of homework copying

    Directory of Open Access Journals (Sweden)

    David J. Palazzo

    2010-03-01

    Full Text Available Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days prior to the deadline, whereas repetitive copiers (those who copied >30% of their submitted problems exerted little effort early. Importantly, copying homework problems that require an analytic answer correlates with a 2(σ decline over the semester in relative score for similar problems on exams but does not significantly correlate with the amount of conceptual learning as measured by pretesting and post-testing. An anonymous survey containing questions used in many previous studies of self-reported academic dishonesty showed ∼1/3 less copying than actually was detected. The observed patterns of copying, free response questions on the survey, and interview data suggest that time pressure on students who do not start their homework in a timely fashion is the proximate cause of copying. Several measures of initial ability in math or physics correlated with copying weakly or not at all. Changes in course format and instructional practices that previous self-reported academic dishonesty surveys and/or the observed copying patterns suggested would reduce copying have been accompanied by more than a factor of 4 reduction of copying from ∼11% of all electronic problems to less than 3%. As expected (since repetitive copiers have approximately three times the chance of failing, this was accompanied by a reduction in the overall course failure rate. Survey results indicate that students copy almost twice as much written homework as online homework and show that students nationally admit to more academic dishonesty than MIT students.

  3. Winter is losing its cool

    Science.gov (United States)

    Feng, S.

    2017-12-01

    Winter seasons have significant societal impacts across all sectors ranging from direct human health to ecosystems, transportation, and recreation. This study quantifies the severity of winter and its spatial-temporal variations using a newly developed winter severity index and daily temperature, snowfall and snow depth. The winter severity and the number of extreme winter days are decreasing across the global terrestrial areas during 1901-2015 except the southeast United States and isolated regions in the Southern Hemisphere. These changes are dominated by winter warming, while the changes in daily snowfall and snow depth played a secondary role. The simulations of multiple CMIP5 climate models can well capture the spatial and temporal variations of the observed changes in winter severity and extremes during 1951-2005. The models are consistent in projecting a future milder winter under various scenarios. The winter severity is projected to decrease 60-80% in the middle-latitude Northern Hemisphere under the business-as-usual scenario. The winter arrives later, ends earlier and the length of winter season will be notably shorter. The changes in harsh winter in the polar regions are weak, mainly because the warming leads to more snowfall in the high latitudes.

  4. Print Finishing: From Manual to Automated Print Finishing

    Directory of Open Access Journals (Sweden)

    Gareth Ward

    2004-12-01

    Full Text Available Meeting the demand for faster turnrounds and shorter print runs goes beyond making the printing press easier to set up and change. There is little point in producing plates and then sheets from a press if the post press area does not change to keep abreast of developments in prepress and the print room. The greatest impact is going to come from JDF, the end to end production data format which is finding wide spread acceptance in print areas. To date finishing equipment manufacturers are not as well represented within the CIP4 organisation as prepress and press vendors, but the major manufacturers are members. All are working to the goal of complete connectivity.The idea of JDF is that if the format of a print product like a magazine is known during the creation phases, the information can be used to preset machinery that is going to be used to produce it, so avoiding input errors and saving manufacturing time.A second aspect to JDF is that information about performance and progress is gathered and can be retrieved from a central point or made available to a customer. Production scheduling and costing becomes more accurate and customer relationships are deepened. However JDF to its fullest extent is not yet in use in connecting the finishing area to the rest of the printing plant. Around the world different companies are testing the idea of JDF to connect saddle stitchers, guillotines and binders with frantic work underway to be able to show results soon.

  5. A high speed electrohydrodynamic (EHD) jet printing method for line printing

    International Nuclear Information System (INIS)

    Phung, Thanh Huy; Kim, Seora; Kwon, Kye-Si

    2017-01-01

    Electrohydrodynamic (EHD) jet printing has drawn attention due to its capability to produce smaller dots and patterns with finer lines when compared to those obtained from using conventional inkjet printing. Previous studies have suggested that drop-on-demand EHD-patterning applications should be limited to very slow printing cases with speeds far less than 10 mm s −1 due to the small dot size and limited jetting frequency. In this study, a new EHD printing method is proposed to significantly increase the line-patterning printing speed by modifying the ink and thereby changing the relic shape. The proposed method has the additional advantage of reducing the line-pattern width. The results of the experiment show that the pattern width could be reduced from 20 µ m to 4 µ m by increasing the printing speed from 10 mm s −1 to 50 mm s −1 , respectively. (paper)

  6. OPTICAL MONITORING OF TWO BRIGHTEST NEARBY QUASARS, PHL 1811 AND 3C 273

    International Nuclear Information System (INIS)

    Fan, J. H.; Liu, Y.; Yuan, Y. H.; Kurtanidze, O.; Chanishvili, R.; Richter, G. M.

    2014-01-01

    Variability is one of the most observable characteristics of active galactic nuclei, and it is important when considering the emission mechanism. In this paper, we report optical photometry monitoring of two nearby brightest quasars, PHL 1811 and 3C 273, using the ST-6 camera attached to the Newtonian focus and the Ap6E CCD camera attached to the primary focus of the 70 cm meniscus telescope at the Abastumani Observatory, Georgia. PHL 1811 was monitored during the period from 2002 September to 2012 December, while 3C 273 was monitored during the period from 1998 February to 2008 May. During our monitoring period, the two sources did not show any significant intra-day variability. The largest detected variations are ΔR = 0.112 ± 0.010 mag. for PHL 1811, ΔB = 0.595 ± 0.099 mag, ΔV = 0.369 ± 0.028 mag, ΔR = 0.495 ± 0.076 mag, and ΔI = 0.355 ± 0.009 mag for 3C 273. When the periodicity analysis methods are adopted for the observations of the sources, a period of p = 5.80 ± 1.12 yr is obtained for PHL 1811 in the R light curve in the present work, and periods of p = 21.10 ± 0.14, 10.00 ± 0.14, 7.30 ± 0.09, 13.20 ± 0.09, 2.10 ± 0.06, and 0.68 ± 0.05 yr are obtained for 3C 273 based on the data in the present work combined with historical works

  7. OPTICAL MONITORING OF TWO BRIGHTEST NEARBY QUASARS, PHL 1811 AND 3C 273

    Energy Technology Data Exchange (ETDEWEB)

    Fan, J. H.; Liu, Y.; Yuan, Y. H. [Center for Astrophysics, Guangzhou University, Guangzhou 510006 (China); Kurtanidze, O.; Chanishvili, R. [Abastumani Observatory, Mt. Kanobili, 0301 Abastumani, Georgia (United States); Richter, G. M. [Astrophysikalisches Institut Potsdam, An der Sternwarte 16, D-14482 Potsdam (Germany)

    2014-08-01

    Variability is one of the most observable characteristics of active galactic nuclei, and it is important when considering the emission mechanism. In this paper, we report optical photometry monitoring of two nearby brightest quasars, PHL 1811 and 3C 273, using the ST-6 camera attached to the Newtonian focus and the Ap6E CCD camera attached to the primary focus of the 70 cm meniscus telescope at the Abastumani Observatory, Georgia. PHL 1811 was monitored during the period from 2002 September to 2012 December, while 3C 273 was monitored during the period from 1998 February to 2008 May. During our monitoring period, the two sources did not show any significant intra-day variability. The largest detected variations are ΔR = 0.112 ± 0.010 mag. for PHL 1811, ΔB = 0.595 ± 0.099 mag, ΔV = 0.369 ± 0.028 mag, ΔR = 0.495 ± 0.076 mag, and ΔI = 0.355 ± 0.009 mag for 3C 273. When the periodicity analysis methods are adopted for the observations of the sources, a period of p = 5.80 ± 1.12 yr is obtained for PHL 1811 in the R light curve in the present work, and periods of p = 21.10 ± 0.14, 10.00 ± 0.14, 7.30 ± 0.09, 13.20 ± 0.09, 2.10 ± 0.06, and 0.68 ± 0.05 yr are obtained for 3C 273 based on the data in the present work combined with historical works.

  8. 25 CFR 273.37 - Use of funds outside of schools.

    Science.gov (United States)

    2010-04-01

    ... Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT PROGRAM EDUCATION CONTRACTS UNDER JOHNSON-O'MALLEY ACT Funding Provisions § 273.37 Use of funds outside of schools. Nothing in these regulations shall prevent the Commissioner from contracting...

  9. Engraving Print Classification

    International Nuclear Information System (INIS)

    Hoelck, Daniel; Barbe, Joaquim

    2008-01-01

    A print is a mark, or drawing, made in or upon a plate, stone, woodblock or other material which is cover with ink and then is press usually into a paper reproducing the image on the paper. Engraving prints usually are image composed of a group of binary lines, specially those are made with relief and intaglio techniques. Varying the number and the orientation of lines, the drawing of the engraving print is conformed. For this reason we propose an application based on image processing methods to classify engraving prints

  10. The drama of illumination: artist's approaches to the creation of HDR in paintings and prints

    Science.gov (United States)

    Parraman, Carinna

    2010-02-01

    For many centuries artists have considered and depicted illumination in art, from the effect of sunlight on objects at different times of the day, of shadows and highlights as cast by the moon, through indirect light as that through an open window or the artificial light of the candle or firelight. The presentation will consider artists who were fascinated by the phenomena of natural and artificial illumination and how they were able to render the natural world as a form of dynamic range through pigment. Artists have been long aware of the psychological aspects of the juxtaposition of colour in exploiting the optical qualities and arranging visual effects in painting and prints. Artists in the 16th century were attempting to develop an extended dynamic range through multi-colour, wood-block printing. Artists working at the height of naturalist realism in the 17th through the 19th century were fascinated by the illusory nature of light on objects. The presentation will also consider the interpretation of dynamic range through the medium of mezzotint, possibly the most subtle of printing methods, which was used by printers to copy paintings, and to create highly original works of art containing a dynamic range of tones.

  11. Printing Insecurity? The Security Implications of 3D-Printing of Weapons

    OpenAIRE

    Walther, Gerald

    2014-01-01

    In 2013, the first gun printed out of plastic by a 3D-printer was successfully fired in the US. This event caused a major media hype about the dangers of being able to print a gun. Law enforcement agencies worldwide were concerned about this development and the potentially huge security implications of these functional plastic guns. As a result, politicians called for a ban of these weapons and a control of 3D-printing technology. This paper reviews the security implications of 3D-printing te...

  12. Multiple-copy entanglement transformation and entanglement catalysis

    International Nuclear Information System (INIS)

    Duan Runyao; Feng Yuan; Li Xin; Ying Mingsheng

    2005-01-01

    We prove that any multiple-copy entanglement transformation [S. Bandyopadhyay, V. Roychowdhury, and U. Sen, Phys. Rev. A 65, 052315 (2002)] can be implemented by a suitable entanglement-assisted local transformation [D. Jonathan and M. B. Plenio, Phys. Rev. Lett. 83, 3566 (1999)]. Furthermore, we show that the combination of multiple-copy entanglement transformation and the entanglement-assisted one is still equivalent to the pure entanglement-assisted one. The mathematical structure of multiple-copy entanglement transformations then is carefully investigated. Many interesting properties of multiple-copy entanglement transformations are presented, which exactly coincide with those satisfied by the entanglement-assisted ones. Most interestingly, we show that an arbitrarily large number of copies of state should be considered in multiple-copy entanglement transformations

  13. New winter hardy winter bread wheat cultivar (Triticum aestivum L. Voloshkova

    Directory of Open Access Journals (Sweden)

    Л. М. Голик

    2007-12-01

    Full Text Available Creation of Initial raw for breeding of winter wheat by change of the development type under low temperatures influence was described. Seeds of spring wheat were vernalized in aluminum weighting bottle. By using low temperatures at sawing of M2-6 at the begin ind of optimal terms of sawing of winter wheat, new winter-hardy variety of Voloshkova was bred.

  14. Adult rat retinal ganglion cells and glia can be printed by piezoelectric inkjet printing

    International Nuclear Information System (INIS)

    Lorber, Barbara; Martin, Keith R; Hsiao, Wen-Kai; Hutchings, Ian M

    2014-01-01

    We have investigated whether inkjet printing technology can be extended to print cells of the adult rat central nervous system (CNS), retinal ganglion cells (RGC) and glia, and the effects on survival and growth of these cells in culture, which is an important step in the development of tissue grafts for regenerative medicine, and may aid in the cure of blindness. We observed that RGC and glia can be successfully printed using a piezoelectric printer. Whilst inkjet printing reduced the cell population due to sedimentation within the printing system, imaging of the printhead nozzle, which is the area where the cells experience the greatest shear stress and rate, confirmed that there was no evidence of destruction or even significant distortion of the cells during jet ejection and drop formation. Importantly, the viability of the cells was not affected by the printing process. When we cultured the same number of printed and non-printed RGC/glial cells, there was no significant difference in cell survival and RGC neurite outgrowth. In addition, use of a glial substrate significantly increased RGC neurite outgrowth, and this effect was retained when the cells had been printed. In conclusion, printing of RGC and glia using a piezoelectric printhead does not adversely affect viability and survival/growth of the cells in culture. Importantly, printed glial cells retain their growth-promoting properties when used as a substrate, opening new avenues for printed CNS grafts in regenerative medicine. (paper)

  15. 33 CFR 100.109 - Winter Harbor Lobster Boat Race, Winter Harbor, ME.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Winter Harbor Lobster Boat Race, Winter Harbor, ME. 100.109 Section 100.109 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.109 Winter Harbor...

  16. Advances in Home Photo Printing

    Institute of Scientific and Technical Information of China (English)

    Qian Lin; Brian Atkins; Huitao Luo

    2004-01-01

    With digital camera adoptions going main stream, consumers capture a record number of photos.Currently, the majority of the digital photos are printed at home. One of the key enablers of this transformation is the advancement of home photo printing technologies. In the past few years, inkjet printing technologies have continued to deliver smaller drop size, larger number of inks, and longer-lasting prints. In the mean time, advanced image processing automatically enhances captured digital photos while being printed. The combination of the above two forces has closed the gap between the home photo prints and AgX prints. It will give an overview of the home photo printing market and technology trends, and discuss major advancements in automatic image processing.

  17. Hard Copy Market Overview

    Science.gov (United States)

    Testan, Peter R.

    1987-04-01

    A number of Color Hard Copy (CHC) market drivers are currently indicating strong growth in the use of CHC technologies for the business graphics marketplace. These market drivers relate to product, software, color monitors and color copiers. The use of color in business graphics allows more information to be relayed than is normally the case in a monochrome format. The communicative powers of full-color computer generated output in the business graphics application area will continue to induce end users to desire and require color in their future applications. A number of color hard copy technologies will be utilized in the presentation graphics arena. Thermal transfer, ink jet, photographic and electrophotographic technologies are all expected to be utilized in the business graphics presentation application area in the future. Since the end of 1984, the availability of color application software packages has grown significantly. Sales revenue generated by business graphics software is expected to grow at a compound annual growth rate of just over 40 percent to 1990. Increased availability of packages to allow the integration of text and graphics is expected. Currently, the latest versions of page description languages such as Postscript, Interpress and DDL all support color output. The use of color monitors will also drive the demand for color hard copy in the business graphics market place. The availability of higher resolution screens is allowing color monitors to be easily used for both text and graphics applications in the office environment. During 1987, the sales of color monitors are expected to surpass the sales of monochrome monitors. Another major color hard copy market driver will be the color copier. In order to take advantage of the communications power of computer generated color output, multiple copies are required for distribution. Product introductions of a new generation of color copiers is now underway with additional introductions expected

  18. Printed Electronics

    Science.gov (United States)

    Korkut, Sibel (Inventor); Chiang, Katherine S. (Inventor); Crain, John M. (Inventor); Aksay, Ilhan A. (Inventor); Lettow, John S. (Inventor); Chen, Chuan-Hua (Inventor); Prud'Homme, Robert K. (Inventor)

    2018-01-01

    Printed electronic device comprising a substrate onto at least one surface of which has been applied a layer of an electrically conductive ink comprising functionalized graphene sheets and at least one binder. A method of preparing printed electronic devices is further disclosed.

  19. Flash light sintered copper precursor/nanoparticle pattern with high electrical conductivity and low porosity for printed electronics

    International Nuclear Information System (INIS)

    Chung, Wan-Ho; Hwang, Hyun-Jun; Kim, Hak-Sung

    2015-01-01

    In this work, the hybrid copper inks with precursor and nanoparticles were fabricated and sintered via flash light irradiation to achieve highly conductive electrode pattern with low porosity. The hybrid copper ink was made of copper nanoparticles and various copper precursors (e.g., copper(II) chloride, copper(II) nitrate trihydrate, copper(II) sulfate pentahydrate and copper(II) trifluoroacetylacetonate). The printed hybrid copper inks were sintered at room temperature and under ambient conditions using an in-house flash light sintering system. The effects of copper precursor weight fraction and the flash light irradiation conditions (light energy and pulse duration) were investigated. Surfaces of the sintered hybrid copper patterns were analyzed using a scanning electron microscope. Also, spectroscopic characterization techniques such as Fourier transform infrared spectroscopy and X-ray diffraction were used to investigate the crystal phases of the flash light sintered copper precursors. High conductivity hybrid copper patterns (27.3 μΩ cm), which is comparable to the resistivity of bulk copper (1.68 μΩ cm) were obtained through flash light sintering at room temperature and under ambient conditions. - Highlights: • The hybrid copper inks with precursor and nanoparticles were fabricated. • The hybrid copper ink was sintered via flash light irradiation. • The resistivity of sintered hybrid copper ink was 27.3 μΩ cm. • Highly conductive copper film with low porosity could be achieved

  20. Flash light sintered copper precursor/nanoparticle pattern with high electrical conductivity and low porosity for printed electronics

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Wan-Ho; Hwang, Hyun-Jun [Department of Mechanical Convergence Engineering, Hanyang University, 17 Haendang-Dong, Seongdong-Gu, Seoul 133-791 (Korea, Republic of); Kim, Hak-Sung, E-mail: kima@hanyang.ac.kr [Department of Mechanical Convergence Engineering, Hanyang University, 17 Haendang-Dong, Seongdong-Gu, Seoul 133-791 (Korea, Republic of); Institute of Nano Science and Technology, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2015-04-01

    In this work, the hybrid copper inks with precursor and nanoparticles were fabricated and sintered via flash light irradiation to achieve highly conductive electrode pattern with low porosity. The hybrid copper ink was made of copper nanoparticles and various copper precursors (e.g., copper(II) chloride, copper(II) nitrate trihydrate, copper(II) sulfate pentahydrate and copper(II) trifluoroacetylacetonate). The printed hybrid copper inks were sintered at room temperature and under ambient conditions using an in-house flash light sintering system. The effects of copper precursor weight fraction and the flash light irradiation conditions (light energy and pulse duration) were investigated. Surfaces of the sintered hybrid copper patterns were analyzed using a scanning electron microscope. Also, spectroscopic characterization techniques such as Fourier transform infrared spectroscopy and X-ray diffraction were used to investigate the crystal phases of the flash light sintered copper precursors. High conductivity hybrid copper patterns (27.3 μΩ cm), which is comparable to the resistivity of bulk copper (1.68 μΩ cm) were obtained through flash light sintering at room temperature and under ambient conditions. - Highlights: • The hybrid copper inks with precursor and nanoparticles were fabricated. • The hybrid copper ink was sintered via flash light irradiation. • The resistivity of sintered hybrid copper ink was 27.3 μΩ cm. • Highly conductive copper film with low porosity could be achieved.

  1. Printing Has a Future

    Directory of Open Access Journals (Sweden)

    Hans Georg Wenke

    2004-12-01

    Full Text Available Printing will also be done in the future. Printed items meet basic needs and are deeply anchored in people’s habits. Being able to handle and collect printed matter is highly attractive. And paper is now more alive than ever. It is therefore too shortsighted to disclaim the importance of one of the still large economic sectors just because of a few looming-recession instigated market shifts.The exciting aspect of drupa 2004 is: printing will be reinvented, so to speak. Much more printing will be done in the future than at present. On the one hand, people are concentrating on process optimization and automation to ensure this. Measuring and testing, process control and optimization, and linking up "office software" with printing technology will be very central topics at drupa 2004. Electronics and print are not rivals; a symbiosis exists. And printing is high-tech: hardly any other multifaceted sector which has been so successful for centuries is as computerized as the printing industry.A series of "new chapters" in the variety of printing possibilities will be opened at drupa. Talk will be generated by further technical developments, often the connection between paper/cardboard and electronics, the link between the office world and graphics industry, text databases and their link-up to graphic page production tools, and "on the fly" dynamic printing over networks.All of this and more belongs to future potentialities, which are so substantial overall, the outlook is by no means black for the "black art". Like its predecessors, drupa 2004 is also a product trade fair. However, more than ever before in its history, it is also an "information village". The exhibits are useful, because they occasionally make what this means visible.

  2. Printing quality control automation

    Science.gov (United States)

    Trapeznikova, O. V.

    2018-04-01

    One of the most important problems in the concept of standardizing the process of offset printing is the control the quality rating of printing and its automation. To solve the problem, a software has been developed taking into account the specifics of printing system components and the behavior in printing process. In order to characterize the distribution of ink layer on the printed substrate the so-called deviation of the ink layer thickness on the sheet from nominal surface is suggested. The geometric data construction the surface projections of the color gamut bodies allows to visualize the color reproduction gamut of printing systems in brightness ranges and specific color sectors, that provides a qualitative comparison of the system by the reproduction of individual colors in a varying ranges of brightness.

  3. Practical method for appearance match between soft copy and hard copy

    Science.gov (United States)

    Katoh, Naoya

    1994-04-01

    CRT monitors are often used as a soft proofing device for the hard copy image output. However, what the user sees on the monitor does not match its output, even if the monitor and the output device are calibrated with CIE/XYZ or CIE/Lab. This is especially obvious when correlated color temperature (CCT) of CRT monitor's white point significantly differs from ambient light. In a typical office environment, one uses a computer graphic monitor having a CCT of 9300K in a room of white fluorescent light of 4150K CCT. In such a case, human visual system is partially adapted to the CRT monitor's white point and partially to the ambient light. The visual experiments were performed on the effect of the ambient lighting. Practical method for soft copy color reproduction that matches the hard copy image in appearance is presented in this paper. This method is fundamentally based on a simple von Kries' adaptation model and takes into account the human visual system's partial adaptation and contrast matching.

  4. Solvents interactions with thermochromic print

    Directory of Open Access Journals (Sweden)

    Mirela Rožić

    2017-12-01

    Full Text Available In this study, the interactions between different solvents (benzene, acetone, cyclohexanone, various alcohols and water and thermochromic printing ink were investigated. Thermochromic printing ink was printed on metal surface. Components of thermochromic printing inks are polymeric microcapsules and classic yellow offset printing ink. Below its activation temperature, dye and developer within the microcapsules form a blue coloured complex. Therefore, thermochromic print is green. By heating above the activation temperature, blue colour of the complex turns into the leuco dye colourless state and the green colour of the prints turns into the yellow colour of the classic offset pigment. The results of the interaction with various solvents show that the thermochromic print is stable in all tested solvents except in ethanol, acetone and cyclohexanone. In ethanol, the green colour of the print becomes yellow. SEM analysis shows that microcapsules are dissolved. In acetone and cyclohexanone, the green colour of the print turns into blue, and the microcapsules become significantly more visible. Thus, the yellow pigment interacts with examined ketones. Based on the obtained interactions it can be concluded that the microcapsules have more polar nature than the classical pigment particles. Solvent-thermocromic print interactions were analysed using Hansen solubility parameters that rank the solvents based on their estimated interaction capabilities.

  5. Analysis of T-DNA integration and generative segregation in transgenic winter triticale (x Triticosecale Wittmack

    Directory of Open Access Journals (Sweden)

    Hensel Goetz

    2012-09-01

    Full Text Available Abstract Background While the genetic transformation of the major cereal crops has become relatively routine, to date only a few reports were published on transgenic triticale, and robust data on T-DNA integration and segregation have not been available in this species. Results Here, we present a comprehensive analysis of stable transgenic winter triticale cv. Bogo carrying the selectable marker gene HYGROMYCIN PHOSPHOTRANSFERASE (HPT and a synthetic green fluorescent protein gene (gfp. Progeny of four independent transgenic plants were comprehensively investigated with regard to the number of integrated T-DNA copies, the number of plant genomic integration loci, the integrity and functionality of individual T-DNA copies, as well as the segregation of transgenes in T1 and T2 generations, which also enabled us to identify homozygous transgenic lines. The truncation of some integrated T-DNAs at their left end along with the occurrence of independent segregation of multiple T-DNAs unintendedly resulted in a single-copy segregant that is selectable marker-free and homozygous for the gfp gene. The heritable expression of gfp driven by the maize UBI-1 promoter was demonstrated by confocal laser scanning microscopy. Conclusions The used transformation method is a valuable tool for the genetic engineering of triticale. Here we show that comprehensive molecular analyses are required for the correct interpretation of phenotypic data collected from the transgenic plants.

  6. Three-dimensional bio-printing.

    Science.gov (United States)

    Gu, Qi; Hao, Jie; Lu, YangJie; Wang, Liu; Wallace, Gordon G; Zhou, Qi

    2015-05-01

    Three-dimensional (3D) printing technology has been widely used in various manufacturing operations including automotive, defence and space industries. 3D printing has the advantages of personalization, flexibility and high resolution, and is therefore becoming increasingly visible in the high-tech fields. Three-dimensional bio-printing technology also holds promise for future use in medical applications. At present 3D bio-printing is mainly used for simulating and reconstructing some hard tissues or for preparing drug-delivery systems in the medical area. The fabrication of 3D structures with living cells and bioactive moieties spatially distributed throughout will be realisable. Fabrication of complex tissues and organs is still at the exploratory stage. This review summarize the development of 3D bio-printing and its potential in medical applications, as well as discussing the current challenges faced by 3D bio-printing.

  7. Printing at CERN

    CERN Multimedia

    Otto, R

    2007-01-01

    For many years CERN had a very sophisticated print server infrastructure which supported several different protocols (AppleTalk, IPX and TCP/IP) and many different printing standards. Today’s situation differs a lot: we have a much more homogenous network infrastructure, where TCP/IP is used everywhere and we have less printer models, which almost all work using current standards (i.e. they all provide PostScript drivers). This change gave us the possibility to review the printing architecture aiming at simplifying the infrastructure in order to achieve full automation of the service. The new infrastructure offers both: LPD service exposing print queues to Linux and Mac OS X computers and native printing for Windows based clients. The printer driver distribution is automatic and native on Windows and automated by custom mechanisms on Linux, where the appropriate Foomatic drivers are configured. Also the process of printer registration and queue creation is completely automated following the printer regis...

  8. Copy Counts

    Science.gov (United States)

    Beaumont, Lee R.

    1970-01-01

    The level of difficulty of straight copy, which is used to measure typewriting speed, is influenced by syllable intensity (the average number of syllables per word), stroke intensity (average number of strokes per word), and high-frequency words. (CH)

  9. Distinct summer and winter bacterial communities in the active layer of Svalbard permafrost revealed by DNA- and RNA-based analyses

    DEFF Research Database (Denmark)

    Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.

    2015-01-01

    organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below -10ºC. Multivariate statistical analysis of the bacterial diversity data (DNA......The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78º......N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable...

  10. Winter Weather Emergencies

    Science.gov (United States)

    Severe winter weather can lead to health and safety challenges. You may have to cope with Cold related health problems, including ... there are no guarantees of safety during winter weather emergencies, you can take actions to protect yourself. ...

  11. Printing nanotube/nanowire for flexible microsystems

    Science.gov (United States)

    Tortorich, Ryan P.; Choi, Jin-Woo

    2014-04-01

    Printing has become an emerging manufacturing technology for mechanics, electronics, and consumer products. Additionally, both nanotubes and nanowires have recently been used as materials for sensors and electrodes due to their unique electrical and mechanical properties. Printed electrodes and conductive traces particularly offer versatility of fabricating low-cost, disposable, and flexible electrical devices and microsystems. While various printing methods such as screen printing have been conventional methods for printing conductive traces and electrodes, inkjet printing has recently attracted great attention due to its unique advantages including no template requirement, rapid printing at low cost, on-demand printing capability, and precise control of the printed material. Computer generated conductive traces or electrode patterns can simply be printed on a thin film substrate with proper conductive ink consisting of nanotubes or nanowires. However, in order to develop nanotube or nanowire ink, there are a few challenges that need to be addressed. The most difficult obstacle to overcome is that of nanotube/nanowire dispersion within a solution. Other challenges include adjusting surface tension and controlling viscosity of the ink as well as treating the surface of the printing substrate. In an attempt to pave the way for nanomaterial inkjet printing, we present a method for preparing carbon nanotube ink as well as its printing technique. A fully printed electrochemical sensor using inkjet-printed carbon nanotube electrodes is also demonstrated as an example of the possibilities for this technology.

  12. Colour changes in prints during long-term dark storage of prints

    International Nuclear Information System (INIS)

    Parraman, Carinna

    2010-01-01

    The most significant impact on colour fading in prints is exposure to light and air. However what happens to coloured prints during long-term storage in boxes, drawers and on shelves? Measurements of samples, printed in July 2005, stored in a range of light and darkened storage conditions have shown some interesting initial results. As more emphasis is placed on the effects of light, the dark stability of inkjet prints is relatively overlooked when considering how to preserve or store coloured prints. This study and presentation builds on previous research [1] and has concentrated on the changes to colour during storage. With reference to ASTM F2035 - 00(2006) Standard Practice for Measuring the Dark Stability of Ink Jet Prints, the Standards outline points out that whilst natural aging is the most reliable method of assessing image stability, materials and inks any data that is produced quickly becomes redundant; therefore accelerated aging is more preferred. However, the fine art materials in this study are still very much in circulation. The leading fine art papers, and pigmented ink-sets used in these trials are still being used by artists. We can therefore demonstrate the characteristics of colour changes and the impact of ink on paper that utilises natural aging methods.

  13. Bindings and covers of Cyrillic old printed editions of Holy Dormition Pochayiv Lavra publishing house

    Directory of Open Access Journals (Sweden)

    Zheleznyak O.

    2014-01-01

    Full Text Available The article observes bindings and covers of Holy Dormition Pochayiv monastery publishing house editions. On the basis of copies from V. Vernadsky National Library of Ukraine fonds the covering material and decoration (centerpieces, ornaments, corner pieces of Pochayiv editions covers are analyzed. Besides that, distinctive features of Pochaiv publishing house bindings and covers are defined and described. Description of bindings enabled us to find bookbinder’s chiches, which had often been put on bottom endleafs. Special attention in the article is paid to highly artistic decoration of Pochayiv publishing house bindings of Altar Gospels. In the eighties of 18th century Pochayiv publishing house printed books, ordered by Old Believers. As a rule Old Believers editions derive all their compositional elements from books of 17th century, published before the reform. Bindings of Pochayiv Old Believers editions, distinctive for its modest decoration, are not exception of this rule. Besides that, Pochayiv old printed books were sometimes binded in covers made by Kyiv Pechersk Lavra craftsmen. Centerpieces of these covers sometimes contain the image of Kyiv Holy Dormition cathedral.

  14. A Vector Printing Method for High-Speed Electrohydrodynamic (EHD Jet Printing Based on Encoder Position Sensors

    Directory of Open Access Journals (Sweden)

    Thanh Huy Phung

    2018-02-01

    Full Text Available Electrohyrodynamic (EHD jet printing has been widely used in the field of direct micro-nano patterning applications, due to its high resolution printing capability. So far, vector line printing using a single nozzle has been widely used for most EHD printing applications. However, the application has been limited to low-speed printing, to avoid non-uniform line width near the end points where line printing starts and ends. At end points of line vector printing, the deposited drop amount is likely to be significantly large compared to the rest of the printed lines, due to unavoidable acceleration and deceleration. In this study, we proposed a method to solve the printing quality problems by producing droplets at an equally spaced distance, irrespective of the printing speed. For this purpose, an encoder processing unit (EPU was developed, so that the jetting trigger could be generated according to user-defined spacing by using encoder position signals, which are used for the positioning control of the two linear stages.

  15. Some Thoughts on Contemporary Graphic Print

    Directory of Open Access Journals (Sweden)

    Stefan Skiba

    2016-09-01

    Full Text Available The production requirements of original graphic works of art have changed since 1980. The development of digital printing using lightfast colors now rivals traditional techniques such as wood cut, screen print, lithography, etching etc. Today, with respect to artistic legitimacy, original graphics using traditional printing techniques compete with original graphics produced by digital printing techniques on the art market. What criteria distinguish traditional printing techniques from those of digital printing in the production and acquisition of original graphics? What consequences is the serious artist faced with when deciding to implement digital print production? How does digital print change original graphic acquisition decisions?

  16. 36 CFR 1290.6 - Originals and copies.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Originals and copies. 1290.6... ASSASSINATION RECORDS COLLECTION ACT OF 1992 (JFK ACT) § 1290.6 Originals and copies. (a) For purposes of determining whether originals or copies of assassination records will be made part of the President John F...

  17. Preservation Copying Endangered Historic Negative Collections

    DEFF Research Database (Denmark)

    Kejser, Ulla Bøgvad

    2008-01-01

    This article discusses preservation copying of unstable B&W nitrate and acetate still photographic negatives. It focuses on evaluating two different strategies for preserving the copies from a point of view of quality and cost-effectiveness. The evaluated strategies are preservation of the master...... by describing essential characteristics of negatives, which must be passed on to the copies, and the required metadata and technical imaging specifications. Next the paper discusses strategies for preservation and makes an analysis with the LIFE2 Costing Model. The paper concludes that the most beneficial...... and cost-effective preservation solution for large format negatives is to keep the preservation copies as digital files. However, it also acknowledges that it is important to revisit such strategies regularly to monitor changes in user expectations, technologies and costs....

  18. COPI is required for enterovirus 71 replication.

    Directory of Open Access Journals (Sweden)

    Jianmin Wang

    Full Text Available Enterovirus 71 (EV71, a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11, is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies.

  19. Colour printing techniques

    OpenAIRE

    Parraman, C.

    2017-01-01

    Invited chapter in the book Colour Design: Theories and Applications. In PART 3 COLOUR, DESIGN AND COLORATION this chapter covers:\\ud - Hardcopy colour: analogue versus digital\\ud - Colour theory in relation to printing\\ud - Overview of halftoning and digital print technologies\\ud - Overview and development of inks\\ud - Inkjet papers and inks\\ud - Recent and future trends in colour, printing inks and hardware.\\ud \\ud This book differs from other existing books in the field, with the aim of an...

  20. Print and Manuscript

    OpenAIRE

    Erne, Lukas Christian

    2007-01-01

    Positioning Shakespeare at the "crossroads of manuscript and print" and exploring what the choice of print or manuscript reveals about the poet's intended audience and the social persona the poet wanted to assume and fashion, argues that "Shakespeare's authorial self-presentation begins as a poet and, more specifically, as a print-published poet" with the publication of Venus and Adonis in 1593 and the allusion to the publication of Rape of Lucrece in the next year. Yet also considers the imp...

  1. Printed Electronics

    Science.gov (United States)

    Wade, Jessica; Hollis, Joseph Razzell; Wood, Sebastian

    2018-04-01

    The combination of printing technology with manufacturing electronic devices enables a new paradigm of printable electronics, where 'smart' functionality can be readily incorporated into almost any product at low cost. Over recent decades, rapid progress has been made in this field, which is now emerging into the industrial andcommercial realm. However, successful development and commercialisation on a large scale presents some significant technical challenges. For fully-printable electronic systems, all the component parts must be deposited from solutions (inks), requiring the development of new inorganic, organic and hybrid materials.A variety of traditional printing techniques are being explored and adapted forprinting these new materials in ways that result in the best performing electronicdevices. Whilst printed electronics research has initially focused on traditional typesof electronic device such as light-emitting diodes, transistors, and photovoltaics, it is increasingly apparent that a much wider range of applications can be realised. The soft and stretchable nature of printable materials makes them perfect candidates forbioelectronics, resulting in a wealth of research looking at biocompatible printable inks and biosensors. Regardless of application, the properties of printed electronicmaterials depend on the chemical structures, processing conditions, device architecture,and operational conditions, the complex inter-relationships of which aredriving ongoing research. We focus on three particular 'hot topics', where attention is currently focused: novel materials, characterisation techniques, and device stability. With progress advancing very rapidly, printed electronics is expected to grow over the next decade into a key technology with an enormous economic and social impact.

  2. Single-copy insertion of transgenes in Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

    2008-01-01

    developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...... be obtained in less than 2 weeks by injecting approximately 20 worms. We have successfully inserted transgenes as long as 9 kb and verified that single copies are inserted at the targeted site. Single-copy transgenes are expressed at endogenous levels and can be expressed in the female and male germlines....

  3. Cost-estimating for commercial digital printing

    Science.gov (United States)

    Keif, Malcolm G.

    2007-01-01

    The purpose of this study is to document current cost-estimating practices used in commercial digital printing. A research study was conducted to determine the use of cost-estimating in commercial digital printing companies. This study answers the questions: 1) What methods are currently being used to estimate digital printing? 2) What is the relationship between estimating and pricing digital printing? 3) To what extent, if at all, do digital printers use full-absorption, all-inclusive hourly rates for estimating? Three different digital printing models were identified: 1) Traditional print providers, who supplement their offset presswork with digital printing for short-run color and versioned commercial print; 2) "Low-touch" print providers, who leverage the power of the Internet to streamline business transactions with digital storefronts; 3) Marketing solutions providers, who see printing less as a discrete manufacturing process and more as a component of a complete marketing campaign. Each model approaches estimating differently. Understanding and predicting costs can be extremely beneficial. Establishing a reliable system to estimate those costs can be somewhat challenging though. Unquestionably, cost-estimating digital printing will increase in relevance in the years ahead, as margins tighten and cost knowledge becomes increasingly more critical.

  4. A STUDY OF RELATIVE CORRELATION BETWEEN THE PATTERN OF FINGER PRINTS AND LIP PRINTS

    OpenAIRE

    Murugan; Karikalan

    2014-01-01

    BACKGROUND AND OBJECTIVE: The use of conventional methods such as dactylography (study of finger prints) & cheiloscopy (study of lip prints) is of paramount importance, since personal identification by other means such as DNA analysis is sophisticated and not available in rural and developing countries. Fingerprint in its narrow sense is an impression left by the friction ridges of human fingers. The second prints of interest are lip prints. Studies of association between ...

  5. CERN printing infrastructure

    International Nuclear Information System (INIS)

    Otto, R; Sucik, J

    2008-01-01

    For many years CERN had a very sophisticated print server infrastructure [13] which supported several different protocols (AppleTalk, IPX and TCP/IP) and many different printing standards. Today's situation differs a lot: we have a much more homogenous network infrastructure, where TCP/IP is used everywhere and we have less printer models, which almost all work using current standards (i.e. they all provide PostScript drivers). This change gave us the possibility to review the printing architecture aiming at simplifying the infrastructure in order to achieve full automation of the service. The new infrastructure offers both: LPD service exposing print queues to Linux and Mac OS X computers and native printing for Windows based clients. The printer driver distribution is automatic and native on Windows and automated by custom mechanisms on Linux, where the appropriate Foomatic drivers are configured. Also the process of printer registration and queue creation is completely automated following the printer registration in the network database. At the end of 2006 we have moved all (∼1200) CERN printers and all users' connections at CERN to the new service. This paper will describe the new architecture and summarize the process of migration

  6. Making PMT halftone prints

    Energy Technology Data Exchange (ETDEWEB)

    Corey, J.D.

    1977-05-01

    In the printing process for technical reports presently used at Bendix Kansas City Division, photographs are reproduced by pasting up PMT halftone prints on the artwork originals. These originals are used to make positive-working plastic plates for offset lithography. Instructions for making good-quality halftone prints using Eastman Kodak's PMT materials and processes are given in this report. 14 figures.

  7. Smart printing technology for counterfeit deterrence

    Science.gov (United States)

    Harrop, Peter J.

    1996-03-01

    Smart (intelligent) printing is the creation of useful patterns beyond alphanumerics and graphics immediately obvious to the human eye. It employs smart inks, patterns, surfaces and substrates. Recent proliferation of color copiers, personal computers and scanners has facilitated a tenfold increase in counterfeiting in many countries over the past three years. Banknotes, cheques, academic certificates, art work, visitors passes, venue tickets and many other artifacts have been compromised. Paradoxically, the best counterfeits produced by some foreign governments and organized crime are rarely the main problem. The secret services of many countries use forensic science to great effect in pursuing these fairly readily identified sources of limited number. Bad counterfeits usually made on color copiers or computers, with or without color scanners, are the most difficult to combat because they are made by very large numbers of casual counterfeiters who may never commit crime again. For instance, counterfeit banknotes intercepted by the Bundesbank have been photocopies in a fluctuating range of 50 - 84% of cases in the last four reported years. Cheque and other document fraud is also inflated by these burgeoning bad copies and here we must add amateurish alterations using copiers or scanners. For instance, a better academic degree can mean a better job, an interbank transfer form can be 'raised' in value by enormous amounts. The issuer of a 'bad' counterfeit does not mind that it is usually picked up on a second transferral. They are long gone by then or, with banknotes, they can deny that they issued it. First priority in reversing the upward trend of counterfeiting must not therefore be the creation of better secret features traceable by forensic laboratories over extended periods of time. Rather we need better and more obvious optically unique features, not easily emulated, that can be spotted in the split second when several, say, banknotes are handed over in a

  8. The NIH 3D Print Exchange: A Public Resource for Bioscientific and Biomedical 3D Prints.

    Science.gov (United States)

    Coakley, Meghan F; Hurt, Darrell E; Weber, Nick; Mtingwa, Makazi; Fincher, Erin C; Alekseyev, Vsevelod; Chen, David T; Yun, Alvin; Gizaw, Metasebia; Swan, Jeremy; Yoo, Terry S; Huyen, Yentram

    2014-09-01

    The National Institutes of Health (NIH) has launched the NIH 3D Print Exchange, an online portal for discovering and creating bioscientifically relevant 3D models suitable for 3D printing, to provide both researchers and educators with a trusted source to discover accurate and informative models. There are a number of online resources for 3D prints, but there is a paucity of scientific models, and the expertise required to generate and validate such models remains a barrier. The NIH 3D Print Exchange fills this gap by providing novel, web-based tools that empower users with the ability to create ready-to-print 3D files from molecular structure data, microscopy image stacks, and computed tomography scan data. The NIH 3D Print Exchange facilitates open data sharing in a community-driven environment, and also includes various interactive features, as well as information and tutorials on 3D modeling software. As the first government-sponsored website dedicated to 3D printing, the NIH 3D Print Exchange is an important step forward to bringing 3D printing to the mainstream for scientific research and education.

  9. Copies, Concepts and Time

    Directory of Open Access Journals (Sweden)

    Anne Eriksen

    2017-09-01

    Full Text Available Copies are defined by their relation to an original. The understanding and evaluation of this relationship has been changing over time. A main argument of this article is that originals and copies are phenomena with no "natural" or essential meaning outside of their specific historical settings. The idea to be explored is how changing historicity regimes have transformed notions of originals and copies over time and how these differences also are reflected in the intrinsically temporal relation between the two concepts. The discussion will be framed by two theory sets. The first is Alexander Nagel and Christopher Woods investigation of two kinds of temporality that vied for dominance in works of art in the late Middle Ages and the Renaissance. The second is Walter Benjamins discussion of artwork in the "age of mechanical reproduction", i.e. the twentieth century. The second half of the article seeks to add to the historical complexity described by both theory sets by introducing a concept of tradition and discussing the early modern ideals of exemplarity, emulation and copiousness.

  10. 3D Printing A Survey

    Directory of Open Access Journals (Sweden)

    Muhammad Zulkifl Hasan

    2017-08-01

    Full Text Available Solid free fabrication SFF are produced to enhance the printing instrument utilizing distinctive strategies like Piezo spout control multi-spout injet printers or STL arrange utilizing cutting information. The procedure is utilized to diminish the cost and enhance the speed of printing. A few techniques take long at last because of extra process like dry the printing. This study will concentrate on SFFS utilizing UV gum for 3D printing.

  11. CERN printing infrastructure

    Energy Technology Data Exchange (ETDEWEB)

    Otto, R; Sucik, J [CERN, Geneva (Switzerland)], E-mail: Rafal.Otto@cern.ch, E-mail: Juraj.Sucik@cern.ch

    2008-07-15

    For many years CERN had a very sophisticated print server infrastructure [13] which supported several different protocols (AppleTalk, IPX and TCP/IP) and many different printing standards. Today's situation differs a lot: we have a much more homogenous network infrastructure, where TCP/IP is used everywhere and we have less printer models, which almost all work using current standards (i.e. they all provide PostScript drivers). This change gave us the possibility to review the printing architecture aiming at simplifying the infrastructure in order to achieve full automation of the service. The new infrastructure offers both: LPD service exposing print queues to Linux and Mac OS X computers and native printing for Windows based clients. The printer driver distribution is automatic and native on Windows and automated by custom mechanisms on Linux, where the appropriate Foomatic drivers are configured. Also the process of printer registration and queue creation is completely automated following the printer registration in the network database. At the end of 2006 we have moved all ({approx}1200) CERN printers and all users' connections at CERN to the new service. This paper will describe the new architecture and summarize the process of migration.

  12. THE INNER KILOPARSEC OF Mrk 273 WITH KECK ADAPTIVE OPTICS

    Energy Technology Data Exchange (ETDEWEB)

    U, Vivian; Sanders, David; Kewley, Lisa [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Dr., Honolulu, HI 96822 (United States); Medling, Anne; Max, Claire [Department of Astronomy and Astrophysics, University of California, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States); Armus, Lee [Spitzer Science Center, California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125 (United States); Iwasawa, Kazushi [ICREA and Institut del Ciències del Cosmos, Universitat de Barcelona (IEEC-UB), Martí i Franquès, 1, E-08028 Barcelona (Spain); Evans, Aaron [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States); Fazio, Giovanni, E-mail: vivianu@ucr.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

    2013-10-01

    There is X-ray, optical, and mid-infrared imaging and spectroscopic evidence that the late-stage ultraluminous infrared galaxy merger Mrk 273 hosts a powerful active galactic nucleus (AGN). However, the exact location of the AGN and the nature of the nucleus have been difficult to determine due to dust obscuration and the limited wavelength coverage of available high-resolution data. Here we present near-infrared integral-field spectra and images of the nuclear region of Mrk 273 taken with OSIRIS and NIRC2 on the Keck II Telescope with laser guide star adaptive optics. We observe three spatially resolved components, and analyze the nuclear molecular and ionized gas emission lines and their kinematics. We confirm the presence of the hard X-ray AGN in the southwest nucleus. In the north nucleus, we find a strongly rotating gas disk whose kinematics indicate a central black hole of mass 1.04 ± 0.1 × 10{sup 9} M{sub ☉}. The H{sub 2} emission line shows an increase in velocity dispersion along the minor axis in both directions, and an increased flux with negative velocities in the southeast direction; this provides direct evidence for a collimated molecular outflow along the axis of rotation of the disk. The third spatially distinct component appears to the southeast, 640 and 750 pc from the north and southwest nuclei, respectively. This component is faint in continuum emission but shows several strong emission line features, including [Si VI] 1.964 μm which traces an extended coronal-line region. The geometry of the [Si VI] emission combined with shock models and energy arguments suggest that [Si VI] in the southeast component must be at least partly ionized by the SW AGN or a putative AGN in the northern disk, either through photoionization or through shock-heating from strong AGN- and circumnuclear-starburst-driven outflows. This lends support to a scenario in which Mrk 273 may be a dual AGN system.

  13. Drug-printing by flexographic printing technology--a new manufacturing process for orodispersible films.

    Science.gov (United States)

    Janssen, Eva Maria; Schliephacke, Ralf; Breitenbach, Armin; Breitkreutz, Jörg

    2013-01-30

    Orodispersible films (ODFs) are intended to disintegrate within seconds when placed onto the tongue. The common way of manufacturing is the solvent casting method. Flexographic printing on drug-free ODFs is introduced as a highly flexible and cost-effective alternative manufacturing method in this study. Rasagiline mesylate and tadalafil were used as model drugs. Printing of rasagiline solutions and tadalafil suspensions was feasible. Up to four printing cycles were performed. The possibility to employ several printing cycles enables a continuous, highly flexible manufacturing process, for example for individualised medicine. The obtained ODFs were characterised regarding their mechanical properties, their disintegration time, API crystallinity and homogeneity. Rasagiline mesylate did not recrystallise after the printing process. Relevant film properties were not affected by printing. Results were comparable to the results of ODFs manufactured with the common solvent casting technique, but the APIs are less stressed through mixing, solvent evaporation and heat. Further, loss of material due to cutting jumbo and daughter rolls can be reduced. Therefore, a versatile new manufacturing technology particularly for processing high-potent low-dose or heat sensitive drugs is introduced in this study. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. The best printing methods to print satellite images

    OpenAIRE

    G.A. Yousif; R.Sh. Mohamed

    2011-01-01

    Printing systems operate in general as a system of color its color scale is limited as compared with the system color satellite images. Satellite image is building from very small cell named pixel, which represents the picture element and the unity of color when the image is displayed on the screen, this unit becomes lesser in size and called screen point. This unit posseses different size and shape from the method of printing to another, depending on the output resolution, tools and material...

  15. MolPrint3D: Enhanced 3D Printing of Ball-and-Stick Molecular Models

    Science.gov (United States)

    Paukstelis, Paul J.

    2018-01-01

    The increased availability of noncommercial 3D printers has provided instructors and students improved access to printing technology. However, printing complex ball-and-stick molecular structures faces distinct challenges, including the need for support structures that increase with molecular complexity. MolPrint3D is a software add-on for the…

  16. Influence of printing speed on production of embossing tools using FDM 3D printing technology

    Directory of Open Access Journals (Sweden)

    Jelena Žarko

    2017-06-01

    Full Text Available Manufacturing of the embossing tools customary implies use of metals such as zinc, magnesium, copper, and brass. In the case of short run lengths, a conventional manufacturing process and the material itself represent a significant cost, not only in the terms of material costs and the need for using complex technological systems which are necessary for their production, but also in the terms of the production time. Alternatively, 3D printing can be used for manufacturing similar embossing tools with major savings in production time and costs. However, due to properties of materials used in the 3D printing technology, expected results of embossing by 3D printed tools cannot be identical to metal ones. This problem is emphasized in the case of long run lengths and high accuracy requirement for embossed elements. The objective of this paper is primarily focused on investigating the influence of the printing speed on reproduction quality of the embossing tools printed with FDM (Fused Deposition Modelling technology. The obtained results confirmed that printing speed as a process parameter affects the reproduction quality of the embossing tools printed with FDM technology: in the case of deposition rate of 90 mm/s was noted the poorest dimensional accuracy in relation to the 3D model, which is more emphasised in case of circular and square elements. Elements printed with the highest printing speed have a greater dimensional accuracy, but with evident cracks on the surface.

  17. Image quality of paper prints compared to film copies in CT investigations; Bildqualitaet von Papierausdrucken zur Befunddokumentation im Vergleich zu Laserfilmen bei MSCT-Untersuchungen

    Energy Technology Data Exchange (ETDEWEB)

    Bley, T.; Burger, D.; Ghanem, N.; Thuerl, C.; Saueressig, U.; Kotter, E.; Langer, M. [Abt. Roentgendiagnostik, Radiologische Klinik, Universitaetsklinikum Freiburg (Germany)

    2002-04-01

    Purpose: Evaluation of image quality of paper prints in routine CT investigations. Method: The image quality of paper prints from 104 CT scans of daily routine investigations was analysed by three observer three observers according to a five-point ranking scale for contrast, grey level, spatial resolution, and subjective confidence in correct evaluation. Each study was rated ''acceptable'' or ''not acceptable for documentation''. Results: In 312 ratings the mean grade for contrast was 2.7, for grey levels 3.2, and for spatial resolution 3.3. Grades ranged from 1 = very good to 5 = insufficient. Subjective confidence in correct evaluation was rated as ''certain'' in 77.4%, ''likely'' in 18.4% and ''impossible to evaluate'' in 4.2% of cases. 93.7% of printed CT images were rated ''acceptable for documentation''. Conclusion: Image quality of paper prints does not reach the quality of laser films concerning its contrast, grey levels, and spatial resolution. Nevertheless, paper prints are acceptable for documentation of findings in most CT investigations. A high confidence in correct evaluation was found. Limitations are found in documentation of small coin lesions of the lung and ischemic lesions of the neurocranium. (orig.) [German] Ziel: Qualitaetsbewertung von Papierausdrucken zur Bilddokumentation von Routine-CT-Untersuchungen. Material und Methoden: Bei 104 Routine-CT-Untersuchungen werteten drei Untersucher (insgesamt 312 Auswertungen) die Bildqualitaet von Papierausdrucken im Vergleich zu Laserfilmen bezueglich Kontrast, Grauwerten und Aufloesung sowie ''persoenlicher Befundsicherheit'' (Skala 1 - 5) aus. Abschliessend wurde entschieden, ob der Papierausdruck fuer die Befunddokumentation ausreiche. Ergebnisse: Mit Bewertungen zwischen 1 fuer ''sehr gut'' und 5 fuer &apos

  18. Introduction to printed electronics

    CERN Document Server

    Suganuma, Katsuaki

    2014-01-01

    This book describes in detail modern technologies for printed electronics, explaining how nanotechnology and modern printing technology are merging to revolutionize electronics fabrication of thin, lightweight, large, and inexpensive products. Readers will benefit from the explanations of materials, devices and circuits used to design and implement the latest applications of printed electronics, such as thin flexible OLED displays, organic solar cells, OLED lighting, smart wallpaper, sensors, logic, memory and more.

  19. Recent Progress in the Development of Printed Thin-Film Transistors and Circuits with High-Resolution Printing Technology.

    Science.gov (United States)

    Fukuda, Kenjiro; Someya, Takao

    2017-07-01

    Printed electronics enable the fabrication of large-scale, low-cost electronic devices and systems, and thus offer significant possibilities in terms of developing new electronics/optics applications in various fields. Almost all electronic applications require information processing using logic circuits. Hence, realizing the high-speed operation of logic circuits is also important for printed devices. This report summarizes recent progress in the development of printed thin-film transistors (TFTs) and integrated circuits in terms of materials, printing technologies, and applications. The first part of this report gives an overview of the development of functional inks such as semiconductors, electrodes, and dielectrics. The second part discusses high-resolution printing technologies and strategies to enable high-resolution patterning. The main focus of this report is on obtaining printed electrodes with high-resolution patterning and the electrical performance of printed TFTs using such printed electrodes. In the final part, some applications of printed electronics are introduced to exemplify their potential. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Prints Charles ja prints Michael külastasid Tallinna kirikuid / Allan Tammiku

    Index Scriptorium Estoniae

    Tammiku, Allan

    2001-01-01

    Prints Charles külastas 6. novembril Eesti-visiidi ajal Tallinna toomkirikut ja Pühavaimu kirikut, prints Michael viibis Tallinnas 11. novembril eravisiidil, ta külastas toomkirikut, Niguliste ja Pühavaimu kirikut

  1. Semiotic Analysis Of Mcdonald's Printed Advertisement

    OpenAIRE

    URAIDA, SITI

    2014-01-01

    Keywords: Semiotic, printed advertisement, sign, icon, symbol, index, connotation, myth Printed advertisement has a promotional function as medium to advertise aproduct. It implicitly persuades people to create demand of product which is being advertised. In this study, the writer uses printed advertisement of McDonald's fast food company as the object. The printed advertisement was analyzed by usingSemiotics study. There are seven printed advertisements that were analyzes in this study. All ...

  2. AirPrint Forensics: Recovering the Contents and Metadata of Printed Documents from iOS Devices

    Directory of Open Access Journals (Sweden)

    Luis Gómez-Miralles

    2015-01-01

    data they may store, opens new opportunities in the field of computer forensics. In 2010, version 4 of the iOS operating system introduced AirPrint, a simple and driverless wireless printing functionality supported by hundreds of printer models from all major vendors. This paper describes the traces left in the iOS device when AirPrint is used and presents a method for recovering content and metadata of documents that have been printed.

  3. Durability of ink jet prints

    International Nuclear Information System (INIS)

    Dobric, E; Mirkovic, I Bolanca; Bolanca, Z

    2010-01-01

    The aim of this paper is the result presentation of some optical properties research for ink jet prints after: exposing the prints to the mixed daylight and artificial light, exposing of prints to the sun-light through the glass window, and exposing of prints to outdoor conditions during the summer months. The prints obtained by piezoelectric and thermal ink jet technologies were used in the researches. The dye-based inks and the pigmented inks based on water and the low solvent inks were used. The results of these researches, except the scientific contribution in the domain of understanding and explaining the environmental conditions on the gamut size, i.e. the range of color tonality, colorimetric stability and print quality, can be used by the ink and paper manufacturers in new formulations, offer data for the printer producers for further production and evaluation of the position of their products.

  4. Luminous lip-prints as criminal evidence.

    Science.gov (United States)

    Castelló, Ana; Alvarez-Seguí, Mercedes; Verdú, Fernando

    2005-12-20

    Luminescence is specially a useful property for the search of invisible evidences at the scene of a crime. In the latent fingerprints particular case, there are at one's disposal fluorescent reagents for their localization. The study of latent lip prints (that is lip prints from protective lipstick, or permanent or long-lasting lipstick that do not leave any visible marks) is more recent than fingerprints study. Because of the different composition of both types of prints, different reagents have been tried out on their developing. Although, lysochromes are particularly useful reagents to obtain latent lip prints, it may occur on coloured or multicoloured surfaces, the developing is not perceived due to contrast problems between the reagent and the surface where the print is searched. Again, luminescence offers the possibility to solve this problem. Nile Red is being studied as a potential developer for latent lip prints. The results on very old prints (over 1year) indicate that this reagent is highly efficient to get latent lip prints.

  5. 40 CFR 264.53 - Copies of contingency plan.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan... called upon to provide emergency services. [Comment: The contingency plan must be submitted to the...

  6. Two-Way 4D Printing: A Review on the Reversibility of 3D-Printed Shape Memory Materials

    Directory of Open Access Journals (Sweden)

    Amelia Yilin Lee

    2017-10-01

    Full Text Available The rapid development of additive manufacturing and advances in shape memory materials have fueled the progress of four-dimensional (4D printing. With the right external stimulus, the need for human interaction, sensors, and batteries will be eliminated, and by using additive manufacturing, more complex devices and parts can be produced. With the current understanding of shape memory mechanisms and with improved design for additive manufacturing, reversibility in 4D printing has recently been proven to be feasible. Conventional one-way 4D printing requires human interaction in the programming (or shape-setting phase, but reversible 4D printing, or two-way 4D printing, will fully eliminate the need for human interference, as the programming stage is replaced with another stimulus. This allows reversible 4D printed parts to be fully dependent on external stimuli; parts can also be potentially reused after every recovery, or even used in continuous cycles—an aspect that carries industrial appeal. This paper presents a review on the mechanisms of shape memory materials that have led to 4D printing, current findings regarding 4D printing in alloys and polymers, and their respective limitations. The reversibility of shape memory materials and their feasibility to be fabricated using three-dimensional (3D printing are summarized and critically analyzed. For reversible 4D printing, the methods of 3D printing, mechanisms used for actuation, and strategies to achieve reversibility are also highlighted. Finally, prospective future research directions in reversible 4D printing are suggested.

  7. Print-to-print: printer-enabled out-of-cleanroom multiobject microprinting method.

    Science.gov (United States)

    Xing, Siyuan; Zhao, Siwei; Pan, Tingrui

    2014-01-01

    Micropatterning techniques have gained growing interests from a broad range of engineering and biology researches as it realizes the high-throughput and highly quantitative investigations on miniature biological objects (e.g., cells and bacteria) by spatially defined micropatterns. However, most of the existing techniques rely on expensive instruments or intensive cleanroom access which may not be easy to be utilized in a regular biological laboratory. Here, we present the detailed procedures of a simple versatile microprinting process, referred to as Print-to-Print (P2P), to form multiobject micropatterns for potential biological applications. Only a solid-phase printer and custom-made superhydrophobic (SH) films are utilized for the printing and no thermal or chemical treatment is involved during the entire printing process. Moreover, the noncontact nature of droplet transferring and printing steps can be highly advantageous for sensitive biological uses. By the P2P process, a minimal feature resolution of 229 ± 17 μm has been successfully achieved. What's more, this approach has been applied to form micropatterning on various commonly used substrates in biology as well as multiobject co-patterns. In addition, the SH substrates have also been demonstrated to be reusable. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. 40 CFR 265.53 - Copies of contingency plan.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

  9. 3D-Printed Millimeter Wave Structures

    Science.gov (United States)

    2016-03-14

    demonstrates the resolution of the printer with a 10 micron nozzle. Figure 2: Measured loss tangent of SEBS and SBS samples. 3D - Printed Millimeter... 3D printing of styrene-butadiene-styrene (SBS) and styrene ethylene/butylene-styrene (SEBS) is used to demonstrate the feasibility of 3D - printed ...Additionally, a dielectric lens is printed which improves the antenna gain of an open-ended WR-28 waveguide from 7 to 8.5 dBi. Keywords: 3D printing

  10. Winter maintenance performance measure.

    Science.gov (United States)

    2016-01-01

    The Winter Performance Index is a method of quantifying winter storm events and the DOTs response to them. : It is a valuable tool for evaluating the States maintenance practices, performing post-storm analysis, training : maintenance personnel...

  11. Inkjet-Printed Lithium-Sulfur Microcathodes for All-Printed, Integrated Nanomanufacturing.

    Science.gov (United States)

    Milroy, Craig A; Jang, Seonpil; Fujimori, Toshihiko; Dodabalapur, Ananth; Manthiram, Arumugam

    2017-03-01

    Improved thin-film microbatteries are needed to provide appropriate energy-storage options to power the multitude of devices that will bring the proposed "Internet of Things" network to fruition (e.g., active radio-frequency identification tags and microcontrollers for wearable and implantable devices). Although impressive efforts have been made to improve the energy density of 3D microbatteries, they have all used low energy-density lithium-ion chemistries, which present a fundamental barrier to miniaturization. In addition, they require complicated microfabrication processes that hinder cost-competitiveness. Here, inkjet-printed lithium-sulfur (Li-S) cathodes for integrated nanomanufacturing are reported. Single-wall carbon nanotubes infused with electronically conductive straight-chain sulfur (S@SWNT) are adopted as an integrated current-collector/active-material composite, and inkjet printing as a top-down approach to achieve thin-film shape control over printed electrode dimensions is used. The novel Li-S cathodes may be directly printed on traditional microelectronic semicoductor substrates (e.g., SiO 2 ) or on flexible aluminum foil. Profilometry indicates that these microelectrodes are less than 10 µm thick, while cyclic voltammetry analyses show that the S@SWNT possesses pseudocapacitive characteristics and corroborates a previous study suggesting the S@SWNT discharge via a purely solid-state mechanism. The printed electrodes produce ≈800 mAh g -1 S initially and ≈700 mAh g -1 after 100 charge/discharge cycles at C/2 rate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Remote Collaborative 3D Printing - Process Investigation

    Science.gov (United States)

    2016-04-01

    COLLABORATIVE 3D PRINTING - PROCESS INVESTIGATION Cody M. Reese, PE CAD MODEL PRINT MODEL PRINT PREVIEW PRINTED PART AERIAL VIRTUAL This...REMOTE COLLABORATIVE 3D PRINTING - PROCESS INVESTIGATION 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Cody M. Reese...release; distribution is unlimited. 13. SUPPLEMENTARY NOTES 14. ABSTRACT The Remote Collaborative 3D Printing project is a collaboration between

  13. Apps for Angiosperms: The Usability of Mobile Computers and Printed Field Guides for UK Wild Flower and Winter Tree Identification

    Science.gov (United States)

    Stagg, Bethan C.; Donkin, Maria E.

    2017-01-01

    We investigated usability of mobile computers and field guide books with adult botanical novices, for the identification of wildflowers and deciduous trees in winter. Identification accuracy was significantly higher for wildflowers using a mobile computer app than field guide books but significantly lower for deciduous trees. User preference…

  14. Estimating winter survival of winter wheat by simulations of plant frost tolerance

    NARCIS (Netherlands)

    Bergjord Olsen, A.K.; Persson, T.; Wit, de A.; Nkurunziza, L.; Sindhøj, E.; Eckersten, H.

    2018-01-01

    Based on soil temperature, snow depth and the grown cultivar's maximum attainable level of frost tolerance (LT50c), the FROSTOL model simulates development of frost tolerance (LT50) and winter damage, thereby enabling risk calculations for winter wheat survival. To explore the accuracy of this

  15. The edition from the VNLU fonds, unknown in the bibliography, as a sourcefor the biography of the book owner in the 18th ct. (description of the edition and the copy

    Directory of Open Access Journals (Sweden)

    Zabolotna N.

    2014-01-01

    Full Text Available The research of small (with a small amount of pages editions is now very actual as such publications usually are not covered by most scientific catalogs. This complicates their attribution and primarily their dating because many of these books are undated. The activity of Pochayiv Assumption monastery printing house in the 18th ct., especially in 70’s - 80’s is an example of active publication of such kind of editions. The article is devoted to the copy of the book «Decretum quo Sanctissimus Dominus Noster Clemens Divina Providentiв PP. XIV. concedit Proto-Archmandritж Congregationis S. Basilii Magni Ruthenorum, nec non cжteris Archimadritis ejusdem Congregationis, eorumquи in perpetuum Successoribus, facuttalem impertendi Benedictionem cum Jndulgentia Plenaria in articulo mortis» [Pochayiv: Typography of Assumption Monastery, between 1772 and 1774], which is not described in the bibliography. The investigated copy is also a document of one of the owners, the Basilian monk Amvrosii Lukasevych. The article has appendices with scientific descriptions of the edition and the copy.

  16. Printed and tablet e-paper newspaper from an environmental perspective - A screening life cycle assessment

    International Nuclear Information System (INIS)

    Moberg, Asa; Johansson, Martin; Finnveden, Goeran; Jonsson, Alex

    2010-01-01

    Viable alternatives to conventional newspapers, such as electronic papers, e-papers or e-readers, are intended to have many of the qualities of paper, such as reading using reflective light, high resolution, 180 deg. viewing angle. It has been suggested that the environmental impact of e-paper can be lower than for printed and internet-based newspapers. However, in order to find the facts of the matter, a thorough life cycle perspective covering raw material acquisition, production, use and disposal should preferably be used to study the environmental performance of the different products. A screening life cycle assessment was performed to describe the potential environmental impacts of two product systems; printed on paper and tablet e-paper newspapers. Results show that the most significant phase of the life cycle for both product systems was the production of substrate or platform. Accordingly, key aspects that may affect the resulting environmental performance of newspaper product systems were for the printed newspaper number of readers per copy and number of pages per issue and for the tablet e-paper newspaper lifetime and multi-use of the device. The printed newspaper in general had a higher energy use, higher emissions of gases contributing to climate change and several other impact categories than the tablet e-paper newspaper. It was concluded that tablet e-paper has the potential to decrease the environmental impact of newspaper consumption. However, further studies regarding the environmental impact of production and waste management of electronic devices and internet use, as well as more comprehensive assessment of toxicological impacts are needed. As the data on the electronic devices becomes more comprehensive this may prove to be a major limitation of electronic newspaper systems. Developers are suggested to strive towards minimisation of toxic and rare substances in production.

  17. Incorporating Yearly Derived Winter Wheat Maps Into Winter Wheat Yield Forecasting Model

    Science.gov (United States)

    Skakun, S.; Franch, B.; Roger, J.-C.; Vermote, E.; Becker-Reshef, I.; Justice, C.; Santamaría-Artigas, A.

    2016-01-01

    Wheat is one of the most important cereal crops in the world. Timely and accurate forecast of wheat yield and production at global scale is vital in implementing food security policy. Becker-Reshef et al. (2010) developed a generalized empirical model for forecasting winter wheat production using remote sensing data and official statistics. This model was implemented using static wheat maps. In this paper, we analyze the impact of incorporating yearly wheat masks into the forecasting model. We propose a new approach of producing in season winter wheat maps exploiting satellite data and official statistics on crop area only. Validation on independent data showed that the proposed approach reached 6% to 23% of omission error and 10% to 16% of commission error when mapping winter wheat 2-3 months before harvest. In general, we found a limited impact of using yearly winter wheat masks over a static mask for the study regions.

  18. Winter weather demand considerations.

    Science.gov (United States)

    2015-04-01

    Winter weather has varied effects on travel behavior. Using 418 survey responses from the Northern Virginia : commuting area of Washington, D.C. and binary logit models, this study examines travel related changes under : different types of winter wea...

  19. The influence of sowing period and seeding norm on autumn vegetation, winter hardiness and yield of winter cereal crops

    Directory of Open Access Journals (Sweden)

    Potapova G. N.

    2017-10-01

    Full Text Available the winter wheat and triticale in the middle part of the Ural Mountains haven’t been seeded before. The technology of winter crop cultivation should be improved due to the production of new varieties of winter rye. Winter hardiness and yield of winter rye are higher in comparison with winter triticale and especially with winter wheat. The sowing period and the seeding rate influence the amount of yield and winter hardiness. The winter hardiness of winter cereals and the yield of the rye variety Iset sowed on August 25 and the yield of the triticale variety Bashkir short-stalked and wheat Kazanskaya 560 sowed on August 15 were higher. It is important to sow winter grain in local conditions in the second half of August. The sowing this period allows to provide plants with the necessary amount of positive temperatures (450–500 °C. This helps the plants to form 3–4 shoots of tillering and a mass of 10 dry plants reaching 3–5 grams. The winter grain crops in the middle part of the Ural Mountains should be sown with seeding rates of 6 and 7 million of sprouting grains per 1 ha, and the seeds must be cultivated with fungicidal preparation before seeding.

  20. Gauge and non-gauge curvature tensor copies

    International Nuclear Information System (INIS)

    Srivastava, P.P.

    1982-10-01

    A procedure for constructing curvature tensor copies is discussed using the anholonomic geometrical framework. The corresponding geometries are compared and the notion of gauge copy is elucidated. An explicit calculation is also made. (author)

  1. Software for Quantitative Estimation of Coefficients of Ink Transfer on the Printed Substrate in Offset Printing

    Science.gov (United States)

    Varepo, L. G.; Trapeznikova, O. V.; Panichkin, A. V.; Roev, B. A.; Kulikov, G. B.

    2018-04-01

    In the framework of standardizing the process of offset printing, one of the most important tasks is the correct selection of the printing system components, taking into account the features of their interaction and behavior in the printing process. The program allows to calculate the transfer of ink on the printed material between the contacting cylindrical surfaces of the sheet-fed offset printing apparatus with the boundaries deformation. A distinctive feature of this software product is the modeling of the liquid flow having free boundaries and causing deformation of solid boundaries when flowing between the walls of two cylinders.

  2. 20 CFR 404.273 - When are automatic cost-of-living increases effective?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false When are automatic cost-of-living increases..., SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Cost-Of-Living Increases § 404.273 When are automatic cost-of-living increases effective? We make automatic cost-of-living...

  3. Gauge field copies and Higgs mechanism

    International Nuclear Information System (INIS)

    Gleiser, M.

    1982-07-01

    From the algebric classification of the possible solutions of the necessary and sufficient condition for the existence of gauge field copies in two possible classes the Higgs mechanism for the potential obtained from the difference between two copied potentials is applied. It is shown that for class I 'electric type' it is possible to construct a vector field that satisfies an electromagnetic wave equation. For class I 'magnetic type', a vector field that satisfies a non-linear equation as a consequence of the non-abelianity of the theory, is obtained. It is shown that for class II it's not possible to apply the Higgs mechanism. A possible physical interpretation for the 'gauge field copies' phenomenon, is obtained. (author) [pt

  4. Selecting suitable enclosures for digitally printed materials

    International Nuclear Information System (INIS)

    Burge, D; Rima, L

    2010-01-01

    It cannot be assumed that storage enclosures considered safe for traditionally printed images and documents are suitable for modern, digitally printed materials. In this project, a large variety of digital print types were tested using a modified version of the ISO 18916 Imaging materials-Processed imaging materials-Photographic activity test for enclosure materials standard to assess the risk to digital prints by paper enclosures known to be inert or reactive with traditional photographic prints. The types of enclosures tested included buffered and non-buffered cotton papers, and groundwood paper. In addition, qualitative filter paper that had been wetted and dried with either an acidic or basic solution was also tested to determine the effects of enclosure pH on digitally printed materials. It was determined that, in general, digital prints tended to be less reactive with various enclosure types than traditional prints. Digital prints were most sensitive to paper that contained groundwood. The enclosure reactivity test results were then integrated with previous published work on the tendencies of various enclosure types to abrade, ferrotype, or block to digital prints in order to create a comprehensive set of recommendations for digital print storage enclosures.

  5. Accuracy evaluation of a 3D-printed individual template for needle guidance in head and neck brachytherapy

    International Nuclear Information System (INIS)

    Huang, Ming-Wei; Zhang, Jian-Guo; Zheng, Lei; Liu, Shu-Ming; Yu, Guang-Yan

    2016-01-01

    To transfer the preplan for the head and neck brachytherapy to the clinical implantation procedure, a preplan-based 3D-printed individual template for needle insertion guidance had previously been designed and used. The accuracy of needle insertion using this kind template was assessed in vivo. In the study, 25 patients with head and neck tumors were implanted with 125 I radioactive seeds under the guidance of the 3D-printed individual template. Patients were divided into four groups based on the site of needle insertion: the parotid and masseter region group (nine patients); the maxillary and paranasal region group (eight patients); the submandibular and upper neck area group (five patients); and the retromandibular region group (six patients). The distance and angular deviations between the preplanned and placed needles were compared, and the complications and time required for needle insertion were assessed. The mean entrance point distance deviation for all 619 needles was 1.18 ± 0.81 mm, varying from 0.857 ± 0.545 to 1.930 ± 0.843 mm at different sites. The mean angular deviation was 2.08 ± 1.07 degrees, varying from 1.85 ± 0.93 to 2.73 ± 1.18 degrees at different sites. All needles were manually inserted to their preplanned positions in a single attempt, and the mean time to insert one needle was 7.5 s. No anatomical complications related to inaccurately placed implants were observed. Using the 3D-printed individual template for the implantation of 125 I radioactive seeds in the head and neck region can accurately transfer a CT-based preplan to the brachytherapy needle insertion procedure. Moreover, the addition of individual template guidance can reduce the time required for implantation and minimize the damage to normal tissues.

  6. The nuclear winter

    International Nuclear Information System (INIS)

    Velikhow, Y.P.

    1986-01-01

    Nuclear winter is an example of possible secondary effects, and if we speak of secondary we are thinking of small-scale second-order effects, but a nuclear winter is not a second-order effect. If you calculate the amount of heat produced by a nuclear explosion, it is a very small amount which does not have any chance of changing the Earth's climate, but a nuclear explosion drives or stars some new mechanism - the mechanism of nuclear winter - after 100 megatons of dust are transferred to the upper atmosphere. Another example of such amplification is radioactive fall-out, especially long-life radioactive fall-out after the possible elimination of the nuclear power industry, nuclear storage and distribution of storage waste around the globe. This is a very powerful amplification mechanism

  7. Inkjet printed electronics using copper nanoparticle ink

    OpenAIRE

    Kang, Jin Sung; Kim, Hak Sung; Ryu, Jongeun; Thomas Hahn, H.; Jang, Seonhee; Joung, Jae Woo

    2010-01-01

    Inkjet printing of electrode using copper nanoparticle ink is presented. Electrode was printed on a flexible glass epoxy composite substrate using drop on demand piezoelectric dispenser and was sintered at 200 °C of low temperature in N2 gas condition. The printed electrodes were made with various widths and thickness. In order to control the thickness of the printed electrode, number of printing was varied. Resistivity of printed electrode was calculated from the cross-sectional area measure...

  8. Checking a printed board

    CERN Multimedia

    1977-01-01

    An 'Interactive Printed Circuit Board Design System' has been developed by a company in a Member-State. Printed circuits are now produced at the SB's surface treatment workshop using a digitized photo-plotter.

  9. 3D Printing of Highly Stretchable, Shape-Memory, and Self-Healing Elastomer toward Novel 4D Printing.

    Science.gov (United States)

    Kuang, Xiao; Chen, Kaijuan; Dunn, Conner K; Wu, Jiangtao; Li, Vincent C F; Qi, H Jerry

    2018-02-28

    The three-dimensional (3D) printing of flexible and stretchable materials with smart functions such as shape memory (SM) and self-healing (SH) is highly desirable for the development of future 4D printing technology for myriad applications, such as soft actuators, deployable smart medical devices, and flexible electronics. Here, we report a novel ink that can be used for the 3D printing of highly stretchable, SM, and SH elastomer via UV-light-assisted direct-ink-write printing. An ink containing urethane diacrylate and a linear semicrystalline polymer is developed for the 3D printing of a semi-interpenetrating polymer network elastomer that can be stretched by up to 600%. The 3D-printed complex structures show interesting functional properties, such as high strain SM and SM -assisted SH capability. We demonstrate that such a 3D-printed SM elastomer has the potential application for biomedical devices, such as vascular repair devices. This research paves a new way for the further development of novel 4D printing, soft robotics, and biomedical devices.

  10. 43 CFR 30.273 - What action will the judge take to record title?

    Science.gov (United States)

    2010-10-01

    ... PROBATE HEARINGS PROCEDURES Tribal Purchase of Interests Under Special Statutes § 30.273 What action will...) File the complete record, including the decision, with the LTRO as provided in § 30.233; (c) Furnish a... decision to each interested party. ...

  11. Partitioning of copy-number genotypes in pedigrees

    Directory of Open Access Journals (Sweden)

    Andelfinger Gregor U

    2010-05-01

    Full Text Available Abstract Background Copy number variations (CNVs and polymorphisms (CNPs have only recently gained the genetic community's attention. Conservative estimates have shown that CNVs and CNPs might affect more than 10% of the genome and that they may be at least as important as single nucleotide polymorphisms in assessing human variability. Widely used tools for CNP analysis have been implemented in Birdsuite and PLINK for the purpose of conducting genetic association studies based on the unpartitioned total number of CNP copies provided by the intensities from Affymetrix's Genome-Wide Human SNP Array. Here, we are interested in partitioning copy number variations and polymorphisms in extended pedigrees for the purpose of linkage analysis on familial data. Results We have developed CNGen, a new software for the partitioning of copy number polymorphism using the integrated genotypes from Birdsuite with the Affymetrix platform. The algorithm applied to familial trios or extended pedigrees can produce partitioned copy number genotypes with distinct parental alleles. We have validated the algorithm using simulations on a complex pedigree structure using frequencies calculated from a real dataset of 300 genotyped samples from 42 pedigrees segregating a congenital heart defect phenotype. Conclusions CNGen is the first published software for the partitioning of copy number genotypes in pedigrees, making possible the use CNPs and CNVs for linkage analysis. It was implemented with the Python interpreter version 2.5.2. It was successfully tested on current Linux, Windows and Mac OS workstations.

  12. Measurement methods and accuracy in copy number variation: failure to replicate associations of beta-defensin copy number with Crohn's disease

    Science.gov (United States)

    Aldhous, Marian C.; Abu Bakar, Suhaili; Prescott, Natalie J.; Palla, Raquel; Soo, Kimberley; Mansfield, John C.; Mathew, Christopher G.; Satsangi, Jack; Armour, John A.L.

    2010-01-01

    The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case–control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case–control studies. PMID:20858604

  13. Measurement methods and accuracy in copy number variation: failure to replicate associations of beta-defensin copy number with Crohn's disease.

    Science.gov (United States)

    Aldhous, Marian C; Abu Bakar, Suhaili; Prescott, Natalie J; Palla, Raquel; Soo, Kimberley; Mansfield, John C; Mathew, Christopher G; Satsangi, Jack; Armour, John A L

    2010-12-15

    The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case-control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case-control studies.

  14. The double copy: Bremsstrahlung and accelerating black holes

    CERN Document Server

    Luna, Andres; Nicholson, Isobel; O'Connell, Donal; White, Chris D

    2016-01-01

    Advances in our understanding of perturbation theory suggest the existence of a correspondence between classical general relativity and Yang-Mills theory. A concrete example of this correspondence, which is known as the double copy, was recently introduced for the case of stationary Kerr-Schild spacetimes. Building on this foundation, we examine the simple time-dependent case of an accelerating, radiating point source. The gravitational solution, which generalises the Schwarzschild solution, includes a non-trivial stress-energy tensor. This stress-energy tensor corresponds to a gauge theoretic current in the double copy. We interpret both of these sources as representing the radiative part of the field. Furthermore, in the simple example of Bremsstrahlung, we determine a scattering amplitude describing the radiation, maintaining the double copy throughout. Our results provide the strongest evidence yet that the classical double copy is directly related to the BCJ double copy for scattering amplitudes.

  15. High-resolution direct 3D printed PLGA scaffolds: print and shrink

    International Nuclear Information System (INIS)

    Chia, Helena N; Wu, Benjamin M

    2015-01-01

    Direct three-dimensional printing (3DP) produces the final part composed of the powder and binder used in fabrication. An advantage of direct 3DP is control over both the microarchitecture and macroarchitecture. Prints which use porogen incorporated in the powder result in high pore interconnectivity, uniform porosity, and defined pore size after leaching. The main limitations of direct 3DP for synthetic polymers are the use of organic solvents which can dissolve polymers used in most printheads and limited resolution due to unavoidable spreading of the binder droplet after contact with the powder. This study describes a materials processing strategy to eliminate the use of organic solvent during the printing process and to improve 3DP resolution by shrinking with a non-solvent plasticizer. Briefly, poly(lactic-co-glycolic acid) (PLGA) powder was prepared by emulsion solvent evaporation to form polymer microparticles. The printing powder was composed of polymer microparticles dry mixed with sucrose particles. After printing with a water-based liquid binder, the polymer microparticles were fused together to form a network by solvent vapor in an enclosed vessel. The sucrose is removed by leaching and the resulting scaffold is placed in a solution of methanol. The methanol acts as a non-solvent plasticizer and allows for polymer chain rearrangement and efficient packing of polymer chains. The resulting volumetric shrinkage is ∼80% at 90% methanol. A complex shape (honey-comb) was designed, printed, and shrunken to demonstrate isotropic shrinking with the ability to reach a final resolution of ∼400 μm. The effect of type of alcohol (i.e. methanol or ethanol), concentration of alcohol, and temperature on volumetric shrinking was studied. This study presents a novel materials processing strategy to overcome the main limitations of direct 3DP to produce high resolution PLGA scaffolds. (paper)

  16. High-resolution direct 3D printed PLGA scaffolds: print and shrink.

    Science.gov (United States)

    Chia, Helena N; Wu, Benjamin M

    2014-12-17

    Direct three-dimensional printing (3DP) produces the final part composed of the powder and binder used in fabrication. An advantage of direct 3DP is control over both the microarchitecture and macroarchitecture. Prints which use porogen incorporated in the powder result in high pore interconnectivity, uniform porosity, and defined pore size after leaching. The main limitations of direct 3DP for synthetic polymers are the use of organic solvents which can dissolve polymers used in most printheads and limited resolution due to unavoidable spreading of the binder droplet after contact with the powder. This study describes a materials processing strategy to eliminate the use of organic solvent during the printing process and to improve 3DP resolution by shrinking with a non-solvent plasticizer. Briefly, poly(lactic-co-glycolic acid) (PLGA) powder was prepared by emulsion solvent evaporation to form polymer microparticles. The printing powder was composed of polymer microparticles dry mixed with sucrose particles. After printing with a water-based liquid binder, the polymer microparticles were fused together to form a network by solvent vapor in an enclosed vessel. The sucrose is removed by leaching and the resulting scaffold is placed in a solution of methanol. The methanol acts as a non-solvent plasticizer and allows for polymer chain rearrangement and efficient packing of polymer chains. The resulting volumetric shrinkage is ∼80% at 90% methanol. A complex shape (honey-comb) was designed, printed, and shrunken to demonstrate isotropic shrinking with the ability to reach a final resolution of ∼400 μm. The effect of type of alcohol (i.e. methanol or ethanol), concentration of alcohol, and temperature on volumetric shrinking was studied. This study presents a novel materials processing strategy to overcome the main limitations of direct 3DP to produce high resolution PLGA scaffolds.

  17. The Physics of AGN, a Deep Understanding of the Quasar 3C 273

    Science.gov (United States)

    Courvoisier, T.; Bottcher, Markus

    2004-01-01

    Upon our successful AO-1 proposal no. 120023, the quasar 3C 273 has been observed with INTEGRAL in 3 epochs in January 2003. The first observation, on January 5, 2003, with a total INTEGRAL exposure of 1.2 x 10(exp 5) s, was simultaneous with RXTE and XMM- Newton observations. Two more INTEGRAL observations were carried out on January 11, 2003 (exposure: lo4 s) and January 17, 2003 (exposure: 1.1 x 10(exp 5) s). The source was detected with high significance by all INTEGRAL instruments, the OMC, JEM-X, SPI, and IBIS/ISGRI. Being one of the first INTEGRAL observations simultaneous with XMM and RXTE, our observations were also used to fix the cross calibration with those instruments. The combined spectrum resulting from the XMM-Newton, JEM-X, RXTE, SPI and ISGRI X-ray / soft gamma-ray observations is consistent with a straight power-law of photon index Gamma = (1.73 +/- 0.015) between 3 keV and at least 200 keV. A possible detection in the 200 keV - 500 keV band by SPI can not be confirmed with our observations. The normalization of the X/gamma-ray spectrum is (2.24 +/- 0.05) x 10(exp -2) photons /sq cm keV at 1 keV. The source showed a moderate amount of optical variability as observed with the OMC onboard INTEGRAL. No evidence for variability at X-rays and gamma-rays could be reported, which may have been a result of insufficient photon statistics. The X-/gamma-ray spectrum observed in our 2003 observations is consistent with previously measured and modelled broadband spectral energy distributions of 3C 273. It has been included in the U.S. lead Col's work on spectral and variability modelling of gamma-ray blazars, supporting the trend of flat-spectrum radio quasars such as 3C 273 being 7-ray dominated due to a strong contribution from Compton upscattering of external radiation by ultrarelativistic electrons in a relativistic jet. 3C 273 is a particularly convincing example for such a picture since it provides very direct evidence for a strong external radiation

  18. The λ transformation and gravitational copies

    International Nuclear Information System (INIS)

    Silva, M.R. da.

    1984-01-01

    An Abelian symmetry already considered by Einstein with respect to his asymmetrical field theories is related to the gravitational and gauge field copy phenomenon. It is shown that gauge field copies arise out of a straightforward generalization of the λ - map. The connection between Einstein's work on the λ-transformation and the copy phenomenon is obtained with the help of the Frobenius Theorem on the existence of foliations on a differentiable manifold. A problem like the one above is usually treated within the language of (intrinsic) Differential Geometry; General Relativity and classical unified field theories are traditionally developed in a classical style, that gap, a long introduction is prepared where the same structures are studied from the traditional and from the more recent point of view. (author)

  19. 3D Printing of Biosamples: A Concise Review

    Science.gov (United States)

    Zhao, Victoria Xin Ting; Wong, Ten It; Zhou, Xiaodong

    This paper reviews the recent development of 3D printing of biosamples, in terms of the 3D structure design, suitable printing technology, and available materials. Successfully printed 3D biosamples should possess the properties of high cell viability, vascularization and good biocompatibility. These goals are attained by printing the materials of hydrogels, polymers and cells, with a carefully selected 3D printer from the categories of inkjet printing, extrusion printing and laser printing, based on the uniqueness, advantages and disadvantages of these technologies. For recent developments, we introduce the 3D applications of creating scaffolds, printing cells for self-assembly and testing platforms. We foresee more bio-applications of 3D printing will be developed, with the advancements on materials and 3D printing machines.

  20. 3D Bio-Printing Review

    Science.gov (United States)

    Du, Xianbin

    2018-01-01

    Ultimate goal of tissue engineering is to replace pathological or necrotic body tissue or organ by artificial tissue or organ and tissue engineering is a very promising research field. 3D bio-printing is a kind of emerging technologies and a branch of tissue engineering. It has made significant progress in the past decade. 3D bio-printing can realize tissue and organ construction in vitro and has wide application in basic research and pharmacy. This paper is to make an analysis and review on 3D bio-printing from the perspectives of bioink, printing technology and technology application.

  1. 3D printing for dummies

    CERN Document Server

    Hausman, Kalani Kirk

    2014-01-01

    Get started printing out 3D objects quickly and inexpensively! 3D printing is no longer just a figment of your imagination. This remarkable technology is coming to the masses with the growing availability of 3D printers. 3D printers create 3-dimensional layered models and they allow users to create prototypes that use multiple materials and colors.  This friendly-but-straightforward guide examines each type of 3D printing technology available today and gives artists, entrepreneurs, engineers, and hobbyists insight into the amazing things 3D printing has to offer. You'll discover methods for

  2. Fabrication of Capacitive Acoustic Resonators Combining 3D Printing and 2D Inkjet Printing Techniques

    Directory of Open Access Journals (Sweden)

    Rubaiyet Iftekharul Haque

    2015-10-01

    Full Text Available A capacitive acoustic resonator developed by combining three-dimensional (3D printing and two-dimensional (2D printed electronics technique is described. During this work, a patterned bottom structure with rigid backplate and cavity is fabricated directly by a 3D printing method, and then a direct write inkjet printing technique has been employed to print a silver conductive layer. A novel approach has been used to fabricate a diaphragm for the acoustic sensor as well, where the conductive layer is inkjet-printed on a pre-stressed thin organic film. After assembly, the resulting structure contains an electrically conductive diaphragm positioned at a distance from a fixed bottom electrode separated by a spacer. Measurements confirm that the transducer acts as capacitor. The deflection of the diaphragm in response to the incident acoustic single was observed by a laser Doppler vibrometer and the corresponding change of capacitance has been calculated, which is then compared with the numerical result. Observation confirms that the device performs as a resonator and provides adequate sensitivity and selectivity at its resonance frequency.

  3. 3D Printing: Print the future of ophthalmology.

    Science.gov (United States)

    Huang, Wenbin; Zhang, Xiulan

    2014-08-26

    The three-dimensional (3D) printer is a new technology that creates physical objects from digital files. Recent technological advances in 3D printing have resulted in increased use of this technology in the medical field, where it is beginning to revolutionize medical and surgical possibilities. It is already providing medicine with powerful tools that facilitate education, surgical planning, and organ transplantation research. A good understanding of this technology will be beneficial to ophthalmologists. The potential applications of 3D printing in ophthalmology, both current and future, are explored in this article. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  4. Application to printed resistors

    International Nuclear Information System (INIS)

    Hachiyanagi, Yoshimi; Uraki, Hisatsugu; Sawamura, Masashi

    1989-01-01

    Most of printed circuit boards are made at present by etching copper foils which are laminated on insulating composite boards of paper/phenol resin or glass nonwoven fabric/epoxy rein. This is called subtractive process, and since this is a wet process, the problem of coping with the pollution due to etching solution, plating solution and others is involved. As the method of solving this problem, attention has been paid to the dry process which forms conductor patterns by screen printing using electro-conductive paste. For such resin substrates, generally polymer thick films (PTF) using thermosetting resin as the binder are used. Also the research on the formation of resistors, condensers and other parts by printing using the technology of cermet thick films (CTF) and PTF is active, and it is partially put in practical use. The problems are the deformation and deterioration of substrates, therefore, as the countermeasures, electron beam hardening type PTF has been studied, and various pastes have been developed. In this paper, electron beam hardening type printed resistors are reported. The features, resistance paste, and a number of the experiments on printed resistors are described. (K.I.)

  5. Prevalence of operator fatigue in winter maintenance operations.

    Science.gov (United States)

    Camden, Matthew C; Medina-Flintsch, Alejandra; Hickman, Jeffrey S; Bryce, James; Flintsch, Gerardo; Hanowski, Richard J

    2018-02-02

    Similar to commercial motor vehicle drivers, winter maintenance operators are likely to be at an increased risk of becoming fatigued while driving due to long, inconsistent shifts, environmental stressors, and limited opportunities for sleep. Despite this risk, there is little research concerning the prevalence of winter maintenance operator fatigue during winter emergencies. The purpose of this research was to investigate the prevalence, sources, and countermeasures of fatigue in winter maintenance operations. Questionnaires from 1043 winter maintenance operators and 453 managers were received from 29 Clear Road member states. Results confirmed that fatigue was prevalent in winter maintenance operations. Over 70% of the operators and managers believed that fatigue has a moderate to significant impact on winter maintenance operations. Approximately 75% of winter maintenance operators reported to at least sometimes drive while fatigued, and 96% of managers believed their winter maintenance operators drove while fatigued at least some of the time. Furthermore, winter maintenance operators and managers identified fatigue countermeasures and sources of fatigue related to winter maintenance equipment. However, the countermeasures believed to be the most effective at reducing fatigue during winter emergencies (i.e., naps) were underutilized. For example, winter maintenance operators reported to never use naps to eliminate fatigue. These results indicated winter maintenance operations are impacted by operator fatigue. These results support the increased need for research and effective countermeasures targeting winter maintenance operator fatigue. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  7. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  8. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  9. Inkjet-Printed Small-Molecule Organic Light-Emitting Diodes: Halogen-Free Inks, Printing Optimization, and Large-Area Patterning.

    Science.gov (United States)

    Zhou, Lu; Yang, Lei; Yu, Mengjie; Jiang, Yi; Liu, Cheng-Fang; Lai, Wen-Yong; Huang, Wei

    2017-11-22

    Manufacturing small-molecule organic light-emitting diodes (OLEDs) via inkjet printing is rather attractive for realizing high-efficiency and long-life-span devices, yet it is challenging. In this paper, we present our efforts on systematical investigation and optimization of the ink properties and the printing process to enable facile inkjet printing of conjugated light-emitting small molecules. Various factors on influencing the inkjet-printed film quality during the droplet generation, the ink spreading on the substrates, and its solidification processes have been systematically investigated and optimized. Consequently, halogen-free inks have been developed and large-area patterning inkjet printing on flexible substrates with efficient blue emission has been successfully demonstrated. Moreover, OLEDs manufactured by inkjet printing the light-emitting small molecules manifested superior performance as compared with their corresponding spin-cast counterparts.

  10. Banner Pages on the New Printing Infrastructure

    CERN Multimedia

    2006-01-01

    Changes to the printing service were announced in CERN Bulletin No. 37-38/2006. In the new infrastructure, the printing of the banner page has been disabled in order to reduce paper consumption. Statistics show that the average print job size is small and the paper savings by not printing the banner page could be up to 20 %. When each printer is moved onto the new infrastructure banner page printing will be disabled. In the case of corridor printers which are shared by several users, the Helpdesk can re-enable banner page printing upon request. We hope ultimately to arrive at a situation where banner page printing is enabled on fewer than 10% of printers registered on the network. You can still print banner pages on printers where it has been centrally disabled by using Linux. Simply add it to your print job on the client side by adding the -o job-sheets option to your lpr command. Detailed documentation is available on each SLC3/4 under the following link: http://localhost:631/sum.html#4_2 Please bea...

  11. Balkan Print Forum – Dynamic Balkan Print Media Community

    Directory of Open Access Journals (Sweden)

    Rossitza Velkova

    2011-11-01

    Full Text Available Founded in October 2006, the Balkan Print Forum is gradually becoming an important regional institution. Its main targets are to share experiences and know-how,to initiate and intensify contacts and to support joint projects in the Balkan region.Since drupa 2008 there are 11 member countries of the Balkan Print Forum:Albania, Bosnia and Herzegovina, Bulgaria, Croatia, Former Yugoslav Republic of Macedonia, Greece, Hungary, Romania, Serbia, Slovenia and Turkey. Partners of BPF are some companies and universities from Russia and Ukraine.

  12. Hacking DNA copy number for circuit engineering.

    Science.gov (United States)

    Wu, Feilun; You, Lingchong

    2017-07-27

    DNA copy number represents an essential parameter in the dynamics of synthetic gene circuits but typically is not explicitly considered. A new study demonstrates how dynamic control of DNA copy number can serve as an effective strategy to program robust oscillations in gene expression circuits.

  13. Active origami by 4D printing

    International Nuclear Information System (INIS)

    Ge, Qi; Qi, H Jerry; Dunn, Martin L; Dunn, Conner K

    2014-01-01

    Recent advances in three dimensional (3D) printing technology that allow multiple materials to be printed within each layer enable the creation of materials and components with precisely controlled heterogeneous microstructures. In addition, active materials, such as shape memory polymers, can be printed to create an active microstructure within a solid. These active materials can subsequently be activated in a controlled manner to change the shape or configuration of the solid in response to an environmental stimulus. This has been termed 4D printing, with the 4th dimension being the time-dependent shape change after the printing. In this paper, we advance the 4D printing concept to the design and fabrication of active origami, where a flat sheet automatically folds into a complicated 3D component. Here we print active composites with shape memory polymer fibers precisely printed in an elastomeric matrix and use them as intelligent active hinges to enable origami folding patterns. We develop a theoretical model to provide guidance in selecting design parameters such as fiber dimensions, hinge length, and programming strains and temperature. Using the model, we design and fabricate several active origami components that assemble from flat polymer sheets, including a box, a pyramid, and two origami airplanes. In addition, we directly print a 3D box with active composite hinges and program it to assume a temporary flat shape that subsequently recovers to the 3D box shape on demand. (paper)

  14. Active origami by 4D printing

    Science.gov (United States)

    Ge, Qi; Dunn, Conner K.; Qi, H. Jerry; Dunn, Martin L.

    2014-09-01

    Recent advances in three dimensional (3D) printing technology that allow multiple materials to be printed within each layer enable the creation of materials and components with precisely controlled heterogeneous microstructures. In addition, active materials, such as shape memory polymers, can be printed to create an active microstructure within a solid. These active materials can subsequently be activated in a controlled manner to change the shape or configuration of the solid in response to an environmental stimulus. This has been termed 4D printing, with the 4th dimension being the time-dependent shape change after the printing. In this paper, we advance the 4D printing concept to the design and fabrication of active origami, where a flat sheet automatically folds into a complicated 3D component. Here we print active composites with shape memory polymer fibers precisely printed in an elastomeric matrix and use them as intelligent active hinges to enable origami folding patterns. We develop a theoretical model to provide guidance in selecting design parameters such as fiber dimensions, hinge length, and programming strains and temperature. Using the model, we design and fabricate several active origami components that assemble from flat polymer sheets, including a box, a pyramid, and two origami airplanes. In addition, we directly print a 3D box with active composite hinges and program it to assume a temporary flat shape that subsequently recovers to the 3D box shape on demand.

  15. Inkjet and screen printing for electronic applications

    OpenAIRE

    Medina Rodríguez, Beatriz

    2016-01-01

    Printed electronics (PE) is a set of printing methods used to create electrical devices on various substrates. Printing typically uses common printing equipment suitable for defining patterns on material, such as screen printing, flexography, gravure, offset lithography, and inkjet. Electrically functional, electronic or optical inks are deposited on the substrate, creating active or passive devices. PE offers a great advantage when compared to traditional processes or microelectronics du...

  16. Can lip prints provide biologic evidence?

    Science.gov (United States)

    Sharma, Preeti; Sharma, Neeraj; Wadhwan, Vijay; Aggarwal, Pooja

    2016-01-01

    Lip prints are unique and can be used in personal identification. Very few studies are available which establish them as biological evidence in the court of law. Thus, the objective of this study was to attempt to isolate DNA and obtain full short tandem repeat (STR) loci of the individual from the lip prints on different surfaces. Twelve lip prints were procured on different surfaces such as tissue paper, cotton cloth, ceramic tile, and glass surface. Latent lip prints were developed using fingerprint black powder. Lipstick-coated lip prints were also collected on the same supporting items. DNA was isolated, quantified, and amplified using Identifiler™ kit to type 15 STR loci. Ample quantity of DNA was extracted from all the lip print impressions and 15 loci were successfully located in seven samples. Fourteen loci were successfully typed in 3 lip impressions while 13 loci were typed in 2 samples. This study emphasizes the relevance of lip prints at the scene of crime. Extraction of DNA followed by typing of STR loci establishes the lip prints as biological evidence too. Tissue papers, napkins, cups, and glasses may have imprints of the suspect's lips. Thus, the full genetic profile is extremely useful for the forensic team.

  17. 3D printed e-tongue

    Science.gov (United States)

    Gaál, Gabriel; da Silva, Tatiana A.; Gaál, Vladimir; Hensel, Rafael C.; Amaral, Lucas R.; Rodrigues, Varlei; Riul, Antonio

    2018-05-01

    Nowadays, one of the biggest issues addressed to electronic sensor fabrication is the build-up of efficient electrodes as an alternative way to the expensive, complex and multistage processes required by traditional techniques. Printed electronics arises as an interesting alternative to fulfill this task due to the simplicity and speed to stamp electrodes on various surfaces. Within this context, the Fused Deposition Modeling 3D printing is an emerging, cost-effective and alternative technology to fabricate complex structures that potentiates several fields with more creative ideas and new materials for a rapid prototyping of devices. We show here the fabrication of interdigitated electrodes using a standard home-made CoreXY 3D printer using transparent and graphene-based PLA filaments. Macro 3D printed electrodes were easily assembled within 6 minutes with outstanding reproducibility. The electrodes were also functionalized with different nanostructured thin films via dip-coating Layer-by-Layer technique to develop a 3D printed e-tongue setup. As a proof of concept, the printed e-tongue was applied to soil analysis. A control soil sample was enriched with several macro-nutrients to the plants (N, P, K, S, Mg and Ca) and the discrimination was done by electrical impedance spectroscopy of water solution of the soil samples. The data was analyzed by Principal Component Analysis and the 3D printed sensor distinguished clearly all enriched samples despite the complexity of the soil chemical composition. The 3D printed e-tongue successfully used in soil analysis encourages further investments in developing new sensory tools for precision agriculture and other fields exploiting the simplicity and flexibility offered by the 3D printing techniques.

  18. Plasma jet printing for flexible substrates

    Energy Technology Data Exchange (ETDEWEB)

    Gandhiraman, Ram P.; Singh, Eric; Diaz-Cartagena, Diana C.; Koehne, Jessica; Meyyappan, M. [Center for Nanotechnology, NASA Ames Research Center, Moffett Field, California 94035 (United States); Nordlund, Dennis [Stanford Synchrotron Radiation Lightsource, SLAC National Accelerator Laboratory, Menlo Park, California 94025 (United States)

    2016-03-21

    Recent interest in flexible electronics and wearable devices has created a demand for fast and highly repeatable printing processes suitable for device manufacturing. Robust printing technology is critical for the integration of sensors and other devices on flexible substrates such as paper and textile. An atmospheric pressure plasma-based printing process has been developed to deposit different types of nanomaterials on flexible substrates. Multiwalled carbon nanotubes were deposited on paper to demonstrate site-selective deposition as well as direct printing without any type of patterning. Plasma-printed nanotubes were compared with non-plasma-printed samples under similar gas flow and other experimental conditions and found to be denser with higher conductivity. The utility of the nanotubes on the paper substrate as a biosensor and chemical sensor was demonstrated by the detection of dopamine, a neurotransmitter, and ammonia, respectively.

  19. Anti-spoofing for display and print attacks on palmprint verification systems

    Science.gov (United States)

    Kanhangad, Vivek; Bhilare, Shruti; Garg, Pragalbh; Singh, Pranjalya; Chaudhari, Narendra

    2015-05-01

    A number of approaches for personal authentication using palmprint features have been proposed in the literature, majority of which focus on improving the matching performance. However, of late, preventing potential attacks on biometric systems has become a major concern as more and more biometric systems get deployed for wide range of applications. Among various types of attacks, sensor level attack, commonly known as spoof attack, has emerged as the most common attack due to simplicity in its execution. In this paper, we present an approach for detection of display and print based spoof attacks on palmprint verifcation systems. The approach is based on the analysis of acquired hand images for estimating surface re ectance. First and higher order statistical features computed from the distributions of pixel intensities and sub-band wavelet coeefficients form the feature set. A trained binary classifier utilizes the discriminating information to determine if the acquired image is of real hand or a fake one. Experiments are performed on a publicly available hand image dataset, containing 1300 images corresponding to 230 subjects. Experimental results show that the real hand biometrics samples can be substituted by the fake digital or print copies with an alarming spoof acceptance rate as high as 79.8%. Experimental results also show that the proposed spoof detection approach is very effective for discriminating between real and fake palmprint images. The proposed approach consistently achieves over 99% average 10-fold cross validation classification accuracy in our experiments.

  20. The NIH 3D Print Exchange: A Public Resource for Bioscientific and Biomedical 3D Prints

    OpenAIRE

    Coakley, Meghan F.; Hurt, Darrell E.; Weber, Nick; Mtingwa, Makazi; Fincher, Erin C.; Alekseyev, Vsevelod; Chen, David T.; Yun, Alvin; Gizaw, Metasebia; Swan, Jeremy; Yoo, Terry S.; Huyen, Yentram

    2014-01-01

    The National Institutes of Health (NIH) has launched the NIH 3D Print Exchange, an online portal for discovering and creating bioscientifically relevant 3D models suitable for 3D printing, to provide both researchers and educators with a trusted source to discover accurate and informative models. There are a number of online resources for 3D prints, but there is a paucity of scientific models, and the expertise required to generate and validate such models remains a barrier. The NIH 3D Print ...

  1. Automotive advertising copy test. Final report

    Energy Technology Data Exchange (ETDEWEB)

    1984-11-01

    In order to better understand consumer perceptions and use of the mileage estimates as presented in print advertising, the Department of Energy, in conjunction with the Federal Trade Commission and the EPA, initiated a research project. Purpose was to: measure recall/recognition of EPA Estimated MPG/highway mileage estimates in print ads; determine consumer expectations and believability of advertised mileage guidelines; measure recall/comprehension of mileage disclaimers; and determine how consumers utilize published mileage estimates.

  2. Electron beam hardening type copper plate printing ink

    International Nuclear Information System (INIS)

    Kawamura, Eiji; Inoue, Mitsuo; Kusaki, Satoichiro

    1989-01-01

    Copper plate printing is the printing method of filling ink in the parts of concave printing elements on a type area, and transferring the ink to a base, and it is the feature that the ink in the printing element parts of a print rises. Copper plate prints show profound feeling, in addition, its effect of preventing forgery is high. This method is generally called engraving printing, and is used frequently for printing various bills and artistic prints. The electron beam irradiation apparatus installed in the laboratory of the Printing Bureau, Ministry of Finance, is an experimental machine of area beam type, and is so constructed as to do batch conveyance and web conveyance. As the ink in printing element parts rises, the offset at the delivery part of a printing machine becomes a problem. Electron beam is superior in its transparency, and can dry instantaneously to the inside of opaque ink. At 200 kV of acceleration voltage, the ink of copper plate prints can be hardened by electron beam irradiation. The dilution monomers as the vehicle for ink were tested for their dilution capability and the effect of electron beam hardening. The problem in the utilization of electron beam is the deterioration of papers, and the counter-measures were tested. (K.I.)

  3. Readability as a Factor in Magazine Ad Copy Recall.

    Science.gov (United States)

    Wesson, David A.

    1989-01-01

    Examines the relationship between advertising copy readability and advertising effectiveness. Finds that recall is improved when the copy style is either fairly easy or fairly hard to read. Suggests the value of considering copy readability as a potential contributor, though a minor one, to the success of magazine advertising. (RS)

  4. Customizing digital printing for fine art practice

    Science.gov (United States)

    Parraman, Carinna E.; Thirkell, Paul; Hoskins, Steve; Wang, Hong Qiang; Laidler, Paul

    2005-01-01

    The presentation will demonstrate how through alternative methods of digital print production the Centre for Fine Print Research (CFPR) is developing methodologies for digital printing that attempt to move beyond standard reproductive print methods. Profiling is used for input and output hardware, along with bespoke profiling for fine art printmaking papers. Examples of artist's work, and examples from the Perpetual Portfolio are included - an artist in residence scheme for selected artists wanting to work at the Centre and to make a large-format digital print. Colour is an important issue: colour fidelity, colour density on paper, colour that can be achieved through multiple-pass printing. Research is also underway to test colour shortfalls in the current inkjet ink range, and to extend colour through the use of traditional printing inks.

  5. PRINTING TECHNIQUES: RECENT DEVELOPMENTS IN PHARMACEUTICAL TECHNOLOGY.

    Science.gov (United States)

    Jamroz, Witold; Kurek, Mateusz; Lyszczarz, Ewelina; Brniak, Witold; Jachowicz, Renata

    2017-05-01

    In the last few years there has been a huge progress in a development of printing techniques and their application in pharmaceutical sciences and particularly in the pharmaceutical technology. The variety of printing methods makes it necessary to systemize them, explain the principles of operation, and specify the possibilities of their use in pharmaceutical technology. This paper aims to review the printing techniques used in a drug development process. The growing interest in 2D and 3D printing methods results in continuously increasing number of scientific papers. Introduction of the first printed drug Spritam@ to the market seems to be a milestone of the 3D printing development. Thus, a particular aim of this review is to show the latest achievements of the researchers in the field of the printing medicines.

  6. AN HST PROPER-MOTION STUDY OF THE LARGE-SCALE JET OF 3C273

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Eileen T.; Georganopoulos, Markos [University of Maryland Baltimore County, Baltimore, MD 21250 (United States); Sparks, William B. [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Anderson, Jay; Marel, Roeland van der; Biretta, John; Chiaberge, Marco; Norman, Colin [Space Telescope Science Institute, Baltimore, MD 21210 (United States); Tony Sohn, Sangmo [Johns Hopkins University, Baltimore, MD 21210 (United States); Perlman, Eric, E-mail: meyer@stsci.edu [Florida Institute of Technology, Melbourne, FL 32901 (United States)

    2016-02-20

    The radio galaxy 3C 273 hosts one of the nearest and best-studied powerful quasar jets. Having been imaged repeatedly by the Hubble Space Telescope (HST) over the past twenty years, it was chosen for an HST program to measure proper motions in the kiloparsec-scale resolved jets of nearby radio-loud active galaxies. The jet in 3C 273 is highly relativistic on sub-parsec scales, with apparent proper motions up to 15c observed by very long baseline interferometry. In contrast, we find that the kiloparsec-scale knots are compatible with being stationary, with a mean speed of −0.2 ± 0.5c over the whole jet. Assuming the knots are packets of moving plasma, an upper limit of 1c implies a bulk Lorentz factor Γ < 2.9. This suggests that the jet has either decelerated significantly by the time it reaches the kiloparsec scale, or that the knots in the jet are standing shock features. The second scenario is incompatible with the inverse Compton off the Cosmic Microwave Background (IC/CMB) model for the X-ray emission of these knots, which requires the knots to be in motion, but IC/CMB is also disfavored in the first scenario due to energetic considerations, in agreement with the recent finding of Meyer and Georganopoulos which ruled out the IC/CMB model for the X-ray emission of 3C 273 via gamma-ray upper limits.

  7. Converting hard copy documents for electronic dissemination

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, F.

    1994-12-31

    Since the advent of computer systems, the goal of a paperless office, and even a paperless society, has been pursued. While the normal paper flow in an organization is far from totally automated, particularly for items requiring signatures or authorizations, electronic information dissemination is becoming an almost simple task. The reasons for providing on-line documents are many and include faster and easier access for everyone, elimination of printing costs, reduction of wasted shelf and desk space, and the security of having a centrally-located, always up-to-date document. New computer software even provides the user with the ability to annotate documents and to have bookmarks so that the old scribbled-in and dog-eared manual can be replaced without loosing this `customizability`. Moreover, new hypermedia capabilities mean that documents can be read in a non-linear fashion and can include color figures and photographs, audio, and even animation sequences, capabilities which exceed those of paper. The proliferation of network-based information servers, coupled with the growth of the Internet, has enticed academic, governmental, and even commercial organizations to provide increasing numbers of documents and data bases in electronic form via the network, not just to internal staff, but to the public as well. Much of this information, which includes everything from mundane company procedures to spiffy marketing brochures, was previously published only in hard copy. Converting existing documents to electronic form and producing only electronic versions of new documents poses some interesting challenges to the maintainer or author.

  8. Influence of Parameters of a Printing Plate on Photoluminescence of Nanophotonic Printed Elements of Novel Packaging

    Directory of Open Access Journals (Sweden)

    Olha Sarapulova

    2015-01-01

    Full Text Available In order to produce nanophotonic elements for smart packaging, we investigated the influence of the parameters of screen and offset gravure printing plates on features of printed application of coatings with nanophotonic components and on parameters of their photoluminescence. To determine the dependence of luminescence intensity on the thickness of solid coating, we carried out the formation of nanophotonic solid surfaces by means of screen printing with different layer thickness on polypropylene film. The obtained analytical dependencies were used to confirm the explanation of the processes that occur during the fabrication of nanophotonic coverings with offset gravure printing plates. As a result of experimental studies, it was determined that the different character of the dependency of total luminescence intensity of nanophotonic elements from the percentage of a pad is explained by the use of different types of offset gravure printing plates, where the size of raster points remains constant in one case and changes in the other case, while the depth of the printing elements accordingly changes or remains constant. To obtain nanophotonic areas with predetermined photoluminescent properties, the influence of investigated factors on changes of photoluminescent properties of nanophotonic printed surfaces should be taken into consideration.

  9. Elimination of Parallel Copies using Code Motion on Data Dependence Graphs

    DEFF Research Database (Denmark)

    Brandner, Florian; Colombet, Quentin

    2013-01-01

    , while at the same time a valid register assignment is preserved. Our results show that even after traditional register allocation with coalescing our technique is able to eliminate an additional 3% (up to 9%) of the remaining copies and reduce the weighted costs of register copies by up to 25......Register allocation regained much interest in recent years due to the development of decoupled strategies that split the problem into separate phases: spilling, register assignment, and copy elimination. Traditional approaches to copy elimination during register allocation are based on interference......% for the SPECINT 2000 benchmarks. In comparison to Parallel Copy Motion, our technique removes 11% (up to 20%) more copies and up to 39% more of the copy costs....

  10. A comprehensive profile of DNA copy number variations in a Korean population: identification of copy number invariant regions among Koreans.

    Science.gov (United States)

    Jeon, Jae Pil; Shim, Sung Mi; Jung, Jong Sun; Nam, Hye Young; Lee, Hye Jin; Oh, Berm Seok; Kim, Kuchan; Kim, Hyung Lae; Han, Bok Ghee

    2009-09-30

    To examine copy number variations among the Korean population, we compared individual genomes with the Korean reference genome assembly using the publicly available Korean HapMap SNP 50 k chip data from 90 individuals. Korean individuals exhibited 123 copy number variation regions (CNVRs) covering 27.2 mb, equivalent to 1.0% of the genome in the copy number variation (CNV) analysis using the combined criteria of P value (Por= 0.25) among study subjects. In contrast, when compared to the Affymetrix reference genome assembly from multiple ethnic groups, considerably more CNVRs (n=643) were detected in larger proportions (5.0%) of the genome covering 135.1 mb even by more stringent criteria (Por=0.25), reflecting ethnic diversity of structural variations between Korean and other populations. Some CNVRs were validated by the quantitative multiplex PCR of short fluorescent fragment (QMPSF) method, and then copy number invariant regions were detected among the study subjects. These copy number invariant regions would be used as good internal controls for further CNV studies. Lastly, we demonstrated that the CNV information could stratify even a single ethnic population with a proper reference genome assembly from multiple heterogeneous populations.

  11. 3D-printed Bioanalytical Devices

    Science.gov (United States)

    Bishop, Gregory W; Satterwhite-Warden, Jennifer E; Kadimisetty, Karteek; Rusling, James F

    2016-01-01

    While 3D printing technologies first appeared in the 1980s, prohibitive costs, limited materials, and the relatively small number of commercially available printers confined applications mainly to prototyping for manufacturing purposes. As technologies, printer cost, materials, and accessibility continue to improve, 3D printing has found widespread implementation in research and development in many disciplines due to ease-of-use and relatively fast design-to-object workflow. Several 3D printing techniques have been used to prepare devices such as milli- and microfluidic flow cells for analyses of cells and biomolecules as well as interfaces that enable bioanalytical measurements using cellphones. This review focuses on preparation and applications of 3D-printed bioanalytical devices. PMID:27250897

  12. Printing and civilization; Insatsu to bunmei

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, T. [Dainippon Ink and Chemicals Inc., Tokyo (Japan)

    1995-01-01

    It can be said that the printing has not been only a barometer of culture, but also has formed a foundation of culture as the facilities of civilization, and has shouldered a role to drag the culture. In modern nation, that the freedom of speech and press has been clearly pointed out as the fundamental human right, shows straightforwardly an important significance of such a printing. Though it is also statistically clear that there is an exact relation between GNP and printed materials per capita, in this paper centering around the examples in Japan, a relation between the printing and civilization/culture is introduced like the episodes. It does not yet become definite that what kind of influence a proposition so called `printing is a barometer of culture` is affected by the information/communication revolution which is regarded to be advanced very rapidly. However, speaking conclusively it can not be thought that a demand for the printing which can produce the information in a great deal of quantity with a low cost, and for the printing which does not need special output terminal and is excellent in portability and glance ability, may largely be reduced. 1 fig.

  13. Natural fibre composites for 3D Printing

    OpenAIRE

    Pandey, Kapil

    2015-01-01

    3D printing has been common option for prototyping. Not all the materials are suitable for 3D printing. Various studies have been done and still many are ongoing regarding the suitability of the materials for 3D printing. This thesis work discloses the possibility of 3D printing of certain polymer composite materials. The main objective of this thesis work was to study the possibility for 3D printing the polymer composite material composed of natural fibre composite and various different ...

  14. Active materials by four-dimension printing

    Science.gov (United States)

    Ge, Qi; Qi, H. Jerry; Dunn, Martin L.

    2013-09-01

    We advance a paradigm of printed active composite materials realized by directly printing glassy shape memory polymer fibers in an elastomeric matrix. We imbue the active composites with intelligence via a programmed lamina and laminate architecture and a subsequent thermomechanical training process. The initial configuration is created by three-dimension (3D) printing, and then the programmed action of the shape memory fibers creates time dependence of the configuration—the four-dimension (4D) aspect. We design and print laminates in thin plate form that can be thermomechanically programmed to assume complex three-dimensional configurations including bent, coiled, and twisted strips, folded shapes, and complex contoured shapes with nonuniform, spatially varying curvature. The original flat plate shape can be recovered by heating the material again. We also show how the printed active composites can be directly integrated with other printed functionalities to create devices; here we demonstrate this by creating a structure that can assemble itself.

  15. 46 CFR 45.73 - Winter freeboard.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Winter freeboard. 45.73 Section 45.73 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Freeboards § 45.73 Winter freeboard. The minimum winter freeboard (fw) in inches is obtained by the formula: fw=f(s)+T s...

  16. Printing versus coating - What will be the future production technology for printed electronics?

    Energy Technology Data Exchange (ETDEWEB)

    Glawe, Andrea; Eggerath, Daniel; Schäfer, Frank [KROENERT GmbH and Co KG, Schuetzenstrasse 105, 22761 Hamburg (Germany)

    2015-02-17

    The market of Large Area Organic Printed Electronics is developing rapidly to increase efficiency and quality as well as to lower costs further. Applications for OPV, OLED, RFID and compact Printed Electronic systems are increasing. In order to make the final products more affordable, but at the same time highly accurate, Roll to Roll (R2R) production on flexible transparent polymer substrates is the way forward. There are numerous printing and coating technologies suitable depending on the design, the product application and the chemical process technology. Mainly the product design (size, pattern, repeatability) defines the application technology.

  17. Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability. | Office of Cancer Genomics

    Science.gov (United States)

    Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.

  18. CERN's Open Access E-print Coverage in 2006 : Three Quarters Full and Counting

    CERN Document Server

    Yeomans, Joanne

    2006-01-01

    CERN's open access e-print repository, CERN Document Server (CDS), contains open access full-text copies of nearly three quarters of its own recently-authored documents. As a result of retrospective scanning projects, just over half of all documents written since CERN's creation in 1954 are available. Metadata harvesting from a variety of external sources contributes to the identification of CERN-authored documents such that close to 100% are believed to be found. Full-text files are obtained through author submission, retro-scanning and upload from external sources. A growth in the numbers of metadata records and full-text files is demonstrated between 2005 and 2006 and the improvements can be linked to certain projects carried out by the Library staff. Ongoing and future projects to capture missing files include scanning projects, attempts to raise author awareness, and direct author contact.

  19. Detection of latent prints by Raman imaging

    Science.gov (United States)

    Lewis, Linda Anne [Andersonville, TN; Connatser, Raynella Magdalene [Knoxville, TN; Lewis, Sr., Samuel Arthur

    2011-01-11

    The present invention relates to a method for detecting a print on a surface, the method comprising: (a) contacting the print with a Raman surface-enhancing agent to produce a Raman-enhanced print; and (b) detecting the Raman-enhanced print using a Raman spectroscopic method. The invention is particularly directed to the imaging of latent fingerprints.

  20. Vocal copying of individually distinctive signature whistles in bottlenose dolphins

    Science.gov (United States)

    King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.

    2013-01-01

    Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174

  1. Job Performance Aids: Research and Technology State-of-the-Art

    Science.gov (United States)

    1978-07-01

    IMAGING SPECIAL REQUESTS STRIPPING SUPPLY COPIES PRINTING PLATE ARCHIVES PRINTING BINDING __COPYING Figure 3. JPA delivery system stages. f2 ! 20 Data...technology as can be applied to JPAs has not changed appre- ciably for many years. The printing process includes several steps (i.e., imaging , stripping...recommend design choices to the extent of page size and typography . The environmental constraints noted are generally human engineering considera

  2. Colour print workflow and methods for multilayering of colour and decorative inks using UV inkjet for fine art printing

    Science.gov (United States)

    Parraman, Carinna

    2012-01-01

    In order to increase density of colour and improve ink coverage when printing onto a range of non standard substrates, this paper will present research into multi-layering of colour and the appearance of colour at 'n' levels of ink coverage. Returning to our original investigation of artist's requirements when making inkjet prints, these observations are based on empirical approaches that address the need to present physical data that is more useful and meaningful to the designer. The study has used multi-pass printed colour charts to measure colour and to provide users with an understanding at a soft-preview level to demonstrate the appearance of printed colour on different substrates. Test results relating to the appearance of print on different surfaces, and a series of case studies will be presented using recent research into the capabilities of UV printing technology, which has widened the opportunities for the designer to print onto non-standard materials. It will also present a study into layering of greys and gloss in order to improve the appearance of printed images onto metal.

  3. The influence of printing substrate on macro non-uniformity and line reproduction quality of imprints printed with electrophotographic process

    Directory of Open Access Journals (Sweden)

    Đorđe Vujčić

    2016-12-01

    Full Text Available Print quality is very important for every printing technique. It depends on many different quality attributes. This research included analysis of macro non-uniformities and line reproduction. 16 different paper substrates printed by electrophotographic process were analyzed. They were separated in two groups: coated and uncoated papers. Analysis of macro non-uniformity showed that print mottle has lower values when printed on coated papers than on uncoated papers. Line reproduction analysis showed that the toner spreaded, during melting and fixation, on line edges for both types of paper. According to these results it can be concluded that paper substrate affects the macro non-uniformity and line reproduction, thus overall print quality.

  4. Reprocessable thermosets for sustainable three-dimensional printing.

    Science.gov (United States)

    Zhang, Biao; Kowsari, Kavin; Serjouei, Ahmad; Dunn, Martin L; Ge, Qi

    2018-05-08

    Among all three-dimensional (3D) printing materials, thermosetting photopolymers claim almost half of the market, and have been widely used in various fields owing to their superior mechanical stability at high temperatures, excellent chemical resistance as well as good compatibility with high-resolution 3D printing technologies. However, once these thermosetting photopolymers form 3D parts through photopolymerization, the covalent networks are permanent and cannot be reprocessed, i.e., reshaped, repaired, or recycled. Here, we report a two-step polymerization strategy to develop 3D printing reprocessable thermosets (3DPRTs) that allow users to reform a printed 3D structure into a new arbitrary shape, repair a broken part by simply 3D printing new material on the damaged site, and recycle unwanted printed parts so the material can be reused for other applications. These 3DPRTs provide a practical solution to address environmental challenges associated with the rapid increase in consumption of 3D printing materials.

  5. Concept of heat-induced inkless eco-printing.

    Science.gov (United States)

    Chen, Jinxiang; Wang, Yong; Xie, Juan; Meng, Chuang; Wu, Gang; Zu, Qiao

    2012-07-01

    Existing laser and inkjet printers often produce adverse effects on human health, the recycling of printing paper and the environment. Therefore, this paper examines the thermogravimetry curves for printer paper, analyzes the discoloration of paper using heat-induction, and investigates the relationship between paper discoloration and the heat-inducing temperature. The mechanism of heat-induced printing is analyzed initially, and its feasibility is determined by a comparative analysis of heat-induced (laser ablation) printing and commercial printing. The innovative concept of heat-induced inkless eco-printing is proposed, in which the required text or graphics are formed on the printing paper via yellowing and blackening produced by thermal energy. This process does not require ink during the printing process; thus, it completely eliminates the aforementioned health and environmental issues. This research also contributes to related interdisciplinary research in biology, laser technology, photochemistry, nano-science, paper manufacturing and color science. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Print like an Egyptian.

    Science.gov (United States)

    Weisensee, Marilyn

    1990-01-01

    Describes a relief printmaking unit for sixth graders with the objective of decorating the inside of a pyramid. Ancient Egyptian imagery was used to help students become familiar with the style. Students designed and printed linoleum prints in different colors. They then critiqued their work and made their selection for the pyramid. (KM)

  7. Medical 3D Printing for the Radiologist

    Science.gov (United States)

    Mitsouras, Dimitris; Liacouras, Peter; Imanzadeh, Amir; Giannopoulos, Andreas A.; Cai, Tianrun; Kumamaru, Kanako K.; George, Elizabeth; Wake, Nicole; Caterson, Edward J.; Pomahac, Bohdan; Ho, Vincent B.; Grant, Gerald T.

    2015-01-01

    While use of advanced visualization in radiology is instrumental in diagnosis and communication with referring clinicians, there is an unmet need to render Digital Imaging and Communications in Medicine (DICOM) images as three-dimensional (3D) printed models capable of providing both tactile feedback and tangible depth information about anatomic and pathologic states. Three-dimensional printed models, already entrenched in the nonmedical sciences, are rapidly being embraced in medicine as well as in the lay community. Incorporating 3D printing from images generated and interpreted by radiologists presents particular challenges, including training, materials and equipment, and guidelines. The overall costs of a 3D printing laboratory must be balanced by the clinical benefits. It is expected that the number of 3D-printed models generated from DICOM images for planning interventions and fabricating implants will grow exponentially. Radiologists should at a minimum be familiar with 3D printing as it relates to their field, including types of 3D printing technologies and materials used to create 3D-printed anatomic models, published applications of models to date, and clinical benefits in radiology. Online supplemental material is available for this article. ©RSNA, 2015 PMID:26562233

  8. Medical 3D Printing for the Radiologist.

    Science.gov (United States)

    Mitsouras, Dimitris; Liacouras, Peter; Imanzadeh, Amir; Giannopoulos, Andreas A; Cai, Tianrun; Kumamaru, Kanako K; George, Elizabeth; Wake, Nicole; Caterson, Edward J; Pomahac, Bohdan; Ho, Vincent B; Grant, Gerald T; Rybicki, Frank J

    2015-01-01

    While use of advanced visualization in radiology is instrumental in diagnosis and communication with referring clinicians, there is an unmet need to render Digital Imaging and Communications in Medicine (DICOM) images as three-dimensional (3D) printed models capable of providing both tactile feedback and tangible depth information about anatomic and pathologic states. Three-dimensional printed models, already entrenched in the nonmedical sciences, are rapidly being embraced in medicine as well as in the lay community. Incorporating 3D printing from images generated and interpreted by radiologists presents particular challenges, including training, materials and equipment, and guidelines. The overall costs of a 3D printing laboratory must be balanced by the clinical benefits. It is expected that the number of 3D-printed models generated from DICOM images for planning interventions and fabricating implants will grow exponentially. Radiologists should at a minimum be familiar with 3D printing as it relates to their field, including types of 3D printing technologies and materials used to create 3D-printed anatomic models, published applications of models to date, and clinical benefits in radiology. Online supplemental material is available for this article. (©)RSNA, 2015.

  9. "Dear Teacher, Johnny Copied."

    Science.gov (United States)

    Jackson, Louise A.; And Others

    1987-01-01

    Presents the problem of intentional or unintentional plagiarism on the part of young students, several possible causes for it, and offers ways teachers can help students avoid copying and understand the value of owning one's writing. (JC)

  10. Photooxidation stability of microcapsules in thermochromic prints

    Directory of Open Access Journals (Sweden)

    Mirela Rozic

    2018-03-01

    Full Text Available In this paper, photochemical stability of two thermochromic prints was investigated: vegetable oil based offset and UV curing screen printing ink. The obtained preliminary results can be used for further detailed examination of prints stability. It is well known that thermochromic printing inks are very unstabile when exsposed to UV irradiance and this is why they are mainly used for applications that are not directly exposed to sunlight. The results of the study show the heterogeneous nature of photooxidative degradation of thermochromic prints, and the opposite behaviour of photooxidation can be noticed comparing examined prints. Microcapsules in the UV curable screen print by fixation with polar polymer binder can create a new products stable to photoxidation. For this reason, the areas where the microcapsules and binder are bonded together are stable. Degraded only areas where binder is not related to microcapsules. Microcapsules in offset print do not have the ability to create new stabile forms due to smaller polarity and different chemical composition of the offset oxidized binder. In the offset print, the microcapsules are the least photooxidative stable and also cause lower photooxidative stability of the binder in contact with them. Cavities are formed in the areas where microcapsules are in contact with the binder, while the areas in which the binder is not in contact with microcapsules are not degraded.

  11. 38 CFR 1.526 - Copies of records and papers.

    Science.gov (United States)

    2010-07-01

    ... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per page...

  12. The classical double copy for Taub–NUT spacetime

    Energy Technology Data Exchange (ETDEWEB)

    Luna, Andrés, E-mail: a.luna-godoy.1@research.gla.ac.uk [School of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom); Monteiro, Ricardo, E-mail: monteiro@maths.ox.ac.uk [Mathematical Institute, University of Oxford, Oxford OX2 6GG, England (United Kingdom); O' Connell, Donal, E-mail: donal@staffmail.ed.ac.uk [Higgs Centre for Theoretical Physics, School of Physics and Astronomy, The University of Edinburgh, Edinburgh EH9 3JZ, Scotland (United Kingdom); Kavli Institute for Theoretical Physics, University of California, Santa Barbara, CA 93106-4030 (United States); White, Chris D., E-mail: Christopher.White@glasgow.ac.uk [School of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ, Scotland (United Kingdom)

    2015-11-12

    The double copy is a much-studied relationship between gauge theory and gravity amplitudes. Recently, this was generalised to an infinite family of classical solutions to Einstein's equations, namely stationary Kerr–Schild geometries. In this paper, we extend this to the Taub–NUT solution in gravity, which has a double Kerr–Schild form. The single copy of this solution is a dyon, whose electric and magnetic charges are related to the mass and NUT charge in the gravity theory. Finally, we find hints that the classical double copy extends to curved background geometries.

  13. All-printed capacitors with continuous solution dispensing technology

    Science.gov (United States)

    Ge, Yang; Plötner, Matthias; Berndt, Andreas; Kumar, Amit; Voit, Brigitte; Pospiech, Doris; Fischer, Wolf-Joachim

    2017-09-01

    Printed electronics have been introduced into the commercial markets in recent years. Various printing technologies have emerged aiming to process printed electronic devices with low cost, environmental friendliness, and compatibility with large areas and flexible substrates. The aim of this study is to propose a continuous solution dispensing technology for processing all-printed thin-film capacitors on glass substrates using a leading-edge printing instrument. Among all printing technologies, this study provides concrete proof of the following outstanding advantages of this technology: high tolerance to inks, high throughput, low cost, and precise pattern transfers. Ag nanoparticle ink based on glycol ethers was used to print the electrodes. To obtain dielectric ink, a copolymer powder of poly(methyl methacrylate-co-benzoylphenyl methacrylate) containing crosslinkable side groups was dissolved in anisole. Various layouts were designed to support multiple electronic applications. Scanning electron microscopy and atomic force microscopy were used to investigate the all-printed capacitor layers formed using the proposed process. Additionally, the printed capacitors were electrically characterized under direct current and alternating current. The measured electrical properties of the printed capacitors were consistent with the theoretical results.

  14. Influence of Parameters of a Printing Plate on Photoluminescence of Nano photonic Printed Elements of Novel Packaging

    International Nuclear Information System (INIS)

    Sarapulova, O.; Sherstiuk, V.

    2015-01-01

    In order to produce nano photonic elements for smart packaging, we investigated the influence of the parameters of screen and offset gravure printing plates on features of printed application of coatings with nano photonic components and on parameters of their photoluminescence. To determine the dependence of luminescence intensity on the thickness of solid coating, we carried out the formation of nano photonic solid surfaces by means of screen printing with different layer thickness on polypropylene film. The obtained analytical dependencies were used to confirm the explanation of the processes that occur during the fabrication of nano photonic coverings with offset gravure printing plates. As a result of experimental studies, it was determined that the different character of the dependency of total luminescence intensity of nano photonic elements from the percentage of a pad is explained by the use of different types of offset gravure printing plates, where the size of raster points remains constant in one case and changes in the other case, while the depth of the printing elements accordingly changes or remains constant. To obtain nano photonic areas with predetermined photo luminescent properties, the influence of investigated factors on changes of photo luminescent properties of nano photonic printed surfaces should be taken into consideration

  15. Review of Recent Inkjet-Printed Capacitive Tactile Sensors

    Directory of Open Access Journals (Sweden)

    Ahmed Salim

    2017-11-01

    Full Text Available Inkjet printing is an advanced printing technology that has been used to develop conducting layers, interconnects and other features on a variety of substrates. It is an additive manufacturing process that offers cost-effective, lightweight designs and simplifies the fabrication process with little effort. There is hardly sufficient research on tactile sensors and inkjet printing. Advancements in materials science and inkjet printing greatly facilitate the realization of sophisticated tactile sensors. Starting from the concept of capacitive sensing, a brief comparison of printing techniques, the essential requirements of inkjet-printing and the attractive features of state-of-the art inkjet-printed tactile sensors developed on diverse substrates (paper, polymer, glass and textile are presented in this comprehensive review. Recent trends in inkjet-printed wearable/flexible and foldable tactile sensors are evaluated, paving the way for future research.

  16. Experiments on Printed Intelligence and Its Applications

    OpenAIRE

    Barbonelova, Angelina

    2015-01-01

    Printed intelligence technology refers to products and systems that are produced using traditional printing methods and that are able to communicate or react with the user, environment or other products and systems. The technology provides the foundations of innovative products such as printed OLEDs (organic light emitting device), electroluminescent displays, organic photovoltaics, thin film batteries and disposable sensors. This study presents research on different printing techniques i...

  17. Winter warming from large volcanic eruptions

    Science.gov (United States)

    Robock, Alan; Mao, Jianping

    1992-01-01

    An examination of the Northern Hemisphere winter surface temperature patterns after the 12 largest volcanic eruptions from 1883-1992 shows warming over Eurasia and North America and cooling over the Middle East which are significant at the 95-percent level. This pattern is found in the first winter after tropical eruptions, in the first or second winter after midlatitude eruptions, and in the second winter after high latitude eruptions. The effects are independent of the hemisphere of the volcanoes. An enhanced zonal wind driven by heating of the tropical stratosphere by the volcanic aerosols is responsible for the regions of warming, while the cooling is caused by blocking of incoming sunlight.

  18. Future of printing: changes and challenges, technologies and markets

    Science.gov (United States)

    Kipphan, Helmut

    1998-01-01

    Digitalization within the graphic arts industry is described and it is explained how it is improving and changing the print production strategies and which new kinds of print production systems are developed or can be expected. The relationship of printed media and electronic media is analyzed and a positioning for the next century is given. The state of the art of conventional printing technologies, especially using direct imagine techniques, and their position within the digital workflow are shortly described. Non-impact printing multicolor printing systems are explained, based on general design criteria and linked to existing and newly announced equipment. The use of high-tech components for building up successful systems with high reliability, high quality and low production costs is included with some examples. Digital printing systems open many opportunities in print production: distributed printing, personalization, print and book on demand are explained as examples. The overview of the several printing technologies and their positioning regarding quality and productivity leads to the scenario about the important position of printed media, also in the distant future.

  19. 29 CFR 1956.84 - Location of plan for inspection and copying.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Location of plan for inspection and copying. 1956.84... PLANS Illinois § 1956.84 Location of plan for inspection and copying. A copy of the plan may be inspected and copied during normal business hours at the following locations: Office of State Programs, U.S...

  20. Functional electronic screen printing – electroluminescent smart fabric watch

    OpenAIRE

    de Vos, Marc; Torah, Russel; Beeby, Steve; Tudor, John

    2013-01-01

    Motivation for screen printed smart fabrics.Introduce functional electronic screen printing on fabrics.Printed smart fabric watch design.Printing process for electroluminescent watch.Demonstration video.Conclusions and further work.Examples of other screen printed smart fabrics.

  1. Contextual advertisement placement in printed media

    Science.gov (United States)

    Liu, Sam; Joshi, Parag

    2010-02-01

    Advertisements today provide the necessary revenue model supporting the WWW ecosystem. Targeted or contextual ad insertion plays an important role in optimizing the financial return of this model. Nearly all the current ads that appear on web sites are geared for display purposes such as banner and "pay-per-click". Little attention, however, is focused on deriving additional ad revenues when the content is repurposed for alternative mean of presentation, e.g. being printed. Although more and more content is moving to the Web, there are still many occasions where printed output of web content is desirable, such as maps and articles; thus printed ad insertion can potentially be lucrative. In this paper, we describe a contextual ad insertion network aimed to realize new revenue for print service providers for web printing. We introduce a cloud print service that enables contextual ads insertion, with respect to the main web page content, when a printout of the page is requested. To encourage service utilization, it would provide higher quality printouts than what is possible from current browser print drivers, which generally produce poor outputs, e.g. ill formatted pages. At this juncture we will limit the scope to only article-related web pages although the concept can be extended to arbitrary web pages. The key components of this system include (1) the extraction of article from web pages, (2) the extraction of semantics from article, (3) querying the ad database for matching advertisement or coupon, and (4) joint content and ad layout for print outputs.

  2. All-printed paper memory

    KAUST Repository

    Lien, Derhsien

    2014-08-26

    We report the memory device on paper by means of an all-printing approach. Using a sequence of inkjet and screen-printing techniques, a simple metal-insulator-metal device structure is fabricated on paper as a resistive random access memory with a potential to reach gigabyte capacities on an A4 paper. The printed-paper-based memory devices (PPMDs) exhibit reproducible switching endurance, reliable retention, tunable memory window, and the capability to operate under extreme bending conditions. In addition, the PBMD can be labeled on electronics or living objects for multifunctional, wearable, on-skin, and biocompatible applications. The disposability and the high-security data storage of the paper-based memory are also demonstrated to show the ease of data handling, which are not achievable for regular silicon-based electronic devices. We envision that the PPMDs manufactured by this cost-effective and time-efficient all-printing approach would be a key electronic component to fully activate a paper-based circuit and can be directly implemented in medical biosensors, multifunctional devices, and self-powered systems. © 2014 American Chemical Society.

  3. 29 CFR 1956.64 - Location of plan for inspection and copying.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Location of plan for inspection and copying. 1956.64... PLANS New Jersey § 1956.64 Location of plan for inspection and copying. A copy of the plan may be inspected and copied during normal business hours at the following locations: Office of State Programs, U.S...

  4. 40 CFR 63.824 - Standards: Publication rotogravure printing.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) National Emission Standards for the Printing and Publishing Industry § 63.824 Standards: Publication rotogravure printing. (a) Each owner or operator of any publication rotogravure printing affected... printing. 63.824 Section 63.824 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR...

  5. Quantum copying and simplification of the quantum Fourier transform

    Science.gov (United States)

    Niu, Chi-Sheng

    Theoretical studies of quantum computation and quantum information theory are presented in this thesis. Three topics are considered: simplification of the quantum Fourier transform in Shor's algorithm, optimal eavesdropping in the BB84 quantum cryptographic protocol, and quantum copying of one qubit. The quantum Fourier transform preceding the final measurement in Shor's algorithm is simplified by replacing a network of quantum gates with one that has fewer and simpler gates controlled by classical signals. This simplification results from an analysis of the network using the consistent history approach to quantum mechanics. The optimal amount of information which an eavesdropper can gain, for a given level of noise in the communication channel, is worked out for the BB84 quantum cryptographic protocol. The optimal eavesdropping strategy is expressed in terms of various quantum networks. A consistent history analysis of these networks using two conjugate quantum bases shows how the information gain in one basis influences the noise level in the conjugate basis. The no-cloning property of quantum systems, which is the physics behind quantum cryptography, is studied by considering copying machines that generate two imperfect copies of one qubit. The best qualities these copies can have are worked out with the help of the Bloch sphere representation for one qubit, and a quantum network is worked out for an optimal copying machine. If the copying machine does not have additional ancillary qubits, the copying process can be viewed using a 2-dimensional subspace in a product space of two qubits. A special representation of such a two-dimensional subspace makes possible a complete characterization of this type of copying. This characterization in turn leads to simplified eavesdropping strategies in the BB84 and the B92 quantum cryptographic protocols.

  6. Printing Ancient Terracotta Warriors

    Science.gov (United States)

    Gadecki, Victoria L.

    2010-01-01

    Standing in awe in Xian, China, at the Terra Cotta warrior archaeological site, the author thought of sharing this experience and excitement with her sixth-grade students. She decided to let her students carve patterns of the ancient soldiers to understand their place in Chinese history. They would make block prints and print multiple soldiers on…

  7. FUTURE SCOPE OF WOMEN CARRIER IN THE PRINTING INDUSTRY: THE CHALLENGES OF WOMEN IN PRINTING OGANIZATIONS (A SURVEY OF TWENTY FIVE COMPANIES "SMALL, MEDIUM AND LARGE PRINTING ORGANIZATION" IN AREA "NCR DELHI AND HISAR, HR".)

    OpenAIRE

    Mr. Azad Singh*

    2017-01-01

    Women carrier in printing organization today, printing industry is growing with an expositional rate & required skills manpower. In this survey based paper to getting recruit of women 10%small, 30%medium and 60% large scale print industry. Objective of this paper is too filled out manpower skills printing industries are seaking in B.Tech women printing students to bridge the gap between skills and required in printing organization. A survey 25 companies was carried out. the result indicated t...

  8. Three-Dimensionally Printed Micro-electromechanical Switches.

    Science.gov (United States)

    Lee, Yongwoo; Han, Jungmin; Choi, Bongsik; Yoon, Jinsu; Park, Jinhee; Kim, Yeamin; Lee, Jieun; Kim, Dae Hwan; Kim, Dong Myong; Lim, Meehyun; Kang, Min-Ho; Kim, Sungho; Choi, Sung-Jin

    2018-05-09

    Three-dimensional (3D) printers have attracted considerable attention from both industry and academia and especially in recent years because of their ability to overcome the limitations of two-dimensional (2D) processes and to enable large-scale facile integration techniques. With 3D printing technologies, complex structures can be created using only a computer-aided design file as a reference; consequently, complex shapes can be manufactured in a single step with little dependence on manufacturer technologies. In this work, we provide a first demonstration of the facile and time-saving 3D printing of two-terminal micro-electromechanical (MEM) switches. Two widely used thermoplastic materials were used to form 3D-printed MEM switches; freely suspended and fixed electrodes were printed from conductive polylactic acid, and a water-soluble sacrificial layer for air-gap formation was printed from poly(vinyl alcohol). Our 3D-printed MEM switches exhibit excellent electromechanical properties, with abrupt switching characteristics and an excellent on/off current ratio value exceeding 10 6 . Therefore, we believe that our study makes an innovative contribution with implications for the development of a broader range of 3D printer applications (e.g., the manufacturing of various MEM devices and sensors), and the work highlights a uniquely attractive path toward the realization of 3D-printed electronics.

  9. Ten Years of Monitoring 3C 273 with XMM–Newton Liu Liu ...

    Indian Academy of Sciences (India)

    Abstract. We present ten years optical/UV/X-ray observations of 3C. 273 performed using XMM–Newton between 2000 and 2009. The short- time scale variability behaviour of the soft and hard X-ray light curves may suggest different origins of the soft/hard X-ray emissions. We fit well the 0.2–10 keV X-ray spectrum with a ...

  10. Scalable, full-colour and controllable chromotropic plasmonic printing

    Science.gov (United States)

    Xue, Jiancai; Zhou, Zhang-Kai; Wei, Zhiqiang; Su, Rongbin; Lai, Juan; Li, Juntao; Li, Chao; Zhang, Tengwei; Wang, Xue-Hua

    2015-01-01

    Plasmonic colour printing has drawn wide attention as a promising candidate for the next-generation colour-printing technology. However, an efficient approach to realize full colour and scalable fabrication is still lacking, which prevents plasmonic colour printing from practical applications. Here we present a scalable and full-colour plasmonic printing approach by combining conjugate twin-phase modulation with a plasmonic broadband absorber. More importantly, our approach also demonstrates controllable chromotropic capability, that is, the ability of reversible colour transformations. This chromotropic capability affords enormous potentials in building functionalized prints for anticounterfeiting, special label, and high-density data encryption storage. With such excellent performances in functional colour applications, this colour-printing approach could pave the way for plasmonic colour printing in real-world commercial utilization. PMID:26567803

  11. Effect of print layer height and printer type on the accuracy of 3-dimensional printed orthodontic models.

    Science.gov (United States)

    Favero, Christian S; English, Jeryl D; Cozad, Benjamin E; Wirthlin, John O; Short, Megan M; Kasper, F Kurtis

    2017-10-01

    Three-dimensional (3D) printing technologies enable production of orthodontic models from digital files; yet a range of variables associated with the process could impact the accuracy and clinical utility of the models. The objective of this study was to investigate the effect of print layer height on the accuracy of orthodontic models printed 3 dimensionally using a stereolithography format printer and to compare the accuracy of orthodontic models fabricated with several commercially available 3D printers. Thirty-six identical models were produced with a stereolithography-based 3D printer using 3 layer heights (n = 12 per group): 25, 50, and 100 μm. Forty-eight additional models were printed using 4 commercially available 3D printers (n = 12 per group). Each printed model was digitally scanned and compared with the input file via superimposition analysis using a best-fit algorithm to assess accuracy. Statistically significant differences were found in the average overall deviations of models printed at each layer height, with the 25-μm and 100-μm layer height groups having the greatest and least deviations, respectively. Statistically significant differences were also found in the average overall deviations of models produced using the various 3D printer models, but all values fell within clinically acceptable limits. The print layer height and printer model can affect the accuracy of a 3D printed orthodontic model, but the impact should be considered with respect to the clinical tolerances associated with the envisioned application. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  12. Determination of beta-defensin genomic copy number in different populations

    DEFF Research Database (Denmark)

    Fode, Peder; Jespersgaard, Cathrine; Hardwick, Robert J

    2011-01-01

    There have been conflicting reports in the literature on association of gene copy number with disease, including CCL3L1 and HIV susceptibility, and ß-defensins and Crohn's disease. Quantification of precise gene copy numbers is important in order to define any association of gene copy number with...

  13. Templated Dry Printing of Conductive Metal Nanoparticles

    Science.gov (United States)

    Rolfe, David Alexander

    Printed electronics can lower the cost and increase the ubiquity of electrical components such as batteries, sensors, and telemetry systems. Unfortunately, the advance of printed electronics has been held back by the limited minimum resolution, aspect ratio, and feature fidelity of present printing techniques such as gravure, screen printing and inkjet printing. Templated dry printing offers a solution to these problems by patterning nanoparticle inks into templates before drying. This dissertation shows advancements in two varieties of templated dry nanoprinting. The first, advective micromolding in vapor-permeable templates (AMPT) is a microfluidic approach that uses evaporation-driven mold filling to create submicron features with a 1:1 aspect ratio. We will discuss submicron surface acoustic wave (SAW) resonators made through this process, and the refinement process in the template manufacturing process necessary to make these devices. We also present modeling techniques that can be applied to future AMPT templates. We conclude with a modified templated dry printing that improves throughput and isolated feature patterning by transferring dry-templated features with laser ablation. This method utilizes surface energy-defined templates to pattern features via doctor blade coating. Patterned and dried features can be transferred to a polymer substrate with an Nd:YAG MOPA fiber laser, and printed features can be smaller than the laser beam width.

  14. Digital Dentistry — 3D Printing Applications

    Directory of Open Access Journals (Sweden)

    Zaharia Cristian

    2017-03-01

    Full Text Available Three-dimensional (3D printing is an additive manufacturing method in which a 3D item is formed by laying down successive layers of material. 3D printers are machines that produce representations of objects either planned with a CAD program or scanned with a 3D scanner. Printing is a method for replicating text and pictures, typically with ink on paper. We can print different dental pieces using different methods such as selective laser sintering (SLS, stereolithography, fused deposition modeling, and laminated object manufacturing. The materials are certified for printing individual impression trays, orthodontic models, gingiva mask, and different prosthetic objects. The material can reach a flexural strength of more than 80 MPa. 3D printing takes the effectiveness of digital projects to the production phase. Dental laboratories are able to produce crowns, bridges, stone models, and various orthodontic appliances by methods that combine oral scanning, 3D printing, and CAD/CAM design. Modern 3D printing has been used for the development of prototypes for several years, and it has begun to find its use in the world of manufacturing. Digital technology and 3D printing have significantly elevated the rate of success in dental implantology using custom surgical guides and improving the quality and accuracy of dental work.

  15. Advances and Future Challenges in Printed Batteries.

    Science.gov (United States)

    Sousa, Ricardo E; Costa, Carlos M; Lanceros-Méndez, Senentxu

    2015-11-01

    There is an increasing interest in thin and flexible energy storage devices to meet modern society's needs for applications such as radio frequency sensing, interactive packaging, and other consumer products. Printed batteries comply with these requirements and are an excellent alternative to conventional batteries for many applications. Flexible and microbatteries are also included in the area of printed batteries when fabricated using printing technologies. The main characteristics, advantages, disadvantages, developments, and printing techniques of printed batteries are presented and discussed in this Review. The state-of-the-art takes into account both the research and industrial levels. On the academic level, the research progress of printed batteries is divided into lithium-ion and Zn-manganese dioxide batteries and other battery types, with emphasis on the different materials for anode, cathode, and separator as well as in the battery design. With respect to the industrial state-of-the-art, materials, device formulations, and manufacturing techniques are presented. Finally, the prospects and challenges of printed batteries are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. 3D Printed Bionic Nanodevices

    Science.gov (United States)

    Kong, Yong Lin; Gupta, Maneesh K.; Johnson, Blake N.; McAlpine, Michael C.

    2016-01-01

    Summary The ability to three-dimensionally interweave biological and functional materials could enable the creation of bionic devices possessing unique and compelling geometries, properties, and functionalities. Indeed, interfacing high performance active devices with biology could impact a variety of fields, including regenerative bioelectronic medicines, smart prosthetics, medical robotics, and human-machine interfaces. Biology, from the molecular scale of DNA and proteins, to the macroscopic scale of tissues and organs, is three-dimensional, often soft and stretchable, and temperature sensitive. This renders most biological platforms incompatible with the fabrication and materials processing methods that have been developed and optimized for functional electronics, which are typically planar, rigid and brittle. A number of strategies have been developed to overcome these dichotomies. One particularly novel approach is the use of extrusion-based multi-material 3D printing, which is an additive manufacturing technology that offers a freeform fabrication strategy. This approach addresses the dichotomies presented above by (1) using 3D printing and imaging for customized, hierarchical, and interwoven device architectures; (2) employing nanotechnology as an enabling route for introducing high performance materials, with the potential for exhibiting properties not found in the bulk; and (3) 3D printing a range of soft and nanoscale materials to enable the integration of a diverse palette of high quality functional nanomaterials with biology. Further, 3D printing is a multi-scale platform, allowing for the incorporation of functional nanoscale inks, the printing of microscale features, and ultimately the creation of macroscale devices. This blending of 3D printing, novel nanomaterial properties, and ‘living’ platforms may enable next-generation bionic systems. In this review, we highlight this synergistic integration of the unique properties of nanomaterials with

  17. 3D Printed Bionic Nanodevices.

    Science.gov (United States)

    Kong, Yong Lin; Gupta, Maneesh K; Johnson, Blake N; McAlpine, Michael C

    2016-06-01

    The ability to three-dimensionally interweave biological and functional materials could enable the creation of bionic devices possessing unique and compelling geometries, properties, and functionalities. Indeed, interfacing high performance active devices with biology could impact a variety of fields, including regenerative bioelectronic medicines, smart prosthetics, medical robotics, and human-machine interfaces. Biology, from the molecular scale of DNA and proteins, to the macroscopic scale of tissues and organs, is three-dimensional, often soft and stretchable, and temperature sensitive. This renders most biological platforms incompatible with the fabrication and materials processing methods that have been developed and optimized for functional electronics, which are typically planar, rigid and brittle. A number of strategies have been developed to overcome these dichotomies. One particularly novel approach is the use of extrusion-based multi-material 3D printing, which is an additive manufacturing technology that offers a freeform fabrication strategy. This approach addresses the dichotomies presented above by (1) using 3D printing and imaging for customized, hierarchical, and interwoven device architectures; (2) employing nanotechnology as an enabling route for introducing high performance materials, with the potential for exhibiting properties not found in the bulk; and (3) 3D printing a range of soft and nanoscale materials to enable the integration of a diverse palette of high quality functional nanomaterials with biology. Further, 3D printing is a multi-scale platform, allowing for the incorporation of functional nanoscale inks, the printing of microscale features, and ultimately the creation of macroscale devices. This blending of 3D printing, novel nanomaterial properties, and 'living' platforms may enable next-generation bionic systems. In this review, we highlight this synergistic integration of the unique properties of nanomaterials with the

  18. 3D printing technologies for electrochemical energy storage

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Feng; Wei, Min; Viswanathan, Vilayanur V.; Swart, Benjamin; Shao, Yuyan; Wu, Gang; Zhou, Chi

    2017-10-01

    Fabrication of electrodes and electrolytes play an important role in promoting the performance of electrochemical energy storage (EES) devices such as batteries and supercapacitors. Traditional fabrication techniques have limited capability in controlling the geometry and architecture of the electrode and solid-state electrolytes, which would otherwise compromise the performance. 3D printing, a disruptive manufacturing technology, has emerged as an innovative approach to fabricating EES devices from nanoscale to macroscale and from nanowatt to megawatt, providing great opportunities to accurately control device geometry (e.g., dimension, porosity, morphology) and structure with enhanced specific energy and power densities. Moreover, the additive manufacturing nature of 3D printing provides excellent controllability of the electrode thickness with much simplified process in a cost effective manner. With the unique spatial and temporal material manipulation capability, 3D printing can integrate multiple nanomaterials in the same print, and multi-functional EES devices (including functional gradient devices) can be fabricated. Herein, we review recent advances in 3D printing of EES devices. We focused on two major 3D printing technologies including direct writing and inkjet printing. The direct material deposition characteristics of these two processes enable them to print on a variety of flat substrates, even a conformal one, well suiting them to applications such as wearable devices and on-chip integrations. Other potential 3D printing techniques such as freeze nano-printing, stereolithography, fused deposition modeling, binder jetting, laminated object manufacturing, and metal 3D printing are also introduced. The advantages and limitations of each 3D printing technology are extensively discussed. More importantly, we provide a perspective on how to integrate the emerging 3D printing with existing technologies to create structures over multiple length scale from

  19. The effects of printing orientation on the electrochemical behaviour of 3D printed acrylonitrile butadiene styrene (ABS)/carbon black electrodes.

    Science.gov (United States)

    Bin Hamzah, Hairul Hisham; Keattch, Oliver; Covill, Derek; Patel, Bhavik Anil

    2018-06-14

    Additive manufacturing also known as 3D printing is being utilised in electrochemistry to reproducibly develop complex geometries with conductive properties. In this study, we explored if the electrochemical behavior of 3D printed acrylonitrile butadiene styrene (ABS)/carbon black electrodes was influenced by printing direction. The electrodes were printed in both horizontal and vertical directions. The horizsontal direction resulted in a smooth surface (HPSS electrode) and a comparatively rougher surface (HPRS electrode) surface. Electrodes were characterized using cyclic voltammetry, electrochemical impedance spectroscopy and chronoamperometry. For various redox couples, the vertical printed (VP) electrode showed enhanced current response when compared the two electrode surfaces generated by horizontal print direction. No differences in the capacitive response was observed, indicating that the conductive surface area of all types of electrodes were identical. The VP electrode had reduced charge transfer resistance and uncompensated solution resistance when compared to the HPSS and HPRS electrodes. Overall, electrodes printed in a vertical direction provide enhanced electrochemical performance and our study indicates that print orientation is a key factor that can be used to enhance sensor performance.

  20. Three-Dimensional Printing Surgical Applications.

    Science.gov (United States)

    AlAli, Ahmad B; Griffin, Michelle F; Butler, Peter E

    2015-01-01

    Three-dimensional printing, a technology used for decades in the industrial field, gains a lot of attention in the medical field for its potential benefits. With advancement of desktop printers, this technology is accessible and a lot of research is going on in the medical field. To evaluate its application in surgical field, which may include but not limited to surgical planning, surgical education, implants, and prosthesis, which are the focus of this review. Research was conducted by searching PubMed, Web of science, and other reliable sources. We included original articles and excluded articles based on animals, those more than 10 years old, and those not in English. These articles were evaluated, and relevant studies were included in this review. Three-dimensional printing shows a potential benefit in surgical application. Printed implants were used in patient in a few cases and show successful results; however, longer follow-up and more trials are needed. Surgical and medical education is believed to be more efficient with this technology than the current practice. Printed surgical instrument and surgical planning are also believed to improve with three-dimensional printing. Three-dimensional printing can be a very powerful tool in the near future, which can aid the medical field that is facing a lot of challenges and obstacles. However, despite the reported results, further research on larger samples and analytical measurements should be conducted to ensure this technology's impact on the practice.

  1. Four-dimensional Printing of Liquid Crystal Elastomers.

    Science.gov (United States)

    Ambulo, Cedric P; Burroughs, Julia J; Boothby, Jennifer M; Kim, Hyun; Shankar, M Ravi; Ware, Taylor H

    2017-10-25

    Three-dimensional structures capable of reversible changes in shape, i.e., four-dimensional-printed structures, may enable new generations of soft robotics, implantable medical devices, and consumer products. Here, thermally responsive liquid crystal elastomers (LCEs) are direct-write printed into 3D structures with a controlled molecular order. Molecular order is locally programmed by controlling the print path used to build the 3D object, and this order controls the stimulus response. Each aligned LCE filament undergoes 40% reversible contraction along the print direction on heating. By printing objects with controlled geometry and stimulus response, magnified shape transformations, for example, volumetric contractions or rapid, repetitive snap-through transitions, are realized.

  2. Strategies in the digital printing value system

    OpenAIRE

    Mejtoft, Thomas

    2006-01-01

    The research objective of this thesis is to identify corporate strategies and strategic decisions in the digital printing business and to analyze how these have evolved due to the introduction of digital printing. This thesis comprises three separate studies, all based on qualitative case methodology. The first study is focused on digital printing houses and how their business strategies have changed due to their investment in digital printing production equipment. The second study concentrat...

  3. Visual Attention to Print-Salient and Picture-Salient Environmental Print in Young Children

    Science.gov (United States)

    Neumann, Michelle M.; Summerfield, Katelyn; Neumann, David L.

    2015-01-01

    Environmental print is composed of words and contextual cues such as logos and pictures. The salience of the contextual cues may influence attention to words and thus the potential of environmental print in promoting early reading development. The present study explored this by presenting pre-readers (n = 20) and beginning readers (n = 16) with…

  4. Image once, print thrice? Three-dimensional printing of replacement parts.

    Science.gov (United States)

    Rankin, Timothy M; Wormer, Blair A; Miller, John D; Giovinco, Nicholas A; Al Kassis, Salam; Armstrong, David G

    2018-02-01

    The last 20 years has seen an exponential increase in 3D printing as it pertains to the medical industry and more specifically surgery. Previous reviews in this domain have chosen to focus on applications within a specific field. To our knowledge, none have evaluated the broad applications of patient-specific or digital imaging and communications in medicine (DICOM) derived applications of this technology. We searched PUBMED and CINAHL from April 2012 to April 2017. 261 studies fulfilled the inclusion criteria. Proportions of articles reviewed: DICOM (5%), CT (38%), MRI (20%), Ultrasonography (28%), and Bio-printing (9%). There is level IV evidence to support the use of 3D printing for education, pre-operative planning, simulation and implantation. In order to make this technology widely applicable, it will require automation of DICOM to standard tessellation language to implant. Advances in knowledge: Recent lapses in intellectual property and greater familiarity with rapid prototyping in medicine has set the stage for the next generation of custom implants, simulators and autografts. Radiologists may be able to help establish reimbursable procedural terminology.

  5. To Reason with Them or Tickle Them: Advertising Strategies in the Discourse of Persian Print Ads

    Directory of Open Access Journals (Sweden)

    Ida Reihani

    2012-07-01

    Full Text Available Consumerism and the inevitable tracking of one's desired product among the endless rows and shelves of colorful products, highlights the importance of winning advertising strategies which have the power to persuade their audience to prefer one product over similar products. The present study aims to investigate two advertising strategies, reason versus tickle advertising and how they translate into the actual discourse of Persian print advertisements. To this end, a corpus of 150 ads was collected from two Iranian magazines, namely Honar-e Ashpazi and Zendegi-ye Ideal. Using the framework adopted by Simpson (2001 in telling apart reason vs. tickle ads based on their discourse features, Persian print ads were analyzed to identify which strategy is more prevalent. Furthermore, the nature of the advertised commodity (consumer's low-involvement or high-involvement was observed to identify whether it is of any significance in the choice of the advertising strategy by the copywriter. The results demonstrated that the nature of the advertised product does not play a significant role in the strategy adopted by the copywriter and that Persian copywriters tend to employ a direct, factual approach in including the logical reasons why customers might prefer a certain commodity over similar ones in their advertising copy.

  6. Designing Biomaterials for 3D Printing.

    Science.gov (United States)

    Guvendiren, Murat; Molde, Joseph; Soares, Rosane M D; Kohn, Joachim

    2016-10-10

    Three-dimensional (3D) printing is becoming an increasingly common technique to fabricate scaffolds and devices for tissue engineering applications. This is due to the potential of 3D printing to provide patient-specific designs, high structural complexity, rapid on-demand fabrication at a low-cost. One of the major bottlenecks that limits the widespread acceptance of 3D printing in biomanufacturing is the lack of diversity in "biomaterial inks". Printability of a biomaterial is determined by the printing technique. Although a wide range of biomaterial inks including polymers, ceramics, hydrogels and composites have been developed, the field is still struggling with processing of these materials into self-supporting devices with tunable mechanics, degradation, and bioactivity. This review aims to highlight the past and recent advances in biomaterial ink development and design considerations moving forward. A brief overview of 3D printing technologies focusing on ink design parameters is also included.

  7. Copy number variations in Saudi family with intellectual disability and epilepsy.

    Science.gov (United States)

    Naseer, Muhammad I; Chaudhary, Adeel G; Rasool, Mahmood; Kalamegam, Gauthaman; Ashgan, Fai T; Assidi, Mourad; Ahmed, Farid; Ansari, Shakeel A; Zaidi, Syed Kashif; Jan, Mohammed M; Al-Qahtani, Mohammad H

    2016-10-17

    Epilepsy is genetically complex but common brain disorder of the world affecting millions of people with almost of all age groups. Novel Copy number variations (CNVs) are considered as important reason for the numerous neurodevelopmental disorders along with intellectual disability and epilepsy. DNA array based studies contribute to explain a more severe clinical presentation of the disease but interoperation of many detected CNVs are still challenging. In order to study novel CNVs with epilepsy related genes in Saudi family with six affected and two normal individuals with several forms of epileptic seizures, intellectual disability (ID), and minor dysmorphism, we performed the high density whole genome Agilent sure print G3 Hmn CGH 2x 400 K array-CGH chips analysis. Our results showed de novo deletions, duplications and deletion plus duplication on differential chromosomal regions in the affected individuals that were not shown in the normal fathe and normal kids by using Agilent CytoGenomics 3.0.6.6 softwear. Copy number gain were observed in the chromosome 1, 16 and 22 with LCE3C, HPR, GSTT2, GSTTP2, DDT and DDTL genes respectively whereas the deletions observed in the chromosomal regions 8p23-p21 (4303127-4337759) and the potential gene in this region is CSMD1 (OMIM: 612279). Moreover, the array CGH results deletions and duplication were also validated by using primer design of deleted regions utilizing the flanked SNPs using simple PCR and also by using quantitative real time PCR. We found some of the de novo deletions and duplication in our study in Saudi family with intellectual disability and epilepsy. Our results suggest that array-CGH should be used as a first line of genetic test for epilepsy except there is a strong indication for a monogenic syndrome. The advanced high through put array-CGH technique used in this study aim to collect the data base and to identify new mechanisms describing epileptic disorder, may help to improve the clinical

  8. Batch fabrication of disposable screen printed SERS arrays.

    Science.gov (United States)

    Qu, Lu-Lu; Li, Da-Wei; Xue, Jin-Qun; Zhai, Wen-Lei; Fossey, John S; Long, Yi-Tao

    2012-03-07

    A novel facile method of fabricating disposable and highly reproducible surface-enhanced Raman spectroscopy (SERS) arrays using screen printing was explored. The screen printing ink containing silver nanoparticles was prepared and printed on supporting materials by a screen printing process to fabricate SERS arrays (6 × 10 printed spots) in large batches. The fabrication conditions, SERS performance and application of these arrays were systematically investigated, and a detection limit of 1.6 × 10(-13) M for rhodamine 6G could be achieved. Moreover, the screen printed SERS arrays exhibited high reproducibility and stability, the spot-to-spot SERS signals showed that the intensity variation was less than 10% and SERS performance could be maintained over 12 weeks. Portable high-throughput analysis of biological samples was accomplished using these disposable screen printed SERS arrays.

  9. Titan's Emergence from Winter

    Science.gov (United States)

    Flasar, F. Michael; Achterberg, Richard; Jennings, Donald; Schinder, Paul

    2011-01-01

    We summarize the changes in Titans thermal structure derived from Cassini CIRS and radio-occultation data during the transition from winter to early spring. Titan's surface, and middle atmosphere show noticeable seasonal change, whereas that in most of the troposphere is mated. This can be understood in terms of the relatively small radiative relaxation time in the middle atmosphere and much larger time scale in the troposphere. The surface exhibits seasonal change because the heat capacity in an annual skin depth is much smaller than that in the lowest scale height of the troposphere. Surface temperatures rise 1 K at raid and high latitudes in the winter northern hemisphere and cool in the southern hemisphere. Changes in in the middle atmosphere are more complicated. Temperatures in the middle stratosphere (approximately 1 mbar) increase by a few kelvin at mid northern latitudes, but those at high latitudes first increase as that region moves out of winter shadow, and then decrease. This probably results from the combined effect of increased solar heating as the suit moves higher in the sky and the decreased adiabatic warming as the sinking motions associated with the cross-equatorial meridional cell weaken. Consistent with this interpretation, the warm temperatures observed higher up at the winter polar stratopause cool significantly.

  10. Printed organic thin-film transistor-based integrated circuits

    International Nuclear Information System (INIS)

    Mandal, Saumen; Noh, Yong-Young

    2015-01-01

    Organic electronics is moving ahead on its journey towards reality. However, this technology will only be possible when it is able to meet specific criteria including flexibility, transparency, disposability and low cost. Printing is one of the conventional techniques to deposit thin films from solution-based ink. It is used worldwide for visual modes of information, and it is now poised to enter into the manufacturing processes of various consumer electronics. The continuous progress made in the field of functional organic semiconductors has achieved high solubility in common solvents as well as high charge carrier mobility, which offers ample opportunity for organic-based printed integrated circuits. In this paper, we present a comprehensive review of all-printed organic thin-film transistor-based integrated circuits, mainly ring oscillators. First, the necessity of all-printed organic integrated circuits is discussed; we consider how the gap between printed electronics and real applications can be bridged. Next, various materials for printed organic integrated circuits are discussed. The features of these circuits and their suitability for electronics using different printing and coating techniques follow. Interconnection technology is equally important to make this product industrially viable; much attention in this review is placed here. For high-frequency operation, channel length should be sufficiently small; this could be achievable with a combination of surface treatment-assisted printing or laser writing. Registration is also an important issue related to printing; the printed gate should be perfectly aligned with the source and drain to minimize parasitic capacitances. All-printed organic inverters and ring oscillators are discussed here, along with their importance. Finally, future applications of all-printed organic integrated circuits are highlighted. (paper)

  11. Your Next Airplane: Just Hit Print

    Science.gov (United States)

    2013-04-01

    significantly impact the market, but if properly managed, 3-D printing can revolutionize the military through three principal benefits : cost...applications arise, many of which can be tailored to either commercial benefit or military utility. For the military to steer the dialogue over the...from custom chocolate sculptures, to firearms printed in your basement, to light-weight, fuel-efficient printed cars. University research grants

  12. Dramatic Advance in Quality in Flexographic Printing

    Directory of Open Access Journals (Sweden)

    Jochen Richter

    2004-12-01

    Full Text Available The enormous changes in flexography printing in recent years concerning the printing quality achievable cannot generally be ascribed to a single revolutionary invention, but are the result of continuous developments to the complete system. Thus the direct drive technology in all machine types and its associated advantages in terms of printing length corrections has become established since drupa 2000. The race for ever finer raster rolls has also been completed to the benefit of improvements in bowl geometry and in ceramic surfaces. Clearly improved colour transfer behaviour has become feasible as a result. In a closely intermeshed system such as flexography printing this naturally has to have an effect on the printing colours used. Further improvements in bonding agents and pigment concentrations now allow users to print ever thinner colour layers while maintaining all of the required authenticities.Furthermore, it has become possible to reduce additional disturbing characteristics in the UV colour area, such as the unpleasant odour. While the digital imaging of printing plates has primarily been improved in terms of economic efficiency by the use of up to eight parallel laser beams, extreme improvements in the system are noticeable especially in the area of directly engraved printing moulds. Whereas many still dismissed directly engraved polymer plates at the last drupa as a laboratory system, the first installation was recently placed on the market a mere three years later. A further noteworthy innovation of recent years that has reached market maturity is thin sleeve technology, which combines the advantages of a photopolymer plate with a round imaged printing mould. There are no high sleeve costs for each printing mould, except for one-off cost for an adapter sleeve. To conclude, it can be said that although flexography printing has experienced many new features in the time between drupa 2000 and today, it still has enormous potential for

  13. 3D Printing Electrically Small Spherical Antennas

    DEFF Research Database (Denmark)

    Kim, Oleksiy S.

    2013-01-01

    3D printing is applied for rapid prototyping of an electrically small spherical wire antenna. The model is first printed in plastic and subsequently covered with several layers of conductive paint. Measured results are in good agreement with simulations.......3D printing is applied for rapid prototyping of an electrically small spherical wire antenna. The model is first printed in plastic and subsequently covered with several layers of conductive paint. Measured results are in good agreement with simulations....

  14. 20 CFR 402.175 - Fees for providing information and related services for non-program purposes.

    Science.gov (United States)

    2010-04-01

    ... rendered. (d) Fee for copies of printed materials. When extra copies of printed material are available, the... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Fees for providing information and related services for non-program purposes. 402.175 Section 402.175 Employees' Benefits SOCIAL SECURITY...

  15. 20 CFR 402.165 - Fee schedule.

    Science.gov (United States)

    2010-04-01

    ... requester for the services rendered. (i) Fee for copies of printed materials. When extra copies of printed... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Fee schedule. 402.165 Section 402.165 Employees' Benefits SOCIAL SECURITY ADMINISTRATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC...

  16. 3D-printing technologies for electrochemical applications.

    Science.gov (United States)

    Ambrosi, Adriano; Pumera, Martin

    2016-05-21

    Since its conception during the 80s, 3D-printing, also known as additive manufacturing, has been receiving unprecedented levels of attention and interest from industry and research laboratories. This is in addition to end users, who have benefited from the pervasiveness of desktop-size and relatively cheap printing machines available. 3D-printing enables almost infinite possibilities for rapid prototyping. Therefore, it has been considered for applications in numerous research fields, ranging from mechanical engineering, medicine, and materials science to chemistry. Electrochemistry is another branch of science that can certainly benefit from 3D-printing technologies, paving the way for the design and fabrication of cheaper, higher performing, and ubiquitously available electrochemical devices. Here, we aim to provide a general overview of the most commonly available 3D-printing methods along with a review of recent electrochemistry related studies adopting 3D-printing as a possible rapid prototyping fabrication tool.

  17. High speed printing with polygon scan heads

    Science.gov (United States)

    Stutz, Glenn

    2016-03-01

    To reduce and in many cases eliminate the costs associated with high volume printing of consumer and industrial products, this paper investigates and validates the use of the new generation of high speed pulse on demand (POD) lasers in concert with high speed (HS) polygon scan heads (PSH). Associated costs include consumables such as printing ink and nozzles, provisioning labor, maintenance and repair expense as well as reduction of printing lines due to high through put. Targets that are applicable and investigated include direct printing on plastics, printing on paper/cardboard as well as printing on labels. Market segments would include consumer products (CPG), medical and pharmaceutical products, universal ID (UID), and industrial products. In regards to the POD lasers employed, the wavelengths include UV(355nm), Green (532nm) and IR (1064nm) operating within the repetition range of 180 to 250 KHz.

  18. Variable-data Printing Serves - Niches Here, There & Everywhere

    Directory of Open Access Journals (Sweden)

    Roger Ynostroza

    2004-12-01

    Full Text Available A milestone focus on high-end digital color presses capable of variable-data imaging - a technology that was introduced ten years ago and is just now at the beginning of wider, more successful implementation in commercial printing-tends to overshadow some real achievements on other variable-data fronts. Those activities involve ink-jet and electrophotographic imaging for high-volume transactional printing, print-on-demand books and catalogs, wide-format proofing and imaging, label production, and printing of text and coding of printed packaging.The capabilities of digital production color presses intrigue commercial printers the most, especially new units referred to by manufacturers as "Series II" or "third-generation" systems. Besides having more press-like characteristics, from offset-caliber quality, image consistency, and high output rates to sturdy construction, reliability, and stock choice, the units seem to represent a way to produce printing that’s beyond the norm.Some users are producing hybrid printed products (offset printing a quantity of "shells" that are later personalized by digital presses, while others are utilizing clients’ "dynamic" databases to personalize marketing materials that drive response rates up to 15%, even 35%. Finally, digital color systems prompt the creation of high-margin Internet-based print providers offering easy-to-design and easy-toorder print materials. Printers may do well to adopt the high-value communications capability that digital imaging offers.

  19. Printing of Wearable Antenna on Textile

    Directory of Open Access Journals (Sweden)

    Khirotdin Rd. Khairilhijra

    2018-01-01

    Full Text Available A wearable antenna which is meant to be a part of the clothing used for communication purposes includes tracking, navigation and mobile computing has been seen in demand due to the recent miniaturization of wireless devices. Printing of conductive ink provides flexibility properties on electronics thus allowing it to be used on conformal surfaces. However, the current printing techniques mostly suffer from ink incompatibility and limited of substrates to be printed with. Hence, this paper intend to discloses the printing of wearable antenna using alternative technique via syringe-based deposition system with conductive ink on textile. A validation between simulation and measurement of return loss, (S11 and radiation pattern of the antenna printed is also performed. It was found that a functional antenna is successfully printed on textile since the performances obtained are as expected. The antenna resonated at a minimum resonant frequency of 1.82 GHz which the S11 gathered at-18.90 dB. The radiation pattern for both simulation and measurement is as predicted since both have a larger magnitude of the main lobe than the side lobe. The magnitude of the main lobe from measurement was observed to be 8.83 dB higher than the magnitude of the main lobe of the simulation which is only 3.77 dB. It is proven that the syringe-based deposition system is capable of printing functional antenna on textile.

  20. Inkjet Printed Radio Frequency Passive Components

    KAUST Repository

    McKerricher, Garret

    2015-12-01

    Inkjet printing is a mature technique for colourful graphic arts. It excels at customized, large area, high resolution, and small volume production. With the developments in conductive, and dielectric inks, there is potential for large area inkjet electronics fabrication. Passive radio frequency devices can benefit greatly from a printing process, since the size of these devices is defined by the frequency of operation. The large size of radio frequency passives means that they either take up expensive space “on chip” or that they are fabricated on a separate lower cost substrate and somehow bonded to the chips. This has hindered cost-sensitive high volume applications such as radio frequency identification tags. Substantial work has been undertaken on inkjet-printed conductors for passive antennas on microwave substrates and even paper, yet there has been little work on the printing of the dielectric materials aimed at radio frequency passives. Both the conductor and dielectric need to be integrated to create a multilayer inkjet printing process that is capable of making quality passives such as capacitors and inductors. Three inkjet printed dielectrics are investigated in this thesis: a ceramic (alumina), a thermal-cured polymer (poly 4 vinyl phenol), and a UV-cured polymer (acrylic based). For the conductor, both a silver nanoparticle ink as well as a custom in-house formulated particle-free silver ink are explored. The focus is on passives, mainly capacitors and inductors. Compared to low frequency electronics, radio frequency components have additional sensitivity regarding skin depth of the conductor and surface roughness, as well as dielectric constant and loss tangent of the dielectric. These concerns are investigated with the aim of making the highest quality components possible and to understand the current limitations of inkjet-fabricated radio frequency devices. An inkjet-printed alumina dielectric that provides quality factors of 200 and high

  1. 39 CFR 955.23 - Copies of papers, withdrawal of exhibits.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false Copies of papers, withdrawal of exhibits. 955.23... SERVICE BOARD OF CONTRACT APPEALS § 955.23 Copies of papers, withdrawal of exhibits. (a) When books, records, papers, or documents have been received in evidence, a true copy thereof or of such part thereof...

  2. 36 CFR 1002.19 - Winter activities.

    Science.gov (United States)

    2010-07-01

    ... RECREATION § 1002.19 Winter activities. (a) Skiing, snowshoeing, ice skating, sledding, innertubing, tobogganing and similar winter sports are prohibited on Presidio Trust roads and in parking areas open to...

  3. 19 CFR 210.55 - Content of service copies.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Content of service copies. 210.55 Section 210.55 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.55 Content of service copies. (a) Any...

  4. aCNViewer: Comprehensive genome-wide visualization of absolute copy number and copy neutral variations.

    Directory of Open Access Journals (Sweden)

    Victor Renault

    Full Text Available Copy number variations (CNV include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information.To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer, a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs Affymetrix SNP Array data (Fig 1A. Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test, validated by another cohort of HCCs (p-value of 5.6e-7 (Fig 2B.aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https://github.com/FJD-CEPH/aCNViewer and Docker https://hub.docker.com/r/fjdceph/acnviewer/.aCNViewer@cephb.fr.

  5. aCNViewer: Comprehensive genome-wide visualization of absolute copy number and copy neutral variations.

    Science.gov (United States)

    Renault, Victor; Tost, Jörg; Pichon, Fabien; Wang-Renault, Shu-Fang; Letouzé, Eric; Imbeaud, Sandrine; Zucman-Rossi, Jessica; Deleuze, Jean-François; How-Kit, Alexandre

    2017-01-01

    Copy number variations (CNV) include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH) events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH) and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information. To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer), a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs) Affymetrix SNP Array data (Fig 1A). Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test), validated by another cohort of HCCs (p-value of 5.6e-7) (Fig 2B). aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https://github.com/FJD-CEPH/aCNViewer and Docker https

  6. Uniformity of fully gravure printed organic field-effect transistors

    International Nuclear Information System (INIS)

    Hambsch, M.; Reuter, K.; Stanel, M.; Schmidt, G.; Kempa, H.; Fuegmann, U.; Hahn, U.; Huebler, A.C.

    2010-01-01

    Fully mass-printed organic field-effect transistors were made completely by means of gravure printing. Therefore a special printing layout was developed in order to avoid register problems in print direction. Upon using this layout, contact pads for source-drain electrodes of the transistors are printed together with the gate electrodes in one and the same printing run. More than 50,000 transistors have been produced and by random tests a yield of approximately 75% has been determined. The principle suitability of the gravure printed transistors for integrated circuits has been shown by the realization of ring oscillators.

  7. 3D Printed Robotic Hand

    Science.gov (United States)

    Pizarro, Yaritzmar Rosario; Schuler, Jason M.; Lippitt, Thomas C.

    2013-01-01

    Dexterous robotic hands are changing the way robots and humans interact and use common tools. Unfortunately, the complexity of the joints and actuations drive up the manufacturing cost. Some cutting edge and commercially available rapid prototyping machines now have the ability to print multiple materials and even combine these materials in the same job. A 3D model of a robotic hand was designed using Creo Parametric 2.0. Combining "hard" and "soft" materials, the model was printed on the Object Connex350 3D printer with the purpose of resembling as much as possible the human appearance and mobility of a real hand while needing no assembly. After printing the prototype, strings where installed as actuators to test mobility. Based on printing materials, the manufacturing cost of the hand was $167, significantly lower than other robotic hands without the actuators since they have more complex assembly processes.

  8. 3D printing in dentistry.

    Science.gov (United States)

    Dawood, A; Marti Marti, B; Sauret-Jackson, V; Darwood, A

    2015-12-01

    3D printing has been hailed as a disruptive technology which will change manufacturing. Used in aerospace, defence, art and design, 3D printing is becoming a subject of great interest in surgery. The technology has a particular resonance with dentistry, and with advances in 3D imaging and modelling technologies such as cone beam computed tomography and intraoral scanning, and with the relatively long history of the use of CAD CAM technologies in dentistry, it will become of increasing importance. Uses of 3D printing include the production of drill guides for dental implants, the production of physical models for prosthodontics, orthodontics and surgery, the manufacture of dental, craniomaxillofacial and orthopaedic implants, and the fabrication of copings and frameworks for implant and dental restorations. This paper reviews the types of 3D printing technologies available and their various applications in dentistry and in maxillofacial surgery.

  9. Printed Spacecraft Separation System

    Energy Technology Data Exchange (ETDEWEB)

    Dehoff, Ryan R [ORNL; Holmans, Walter [Planetary Systems Corporation

    2016-10-01

    In this project Planetary Systems Corporation proposed utilizing additive manufacturing (3D printing) to manufacture a titanium spacecraft separation system for commercial and US government customers to realize a 90% reduction in the cost and energy. These savings were demonstrated via “printing-in” many of the parts and sub-assemblies into one part, thus greatly reducing the labor associated with design, procurement, assembly and calibration of mechanisms. Planetary Systems Corporation redesigned several of the components of the separation system based on additive manufacturing principles including geometric flexibility and the ability to fabricate complex designs, ability to combine multiple parts of an assembly into a single component, and the ability to optimize design for specific mechanical property targets. Shock absorption was specifically targeted and requirements were established to attenuate damage to the Lightband system from shock of initiation. Planetary Systems Corporation redesigned components based on these requirements and sent the designs to Oak Ridge National Laboratory to be printed. ORNL printed the parts using the Arcam electron beam melting technology based on the desire for the parts to be fabricated from Ti-6Al-4V based on the weight and mechanical performance of the material. A second set of components was fabricated from stainless steel material on the Renishaw laser powder bed technology due to the improved geometric accuracy, surface finish, and wear resistance of the material. Planetary Systems Corporation evaluated these components and determined that 3D printing is potentially a viable method for achieving significant cost and savings metrics.

  10. Effect of hydrophobic microstructured surfaces on conductive ink printing

    International Nuclear Information System (INIS)

    Kim, Seunghwan; Kang, Hyun Wook; Lee, Kyung Heon; Sung, Hyung Jin

    2011-01-01

    Conductive ink was printed on various microstructured substrates to measure the printing quality. Poly-dimethylsiloxane (PDMS) substrates were used to test the printability of the hydrophobic surface material. Microstructured arrays of 10 µm regular PDMS cubes were prepared using the MEMS fabrication technique. The gap distance between the cubes was varied from 10 to 40 µm. The printing wettability of the microstructured surfaces was determined by measuring the contact angle of a droplet of silver conductive ink. Screen-printing methods were used in the conductive line printing experiment. Test line patterns with finely varying widths (30–250 µm) were printed repeatedly, and the conductivity of the printed lines was measured. The printability, which was defined as the ratio of the successfully printed patterns to the total number of printed patterns, was analyzed as a function of the linewidth and the gap distance of the microstructured surfaces

  11. A multimaterial electrohydrodynamic jet (E-jet) printing system

    International Nuclear Information System (INIS)

    Sutanto, E; Shigeta, K; Kim, Y K; Graf, P G; Hoelzle, D J; Barton, K L; Alleyne, A G; Ferreira, P M; Rogers, J A

    2012-01-01

    Electrohydrodynamic jet (E-jet) printing has emerged as a high-resolution alternative to other forms of direct solution-based fabrication approaches, such as ink-jet printing. This paper discusses the design, integration and operation of a unique E-jet printing platform. The uniqueness lies in the ability to utilize multiple materials in the same overall print-head, thereby enabling increased degrees of heterogeneous integration of different functionalities on a single substrate. By utilizing multiple individual print-heads, with a carrousel indexing among them, increased material flexibility is achieved. The hardware design and system operation for a relatively inexpensive system are developed and presented. Crossover interconnects and multiple fluorescent tagged proteins, demonstrating printed electronics and biological sensing applications, respectively. (paper)

  12. 3D inkjet printed radio frequency inductors and capacitors

    KAUST Repository

    Vaseem, Mohammad

    2016-12-08

    Inkjet printing has emerged as an ideal method for the fabrication of low cost and efficient electronic systems. However, most of the printed designs at present utilize 2D inkjet printing of metallic inks on conventional substrates. In order to have fully printed RF components, the substrate must also be printed. 3D printing of polymers can be an ideal mechanism for printing substrates, however typically such materials cannot handle high sintering temperatures (>150 0C) required for nanoparticles based metallic inks. In this work, an all-inkjet printed process is demonstrated that utilizes 3D inkjet printing of a UV-cured dielectric material in combination with the printing of a particle free conductive silver organo-complex (SOC) ink for realization of inductors and capacitors. The processing temperature does not exceed 80 0C and still state of the art conductivity of 1×107 S/m is achieved. Both the conductive ink and dielectric have roughness values under 500 nm. The inductor and capacitor exhibit quality factors of 8 and 20 respectively in the high MHz and GHz regime.

  13. Study of lip prints: A forensic study

    Directory of Open Access Journals (Sweden)

    Vikash Ranjan

    2014-01-01

    Full Text Available Background: Although several studies have been done on lip prints for human identification in forensic science, there is a doubt about their use in gender determination. Aims: The present study was designed to study the lip groove patterns in all the quadrants of both male and female subjects to identify the sex, based on the patterns of the grooves of the lip prints. Study Design: 300 lip prints were collected from volunteers of D. J. College of Dental Sciences and Research, Modinagar (UP. Materials and Methods: Lip prints were recorded with lip stick and transferred on to a glass slide. Statistical Analysis: Pearson chi-square test was adopted for statistical analysis and probability value (P value was calculated. Conclusion: In our study, none of the lip prints were identical, thus confirming the role of lip prints in individual identification. According to Suzuki′s classification, Type I, II, III and IV patterns were significant in gender determination.

  14. Printing in heterogeneous computer environment at DESY

    International Nuclear Information System (INIS)

    Jakubowski, Z.

    1996-01-01

    The number of registered hosts DESY reaches 3500 while the number of print queues approaches 150. The spectrum of used computing environment is very wide: from MAC's and PC's, through SUN, DEC and SGI machines to the IBM mainframe. In 1994 we used 18 tons of paper. We present a solution for providing print services in such an environment for more than 3500 registered users. The availability of the print service is a serious issue. Using centralized printing has a lot of advantages for software administration but creates single point of failure. We solved this problem partially without using expensive software and hardware. The talk provides information about the DESY central central print spooler concept. None of the systems available on the market provides ready to use reliable solution for all platforms used for DESY. We discuss concepts for installation, administration and monitoring large number of printers. We found a solution for printing both on central computing facilities likewise for support of stand-alone workstations. (author)

  15. Network printing in a heterogenous environment

    International Nuclear Information System (INIS)

    Beyer, C.; Schroth, G.

    2001-01-01

    Mail and printing are often said to be the most visible services for the user in the network. Though many people talked about the paperless bureau a few years ago it seems that the more digital data is accessible, the more it gets printed. Print management in a heterogenous network environments is typically crossing all operating systems. Each of those brings its own requirements and different printing system implementations with individual user interfaces. The scope is to give the user the advantage and features of the native interface of their operating system while making administration tasks as easy as possible by following the general ideas of a centralised network service on the server side

  16. Examining winter visitor use in Yellowstone National Park

    Science.gov (United States)

    Mae A. Davenport; Wayne A. Freimund; William T. Borrie; Robert E. Manning; William A. Valliere; Benjamin Wang

    2000-01-01

    This research was designed to assist the managers of Yellowstone National Park (YNP) in their decision making about winter visitation. The focus of this report is on winter use patterns and winter visitor preferences. It is the author’s hope that this information will benefit both the quality of winter experiences and the stewardship of the park resources. This report...

  17. Winter Dew Harvest in Mexico City

    Directory of Open Access Journals (Sweden)

    Arias-Torres Jorge Ernesto

    2015-12-01

    Full Text Available This study presents experimental and theoretical results of winter dew harvest in México City in terms of condensation rate. A simplified theoretical model based on a steady-state energy balance on a radiator-condenser was fitted, as a function of the ambient temperature, the relative humidity and the wind velocity. A glass sheet and aluminum sheet white-painted were used as samples over the outdoor experiments. A good correlation was obtained between the theoretical and experimental data. The experimental results show that there was condensation in 68% of the winter nights on both condensers. The total winter condensed mass was 2977 g/m2 and 2888 g/m2 on the glass sheet and aluminum sheet white-painted, respectively. Thus, the condensed mass on the glass was only 3% higher than that on the painted surface. The maximum nightly dew harvests occurred during December, which linearly reduced from 50 g/m2 night to 22 g/m2 night as the winter months went by. The condensation occurred from 1:00 a.m. to 9:00 a.m., with maximum condensation rates between 6:00 a.m. and 7:00 a.m. The dew harvest can provide a partial alternative to the winter water shortage in certain locations with similar climates to the winter in Mexico City, as long as pollution is not significant.

  18. Exposure assessment of workers in printed electronics workplace.

    Science.gov (United States)

    Lee, Ji Hyun; Sohn, Eun Kyung; Ahn, Jin Soo; Ahn, Kangho; Kim, Keun Soo; Lee, Jong Hwan; Lee, Taik Min; Yu, Il Je

    2013-07-01

    Printed electronics uses converging technologies, such as printing, fine mechanics, nanotechnology, electronics and other new technologies. Consequently, printed electronics raises additional health and safety concerns to those experienced in the traditional printing industry. This study investigated two printed electronics workplaces based on a walk-through survey and personal and area sampling. All the printed electronics operations were conducted in a cleanroom. No indication of exposure to excess silver nanoparticles or carbon nanotubes (CNTs) was found. While the organic solvents were lower than current occupational exposure limits, there was a lack of engineering controls, such as local exhaust ventilation, correct enclosure and duct connections. There was also an insufficient quantity of personal protective equipment, and some organic solvents not described in the safety data sheets (SDSs) were detected in the air samples. Plus, the cleaning work, a major emissions operation, was not conducted within a hood, and the cleaning waste was not properly disposed of. Therefore, the present exposure assessment results from two printed electronics workplaces suggest that the printed electronics industry needs to take note of the occupational safety and health risks and hazards already established by the traditional printing industry, along with new risks and hazards originating from converging technologies such as nanotechnology.

  19. µPlasma printing of hydrophobic and hydrophilic patterns to improve wetting behaviour for printed electronics

    NARCIS (Netherlands)

    Erik Niewenhuis; ir Renee Verkuijlen; Dr Jan Bernards; ir Martijn van Dongen; Lise Verbraeken

    2012-01-01

    Inkjet printing is a rapidly growing technology for depositing functional materials in the production of organic electronics. Challenges lie among others in the printing of high resolution patterns with high aspect ratio of functional materials to obtain the needed functionality like e.g.

  20. Three-Dimensional Printed Graphene Foams.

    Science.gov (United States)

    Sha, Junwei; Li, Yilun; Villegas Salvatierra, Rodrigo; Wang, Tuo; Dong, Pei; Ji, Yongsung; Lee, Seoung-Ki; Zhang, Chenhao; Zhang, Jibo; Smith, Robert H; Ajayan, Pulickel M; Lou, Jun; Zhao, Naiqin; Tour, James M

    2017-07-25

    An automated metal powder three-dimensional (3D) printing method for in situ synthesis of free-standing 3D graphene foams (GFs) was successfully modeled by manually placing a mixture of Ni and sucrose onto a platform and then using a commercial CO 2 laser to convert the Ni/sucrose mixture into 3D GFs. The sucrose acted as the solid carbon source for graphene, and the sintered Ni metal acted as the catalyst and template for graphene growth. This simple and efficient method combines powder metallurgy templating with 3D printing techniques and enables direct in situ 3D printing of GFs with no high-temperature furnace or lengthy growth process required. The 3D printed GFs show high-porosity (∼99.3%), low-density (∼0.015g cm -3 ), high-quality, and multilayered graphene features. The GFs have an electrical conductivity of ∼8.7 S cm -1 , a remarkable storage modulus of ∼11 kPa, and a high damping capacity of ∼0.06. These excellent physical properties of 3D printed GFs indicate potential applications in fields requiring rapid design and manufacturing of 3D carbon materials, for example, energy storage devices, damping materials, and sound absorption.

  1. 77 FR 65526 - Telecommunications Relay Services and Speech-to-Speech Services for Individuals With Hearing and...

    Science.gov (United States)

    2012-10-29

    ... beginning that review, and ever since then, has been to reform the VRS program, which for many years had... pleading with the Commission's duplicating contractor, Best Copy and Printing, Inc., 445 12th Street SW... purchased from the Commission's duplicating contractor, Best Copy and Printing, Inc., Portals II, 445 12th...

  2. Indirect X-ray Detectors Based on Inkjet-Printed Photodetectors with a Screen-Printed Scintillator Layer.

    Science.gov (United States)

    Oliveira, Juliana; Correia, Vitor; Sowade, Enrico; Etxebarria, Ikerne; Rodriguez, Raul D; Mitra, Kalyan Y; Baumann, Reinhard R; Lanceros-Mendez, Senentxu

    2018-04-18

    Organic photodetectors (PDs) based on printing technologies will allow to expand the current field of PD applications toward large-area and flexible applications in areas such as medical imaging, security, and quality control, among others. Inkjet printing is a powerful digital tool for the deposition of smart and functional materials on various substrates, allowing the development of electronic devices such as PDs on various substrates. In this work, inkjet-printed PD arrays, based on the organic thin-film transistor architecture, have been developed and applied for the indirect detection of X-ray radiation using a scintillator ink as an X-ray absorber. The >90% increase of the photocurrent of the PDs under X-ray radiation, from about 53 nA without the scintillator film to about 102 nA with the scintillator located on top of the PD, proves the suitability of the developed printed device for X-ray detection applications.

  3. Inkjet 3D printing of microfluidic structures—on the selection of the printer towards printing your own microfluidic chips

    International Nuclear Information System (INIS)

    Walczak, Rafał; Adamski, Krzysztof

    2015-01-01

    This article reports, for the first time, the results of detailed research on the application of inkjet 3D printing for the fabrication of microfluidic structures. CAD designed test structures were printed with four different printers. Dimensional fidelity, shape conformity, and surface roughness were studied for each printout. It was found that the minimum dimension (width or depth) for a properly printed microfluidic channel was approximately 200 μm. Although the nominal resolution of the printers was one order of magnitude better, smaller structures were significantly deformed or not printed at all. It was also found that a crucial step in one-step fabrication of embedded microchannels is the removal of the support material. We also discuss the source of print error and present a way to evaluate other printers. The printouts obtained from the four different printers were compared, and the optimal printing technique and printer were used to fabricate a microfluidic structure for the spectrophotometric characterisation of beverages. UV/VIS absorbance characteristics were collected using this microfluidic structure, demonstrating that the fabricated spectrophotometric chip operated properly. Thus, a proof-of-concept for using inkjet 3D printing for the fabrication of microfluidic structures was obtained. (paper)

  4. 3D Printing of Carbon Nanotubes-Based Microsupercapacitors.

    Science.gov (United States)

    Yu, Wei; Zhou, Han; Li, Ben Q; Ding, Shujiang

    2017-02-08

    A novel 3D printing procedure is presented for fabricating carbon-nanotubes (CNTs)-based microsupercapacitors. The 3D printer uses a CNTs ink slurry with a moderate solid content and prints a stream of continuous droplets. Appropriate control of a heated base is applied to facilitate the solvent removal and adhesion between printed layers and to improve the structure integrity without structure delamination or distortion upon drying. The 3D-printed electrodes for microsupercapacitors are characterized by SEM, laser scanning confocal microscope, and step profiler. Effect of process parameters on 3D printing is also studied. The final solid-state microsupercapacitors are assembled with the printed multilayer CNTs structures and poly(vinyl alcohol)-H 3 PO 4 gel as the interdigitated microelectrodes and electrolyte. The electrochemical performance of 3D printed microsupercapacitors is also tested, showing a significant areal capacitance and excellent cycle stability.

  5. Leadership in American Indian Communities: Winter Lessons

    Science.gov (United States)

    Metoyer, Cheryl A.

    2010-01-01

    Winter lessons, or stories told in the winter, were one of the ways in which tribal elders instructed and directed young men and women in the proper ways to assume leadership responsibilities. Winter lessons stressed the appropriate relationship between the leader and the community. The intent was to remember the power and purpose of that…

  6. Advantage of using allele-specific copy numbers when testing for association in regions with common copy number variants.

    Directory of Open Access Journals (Sweden)

    Gaëlle Marenne

    Full Text Available Copy number variants (CNV can be called from SNP-arrays; however, few studies have attempted to combine both CNV and SNP calls to test for association with complex diseases. Even when SNPs are located within CNVs, two separate association analyses are necessary, to compare the distribution of bi-allelic genotypes in cases and controls (referred to as SNP-only strategy and the number of copies of a region (referred to as CNV-only strategy. However, when disease susceptibility is actually associated with allele specific copy-number states, the two strategies may not yield comparable results, raising a series of questions about the optimal analytical approach. We performed simulations of the performance of association testing under different scenarios that varied genotype frequencies and inheritance models. We show that the SNP-only strategy lacks power under most scenarios when the SNP is located within a CNV; frequently it is excluded from analysis as it does not pass quality control metrics either because of an increased rate of missing calls or a departure from fitness for Hardy-Weinberg proportion. The CNV-only strategy also lacks power because the association testing depends on the allele which copy number varies. The combined strategy performs well in most of the scenarios. Hence, we advocate the use of this combined strategy when testing for association with SNPs located within CNVs.

  7. Pseudoisochromatic test plate colour representation dependence on printing technology

    International Nuclear Information System (INIS)

    Luse, K; Ozolinsh, M; Fomins, S

    2012-01-01

    The aim of the study is to determine best printing technology for creation of colour vision deficiency tests. Valid tests for protanopia and deuteranopia were created from perceived colour matching experiments from printed colour samples by colour deficient individuals. Calibrated EpsonStylus Pro 7800 printer for ink prints and Noritsu HD 3701 digital printer for photographic prints were used. Multispectral imagery (by tunable liquid crystal filters system CRI Nuance Vis 07) data analysis show that in case of ink prints, the measured pixel colour coordinate dispersion (in the CIExy colour diagram) of similar colour arrays is smaller than in case of photographic printing. The print quality in terms of colour coordinate dispersion for printing methods used is much higher than in case of commercially available colour vision deficiency tests.

  8. Copying of holograms by spot scanning approach.

    Science.gov (United States)

    Okui, Makoto; Wakunami, Koki; Oi, Ryutaro; Ichihashi, Yasuyuki; Jackin, Boaz Jessie; Yamamoto, Kenji

    2018-05-20

    To replicate holograms, contact copying has conventionally been used. In this approach, a photosensitive material is fixed together with a master hologram and illuminated with a coherent beam. This method is simple and enables high-quality copies; however, it requires a large optical setup for large-area holograms. In this paper, we present a new method of replicating holograms that uses a relatively compact optical system even for the replication of large holograms. A small laser spot that irradiates only part of the hologram is used to reproduce the hologram by scanning the spot over the whole area of the hologram. We report on the results of experiments carried out to confirm the copy quality, along with a guide to design scanning conditions. The results show the potential effectiveness of the large-area hologram replication technology using a relatively compact apparatus.

  9. Paper-based inkjet-printed ultra-wideband fractal antennas

    KAUST Repository

    Maza, Armando Rodriguez

    2012-01-01

    For the first time, paper-based inkjet-printed ultra-wideband (UWB) fractal antennas are presented. Two new designs, a miniaturised UWB monopole, which utilises a fractal matching network and is the smallest reported inkjet-printed UWB printed antenna to date, and a fourth-order Koch Snowflake monopole, which utilises a Sierpinski gasket fractal for ink reduction, are demonstrated. It is shown that fractals prove to be a successful method of reducing fabrication costs in inkjet-printed antennas, while retaining or enhancing printed antenna performance. © 2012 The Institution of Engineering and Technology.

  10. Re-thinking copyright through the copy in Russia

    NARCIS (Netherlands)

    Sezneva, O.

    2013-01-01

    How one copy of a film or a single is made illegal, while its identical twin is treated as legitimate? By drawing from the material collected in Russia on the illegal copying and distribution of video and musical contents, this paper moves beyond the definition of media piracy in legal terms, and

  11. 1 CFR 18.1 - Original and copies required.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... agency submitting a document to be filed and published in the Federal Register shall send an original and...

  12. Digital Printing Quality Detection and Analysis Technology Based on CCD

    Science.gov (United States)

    He, Ming; Zheng, Liping

    2017-12-01

    With the help of CCD digital printing quality detection and analysis technology, it can carry out rapid evaluation and objective detection of printing quality, and can play a certain control effect on printing quality. It can be said CDD digital printing quality testing and analysis of the rational application of technology, its digital printing and printing materials for a variety of printing equipments to improve the quality of a very positive role. In this paper, we do an in-depth study and discussion based on the CCD digital print quality testing and analysis technology.

  13. 3D printed soft parallel actuator

    Science.gov (United States)

    Zolfagharian, Ali; Kouzani, Abbas Z.; Khoo, Sui Yang; Noshadi, Amin; Kaynak, Akif

    2018-04-01

    This paper presents a 3-dimensional (3D) printed soft parallel contactless actuator for the first time. The actuator involves an electro-responsive parallel mechanism made of two segments namely active chain and passive chain both 3D printed. The active chain is attached to the ground from one end and constitutes two actuator links made of responsive hydrogel. The passive chain, on the other hand, is attached to the active chain from one end and consists of two rigid links made of polymer. The actuator links are printed using an extrusion-based 3D-Bioplotter with polyelectrolyte hydrogel as printer ink. The rigid links are also printed by a 3D fused deposition modelling (FDM) printer with acrylonitrile butadiene styrene (ABS) as print material. The kinematics model of the soft parallel actuator is derived via transformation matrices notations to simulate and determine the workspace of the actuator. The printed soft parallel actuator is then immersed into NaOH solution with specific voltage applied to it via two contactless electrodes. The experimental data is then collected and used to develop a parametric model to estimate the end-effector position and regulate kinematics model in response to specific input voltage over time. It is observed that the electroactive actuator demonstrates expected behaviour according to the simulation of its kinematics model. The use of 3D printing for the fabrication of parallel soft actuators opens a new chapter in manufacturing sophisticated soft actuators with high dexterity and mechanical robustness for biomedical applications such as cell manipulation and drug release.

  14. Printing Values In Interactive ROOT

    CERN Document Server

    Perovic, Boris

    2015-01-01

    This project report summarizes the work I have been performing during the past twelve weeks as a Summer Student intern working on ROOT project in the SFT group, PH department, under the supervision of Axel Naumann and Danilo Piparo. One of the widely requested features for ROOT was improved interactive shell experience as well as improved printing of object values. Solving this issue was the goal of this project. Primarily, we have enabled printing of the collections. Secondly, we have unified the printing interface, making it much more robust and extendible. Thirdly, we have implemented printing of nested collections in a flexible and user-friendly manner. Finally, we have added an interactive mode, allowing for paginated output. At the beginning of the report, ROOT is presented with examples of where it is used and how important it is. Then, the motivation behind the project is elaborated, by presenting the previous state of the software package and its potential for improvement. Further, the process in wh...

  15. 7 CFR 58.340 - Printing and packaging.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Printing and packaging. 58.340 Section 58.340... Procedures § 58.340 Printing and packaging. Printing and packaging of consumer size containers of butter... packaging equipment should be provided. The outside cartons should be removed from bulk butter in a room...

  16. Advances in digital printing and quality considerations of digitally printed images

    Science.gov (United States)

    Waes, Walter C.

    1997-02-01

    The traditional 'graphic arts' market has changed very rapidly. It has been only ten years now since Aldus introduced its 'PageMaker' software for text and layout. The platform used was Apple-Mac, which became also the standard for many other graphic applications. The so-called high-end workstations disappeared. This was the start for what later was called: the desk top publishing revolution. At the same time, image scanning became also user-friendly and heavy duty scanners were reduced to desktop-size. Color- reproduction became a commodity product. Since then, the pre-press industry has been going through a technical nightmare, trying to keep up with the digital explosion. One after another, tasks and crafts of pre-press were being transformed by digital technologies. New technologies in this field came almost too fast for many people to adapt. The next digital revolution will be for the commercial printers. All the reasons are explained later in this document. There is now a definite need for a different business-strategy and a new positioning in the electronic media-world. Niches have to be located for new graphic arts- applications. Electronic services to-and-from originators' and executors environments became a requirement. Data can now flow on-line between the printer and the originator of the job. It is no longer the pre-press shop who is controlling this. In many cases, electronic data goes between the print-buyer or agency and the printer. High power communication-systems with accepted standard color- management are transforming the printer, and more particularly, the pre-press shop fatally. The new digital printing market, now in the beginning of its expected full expansion, has to do with growing requests coming from agencies and other print-buyers for: (1) short-run printing; (2) print-on-demand approximately in-time; (3) personalization or other forms of customization; (4) quick turnaround.

  17. Simultaneous observations of the quasar 3C 273 with INTEGRAL, XMM-Newton and RXTE

    DEFF Research Database (Denmark)

    Courvoisier, T.J.L.; Beckmann, V.; Bourban, G.

    2003-01-01

    INTEGRAL has observed the bright quasar 3C 273 on 3 epochs in January 2003 as one of the first observations of the open programme. The observation on January 5 was simultaneous with RXTE and XMM-Newton observations. We present here a first analysis of the continuum emission as observed by these 3...

  18. 3D printing applications for transdermal drug delivery.

    Science.gov (United States)

    Economidou, Sophia N; Lamprou, Dimitrios A; Douroumis, Dennis

    2018-06-15

    The role of two and three-dimensional printing as a fabrication technology for sophisticated transdermal drug delivery systems is explored in literature. 3D printing encompasses a family of distinct technologies that employ a virtual model to produce a physical object through numerically controlled apparatuses. The applicability of several printing technologies has been researched for the direct or indirect printing of microneedle arrays or for the modification of their surface through drug-containing coatings. The findings of the respective studies are presented. The range of printable materials that are currently used or potentially can be employed for 3D printing of transdermal drug delivery (TDD) systems is also reviewed. Moreover, the expected impact and challenges of the adoption of 3D printing as a manufacturing technique for transdermal drug delivery systems, are assessed. Finally, this paper outlines the current regulatory framework associated with 3D printed transdermal drug delivery systems. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Viscoplastic Matrix Materials for Embedded 3D Printing.

    Science.gov (United States)

    Grosskopf, Abigail K; Truby, Ryan L; Kim, Hyoungsoo; Perazzo, Antonio; Lewis, Jennifer A; Stone, Howard A

    2018-03-16

    Embedded three-dimensional (EMB3D) printing is an emerging technique that enables free-form fabrication of complex architectures. In this approach, a nozzle is translated omnidirectionally within a soft matrix that surrounds and supports the patterned material. To optimize print fidelity, we have investigated the effects of matrix viscoplasticity on the EMB3D printing process. Specifically, we determine how matrix composition, print path and speed, and nozzle diameter affect the yielded region within the matrix. By characterizing the velocity and strain fields and analyzing the dimensions of the yielded regions, we determine that scaling relationships based on the Oldroyd number, Od, exist between these dimensions and the rheological properties of the matrix materials and printing parameters. Finally, we use EMB3D printing to create complex architectures within an elastomeric silicone matrix. Our methods and findings will both facilitate future characterization of viscoplastic matrices and motivate the development of new materials for EMB3D printing.

  20. Direct Desktop Printed-Circuits-on-Paper Flexible Electronics

    Science.gov (United States)

    Zheng, Yi; He, Zhizhu; Gao, Yunxia; Liu, Jing

    2013-01-01

    There currently lacks of a way to directly write out electronics, just like printing pictures on paper by an office printer. Here we show a desktop printing of flexible circuits on paper via developing liquid metal ink and related working mechanisms. Through modifying adhesion of the ink, overcoming its high surface tension by dispensing machine and designing a brush like porous pinhead for printing alloy and identifying matched substrate materials among different papers, the slightly oxidized alloy ink was demonstrated to be flexibly printed on coated paper, which could compose various functional electronics and the concept of Printed-Circuits-on-Paper was thus presented. Further, RTV silicone rubber was adopted as isolating inks and packaging material to guarantee the functional stability of the circuit, which suggests an approach for printing 3D hybrid electro-mechanical device. The present work paved the way for a low cost and easygoing method in directly printing paper electronics.

  1. Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins

    DEFF Research Database (Denmark)

    Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra

    2015-01-01

    STUDY OBJECTIVES: Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins...... structure to assess within-pair effects of sleep duration on mtDNA copy number. MEASUREMENTS AND RESULTS: Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P sleep efficiency (β = 0.51; 95% CI 0.......06, 0.95; P DNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated...

  2. 3D inkjet printed radio frequency inductors and capacitors

    KAUST Repository

    Vaseem, Mohammad; McKerricher, Garret; Shamim, Atif

    2016-01-01

    fully printed RF components, the substrate must also be printed. 3D printing of polymers can be an ideal mechanism for printing substrates, however typically such materials cannot handle high sintering temperatures (>150 0C) required for nanoparticles

  3. A novel digital workflow to manufacture personalized three-dimensional-printed hollow surgical obturators after maxillectomy.

    Science.gov (United States)

    Kortes, J; Dehnad, H; Kotte, A N T; Fennis, W M M; Rosenberg, A J W P

    2018-04-07

    Partial or complete resection of the maxilla during tumour surgery causes oronasal defects, leading to oral-maxillofacial dysfunction, for which the surgical obturator (SO) is an important treatment option. Traditional manufacturing of SOs is complex, time-consuming, and often results in inadequate fit and function. This technical note describes a novel digital workflow to design and manufacture a three-dimensional (3D)-printed hollow SO. Registered computed tomography and magnetic resonance imaging images are used for gross tumour delineation. The produced RTStruct set is exported as a stereolitography (STL) file and merged with a 3D model of the dental status. Based on these merged files, a personalized and hollow digital SO design is created, and 3D printed. Due to the proper fit of the prefabricated SO, a soft silicone lining material can be used during surgery to adapt the prosthesis to the oronasal defect, instead of putty materials that are not suitable for this purpose. An STL file of this final SO is created during surgery, based on a scan of the relined SO. The digital workflow results in a SO weight reduction, an increased fit, an up-to-date digital SO copy, and overall easier clinical handling. Copyright © 2018 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  4. The person behind much of your reading matter

    CERN Multimedia

    Alizée Dauvergne

    2010-01-01

    Four million black and white copies and twenty thousand colour copies in 2009 alone – all printed, finished and filed by one person: Florella Lamole, an employee of an outside contractor who has been based at CERN since 1982.   Florella Lamole and her daily printings Maybe you know her better as Flo: she's the person in charge of the CERN Print Shop's high-tech printers and copiers. With her beloved machines, Flo produces paper copies of all manner of CERN documents, from Council and Management documents to minutes of meetings, scientific documents for CMS and ATLAS, brochures, students' theses, and even the paper version of the Bulletin you're reading. Flo is undeniably behind a good deal of your reading matter! CERN's printing demands are high in terms of both quality and quantity. "The Council documents are strictly confidential. And when there's a Council meeting, documents need to be printed straight away, as soon as it's over. That just wouldn't work with an outside prin...

  5. 25 CFR 571.13 - Copies of audit reports.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Copies of audit reports. 571.13 Section 571.13 Indians... MONITORING AND INVESTIGATIONS Audits § 571.13 Copies of audit reports. (a) Each tribe shall prepare and.../or reports as a result of the audit setting forth the results of each fiscal year. The submission...

  6. Free E-Books May Increase Print Sales: A Study with Mixed Results. A Review of: Hilton, J. III, & Wiley, D. (2010. The short-term influence of free digital versions of books on print sales. Journal of Electronic Publishing, 13(1.

    Directory of Open Access Journals (Sweden)

    Heather R. Williams

    2011-03-01

    Full Text Available Objective – To determine whether the availability of free digital versions of books impacts print sales.Design – Quantitative data comparison.Setting – University Instructional Psychology Department.Subjects – A total of 41 books, each with a free digital version and a traditional print version.Methods – This study used Nielson BookScan data to track print book sales during a 16-week period, 8 weeks before a free digital version of the book became available and 8 weeks after the availability of the free digital version. The authors tracked 41 books and organized them into four categories. The first included 7 nonfiction books, the second consisted of 5 science fiction/fantasy books, the third included 5 science fiction/fantasy books released together by Random House, and the fourth group consisted of 24 science fiction/fantasy books released by Tor Books. The books released by Tor Books, unlike the other books in the study, were available by free download only if a person registered for Tor’s newsletter and the downloads were only available for one week. When a free digital book from any of the other three groups was released, it remained available for several weeks, and more often, indefinitely.Main Results – Combined print sales of the nonfiction titles in the first group increased 5% after the release of a free digital copy. The majority of the science fiction/fantasy books in the second group also had an increase in post-free release sales, with a combined increase of 26%. The combined sales of the Random House titles increased by 9% after the release of the free digital versions. However, in stark contrast to the results of the first three groups, the fourth group of Tor books had a combined decrease in print sales of 18%. While the authors were not able to explain this difference with certainty, they point out that the Tor model for releasing the free digital books (making the free books available for only one week and

  7. Quality Inspection of Printed Texts

    DEFF Research Database (Denmark)

    Pedersen, Jesper Ballisager; Nasrollahi, Kamal; Moeslund, Thomas B.

    2016-01-01

    -folded: for costumers of the printing and verification system, the overall grade used to verify if the text is of sufficient quality, while for printer's manufacturer, the detailed character/symbols grades and quality measurements are used for the improvement and optimization of the printing task. The proposed system...

  8. Printed organo-functionalized graphene for biosensing applications.

    Science.gov (United States)

    Wisitsoraat, A; Mensing, J Ph; Karuwan, C; Sriprachuabwong, C; Jaruwongrungsee, K; Phokharatkul, D; Daniels, T M; Liewhiran, C; Tuantranont, A

    2017-01-15

    Graphene is a highly promising material for biosensors due to its excellent physical and chemical properties which facilitate electron transfer between the active locales of enzymes or other biomaterials and a transducer surface. Printing technology has recently emerged as a low-cost and practical method for fabrication of flexible and disposable electronics devices. The combination of these technologies is promising for the production and commercialization of low cost sensors. In this review, recent developments in organo-functionalized graphene and printed biosensor technologies are comprehensively covered. Firstly, various methods for printing graphene-based fluids on different substrates are discussed. Secondly, different graphene-based ink materials and preparation methods are described. Lastly, biosensing performances of printed or printable graphene-based electrochemical and field effect transistor sensors for some important analytes are elaborated. The reported printed graphene based sensors exhibit promising properties with good reliability suitable for commercial applications. Among most reports, only a few printed graphene-based biosensors including screen-printed oxidase-functionalized graphene biosensor have been demonstrated. The technology is still at early stage but rapidly growing and will earn great attention in the near future due to increasing demand of low-cost and disposable biosensors. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. The Art of Copying: Five strategies for Transforming Originals in the Art Museum

    Directory of Open Access Journals (Sweden)

    Hans Dam Christensen

    2017-09-01

    Full Text Available This article discusses copies within the field of art museums by way of mapping strategies for copy practices. This mapping leans heavily towards parts of the wri-tings of Jacques Derrida (1930-2004. Against the backdrop of this theoretical premise, the article distinguishes five main strategies. Firstly, the copies which of-ten are considered to be typical museum copies, characterize the strategy for the disseminating relation between original and copy, that is, reproductions, magnets, etc. This strategy implies how copy practices are closely integrated into museum practices in general. Secondly, the supplementing relation between original and copy will be introduced. This strategy frames, for example, artists' citations of other works and forgeries. Both show that copy practices often lead to new originals, in principle, ad infinitum. Thirdly, this leads to the strategy for the displacing relation between original and copy which encompasses, for example, artistic reworkings of other artists' originals and conservatorial restorations. This approach partly ex-cludes the copy and partly displaces the original, while still, unavoidably, referring to the latter. In general, this strategy signifies the latent instability of the origi-nal. Fourthly, the strategy for the informational relation between original and copy will be discussed as it has a vital function in terms of talking about museum originals and copies. This is the strategy which grants the original artifacts their status as museum objects. An informational copy is just as unique as an original object of art, and at the same time, it defines the original and is itself defined by this opposition. Lastly, the strategy for the imagined relation between original and copy follows. This strategy is dependent upon several of the previous approaches, and, in addition, handles signs that exist without explicit originals, as the strategy covers copies referring to originals which have disappeared

  10. 3D-printed upper limb prostheses: a review.

    Science.gov (United States)

    Ten Kate, Jelle; Smit, Gerwin; Breedveld, Paul

    2017-04-01

    This paper aims to provide an overview with quantitative information of existing 3D-printed upper limb prostheses. We will identify the benefits and drawbacks of 3D-printed devices to enable improvement of current devices based on the demands of prostheses users. A review was performed using Scopus, Web of Science and websites related to 3D-printing. Quantitative information on the mechanical and kinematic specifications and 3D-printing technology used was extracted from the papers and websites. The overview (58 devices) provides the general specifications, the mechanical and kinematic specifications of the devices and information regarding the 3D-printing technology used for hands. The overview shows prostheses for all different upper limb amputation levels with different types of control and a maximum material cost of $500. A large range of various prostheses have been 3D-printed, of which the majority are used by children. Evidence with respect to the user acceptance, functionality and durability of the 3D-printed hands is lacking. Contrary to what is often claimed, 3D-printing is not necessarily cheap, e.g., injection moulding can be cheaper. Conversely, 3D-printing provides a promising possibility for individualization, e.g., personalized socket, colour, shape and size, without the need for adjusting the production machine. Implications for rehabilitation Upper limb deficiency is a condition in which a part of the upper limb is missing as a result of a congenital limb deficiency of as a result of an amputation. A prosthetic hand can restore some of the functions of a missing limb and help the user in performing activities of daily living. Using 3D-printing technology is one of the solutions to manufacture hand prostheses. This overview provides information about the general, mechanical and kinematic specifications of all the devices and it provides the information about the 3D-printing technology used to print the hands.

  11. A spatial haplotype copying model with applications to genotype imputation.

    Science.gov (United States)

    Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan

    2015-05-01

    Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.

  12. Logistics of Three-dimensional Printing: Primer for Radiologists.

    Science.gov (United States)

    Hodgdon, Taryn; Danrad, Raman; Patel, Midhir J; Smith, Stacy E; Richardson, Michael L; Ballard, David H; Ali, Sayed; Trace, Anthony Paul; DeBenedectis, Carolynn M; Zygmont, Matthew E; Lenchik, Leon; Decker, Summer J

    2018-01-01

    The Association of University Radiologists Radiology Research Alliance Task Force on three-dimensional (3D) printing presents a review of the logistic considerations for establishing a clinical service using this new technology, specifically focused on implications for radiology. Specific topics include printer selection for 3D printing, software selection, creating a 3D model for printing, providing a 3D printing service, research directions, and opportunities for radiologists to be involved in 3D printing. A thorough understanding of the technology and its capabilities is necessary as the field of 3D printing continues to grow. Radiologists are in the unique position to guide this emerging technology and its use in the clinical arena. Copyright © 2018 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

  13. High-Speed Printing Process Characterization using the Lissajous Trajectory Method

    Science.gov (United States)

    Lee, Sangwon; Kim, Daekeun

    2018-04-01

    We present a novel stereolithographic three-dimensional (3D) printing process that uses Lissajous trajectories. By using Lissajous trajectories, this 3D printing process allows two laser-scanning mirrors to operate at similar high-speed frequencies simultaneously, and the printing speed can be faster than that of raster scanning used in conventional stereolithography. In this paper, we first propose the basic theoretical background for this printing process based on Lissajous trajectories. We also characterize its printing conditions, such as printing size, laser spot size, and minimum printing resolution, with respect to the operating frequencies of the scanning mirrors and the capability of the laser modulation. Finally, we demonstrate simulation results for printing basic 2D shapes by using a noble printing process algorithm.

  14. A plastic surgery application in evolution: three-dimensional printing.

    Science.gov (United States)

    Gerstle, Theodore L; Ibrahim, Ahmed M S; Kim, Peter S; Lee, Bernard T; Lin, Samuel J

    2014-02-01

    Three-dimensional printing represents an evolving technology still in its infancy. Currently, individuals and small business entities have the ability to manufacture physical objects from digital renderings, computer-aided design, and open source files. Design modifications and improvements in extrusion methods have made this technology much more affordable. This article explores the potential uses of three-dimensional printing in plastic surgery. A review was performed detailing the known uses of three-dimensional printing in medicine. The potential applications of three-dimensional printing in plastic surgery are discussed. Various applications for three-dimensional printing technology have emerged in medicine, including printing organs, printing body parts, bio-printing, and computer-aided tissue engineering. In plastic surgery, these tools offer various prospective applications for surgical planning, resident education, and the development of custom prosthetics. Numerous applications exist in medicine, including the printing of devices, implants, tissue replacements, and even whole organs. Plastic surgeons may likely find this technology indispensable in surgical planning, education, and prosthetic device design and development in the near future.

  15. The analysis of ink jet printed eco-font efficiency

    Directory of Open Access Journals (Sweden)

    Rastko Milošević

    2016-07-01

    Full Text Available Utilization of eco-font for office printing is one of sustainable, “green” printing concepts, which besides obvious economic benefits, as a result has a certain effect on environmental sustainability as well. The fundamental problem that this practice faces is decreased quality of text printed using eco-fonts comparing to those printed with regular fonts. The aim of this research is eco-font efficiency estimation, i.e. determination of toner usage reduction level of ink jet printed documents typed with this font type, as well as estimation of the extent humans perceive differences between text printed with eco-font and the one printed by its „non-eco“ equivalent. Combining instrumental measuring method and digital image analysis, it was found that this simple principle (eco-font utilization enables substantial toner usage reduction for an ink jet printing system, while visual test showed that visual experience of text printed using eco-font is sufficient. In addition, awareness of benefits that eco-font utilization brings, change users’ attitude towards eco-font quality.

  16. Barriers to wheelchair use in the winter.

    Science.gov (United States)

    Ripat, Jacquie D; Brown, Cara L; Ethans, Karen D

    2015-06-01

    To test the hypothesis that challenges to community participation posed by winter weather are greater for individuals who use scooters, manual and power wheelchairs (wheeled mobility devices [WMDs]) than for the general ambulatory population, and to determine what WMD users identify as the most salient environmental barriers to community participation during the winter. Cross-sectional survey organized around 5 environmental domains: technological, natural, physical, social/attitudinal, and policy. Urban community in Canada. Convenience sample of WMD users or their proxy (N=99). Not applicable. Not applicable. Forty-two percent identified reduced outing frequency in winter months, associated with increased age (χ(3)=6.4, P=.04), lack of access to family/friends for transportation (χ(2)=8.1, P=.04), and primary type of WMD used in the winter (scooter χ(2)=8.8, P=.003). Most reported tires/casters becoming stuck in the snow (95%) or slipping on the ice (91%), difficulty ascending inclines/ramps (92%), and cold hands while using controls or pushing rims (85%); fewer identified frozen wheelchair/scooter batteries, seat cushions/backrests, or electronics. Sidewalks/roads were reported to be problematic by 99%. Eighty percent reported needing additional help in the winter. Limited community access in winter led to a sense of loneliness/isolation, and fear/anxiety related to safety. Respondents identified policies that limited participation during winter. People who use WMDs decrease their community participation in cold weather because of multiple environmental barriers. Clinicians, researchers, and policymakers can take a multidimensional approach to mitigate these barriers in order to enhance community participation by WMD users in winter. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  17. AGA predicts winter jump in residential gas price

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    The American Gas Association predicts the average heating bill for residential gas consumers could increase by as much as 18% this winter. AGA Pres. Mike Baly said, Last year's winter was warmer than normal. If the 1992-93 winter is similar, AGA projects that residential natural gas heating bills will go up about 6%. If we see a return to normal winter weather, our projection show the average bill could rise by almost 18%

  18. 44 CFR 5.85 - Authentication and attestation of copies.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Authentication and attestation of copies. 5.85 Section 5.85 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT... Authentication and attestation of copies. The Administrator, Deputy Administrators, Regional Administrators...

  19. Scalable, full-colour and controllable chromotropic plasmonic printing

    OpenAIRE

    Xue, Jiancai; Zhou, Zhang-Kai; Wei, Zhiqiang; Su, Rongbin; Lai, Juan; Li, Juntao; Li, Chao; Zhang, Tengwei; Wang, Xue-Hua

    2015-01-01

    Plasmonic colour printing has drawn wide attention as a promising candidate for the next-generation colour-printing technology. However, an efficient approach to realize full colour and scalable fabrication is still lacking, which prevents plasmonic colour printing from practical applications. Here we present a scalable and full-colour plasmonic printing approach by combining conjugate twin-phase modulation with a plasmonic broadband absorber. More importantly, our approach also demonstrates ...

  20. 48 CFR 1631.205-78 - FEHBP printed material costs.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true FEHBP printed material... carrier orders printed material that is available from the Government Printing Office (GPO) under the... COST PRINCIPLES AND PROCEDURES Contracts With Commercial Organizations 1631.205-78 FEHBP printed...

  1. Embedding complex objects with 3d printing

    KAUST Repository

    Hussain, Muhammad Mustafa

    2017-10-12

    A CMOS technology-compatible fabrication process for flexible CMOS electronics embedded during additive manufacturing (i.e. 3D printing). A method for such a process may include printing a first portion of a 3D structure; pausing the step of printing the 3D structure to embed the flexible silicon substrate; placing the flexible silicon substrate in a cavity of the first portion of the 3D structure to embed the flexible silicon substrate in the 3D structure; and resuming the step of printing the 3D structure to form the second portion of the 3D structure.

  2. 3D Printing the Complete CubeSat

    Science.gov (United States)

    Kief, Craig

    2015-01-01

    The 3D Printing the Complete CubeSat project is designed to advance the state-of-the-art in 3D printing for CubeSat applications. Printing in 3D has the potential to increase reliability, reduce design iteration time and provide greater design flexibility in the areas of radiation mitigation, communications, propulsion, and wiring, among others. This project is investigating the possibility of including propulsion systems into the design of printed CubeSat components. One such concept, an embedded micro pulsed plasma thruster (mPPT), could provide auxiliary reaction control propulsion for a spacecraft as a means to desaturate momentum wheels.

  3. Paper-based inkjet-printed ultra-wideband fractal antennas

    KAUST Repository

    Maza, Armando Rodriguez; Cook, Benjamin Stassen; Jabbour, Ghassan E.; Shamim, Atif

    2012-01-01

    For the first time, paper-based inkjet-printed ultra-wideband (UWB) fractal antennas are presented. Two new designs, a miniaturised UWB monopole, which utilises a fractal matching network and is the smallest reported inkjet-printed UWB printed

  4. Substitution within the Danish printing industry

    DEFF Research Database (Denmark)

    Larsen, Henrik Fred; Bøg, Carsten

    2009-01-01

    are running a substitution project. A major part of the work has been mapping the presence of chemicals which are potential candidates for substitution (e.g. PBT, CMR, vPvB, EDS) within the Danish printing industry and this work was recently finished. The mapping comprises a combination of a literature study......The implementation of the EU REACH regulation will most probably promote substitution within sectors handling a lot of different chemicals like the printing industry. With the aim of being at the cutting edge of this development the Danish EPA together with the Danish printing industry and IPU...... total 15 substances) were found in the Danish printing industry. This paper presents the results of the mapping of chemical candidates and the first results on preparing for actual substitutions....

  5. Comparative Study on Cushion Performance Between 3D Printed Kelvin Structure and 3D Printed Lattice Structure

    Science.gov (United States)

    Priyadarshini, Lakshmi

    Frequently transported packaging goods are more prone to damage due to impact, jolting or vibration in transit. Fragile goods, for example, glass, ceramics, porcelain are susceptible to mechanical stresses. Hence ancillary materials like cushions play an important role when utilized within package. In this work, an analytical model of a 3D cellular structure is established based on Kelvin model and lattice structure. The research will provide a comparative study between the 3D printed Kelvin unit structure and 3D printed lattice structure. The comparative investigation is based on parameters defining cushion performance such as cushion creep, indentation, and cushion curve analysis. The applications of 3D printing is in rapid prototyping where the study will provide information of which model delivers better form of energy absorption. 3D printed foam will be shown as a cost-effective approach as prototype. The research also investigates about the selection of material for 3D printing process. As cushion development demands flexible material, three-dimensional printing with material having elastomeric properties is required. Further, the concept of cushion design is based on Kelvin model structure and lattice structure. The analytical solution provides the cushion curve analysis with respect to the results observed when load is applied over the cushion. The results are reported on basis of attenuation and amplification curves.

  6. Ultrafast Digital Printing toward 4D Shape Changing Materials.

    Science.gov (United States)

    Huang, Limei; Jiang, Ruiqi; Wu, Jingjun; Song, Jizhou; Bai, Hao; Li, Bogeng; Zhao, Qian; Xie, Tao

    2017-02-01

    Ultrafast 4D printing (printing converts the structure into 3D. An additional dimension can be incorporated by choosing the printing precursors. The process overcomes the speed limiting steps of typical 3D (4D) printing. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Printing method for organic light emitting device lighting

    Science.gov (United States)

    Ki, Hyun Chul; Kim, Seon Hoon; Kim, Doo-Gun; Kim, Tae-Un; Kim, Snag-Gi; Hong, Kyung-Jin; So, Soon-Yeol

    2013-03-01

    Organic Light Emitting Device (OLED) has a characteristic to change the electric energy into the light when the electric field is applied to the organic material. OLED is currently employed as a light source for the lighting tools because research has extensively progressed in the improvement of luminance, efficiency, and life time. OLED is widely used in the plate display device because of a simple manufacture process and high emitting efficiency. But most of OLED lighting projects were used the vacuum evaporator (thermal evaporator) with low molecular. Although printing method has lower efficiency and life time of OLED than vacuum evaporator method, projects of printing OLED actively are progressed because was possible to combine with flexible substrate and printing technology. Printing technology is ink-jet, screen printing and slot coating. This printing method allows for low cost and mass production techniques and large substrates. In this research, we have proposed inkjet printing for organic light-emitting devices has the dominant method of thick film deposition because of its low cost and simple processing. In this research, the fabrication of the passive matrix OLED is achieved by inkjet printing, using a polymer phosphorescent ink. We are measured optical and electrical characteristics of OLED.

  8. High-Performance Screen-Printed Thermoelectric Films on Fabrics.

    Science.gov (United States)

    Shin, Sunmi; Kumar, Rajan; Roh, Jong Wook; Ko, Dong-Su; Kim, Hyun-Sik; Kim, Sang Il; Yin, Lu; Schlossberg, Sarah M; Cui, Shuang; You, Jung-Min; Kwon, Soonshin; Zheng, Jianlin; Wang, Joseph; Chen, Renkun

    2017-08-04

    Printing techniques could offer a scalable approach to fabricate thermoelectric (TE) devices on flexible substrates for power generation used in wearable devices and personalized thermo-regulation. However, typical printing processes need a large concentration of binder additives, which often render a detrimental effect on electrical transport of the printed TE layers. Here, we report scalable screen-printing of TE layers on flexible fiber glass fabrics, by rationally optimizing the printing inks consisting of TE particles (p-type Bi 0.5 Sb 1.5 Te 3 or n-type Bi 2 Te 2.7 Se 0.3 ), binders, and organic solvents. We identified a suitable binder additive, methyl cellulose, which offers suitable viscosity for printability at a very small concentration (0.45-0.60 wt.%), thus minimizing its negative impact on electrical transport. Following printing, the binders were subsequently burnt off via sintering and hot pressing. We found that the nanoscale defects left behind after the binder burnt off became effective phonon scattering centers, leading to low lattice thermal conductivity in the printed n-type material. With the high electrical conductivity and low thermal conductivity, the screen-printed TE layers showed high room-temperature ZT values of 0.65 and 0.81 for p-type and n-type, respectively.

  9. Pharmaceutical 3D printing: Design and qualification of a single step print and fill capsule.

    Science.gov (United States)

    Smith, Derrick M; Kapoor, Yash; Klinzing, Gerard R; Procopio, Adam T

    2018-06-10

    Fused deposition modeling (FDM) 3D printing (3DP) has a potential to change how we envision manufacturing in the pharmaceutical industry. A more common utilization for FDM 3DP is to build upon existing hot melt extrusion (HME) technology where the drug is dispersed in the polymer matrix. However, reliable manufacturing of drug-containing filaments remains a challenge along with the limitation of active ingredients which can sustain the processing risks involved in the HME process. To circumvent this obstacle, a single step FDM 3DP process was developed to manufacture thin-walled drug-free capsules which can be filled with dry or liquid drug product formulations. Drug release from these systems is governed by the combined dissolution of the FDM capsule 'shell' and the dosage form encapsulated in these shells. To prepare the shells, the 3D printer files (extension '.gcode') were modified by creating discrete zones, so-called 'zoning process', with individual print parameters. Capsules printed without the zoning process resulted in macroscopic print defects and holes. X-ray computed tomography, finite element analysis and mechanical testing were used to guide the zoning process and printing parameters in order to manufacture consistent and robust capsule shell geometries. Additionally, dose consistencies of drug containing liquid formulations were investigated in this work. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. 48 CFR 719.273-4 - Eligibility of Mentor and Protégé firms.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Eligibility of Mentor and... Development (USAID) Mentor-Protégé Program 719.273-4 Eligibility of Mentor and Protégé firms. Eligible business entities approved as Mentors may enter into agreements (hereafter referred to as “Mentor-Protégé...

  11. Root development of fodder radish and winter wheat before winter in relation to uptake of nitrogen

    DEFF Research Database (Denmark)

    Wahlström, Ellen Margrethe; Hansen, Elly Møller; Mandel, A.

    2015-01-01

    occurred. Quantitative data is missing on N leaching of a catch crop compared to a winter cereal in a conventional cereal-based cropping system. The aim of the study was to investigate whether fodder radish (Raphanus sativus L.) (FR) would be more efficient than winter wheat (Triticum aestivum L.) (WW...

  12. No-infill 3D Printing

    Science.gov (United States)

    Wei, Xiao-Ran; Zhang, Yu-He; Geng, Guo-Hua

    2016-09-01

    In this paper, we examined how printing the hollow objects without infill via fused deposition modeling, one of the most widely used 3D-printing technologies, by partitioning the objects to shell parts. More specifically, we linked the partition to the exact cover problem. Given an input watertight mesh shape S, we developed region growing schemes to derive a set of surfaces that had inside surfaces that were printable without support on the mesh for the candidate parts. We then employed Monte Carlo tree search over the candidate parts to obtain the optimal set cover. All possible candidate subsets of exact cover from the optimal set cover were then obtained and the bounded tree was used to search the optimal exact cover. We oriented each shell part to the optimal position to guarantee the inside surface was printed without support, while the outside surface was printed with minimum support. Our solution can be applied to a variety of models, closed-hollowed or semi-closed, with or without holes, as evidenced by experiments and performance evaluation on our proposed algorithm.

  13. Print2Screen Mobile App: Embedding Multimedia in Printed ODL Course Materials Using QR Codes

    Science.gov (United States)

    Abeywardena, Ishan Sudeera

    2017-01-01

    With the rise of OER and multimedia such as YouTube videos, many academic institutions are becoming mindful of the richness they bring into the teaching and learning process. Given that multimedia resources cannot be directly integrated into printed material, the only available alternative is to print hyperlinks, which teachers and learners can…

  14. The meaning of nuclear winter

    International Nuclear Information System (INIS)

    Geiger, H.J.

    1987-01-01

    In this paper the author reviews the history and origins of the basic ideas underlying nuclear winter; and findings and predictions of several groups regarding this topic. The author reviews some of the further developments and scientific analyses regarding nuclear winter since the initial announcements of 1983, touching on some of the revisions and controversies and trying to indicate the current status of the field

  15. All-printed paper memory

    KAUST Repository

    He, Jr-Hau

    2016-08-11

    All-printed paper-based substrate memory devices are described. In an embodiment, a paper-based memory device is prepared by coating one or more areas of a paper substrate with a conductor material such as a carbon paste, to form a first electrode of a memory, depositing a layer of insulator material, such as titanium dioxide, over one or more areas of the conductor material, and depositing a layer of metal over one or more areas of the insulator material to form a second electrode of the memory. In an embodiment, the device can further include diodes printed between the insulator material and the second electrode, and the first electrode and the second electrodes can be formed as a crossbar structure to provide a WORM memory. The various layers and the diodes can be printed onto the paper substrate by, for example, an ink jet printer.

  16. Winter climate limits subantarctic low forest growth and establishment.

    Science.gov (United States)

    Harsch, Melanie A; McGlone, Matt S; Wilmshurst, Janet M

    2014-01-01

    Campbell Island, an isolated island 600 km south of New Zealand mainland (52 °S, 169 °E) is oceanic (Conrad Index of Continentality  =  -5) with small differences between mean summer and winter temperatures. Previous work established the unexpected result that a mean annual climate warming of c. 0.6 °C since the 1940's has not led to upward movement of the forest limit. Here we explore the relative importance of summer and winter climatic conditions on growth and age-class structure of the treeline forming species, Dracophyllum longifolium and Dracophyllum scoparium over the second half of the 20th century. The relationship between climate and growth and establishment were evaluated using standard dendroecological methods and local climate data from a meteorological station on the island. Growth and establishment were correlated against climate variables and further evaluated within hierarchical regression models to take into account the effect of plot level variables. Winter climatic conditions exerted a greater effect on growth and establishment than summer climatic conditions. Establishment is maximized under warm (mean winter temperatures >7 °C), dry winters (total winter precipitation <400 mm). Growth, on the other hand, is adversely affected by wide winter temperature ranges and increased rainfall. The contrasting effect of winter warmth on growth and establishment suggests that winter temperature affects growth and establishment through differing mechanisms. We propose that milder winters enhance survival of seedlings and, therefore, recruitment, but increases metabolic stress on established plants, resulting in lower growth rates. Future winter warming may therefore have complex effects on plant growth and establishment globally.

  17. Sage-grouse habitat selection during winter in Alberta

    Science.gov (United States)

    Carpenter, Jennifer L.; Aldridge, Cameron L.; Boyce, Mark S.

    2010-01-01

    Greater sage-grouse (Centrocercus urophasianus) are dependent on sagebrush (Artemisia spp.) for food and shelter during winter, yet few studies have assessed winter habitat selection, particularly at scales applicable to conservation planning. Small changes to availability of winter habitats have caused drastic reductions in some sage-grouse populations. We modeled winter habitat selection by sage-grouse in Alberta, Canada, by using a resource selection function. Our purpose was to 1) generate a robust winter habitat-selection model for Alberta sage-grouse; 2) spatially depict habitat suitability in a Geographic Information System to identify areas with a high probability of selection and thus, conservation importance; and 3) assess the relative influence of human development, including oil and gas wells, in landscape models of winter habitat selection. Terrain and vegetation characteristics, sagebrush cover, anthropogenic landscape features, and energy development were important in top Akaike's Information Criterionselected models. During winter, sage-grouse selected dense sagebrush cover and homogenous less rugged areas, and avoided energy development and 2-track truck trails. Sage-grouse avoidance of energy development highlights the need for comprehensive management strategies that maintain suitable habitats across all seasons. ?? 2010 The Wildlife Society.

  18. The Unusual Southern Hemisphere Stratosphere Winter of 2002

    Science.gov (United States)

    Newman, Paul A.; Nash, Eric R.

    2003-01-01

    The southern hemisphere stratospheric winter of 2002 was the most unusual winter yet observed in the southern hemisphere climate record. Temperatures near the edge of the Antarctic polar vortex were considerably warmer than normal over the entire course of the winter. The polar night jet was considerably weaker than normal, and was displaced more poleward than has been observed in previous winters. These record high temperatures and weak jet resulted from a series of wave events that took place over the course of the winter. The first large event occurred on 15 May, and the final warming occurred on 25 October. The propagation of these wave events from the troposphere is diagnosed from time series of Eliassen-Palm flux vectors. The wave events tended to occur irregularly over the course of the winter, and pre-conditioned the polar night jet for the extremely large wave event of 22 September. This large wave event resulted in the first ever observed major stratospheric warming in the southern hemisphere. This wave event split the Antarctic ozone hole. The combined effect of the wave events of the 2002 winter resulted in the smallest ozone hole observed since 1988.

  19. Endodontic applications of 3D printing.

    Science.gov (United States)

    Anderson, J; Wealleans, J; Ray, J

    2018-02-27

    Computer-aided design (CAD) and computer-aided manufacturing (CAM) technologies can leverage cone beam computed tomography data for production of objects used in surgical and nonsurgical endodontics and in educational settings. The aim of this article was to review all current applications of 3D printing in endodontics and to speculate upon future directions for research and clinical use within the specialty. A literature search of PubMed, Ovid and Scopus was conducted using the following terms: stereolithography, 3D printing, computer aided rapid prototyping, surgical guide, guided endodontic surgery, guided endodontic access, additive manufacturing, rapid prototyping, autotransplantation rapid prototyping, CAD, CAM. Inclusion criteria were articles in the English language documenting endodontic applications of 3D printing. Fifty-one articles met inclusion criteria and were utilized. The endodontic literature on 3D printing is generally limited to case reports and pre-clinical studies. Documented solutions to endodontic challenges include: guided access with pulp canal obliteration, applications in autotransplantation, pre-surgical planning and educational modelling and accurate location of osteotomy perforation sites. Acquisition of technical expertise and equipment within endodontic practices present formidable obstacles to widespread deployment within the endodontic specialty. As knowledge advances, endodontic postgraduate programmes should consider implementing 3D printing into their curriculums. Future research directions should include clinical outcomes assessments of treatments employing 3D printed objects. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.

  20. Dispenser printed electroluminescent lamps on textiles for smart fabric applications

    Science.gov (United States)

    de Vos, Marc; Torah, Russel; Tudor, John

    2016-04-01

    Flexible electroluminescent (EL) lamps are fabricated onto woven textiles using a novel dispenser printing process. Dispenser printing utilizes pressurized air to deposit ink onto a substrate through a syringe and nozzle. This work demonstrates the first use of this technology to fabricate EL lamps. The luminance of the dispenser printed EL lamps is compared to screen-printed EL lamps, both printed on textile, and also commercial EL lamps on polyurethane film. The dispenser printed lamps are shown to have a 1.5 times higher luminance than the best performing commercially available lamp, and have a comparable performance to the screen-printed lamps.

  1. Dispenser printed electroluminescent lamps on textiles for smart fabric applications

    International Nuclear Information System (INIS)

    De Vos, Marc; Torah, Russel; Tudor, John

    2016-01-01

    Flexible electroluminescent (EL) lamps are fabricated onto woven textiles using a novel dispenser printing process. Dispenser printing utilizes pressurized air to deposit ink onto a substrate through a syringe and nozzle. This work demonstrates the first use of this technology to fabricate EL lamps. The luminance of the dispenser printed EL lamps is compared to screen-printed EL lamps, both printed on textile, and also commercial EL lamps on polyurethane film. The dispenser printed lamps are shown to have a 1.5 times higher luminance than the best performing commercially available lamp, and have a comparable performance to the screen-printed lamps. (paper)

  2. EU Design Law and 3D Printing

    DEFF Research Database (Denmark)

    Nordberg, Ana; Schovsbo, Jens Hemmingsen

    2017-01-01

    The article considers the implications for EU design law of 3D-printing. It first describes the 3D-printing technology and the e-ecosystem which is evolving around the technology and involves a number of new stakeholders who in different ways are engaged in the making and sharing of CAD-files and....../or printing. It is submitted that it is only a matter of time before 3D-printing equipment becomes ubiquitous. It is pointed out how the new technology and e-ecosystem at the same time represent threats and opportunities to design holders and to the societal interests in design and design law. EU design law...

  3. Towards microscale electrohydrodynamic three-dimensional printing

    International Nuclear Information System (INIS)

    He, Jiankang; Xu, Fangyuan; Cao, Yi; Liu, Yaxiong; Li, Dichen

    2016-01-01

    It is challenging for the existing three-dimensional (3D) printing techniques to fabricate high-resolution 3D microstructures with low costs and high efficiency. In this work we present a solvent-based electrohydrodynamic 3D printing technique that allows fabrication of microscale structures like single walls, crossed walls, lattice and concentric circles. Process parameters were optimized to deposit tiny 3D patterns with a wall width smaller than 10 μm and a high aspect ratio of about 60. Tight bonding among neighbour layers could be achieved with a smooth lateral surface. In comparison with the existing microscale 3D printing techniques, the presented method is low-cost, highly efficient and applicable to multiple polymers. It is envisioned that this simple microscale 3D printing strategy might provide an alternative and innovative way for application in MEMS, biosensor and flexible electronics. (paper)

  4. 3D Printed Multimaterial Microfluidic Valve.

    Directory of Open Access Journals (Sweden)

    Steven J Keating

    Full Text Available We present a novel 3D printed multimaterial microfluidic proportional valve. The microfluidic valve is a fundamental primitive that enables the development of programmable, automated devices for controlling fluids in a precise manner. We discuss valve characterization results, as well as exploratory design variations in channel width, membrane thickness, and membrane stiffness. Compared to previous single material 3D printed valves that are stiff, these printed valves constrain fluidic deformation spatially, through combinations of stiff and flexible materials, to enable intricate geometries in an actuated, functionally graded device. Research presented marks a shift towards 3D printing multi-property programmable fluidic devices in a single step, in which integrated multimaterial valves can be used to control complex fluidic reactions for a variety of applications, including DNA assembly and analysis, continuous sampling and sensing, and soft robotics.

  5. Towards microscale electrohydrodynamic three-dimensional printing

    Science.gov (United States)

    He, Jiankang; Xu, Fangyuan; Cao, Yi; Liu, Yaxiong; Li, Dichen

    2016-02-01

    It is challenging for the existing three-dimensional (3D) printing techniques to fabricate high-resolution 3D microstructures with low costs and high efficiency. In this work we present a solvent-based electrohydrodynamic 3D printing technique that allows fabrication of microscale structures like single walls, crossed walls, lattice and concentric circles. Process parameters were optimized to deposit tiny 3D patterns with a wall width smaller than 10 μm and a high aspect ratio of about 60. Tight bonding among neighbour layers could be achieved with a smooth lateral surface. In comparison with the existing microscale 3D printing techniques, the presented method is low-cost, highly efficient and applicable to multiple polymers. It is envisioned that this simple microscale 3D printing strategy might provide an alternative and innovative way for application in MEMS, biosensor and flexible electronics.

  6. Deer Wintering Areas

    Data.gov (United States)

    Vermont Center for Geographic Information — Deer winter habitat is critical to the long term survival of white-tailed deer (Odocoileus virginianus) in Vermont. Being near the northern extreme of the...

  7. Pocket Pal: A Graphic Arts Digest for Printers and Advertising Production Managers. Tenth Edition.

    Science.gov (United States)

    1970

    In this digest of information about printing a brief survey of the history of printing precedes detailed explanations of the processes and the materials involved in printing. The four major printing processes--letterpress, gravure, offset lithography, and screen--are explained. Steps in preparing art and copy for printing, including selection of…

  8. 3D printed replicas for endodontic education.

    Science.gov (United States)

    Reymus, M; Fotiadou, C; Kessler, A; Heck, K; Hickel, R; Diegritz, C

    2018-06-14

    To assess the feasibility of producing artificial teeth for endodontic training using 3D printing technology, to analyse the accuracy of the printing process, and to evaluate the teeth by students when used during training. Sound extracted human teeth were selected, digitalized by cone beam computed tomography (CBCT) and appropriate software and finally reproduced by a stereolithographic printer. The printed teeth were scanned and compared with the original ones (trueness) and to one another (precision). Undergraduate dental students in the third and fourth years performed root canal treatment on printed molars and were subsequently asked to evaluate their experience with these compared to real teeth. The workflow was feasible for manufacturing 3D printed tooth replicas. The absolute deviation after printing (trueness) ranged from 50.9μm to 104.3μm. The values for precision ranged from 43.5μm to 68.2μm. Students reported great benefits in the use of the replicated teeth for training purposes. The presented workflow is feasible for any dental educational institution who has access to a CBCT unit and a stereolithographic printer. The accuracy of the printing process is suitable for the production of tooth replicas for endodontic training. Undergraduate students favoured the availability of these replicas and the fairness they ensured in training due to standardization. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  9. Dimensional accuracy of 3D printed vertebra

    Science.gov (United States)

    Ogden, Kent; Ordway, Nathaniel; Diallo, Dalanda; Tillapaugh-Fay, Gwen; Aslan, Can

    2014-03-01

    3D printer applications in the biomedical sciences and medical imaging are expanding and will have an increasing impact on the practice of medicine. Orthopedic and reconstructive surgery has been an obvious area for development of 3D printer applications as the segmentation of bony anatomy to generate printable models is relatively straightforward. There are important issues that should be addressed when using 3D printed models for applications that may affect patient care; in particular the dimensional accuracy of the printed parts needs to be high to avoid poor decisions being made prior to surgery or therapeutic procedures. In this work, the dimensional accuracy of 3D printed vertebral bodies derived from CT data for a cadaver spine is compared with direct measurements on the ex-vivo vertebra and with measurements made on the 3D rendered vertebra using commercial 3D image processing software. The vertebra was printed on a consumer grade 3D printer using an additive print process using PLA (polylactic acid) filament. Measurements were made for 15 different anatomic features of the vertebral body, including vertebral body height, endplate width and depth, pedicle height and width, and spinal canal width and depth, among others. It is shown that for the segmentation and printing process used, the results of measurements made on the 3D printed vertebral body are substantially the same as those produced by direct measurement on the vertebra and measurements made on the 3D rendered vertebra.

  10. 3D printing for clinical application in otorhinolaryngology.

    Science.gov (United States)

    Zhong, Nongping; Zhao, Xia

    2017-12-01

    Three-dimensional (3D) printing is a promising technology that can use a patient's image data to create complex and personalized constructs precisely. It has made great progress over the past few decades and has been widely used in medicine including medical modeling, surgical planning, medical education and training, prosthesis and implants. Three-dimensional (3D) bioprinting is a powerful tool that has the potential to fabricate bioengineered constructs of the desired shape layer-by-layer using computer-aided deposition of living cells and biomaterials. Advances in 3D printed implants and future tissue-engineered constructs will bring great progress to the field of otolaryngology. By integrating 3D printing into tissue engineering and materials, it may be possible for otolaryngologists to implant 3D printed functional grafts into patients for reconstruction of a variety of tissue defects in the foreseeable future. In this review, we will introduce the current state of 3D printing technology and highlight the applications of 3D printed prosthesis and implants, 3D printing technology combined with tissue engineering and future directions of bioprinting in the field of otolaryngology.

  11. EL device pad-printed on a curved surface

    International Nuclear Information System (INIS)

    Lee, Taik-Min; Hur, Shin; Kim, Jae-Hyun; Choi, Hyun-Cheol

    2010-01-01

    This paper is unique in that the electroluminescence (EL) display device is fabricated on a curved surface using the pad-printing method. The precision of the pad-printing process is explored to verify whether it can be used for micro patterning. The minimum pattern size and pattern distortion, which is caused by use of the pad, were tested and simulated. The minimal pattern was found to be 35 µm wide and 2.4 µm thick. Pattern distortion when pad-printing on a flat surface, caused by the deformation of the silicon pad, was less than 5 µm. Numerical analysis shows how to estimate pattern distortion when pad-printing on a curved surface. The proposed EL display device consists of five layers, namely a bottom electrode, dielectric layer, phosphor, transparent electrode and a bus electrode. The ink of each layer was reformulated with solvents and the pad-printing conditions were controlled. A PEN film was used first in order to realize the pad-printing process condition of each layer. Finally, the EL display device was printed onto a dish with a radius of curvature of 80 mm. The luminance was 180 cd m −2

  12. Freeform inkjet printing of cellular structures with bifurcations.

    Science.gov (United States)

    Christensen, Kyle; Xu, Changxue; Chai, Wenxuan; Zhang, Zhengyi; Fu, Jianzhong; Huang, Yong

    2015-05-01

    Organ printing offers a great potential for the freeform layer-by-layer fabrication of three-dimensional (3D) living organs using cellular spheroids or bioinks as building blocks. Vascularization is often identified as a main technological barrier for building 3D organs. As such, the fabrication of 3D biological vascular trees is of great importance for the overall feasibility of the envisioned organ printing approach. In this study, vascular-like cellular structures are fabricated using a liquid support-based inkjet printing approach, which utilizes a calcium chloride solution as both a cross-linking agent and support material. This solution enables the freeform printing of spanning and overhang features by providing a buoyant force. A heuristic approach is implemented to compensate for the axially-varying deformation of horizontal tubular structures to achieve a uniform diameter along their axial directions. Vascular-like structures with both horizontal and vertical bifurcations have been successfully printed from sodium alginate only as well as mouse fibroblast-based alginate bioinks. The post-printing fibroblast cell viability of printed cellular tubes was found to be above 90% even after a 24 h incubation, considering the control effect. © 2014 Wiley Periodicals, Inc.

  13. Winter climate limits subantarctic low forest growth and establishment.

    Directory of Open Access Journals (Sweden)

    Melanie A Harsch

    Full Text Available Campbell Island, an isolated island 600 km south of New Zealand mainland (52 °S, 169 °E is oceanic (Conrad Index of Continentality  =  -5 with small differences between mean summer and winter temperatures. Previous work established the unexpected result that a mean annual climate warming of c. 0.6 °C since the 1940's has not led to upward movement of the forest limit. Here we explore the relative importance of summer and winter climatic conditions on growth and age-class structure of the treeline forming species, Dracophyllum longifolium and Dracophyllum scoparium over the second half of the 20th century. The relationship between climate and growth and establishment were evaluated using standard dendroecological methods and local climate data from a meteorological station on the island. Growth and establishment were correlated against climate variables and further evaluated within hierarchical regression models to take into account the effect of plot level variables. Winter climatic conditions exerted a greater effect on growth and establishment than summer climatic conditions. Establishment is maximized under warm (mean winter temperatures >7 °C, dry winters (total winter precipitation <400 mm. Growth, on the other hand, is adversely affected by wide winter temperature ranges and increased rainfall. The contrasting effect of winter warmth on growth and establishment suggests that winter temperature affects growth and establishment through differing mechanisms. We propose that milder winters enhance survival of seedlings and, therefore, recruitment, but increases metabolic stress on established plants, resulting in lower growth rates. Future winter warming may therefore have complex effects on plant growth and establishment globally.

  14. Winter Climate Limits Subantarctic Low Forest Growth and Establishment

    Science.gov (United States)

    Harsch, Melanie A.; McGlone, Matt S.; Wilmshurst, Janet M.

    2014-01-01

    Campbell Island, an isolated island 600 km south of New Zealand mainland (52°S, 169°E) is oceanic (Conrad Index of Continentality  = −5) with small differences between mean summer and winter temperatures. Previous work established the unexpected result that a mean annual climate warming of c. 0.6°C since the 1940's has not led to upward movement of the forest limit. Here we explore the relative importance of summer and winter climatic conditions on growth and age-class structure of the treeline forming species, Dracophyllum longifolium and Dracophyllum scoparium over the second half of the 20th century. The relationship between climate and growth and establishment were evaluated using standard dendroecological methods and local climate data from a meteorological station on the island. Growth and establishment were correlated against climate variables and further evaluated within hierarchical regression models to take into account the effect of plot level variables. Winter climatic conditions exerted a greater effect on growth and establishment than summer climatic conditions. Establishment is maximized under warm (mean winter temperatures >7 °C), dry winters (total winter precipitation <400 mm). Growth, on the other hand, is adversely affected by wide winter temperature ranges and increased rainfall. The contrasting effect of winter warmth on growth and establishment suggests that winter temperature affects growth and establishment through differing mechanisms. We propose that milder winters enhance survival of seedlings and, therefore, recruitment, but increases metabolic stress on established plants, resulting in lower growth rates. Future winter warming may therefore have complex effects on plant growth and establishment globally. PMID:24691026

  15. Investigation of the adhesion properties of direct 3D printing of polymers and nanocomposites on textiles: Effect of FDM printing process parameters

    Science.gov (United States)

    Hashemi Sanatgar, Razieh; Campagne, Christine; Nierstrasz, Vincent

    2017-05-01

    In this paper, 3D printing as a novel printing process was considered for deposition of polymers on synthetic fabrics to introduce more flexible, resource-efficient and cost effective textile functionalization processes than conventional printing process like screen and inkjet printing. The aim is to develop an integrated or tailored production process for smart and functional textiles which avoid unnecessary use of water, energy, chemicals and minimize the waste to improve ecological footprint and productivity. Adhesion of polymer and nanocomposite layers which were 3D printed directly onto the textile fabrics using fused deposition modeling (FDM) technique was investigated. Different variables which may affect the adhesion properties including 3D printing process parameters, fabric type and filler type incorporated in polymer were considered. A rectangular shape according to the peeling standard was designed as 3D computer-aided design (CAD) to find out the effect of the different variables. The polymers were printed in different series of experimental design: nylon on polyamide 66 (PA66) fabrics, polylactic acid (PLA) on PA66 fabric, PLA on PLA fabric, and finally nanosize carbon black/PLA (CB/PLA) and multi-wall carbon nanotubes/PLA (CNT/PLA) nanocomposites on PLA fabrics. The adhesion forces were quantified using the innovative sample preparing method combining with the peeling standard method. Results showed that different variables of 3D printing process like extruder temperature, platform temperature and printing speed can have significant effect on adhesion force of polymers to fabrics while direct 3D printing. A model was proposed specifically for deposition of a commercial 3D printer Nylon filament on PA66 fabrics. In the following, among the printed polymers, PLA and its composites had high adhesion force to PLA fabrics.

  16. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers, or...

  17. Peer-to-peer computing for secure high performance data copying

    International Nuclear Information System (INIS)

    Hanushevsky, A.; Trunov, A.; Cottrell, L.

    2001-01-01

    The BaBar Copy Program (bbcp) is an excellent representative of peer-to-peer (P2P) computing. It is also a pioneering application of its type in the P2P arena. Built upon the foundation of its predecessor, Secure Fast Copy (sfcp), bbcp incorporates significant improvements performance and usability. As with sfcp, bbcp uses ssh for authentication; providing an elegant and simple working model--if you can ssh to a location, you can copy files to or from that location. To fully support this notion, bbcp transparently supports 3rd party copy operations. The program also incorporates several mechanism to deal with firewall security; the bane of P2P computing. To achieve high performance in a wide area network, bbcp allows a user to independently specify, the number of parallel network streams, tcp window size, and the file I/O blocking factor. Using these parameters, data is pipelined from source to target to provide a uniform traffic pattern that maximizes router efficiency. For improved recoverability, bbcp also keeps track of copy operations so that an operation can be restarted from the point of failure at a later time; minimizing the amount of network traffic in the event of a copy failure. Here, the authors present the bbcp architecture, it's various features, and the reasons for their inclusion

  18. Peer-to-Peer Computing for Secure High Performance Data Copying

    International Nuclear Information System (INIS)

    2002-01-01

    The BaBar Copy Program (bbcp) is an excellent representative of peer-to-peer (P2P) computing. It is also a pioneering application of its type in the P2P arena. Built upon the foundation of its predecessor, Secure Fast Copy (sfcp), bbcp incorporates significant improvements performance and usability. As with sfcp, bbcp uses ssh for authentication; providing an elegant and simple working model -- if you can ssh to a location, you can copy files to or from that location. To fully support this notion, bbcp transparently supports 3rd party copy operations. The program also incorporates several mechanism to deal with firewall security; the bane of P2P computing. To achieve high performance in a wide area network, bbcp allows a user to independently specify, the number of parallel network streams, tcp window size, and the file I/O blocking factor. Using these parameters, data is pipelined from source to target to provide a uniform traffic pattern that maximizes router efficiency. For improved recoverability, bbcp also keeps track of copy operations so that an operation can be restarted from the point of failure at a later time; minimizing the amount of network traffic in the event of a copy failure. Here, we preset the bbcp architecture, it's various features, and the reasons for their inclusion

  19. 3D Printing by Multiphase Silicone/Water Capillary Inks.

    Science.gov (United States)

    Roh, Sangchul; Parekh, Dishit P; Bharti, Bhuvnesh; Stoyanov, Simeon D; Velev, Orlin D

    2017-08-01

    3D printing of polymers is accomplished easily with thermoplastics as the extruded hot melt solidifies rapidly during the printing process. Printing with liquid polymer precursors is more challenging due to their longer curing times. One curable liquid polymer of specific interest is polydimethylsiloxane (PDMS). This study demonstrates a new efficient technique for 3D printing with PDMS by using a capillary suspension ink containing PDMS in the form of both precured microbeads and uncured liquid precursor, dispersed in water as continuous medium. The PDMS microbeads are held together in thixotropic granular paste by capillary attraction induced by the liquid precursor. These capillary suspensions possess high storage moduli and yield stresses that are needed for direct ink writing. They could be 3D printed and cured both in air and under water. The resulting PDMS structures are remarkably elastic, flexible, and extensible. As the ink is made of porous, biocompatible silicone that can be printed directly inside aqueous medium, it can be used in 3D printed biomedical products, or in applications such as direct printing of bioscaffolds on live tissue. This study demonstrates a number of examples using the high softness, elasticity, and resilience of these 3D printed structures. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Chapter 7: Migration and winter ecology

    Science.gov (United States)

    Deborah M. Finch; Jeffrey F. Kelly; Jean-Luc E. Cartron

    2000-01-01

    The willow flycatcher (Empidonax traillii) is a Neotropical migrant that breeds in North America, but winters in Central and northern South America. Little specific information is known about migration and wintering ecology of the southwestern willow flycatcher (E. t. extimus) (Yong and Finch 1997). Our report applies principally...

  1. Printing of polymer microcapsules for enzyme immobilization on paper substrate.

    Science.gov (United States)

    Savolainen, Anne; Zhang, Yufen; Rochefort, Dominic; Holopainen, Ulla; Erho, Tomi; Virtanen, Jouko; Smolander, Maria

    2011-06-13

    Poly(ethyleneimine) (PEI) microcapsules containing laccase from Trametes hirsuta (ThL) and Trametes versicolor (TvL) were printed onto paper substrate by three different methods: screen printing, rod coating, and flexo printing. Microcapsules were fabricated via interfacial polycondensation of PEI with the cross-linker sebacoyl chloride, incorporated into an ink, and printed or coated on the paper substrate. The same ink components were used for three printing methods, and it was found that laccase microcapsules were compatible with the ink. Enzymatic activity of microencapsulated TvL was maintained constant in polymer-based ink for at least eight weeks. Thick layers with high enzymatic activity were obtained when laccase-containing microcapsules were screen printed on paper substrate. Flexo printed bioactive paper showed very low activity, since by using this printing method the paper surface was not fully covered by enzyme microcapsules. Finally, screen printing provided a bioactive paper with high water-resistance and the highest enzyme lifetime.

  2. Computer Security: Printing confidentially

    CERN Document Server

    Stefan Lueders, Computer Security Team

    2015-01-01

    Have you ever hesitated to print a confidential document using CERN printers? Or perhaps you have rushed quickly to the printer after hitting the “print” button in order to avoid someone else getting hold of and reading your document? These times are over now with the new printing infrastructure!   Indeed, many of us regularly print out confidential documents like our salary slips, MARS forms, tendering documents and drafts of preliminary papers. The upcoming CERN data protection policy will require all of us to respect the confidentiality of such documents and, as the word “confidential” implies, access to “confidential” or sensitive documents will be tightly controlled. What can we do about the public printers located in many buildings, floors and shared spaces - accessible not only to CERN staff and users but also to visitors and guests? Some printers are located in the vicinity of restaurants, cafeterias or close to paths taken b...

  3. Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins.

    Science.gov (United States)

    Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F

    2015-10-01

    Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Academic clinical research center. 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a "normal" (7-9 h/24) and "short" (sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. © 2015 Associated Professional Sleep Societies, LLC.

  4. 3D printing for soft robotics - a review.

    Science.gov (United States)

    Gul, Jahan Zeb; Sajid, Memoon; Rehman, Muhammad Muqeet; Siddiqui, Ghayas Uddin; Shah, Imran; Kim, Kyung-Hwan; Lee, Jae-Wook; Choi, Kyung Hyun

    2018-01-01

    Soft robots have received an increasing attention due to their advantages of high flexibility and safety for human operators but the fabrication is a challenge. Recently, 3D printing has been used as a key technology to fabricate soft robots because of high quality and printing multiple materials at the same time. Functional soft materials are particularly well suited for soft robotics due to a wide range of stimulants and sensitive demonstration of large deformations, high motion complexities and varied multi-functionalities. This review comprises a detailed survey of 3D printing in soft robotics. The development of key 3D printing technologies and new materials along with composites for soft robotic applications is investigated. A brief summary of 3D-printed soft devices suitable for medical to industrial applications is also included. The growing research on both 3D printing and soft robotics needs a summary of the major reported studies and the authors believe that this review article serves the purpose.

  5. Grey Balance Colorimetry of the Automatically Guided Printing

    Directory of Open Access Journals (Sweden)

    Igor Zjakic

    2005-12-01

    Full Text Available Apart from visual control, it is possible to controll the ink on a print by means of auxilliary instruments - densitometer, colorimeter and spectral photometer.One of the problems in offset printing reproduction is the inconstancy of theink flow and ink consumption during the run printing. This problem appears because of the change of ink viscosity, the change of ink temperature, the change of fountain solution quantity in ink, the change of printing speed etc.This article shows the measurements of the chromatic values performed by spectral photometer on the control - signal strip from the very beginning of the run printing till 20000th print. Gray balance (CMY by means of CIE L*a*b* system has been investigated. Densitometric values of the solid area, the growth of the screen values and doubling-shear have been determined. The results of the spectrophotometric measurements of gray balance and the densitometric measurements of the solid tint have been analyzed.

  6. High-Throughput Printing Process for Flexible Electronics

    Science.gov (United States)

    Hyun, Woo Jin

    Printed electronics is an emerging field for manufacturing electronic devices with low cost and minimal material waste for a variety of applications including displays, distributed sensing, smart packaging, and energy management. Moreover, its compatibility with roll-to-roll production formats and flexible substrates is desirable for continuous, high-throughput production of flexible electronics. Despite the promise, however, the roll-to-roll production of printed electronics is quite challenging due to web movement hindering accurate ink registration and high-fidelity printing. In this talk, I will present a promising strategy for roll-to-roll production using a novel printing process that we term SCALE (Self-aligned Capillarity-Assisted Lithography for Electronics). By utilizing capillarity of liquid inks on nano/micro-structured substrates, the SCALE process facilitates high-resolution and self-aligned patterning of electrically functional inks with greatly improved printing tolerance. I will show the fabrication of key building blocks (e.g. transistor, resistor, capacitor) for electronic circuits using the SCALE process on plastics.

  7. Three-dimensional printing and pediatric liver disease.

    Science.gov (United States)

    Alkhouri, Naim; Zein, Nizar N

    2016-10-01

    Enthusiastic physicians and medical researchers are investigating the role of three-dimensional printing in medicine. The purpose of the current review is to provide a concise summary of the role of three-dimensional printing technology as it relates to the field of pediatric hepatology and liver transplantation. Our group and others have recently demonstrated the feasibility of printing three-dimensional livers with identical anatomical and geometrical landmarks to the native liver to facilitate presurgical planning of complex liver surgeries. Medical educators are exploring the use of three-dimensional printed organs in anatomy classes and surgical residencies. Moreover, mini-livers are being developed by regenerative medicine scientist as a way to test new drugs and, eventually, whole livers will be grown in the laboratory to replace organs with end-stage disease solving the organ shortage problem. From presurgical planning to medical education to ultimately the bioprinting of whole organs for transplantation, three-dimensional printing will change medicine as we know in the next few years.

  8. The future of 3D printing technology in biomedicine

    Directory of Open Access Journals (Sweden)

    Iraj Nabipour

    2015-07-01

    Full Text Available 3D printing, one of the hottest cutting-edge interdisciplinary technologies, is projected to have revenue of $8.4 billion in 2020. #D printing technology will implement the concept of personalized medicine in medical healthcare industry and pharmaceutical fabrication. Organ printing, which it is defined as computer-aided, jet based 3D tissue-engineering of living human organs, is an interesting and challengeable field for 3D printing. Customized implants and prostheses can be produced in any imaginable geometry through the translation of radiological images of patients into digital.stl 3D print files. The creation of anatomical models based on the patient’s pathological conditions using 3D printing technologies would provide good models for training and to design surgical approaches. Hence, 3D printing not only will transform medical healthcare industry but also promises new converging technologies in the field of regenerative medicine.

  9. Forensic print extraction using 3D technology and its processing

    Science.gov (United States)

    Rajeev, Srijith; Shreyas, Kamath K. M.; Panetta, Karen; Agaian, Sos S.

    2017-05-01

    Biometric evidence plays a crucial role in criminal scene analysis. Forensic prints can be extracted from any solid surface such as firearms, doorknobs, carpets and mugs. Prints such as fingerprints, palm prints, footprints and lip-prints can be classified into patent, latent, and three-dimensional plastic prints. Traditionally, law enforcement officers capture these forensic traits using an electronic device or extract them manually, and save the data electronically using special scanners. The reliability and accuracy of the method depends on the ability of the officer or the electronic device to extract and analyze the data. Furthermore, the 2-D acquisition and processing system is laborious and cumbersome. This can lead to the increase in false positive and true negative rates in print matching. In this paper, a method and system to extract forensic prints from any surface, irrespective of its shape, is presented. First, a suitable 3-D camera is used to capture images of the forensic print, and then the 3-D image is processed and unwrapped to obtain 2-D equivalent biometric prints. Computer simulations demonstrate the effectiveness of using 3-D technology for biometric matching of fingerprints, palm prints, and lip-prints. This system can be further extended to other biometric and non-biometric modalities.

  10. 3D-PRINTING OF BUILD OBJECTS

    Directory of Open Access Journals (Sweden)

    SAVYTSKYI M. V.

    2016-03-01

    Full Text Available Raising of problem. Today, in all spheres of our life we can constate the permanent search for new, modern methods and technologies that meet the principles of sustainable development. New approaches need to be, on the one hand more effective in terms of conservation of exhaustible resources of our planet, have minimal impact on the environment and on the other hand to ensure a higher quality of the final product. Construction is not exception. One of the new promising technology is the technology of 3D -printing of individual structures and buildings in general. 3Dprinting - is the process of real object recreating on the model of 3D. Unlike conventional printer which prints information on a sheet of paper, 3D-printer allows you to display three-dimensional information, i.e. creates certain physical objects. Currently, 3D-printer finds its application in many areas of production: machine building elements, a variety of layouts, interior elements, various items. But due to the fact that this technology is fairly new, it requires the creation of detailed and accurate technologies, efficient equipment and materials, and development of common vocabulary and regulatory framework in this field. Research Aim. The analysis of existing methods of creating physical objects using 3D-printing and the improvement of technology and equipment for the printing of buildings and structures. Conclusion. 3D-printers building is a new generation of equipment for the construction of buildings, structures, and structural elements. A variety of building printing technics opens up wide range of opportunities in the construction industry. At this stage, printers design allows to create low-rise buildings of different configurations with different mortars. The scientific novelty of this work is to develop proposals to improve the thermal insulation properties of constructed 3D-printing objects and technological equipment. The list of key terms and notions of construction

  11. ERP system for 3D printing industry

    Directory of Open Access Journals (Sweden)

    Deaky Bogdan

    2017-01-01

    Full Text Available GOCREATE is an original cloud-based production management and optimization service which helps 3D printing service providers to use their resources better. The proposed Enterprise Resource Planning system can significantly increase income through improved productivity. With GOCREATE, the 3D printing service providers get a much higher production efficiency at a much lower licensing cost, to increase their competitiveness in the fast growing 3D printing market.

  12. 3D freeform printing of silk fibroin.

    Science.gov (United States)

    Rodriguez, Maria J; Dixon, Thomas A; Cohen, Eliad; Huang, Wenwen; Omenetto, Fiorenzo G; Kaplan, David L

    2018-04-15

    Freeform fabrication has emerged as a key direction in printing biologically-relevant materials and structures. With this emerging technology, complex structures with microscale resolution can be created in arbitrary geometries and without the limitations found in traditional bottom-up or top-down additive manufacturing methods. Recent advances in freeform printing have used the physical properties of microparticle-based granular gels as a medium for the submerged extrusion of bioinks. However, most of these techniques require post-processing or crosslinking for the removal of the printed structures (Miller et al., 2015; Jin et al., 2016) [1,2]. In this communication, we introduce a novel method for the one-step gelation of silk fibroin within a suspension of synthetic nanoclay (Laponite) and polyethylene glycol (PEG). Silk fibroin has been used as a biopolymer for bioprinting in several contexts, but chemical or enzymatic additives or bulking agents are needed to stabilize 3D structures. Our method requires no post-processing of printed structures and allows for in situ physical crosslinking of pure aqueous silk fibroin into arbitrary geometries produced through freeform 3D printing. 3D bioprinting has emerged as a technology that can produce biologically relevant structures in defined geometries with microscale resolution. Techniques for fabrication of free-standing structures by printing into granular gel media has been demonstrated previously, however, these methods require crosslinking agents and post-processing steps on printed structures. Our method utilizes one-step gelation of silk fibroin within a suspension of synthetic nanoclay (Laponite), with no need for additional crosslinking compounds or post processing of the material. This new method allows for in situ physical crosslinking of pure aqueous silk fibroin into defined geometries produced through freeform 3D printing. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights

  13. Analysis of the Optical Properties of Screen-Printed and Aerosol-Printed and Plated Fingers of Silicon Solar Cells

    Directory of Open Access Journals (Sweden)

    R. Woehl

    2008-01-01

    Full Text Available One main efficiency loss in industrial solar cells is the shading of the cell caused by the metal front side contacts. With the aerosol-printing technique plus an additional light-induced plating (LIP step, not only is the geometrical contact width narrowed compared to screen-printed contacts but also the shape of the finger changes. In this work, the effective shading of different finger types is analysed with two different measurement methods. The essential parameter for characterising the finger is the effective width which can be reduced drastically compared to the geometrical width due to total internal reflection at the glass-air layer and the reflection from the roundish edges of the contact fingers into the cell. This parameter was determined with different methods. It could be shown that for aerosol-printed fingers the effective (optical width is only 38% of its geometrical width, while for standard screen-printed fingers it is 47%. The measured values are compared to a theoretical model for an aerosol-printed and plated finger and are in good agreement.

  14. Autumn Weather and Winter Increase in Cerebrovascular Disease Mortality

    LENUS (Irish Health Repository)

    McDonagh, R

    2016-11-01

    Mortality from cerebrovascular disease increases in winter but the cause is unclear. Ireland’s oceanic climate means that it infrequently experiences extremes of weather. We examined how weather patterns relate to stroke mortality in Ireland. Seasonal data for Sunshine (% of average), Rainfall (% of average) and Temperature (degrees Celsius above average) were collected for autumn (September-November) and winter (December-February) using official Irish Meteorological Office data. National cerebrovascular mortality data was obtained from Quarterly Vital Statistics. Excess winter deaths were calculated by subtracting (nadir) 3rd quarter mortality data from subsequent 1st quarter data. Data for 12 years were analysed, 2002-2014. Mean winter mortality excess was 24.7%. Winter mortality correlated with temperature (r=.60, p=0.04). Rise in winter mortality correlated strongly with the weather in the preceding autumn (Rainfall: r=-0.19 p=0.53, Temperature: r=-0.60, p=0.03, Sunshine, r=0.58, p=0.04). Winter cerebrovascular disease mortality appears higher following cool, sunny autum

  15. How useful is 3D printing in maxillofacial surgery?

    Science.gov (United States)

    Louvrier, A; Marty, P; Barrabé, A; Euvrard, E; Chatelain, B; Weber, E; Meyer, C

    2017-09-01

    3D printing seems to have more and more applications in maxillofacial surgery (MFS), particularly since the release on the market of general use 3D printers several years ago. The aim of our study was to answer 4 questions: 1. Who uses 3D printing in MFS and is it routine or not? 2. What are the main clinical indications for 3D printing in MFS and what are the kinds of objects that are used? 3. Are these objects printed by an official medical device (MD) manufacturer or made directly within the department or the lab? 4. What are the advantages and drawbacks? Two bibliographic researches were conducted on January the 1st, 2017 in PubMed, without time limitation, using "maxillofacial surgery" AND "3D printing" for the first and for the second "maxillofacial surgery" AND "computer-aided design" AND "computer-aided manufacturing" as keywords. Articles in English or French dealing with human clinical use of 3D printing were selected. Publication date, nationality of the authors, number of patients treated, clinical indication(s), type of printed object(s), type of printing (lab/hospital-made or professional/industry) and advantages/drawbacks were recorded. Two hundred and ninety-seven articles from 35 countries met the criteria. The most represented country was the People's Republic of China (16% of the articles). A total of 2889 patients (10 per article on average) benefited from 3D printed objects. The most frequent clinical indications were dental implant surgery and mandibular reconstruction. The most frequently printed objects were surgical guides and anatomic models. Forty-five percent of the prints were professional. The main advantages were improvement in precision and reduction of surgical time. The main disadvantages were the cost of the objects and the manufacturing period when printed by the industry. The arrival on the market of low-cost printers has increased the use of 3D printing in MFS. Anatomic models are not considered to be MDs and do not have

  16. Improving Heat Transfer Performance of Printed Circuit Boards

    Science.gov (United States)

    Schatzel, Donald V.

    2009-01-01

    This paper will explore the ability of printed circuit boards laminated with a Carbon Core Laminate to transfer heat vs. standard printed circuit boards that use only thick layers of copper. The paper will compare the differences in heat transfer performance of printed circuit boards with and without CCL.

  17. 3D-printing soft sEMG sensing structures

    NARCIS (Netherlands)

    Wolterink, Gerjan; Sanders, Remco; Muijzer, Frodo; van Beijnum, Bert-Jan; Krijnen, Gijs

    2017-01-01

    This paper describes the development and characterization of soft and flexible 3D-printed sEMG electrodes. The electrodes are printed in one go on a low cost consumer multi-material FDM printer. The printed structures do not need any further production steps to give them conductive properties.

  18. Three-Dimensional Printing of Drug-Eluting Implants

    DEFF Research Database (Denmark)

    Water, Jorrit Jeroen; Bohr, Adam; Bøtker, Johan Peter

    2015-01-01

    The aim of the present work was to investigate the potential of three-dimensional (3D) printing as a manufacturing method for products intended for personalized treatments by exploring the production of novel polylactide-based feedstock materials for 3D printing purposes. Nitrofurantoin (NF......) and hydroxyapatite (HA) were successfully mixed and extruded with up to 30% drug load with and without addition of 5% HA in polylactide strands, which were subsequently 3D-printed into model disc geometries (10 × 2 mm). X-ray powder diffraction analysis showed that NF maintained its anhydrate solid form during...... of custom-made, drug-loaded feedstock materials for 3D printing of pharmaceutical products for controlled release....

  19. 3D-Printed Biopolymers for Tissue Engineering Application

    Directory of Open Access Journals (Sweden)

    Xiaoming Li

    2014-01-01

    Full Text Available 3D printing technology has recently gained substantial interest for potential applications in tissue engineering due to the ability of making a three-dimensional object of virtually any shape from a digital model. 3D-printed biopolymers, which combine the 3D printing technology and biopolymers, have shown great potential in tissue engineering applications and are receiving significant attention, which has resulted in the development of numerous research programs regarding the material systems which are available for 3D printing. This review focuses on recent advances in the development of biopolymer materials, including natural biopolymer-based materials and synthetic biopolymer-based materials prepared using 3D printing technology, and some future challenges and applications of this technology are discussed.

  20. Winter climate variability and classification in the Bulgarian Mountainous Regions

    International Nuclear Information System (INIS)

    Petkova, Nadezhda; Koleva, Ekaterina

    2004-01-01

    The problems of snowiness and thermal conditions of winters are of high interest of investigations because of the more frequent droughts, occurred in the region. In the present study an attempt to reveal tendencies existing during the last 70 years of 20 th century in the course winter precipitation and,temperature as well as in some of the snow cover parameters. On the base of mean winter air temperature winters in the Bulgarian mountains were analyzed and classified. The main results of the study show that winter precipitation has decrease tendencies more significant in the highest parts of the mountains. On the other hand winter air temperature increases. It shows a relatively well-established maximum at the end of the studied period. In the Bulgarian mountains normal winters are about 35-40% of all winters. (Author)

  1. Interim Report 'Winter smog and traffic'.

    NARCIS (Netherlands)

    Bloemen, H.; Blom, T.; Bogaard, van den C.; Boluyt, N.; Bree, van L.; Brunekreef, B.; Hoek, G.; Zee, van der S.

    1994-01-01

    This report presents a halfway score of the research project "Winter smog and Traffic", one of the themes of the research programme "Air Pollution and Health". A state of the art is presented of the health effects associated with exposure to winter smog and of the toxicological effects caused by the

  2. Home advantage in the Winter Paralympic Games 1976-2014.

    Science.gov (United States)

    Wilson, Darryl; Ramchandani, Girish

    2017-01-01

    There is a limited amount of home advantage research concerned with winter sports. There is also a distinct lack of studies that investigate home advantage in the context of para sport events. This paper addresses this gap in the knowledge by examining home advantage in the Winter Paralympic Games. Using a standardised measure of success, we compared the performances of host nations at home with their own performances away from home between 1976 and 2014. Both country level and individual sport level analysis is conducted for this time period. Comparisons are also drawn with the Winter Olympic Games since 1992, the point from which both the Winter Olympic Games and the Winter Paralympic Games have been hosted by the same nations and in the same years. Clear evidence of a home advantage effect in the Winter Paralympic Games was found at country level. When examining individual sports, only alpine skiing and cross country skiing returned a significant home advantage effect. When comparing home advantage in the Winter Paralympic Games with the Winter Olympic Games for the last seven host nations (1992-2014), we found that home advantage was generally more pronounced (although not a statistically significant difference) in the case of the former. The causes of home advantage in the Winter Paralympic Games are unclear and should be investigated further.

  3. Cardiothoracic Applications of 3D Printing

    Science.gov (United States)

    Giannopoulos, Andreas A.; Steigner, Michael L.; George, Elizabeth; Barile, Maria; Hunsaker, Andetta R.; Rybicki, Frank J.; Mitsouras, Dimitris

    2016-01-01

    Summary Medical 3D printing is emerging as a clinically relevant imaging tool in directing preoperative and intraoperative planning in many surgical specialties and will therefore likely lead to interdisciplinary collaboration between engineers, radiologists, and surgeons. Data from standard imaging modalities such as CT, MRI, echocardiography and rotational angiography can be used to fabricate life-sized models of human anatomy and pathology, as well as patient-specific implants and surgical guides. Cardiovascular 3D printed models can improve diagnosis and allow for advanced pre-operative planning. The majority of applications reported involve congenital heart diseases, valvular and great vessels pathologies. Printed models are suitable for planning both surgical and minimally invasive procedures. Added value has been reported toward improving outcomes, minimizing peri-operative risk, and developing new procedures such as transcatheter mitral valve replacements. Similarly, thoracic surgeons are using 3D printing to assess invasion of vital structures by tumors and to assist in diagnosis and treatment of upper and lower airway diseases. Anatomic models enable surgeons to assimilate information more quickly than image review, choose the optimal surgical approach, and achieve surgery in a shorter time. Patient-specific 3D-printed implants are beginning to appear and may have significant impact on cosmetic and life-saving procedures in the future. In summary, cardiothoracic 3D printing is rapidly evolving and may be a potential game-changer for surgeons. The imager who is equipped with the tools to apply this new imaging science to cardiothoracic care is thus ideally positioned to innovate in this new emerging imaging modality. PMID:27149367

  4. 49 CFR 512.5 - How many copies should I submit?

    Science.gov (United States)

    2010-10-01

    ... must send the following in hard copy or electronic format to the Chief Counsel when making a claim for... format, a copy of any special software required to review materials for which confidential treatment is...

  5. Plasmonic colour laser printing

    DEFF Research Database (Denmark)

    Zhu, Xiaolong; Vannahme, Christoph; Højlund-Nielsen, Emil

    2016-01-01

    -beam lithography (EBL) or focused ion beam (FIB), both expensive and not scalable processes that are not suitable for post-processing customization. Here we show a method of colour printing on nanoimprinted plasmonic metasurfaces using laser post-writing. Laser pulses induce transient local heat generation...... that leads to melting and reshaping of the imprinted nanostructures. Depending on the laser pulse energy density, different surface morphologies that support different plasmonic resonances leading to different colour appearances can be created. Using this technique we can print all primary colours...

  6. The Decline of Print: Ten Years of Print Serial Use in a Small Academic Medical Library

    Science.gov (United States)

    Rosati, Karen Thompson

    2006-01-01

    Tracking use of print journals over a ten-year period has allowed The University of South Carolina (USC) School of Medicine Library an essential tool for more accurate collection development, for both print and electronic selection. This lengthy study has provided usage statistics for purchasing decisions regarding electronic subscriptions still…

  7. Screening for common copy-number variants in cancer genes.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

    2010-12-01

    For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Real-time weed detection, decision making and patch spraying in maize, sugarbeet, winter wheat and winter barley

    DEFF Research Database (Denmark)

    Gerhards, R; Christensen, Svend

    2003-01-01

    with weed infestation levels higher than the economic weed threshold; a review of such work is provided. This paper presents a system for site-specific weed control in sugarbeet (Beta vulgaris L.), maize (Zea mays L.), winter wheat (Triticum aestivum L.) and winter barley (Hordeum vulgare L.), including...

  9. Inkjet printing and adhesion characterisation of conductive tracks on a commercial printed circuit board material

    International Nuclear Information System (INIS)

    Sridhar, A.; Dijk, D.J. van; Akkerman, R.

    2009-01-01

    Silver nanoparticle-based conductive tracks were inkjet printed using a piezoelectric drop-on-demand inkjet printer on a commercially available electronics grade fibre glass (E-glass) reinforced substrate material, and the experimental results have been summarised. Ink jetting was done on two variants of this substrate material, viz. etched and unetched, to determine the influence of substrate surface topography on adhesion and accuracy of the printed tracks. The pull-off adhesion test method was used to quantify adhesive strength. The dependence of the pull-off test results on local geometry of the test area are illustrated with the aid of scanning electron microscope images and interferometer studies. Based on the outcomes of the experiments, conclusions concerning the suitable surface topography for inkjet printing have been arrived at.

  10. Warmed Winter Water Temperatures Alter Reproduction in Two Fish Species

    Science.gov (United States)

    Firkus, Tyler; Rahel, Frank J.; Bergman, Harold L.; Cherrington, Brian D.

    2018-02-01

    We examined the spawning success of Fathead Minnows ( Pimephales promelas) and Johnny Darters ( Etheostoma nigrum) exposed to elevated winter water temperatures typical of streams characterized by anthropogenic thermal inputs. When Fathead Minnows were exposed to temperature treatments of 12, 16, or 20 °C during the winter, spawning occurred at 16 and 20 °C but not 12 °C. Eggs were deposited over 9 weeks before winter spawning ceased. Fathead Minnows from the three winter temperature treatments were then exposed to a simulated spring transition. Spawning occurred at all three temperature treatments during the spring, but fish from the 16° and 20 °C treatment had delayed egg production indicating a latent effect of warm winter temperatures on spring spawning. mRNA analysis of the egg yolk protein vitellogenin showed elevated expression in female Fathead Minnows at 16 and 20 °C during winter spawning that decreased after winter spawning ceased, whereas Fathead Minnows at 12 °C maintained comparatively low expression during winter. Johnny Darters were exposed to 4 °C to represent winter temperatures in the absence of thermal inputs, and 12, 16, and 20 °C to represent varying degrees of winter thermal pollution. Johnny Darters spawned during winter at 12, 16, and 20 °C but not at 4 °C. Johnny Darters at 4 °C subsequently spawned following a simulated spring period while those at 12, 16, and 20 °C did not. Our results indicate elevated winter water temperatures common in effluent-dominated streams can promote out-of-season spawning and that vitellogenin expression is a useful indicator of spawning readiness for fish exposed to elevated winter temperatures.

  11. Embedding objects during 3D printing to add new functionalities.

    Science.gov (United States)

    Yuen, Po Ki

    2016-07-01

    A novel method for integrating and embedding objects to add new functionalities during 3D printing based on fused deposition modeling (FDM) (also known as fused filament fabrication or molten polymer deposition) is presented. Unlike typical 3D printing, FDM-based 3D printing could allow objects to be integrated and embedded during 3D printing and the FDM-based 3D printed devices do not typically require any post-processing and finishing. Thus, various fluidic devices with integrated glass cover slips or polystyrene films with and without an embedded porous membrane, and optical devices with embedded Corning(®) Fibrance™ Light-Diffusing Fiber were 3D printed to demonstrate the versatility of the FDM-based 3D printing and embedding method. Fluid perfusion flow experiments with a blue colored food dye solution were used to visually confirm fluid flow and/or fluid perfusion through the embedded porous membrane in the 3D printed fluidic devices. Similar to typical 3D printed devices, FDM-based 3D printed devices are translucent at best unless post-polishing is performed and optical transparency is highly desirable in any fluidic devices; integrated glass cover slips or polystyrene films would provide a perfect optical transparent window for observation and visualization. In addition, they also provide a compatible flat smooth surface for biological or biomolecular applications. The 3D printed fluidic devices with an embedded porous membrane are applicable to biological or chemical applications such as continuous perfusion cell culture or biocatalytic synthesis but without the need for any post-device assembly and finishing. The 3D printed devices with embedded Corning(®) Fibrance™ Light-Diffusing Fiber would have applications in display, illumination, or optical applications. Furthermore, the FDM-based 3D printing and embedding method could also be utilized to print casting molds with an integrated glass bottom for polydimethylsiloxane (PDMS) device replication

  12. Winter barley mutants created in the Ukraine

    International Nuclear Information System (INIS)

    Zayats, O.M.

    2001-01-01

    Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)

  13. Impacts of winter NPO on subsequent winter ENSO: sensitivity to the definition of NPO index

    Science.gov (United States)

    Chen, Shangfeng; Wu, Renguang

    2018-01-01

    This study investigates the linkage between boreal winter North Pacific Oscillation (NPO) and subsequent winter El Niño-Southern Oscillation (ENSO) based on seven different NPO indices. Results show that the influence of winter NPO on the subsequent winter El Niño is sensitive to how the NPO is defined. A significant NPO-El Niño connection is obtained when the NPO-related anomalous cyclone over the subtropical North Pacific extends to near-equatorial regions. The anomalous cyclone induces warm sea surface temperature (SST) anomalies through modulating surface heat fluxes. These warm SST anomalies are able to maintain into the following spring and summer through an air-sea coupled process and in turn induce significant westerly wind anomalies over the tropical western Pacific. In contrast, the NPO-El Niño relationship is unclear when the NPO-related anomalous cyclone over the subtropical North Pacific is confined to off-equatorial regions and cannot induce significant warm SST anomalies over the subtropical North Pacific. The present study suggests that definitions of NPO should be taken into account when using NPO to predict ENSO. In particular, we recommend defining the NPO index based on the empirical orthogonal function technique over appropriate region that does not extend too far north.

  14. DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing

    Directory of Open Access Journals (Sweden)

    Jackson Stuart

    2010-04-01

    Full Text Available Abstract Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value, and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.

  15. 3D Printing of Ball Grid Arrays

    Science.gov (United States)

    Sinha, Shayandev; Hines, Daniel; Dasgupta, Abhijit; Das, Siddhartha

    Ball grid arrays (BGA) are interconnects between an integrated circuit (IC) and a printed circuit board (PCB), that are used for surface mounting electronic components. Typically, lead free alloys are used to make solder balls which, after a reflow process, establish a mechanical and electrical connection between the IC and the PCB. High temperature processing is required for most of these alloys leading to thermal shock causing damage to ICs. For producing flexible circuits on a polymer substrate, there is a requirement for low temperature processing capabilities (around 150 C) and for reducing strain from mechanical stresses. Additive manufacturing techniques can provide an alternative methodology for fabricating BGAs as a direct replacement for standard solder bumped BGAs. We have developed aerosol jet (AJ) printing methods to fabricate a polymer bumped BGA. As a demonstration of the process developed, a daisy chain test chip was polymer bumped using an AJ printed ultra violet (UV) curable polymer ink that was then coated with an AJ printed silver nanoparticle laden ink as a conducting layer printed over the polymer bump. The structure for the balls were achieved by printing the polymer ink using a specific toolpath coupled with in-situ UV curing of the polymer which provided good control over the shape, resulting in well-formed spherical bumps on the order of 200 um wide by 200 um tall for this initial demonstration. A detailed discussion of the AJ printing method and results from accelerated life-time testing will be presented

  16. Excess mortality in winter in Finnish intensive care.

    Science.gov (United States)

    Reinikainen, M; Uusaro, A; Ruokonen, E; Niskanen, M

    2006-07-01

    In the general population, mortality from acute myocardial infarctions, strokes and respiratory causes is increased in winter. The winter climate in Finland is harsh. The aim of this study was to find out whether there are seasonal variations in mortality rates in Finnish intensive care units (ICUs). We analysed data on 31,040 patients treated in 18 Finnish ICUs. We measured severity of illness with acute physiology and chronic health evaluation II (APACHE II) scores and intensity of care with therapeutic intervention scoring system (TISS) scores. We assessed mortality rates in different months and seasons and used logistic regression analysis to test the independent effect of various seasons on hospital mortality. We defined 'winter' as the period from December to February, inclusive. The crude hospital mortality rate was 17.9% in winter and 16.4% in non-winter, P = 0.003. Even after adjustment for case mix, winter season was an independent risk factor for increased hospital mortality (adjusted odds ratio 1.13, 95% confidence interval 1.04-1.22, P = 0.005). In particular, the risk of respiratory failure was increased in winter. Crude hospital mortality was increased during the main holiday season in July. However, the severity of illness-adjusted risk of death was not higher in July than in other months. An increase in the mean daily TISS score was an independent predictor of increased hospital mortality. Severity of illness-adjusted hospital mortality for Finnish ICU patients is higher in winter than in other seasons.

  17. Printed products for digital cameras and mobile devices

    Science.gov (United States)

    Fageth, Reiner; Schmidt-Sacht, Wulf

    2005-01-01

    Digital photography is no longer simply a successor to film. The digital market is now driven by additional devices such as mobile phones with camera and video functions (camphones) as well as innovative products derived from digital files. A large number of consumers do not print their images and non-printing has become the major enemy of wholesale printers, home printing suppliers and retailers. This paper addresses the challenge facing our industry, namely how to encourage the consumer to print images easily and conveniently from all types of digital media.

  18. Confidentiality of 2D Code using Infrared with Cell-level Error Correction

    Directory of Open Access Journals (Sweden)

    Nobuyuki Teraura

    2013-03-01

    Full Text Available Optical information media printed on paper use printing materials to absorb visible light. There is a 2D code, which may be encrypted but also can possibly be copied. Hence, we envisage an information medium that cannot possibly be copied and thereby offers high security. At the surface, the normal 2D code is printed. The inner layers consist of 2D codes printed using a variety of materials, which absorb certain distinct wavelengths, to form a multilayered 2D code. Information can be distributed among the 2D codes forming the inner layers of the multiplex. Additionally, error correction at cell level can be introduced.

  19. Essential Outdoor Sun Safety Tips for Winter

    Science.gov (United States)

    ... Weekend Warriors expand/collapse Vitamin D Essential Outdoor Sun Safety Tips for Winter Winter sports enthusiasts are ... skiing! Be Mindful of Time Spent in the Sun, Regardless of the Season If possible, ski early ...

  20. A wearable tracking device inkjet-printed on textile

    KAUST Repository

    Krykpayev, Bauyrzhan

    2017-05-20

    Despite the abundance of localization applications, the tracking devices have never been truly realized in E-textiles. Standard printed circuit board (PCB)-based devices are obtrusive and rigid and hence not suitable for textile based implementations. An attractive option would be direct printing of circuit layout on the textile itself, negating the use of rigid PCB materials. However, high surface roughness and porosity of textiles prevents efficient and reliable printing of electronics on textile. In this work, by printing an interface layer on the textile first, a complete localization circuit integrated with an antenna has been inkjet-printed on the textile for the first time. Printed conductive traces were optimized in terms of conductivity and resolution by controlling the number of over-printed layers. The tracking device determines the wearer\\'s position using WiFi and this information can be displayed on any internet-enabled device, such as smart phone. The device is compact (55mm×45mm) and lightweight (22g with 500mAh battery) for people to comfortably wear it and can be easily concealed in case discretion is required. The device operates at 2.4GHz communicated up to a distance of 55m, with localization accuracy of up to 8m.

  1. Digital multicolor printing: state of the art and future challenges

    Science.gov (United States)

    Kipphan, Helmut

    1995-04-01

    During the last 5 years, digital techniques have become extremely important in the graphic arts industry. All sections in the production flow for producing multicolor printed products - prepress, printing and postpress - are influenced by digitalization, in an evolutionary and revolutionary way. New equipment and network techniques bring all the sections closer together. The focus is put on high-quality multicolor printing, together with high productivity. Conventional offset printing technology is compared with the leading nonimpact printing technologies. Computer to press is contrasted with computer to print techniques. The newest available digital multicolor presses are described - the direct imaging offset printing press from HEIDELBERG with new laser imaging technique as well as the INDIGO and XEIKON presses based on electrophotography. Regarding technical specifications, economic calculations and print quality, it is worked out that each technique has its own market segments. An outlook is given for future computer to press techniques and the potential of nonimpact printing technologies for advanced high-speed multicolor computer to print equipment. Synergy effects from the NIP-technologies to the conventional printing technologies and vice versa are possible for building up innovative new products, for example hybrid printing systems. It is also shown that there is potential for improving the print quality, based on special screening algorithms, and a higher number of grey levels per pixel by using NIP-technologies. As an intermediate step in digitalization of the production flow, but also as an economical solution computer to plate equipment is described. By producing printed products totally in a digital way, digital color proofing as well as color management systems are needed. The newest high-tech equipment using NIP-technologies for producing proofs is explained. All in all it is shown that the state of the art in digital multicolor printing has reached

  2. Printing Processes Used to Manufacture Photovoltaic Solar Cells

    Science.gov (United States)

    Rardin, Tina E.; Xu, Renmei

    2011-01-01

    There is a growing need for renewable energy sources, and solar power is a good option in many instances. Photovoltaic solar panels are now being manufactured via various methods, and different printing processes are being incorporated into the manufacturing process. Screen printing has been used most prevalently in the printing process to make…

  3. Copy number variations in Saudi family with intellectual disability and epilepsy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Naseer

    2016-10-01

    Full Text Available Abstract Background Epilepsy is genetically complex but common brain disorder of the world affecting millions of people with almost of all age groups. Novel Copy number variations (CNVs are considered as important reason for the numerous neurodevelopmental disorders along with intellectual disability and epilepsy. DNA array based studies contribute to explain a more severe clinical presentation of the disease but interoperation of many detected CNVs are still challenging. Results In order to study novel CNVs with epilepsy related genes in Saudi family with six affected and two normal individuals with several forms of epileptic seizures, intellectual disability (ID, and minor dysmorphism, we performed the high density whole genome Agilent sure print G3 Hmn CGH 2x 400 K array-CGH chips analysis. Our results showed de novo deletions, duplications and deletion plus duplication on differential chromosomal regions in the affected individuals that were not shown in the normal fathe and normal kids by using Agilent CytoGenomics 3.0.6.6 softwear. Copy number gain were observed in the chromosome 1, 16 and 22 with LCE3C, HPR, GSTT2, GSTTP2, DDT and DDTL genes respectively whereas the deletions observed in the chromosomal regions 8p23-p21 (4303127–4337759 and the potential gene in this region is CSMD1 (OMIM: 612279. Moreover, the array CGH results deletions and duplication were also validated by using primer design of deleted regions utilizing the flanked SNPs using simple PCR and also by using quantitative real time PCR. Conclusions We found some of the de novo deletions and duplication in our study in Saudi family with intellectual disability and epilepsy. Our results suggest that array-CGH should be used as a first line of genetic test for epilepsy except there is a strong indication for a monogenic syndrome. The advanced high through put array-CGH technique used in this study aim to collect the data base and to identify new mechanisms describing

  4. 3D printing of functional structures

    NARCIS (Netherlands)

    Krijnen, Gijsbertus J.M.

    The technology colloquial known as ‘3D printing’ has developed in such diversity in printing technologies and application fields that meanwhile it seems anything is possible. However, clearly the ideal 3D Printer, with high resolution, multi-material capability, fast printing, etc. is yet to be

  5. Powder-based 3D printing application for geomechanical testing

    Science.gov (United States)

    Williams, M.; Yoon, H.; Choens, R. C., II; Martinez, M. J.; Dewers, T. A.; Lee, M.

    2017-12-01

    3D printing of fractured and porous analog geomaterials has the potential to enhance hydrogeological and mechanical interpretations by generating engineered samples in testable configurations with reproducible microstructures and tunable surface and mechanical properties. For geoscience applications, 3D printing technology can be co-opted to print reproducible structures derived from CT-imaging of actual rocks and theoretical algorithms. In particular, the use of 3D printed samples allows us to overcome sample-to-sample heterogeneity that plague rock physics testing and to test material response independent from material variability. In this work, gypsum powder-based 3D printing was used to print cylindrical core samples and block samples with a pre-existing flaw geometry. All samples are printed in three different directions to evaluate the impact of printing direction on mechanical properties. For the cylindrical samples, unconfined compression testing has been performed. For compressive strength, the samples printed perpendicular to the loading direction show stronger than those printed parallel to the loading and at 45 degree. Micro-CT images of the printed samples reveal the uneven spreading of binder, resulting in soft inner core surrounded by stronger outer shell. In particular, the layered feature with binder causes the strong anisotropic properties. This was also confirmed by the wave velocity. For the small block samples ( 6.1cm wide, 10cm high, and 1.25cm thick) with an inclined flaw, uniaxial tests coupled with an array of acoustic emission sensors and digital image correlation revealed that cracks were developed at/near the tip of flaw as expected. Although acoustic events were detected, localization was not detectable mainly due to strong attenuation. Advantage and disadvantage of power-based 3D printing for mechanical testing will be discussed and a few attempts will be presented to improve the applicability of powder-based printing technique. Sandia

  6. ABS 3D printed solutions for cryogenic applications

    Science.gov (United States)

    Bartolomé, E.; Bozzo, B.; Sevilla, P.; Martínez-Pasarell, O.; Puig, T.; Granados, X.

    2017-03-01

    3D printing has become a common, inexpensive and rapid prototyping technique, enabling the ad hoc fabrication of complex shapes. In this paper, we demonstrate that 3D printed objects in ABS can be used at cryogenic temperatures, offering flexible solutions in different fields. Firstly, a thermo-mechanical characterization of ABS 3D printed specimens at 77 K is reported, which allowed us to delimit the type of cryogenic uses where 3D printed pieces may be implemented. Secondly, we present three different examples where ABS 3D printed objects working at low temperatures have provided specific solutions: (i) SQUID inserts for angular magnetometry (low temperature material characterization field); (ii) a cage support for a metamaterial ;magnetic concentrator; (superconductivity application), and (iii) dedicated tools for cryopreservation in assisted reproductive techniques (medicine field).

  7. A fully printed ferrite nano-particle ink based tunable antenna

    KAUST Repository

    Ghaffar, Farhan A.

    2016-11-02

    Inkjet printing or printing in general has emerged as a very attractive method for the fabrication of low cost and large size electronic systems. However, most of the printed designs rely on nano-particle based metallic inks which are printed on conventional microwave substrates. In order to have a fully printed fabrication process, the substrate also need to be printed. In this paper, a fully printed multi-layer process utilizing custom Fe2O3 based magnetic ink and a silver organic complex (SOC) ink is demonstrated for tunable antennas applications. The ink has been characterized for high frequency and magnetostatic properties. Finally as a proof of concept, a microstrip patch antenna is realized using the proposed fabrication technique which shows a tuning range of 12.5 %.

  8. Nanoparticle composites for printed electronics

    International Nuclear Information System (INIS)

    Männl, U; Van den Berg, C; Magunje, B; Härting, M; Britton, D T; Jones, S; Van Staden, M J; Scriba, M R

    2014-01-01

    Printed Electronics is a rapidly developing sector in the electronics industry, in which nanostructured materials are playing an increasingly important role. In particular, inks containing dispersions of semiconducting nanoparticles, can form nanocomposite materials with unique electronic properties when cured. In this study we have extended on our previous studies of functional nanoparticle electronic inks, with the development of a solvent-based silicon ink for printed electronics which is compatible with existing silver inks, and with the investigation of other metal nanoparticle based inks. It is shown that both solvent-based and water-based inks can be used for both silver conductors and semiconducting silicon, and that qualitatively there is no difference in the electronic properties of the materials printed with a soluble polymer binder to when an acrylic binder is used. (paper)

  9. 3D-printed patient-specific applications in orthopedics

    Directory of Open Access Journals (Sweden)

    Wong KC

    2016-10-01

    Full Text Available Kwok Chuen Wong Department of Orthopedics and Traumatology, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, Hong Kong Abstract: With advances in both medical imaging and computer programming, two-dimensional axial images can be processed into other reformatted views (sagittal and coronal and three-dimensional (3D virtual models that represent a patients’ own anatomy. This processed digital information can be analyzed in detail by orthopedic surgeons to perform patient-specific orthopedic procedures. The use of 3D printing is rising and has become more prevalent in medical applications over the last decade as surgeons and researchers are increasingly utilizing the technology’s flexibility in manufacturing objects. 3D printing is a type of manufacturing process in which materials such as plastic or metal are deposited in layers to create a 3D object from a digital model. This additive manufacturing method has the advantage of fabricating objects with complex freeform geometry, which is impossible using traditional subtractive manufacturing methods. Specifically in surgical applications, the 3D printing techniques can not only generate models that give a better understanding of the complex anatomy and pathology of the patients and aid in education and surgical training, but can also produce patient-specific surgical guides or even custom implants that are tailor-made to the surgical requirements. As the clinical workflow of the 3D printing technology continues to evolve, orthopedic surgeons should embrace the latest knowledge of the technology and incorporate it into their clinical practice for patient-specific orthopedic applications. This paper is written to help orthopedic surgeons stay up-to-date on the emerging 3D technology, starting from the acquisition of clinical imaging to 3D printing for patient-specific applications in orthopedics. It 1 presents the necessary steps to prepare the medical images that are

  10. Printed MIMO antenna engineering

    CERN Document Server

    Sharawi, Mohammad S

    2014-01-01

    Wireless communications has made a huge leap during the past two decades. The multiple-input-multiple-output (MIMO) technology was proposed in the 1990's as a viable solution that can overcome the data rate limit experienced by single-input-single-output (SISO) systems. This resource is focused on printed MIMO antenna system design. Printed antennas are widely used in mobile and handheld terminals due to their conformity with the device, low cost, good integration within the device elements and mechanical parts, as well as ease of fabrication.A perfect design companion for practicing engineers

  11. Primer printed circuit boards

    CERN Document Server

    Argyle, Andrew

    2009-01-01

    Step-by-step instructions for making your own PCBs at home. Making your own printed circuit board (PCB) might seem a daunting task, but once you master the steps, it's easy to attain professional-looking results. Printed circuit boards, which connect chips and other components, are what make almost all modern electronic devices possible. PCBs are made from sheets of fiberglass clad with copper, usually in multiplelayers. Cut a computer motherboard in two, for instance, and you'll often see five or more differently patterned layers. Making boards at home is relatively easy

  12. Winter Season Mortality: Will Climate Warming Bring Benefits?

    Science.gov (United States)

    Kinney, Patrick L; Schwartz, Joel; Pascal, Mathilde; Petkova, Elisaveta; Tertre, Alain Le; Medina, Sylvia; Vautard, Robert

    2015-06-01

    Extreme heat events are associated with spikes in mortality, yet death rates are on average highest during the coldest months of the year. Under the assumption that most winter excess mortality is due to cold temperature, many previous studies have concluded that winter mortality will substantially decline in a warming climate. We analyzed whether and to what extent cold temperatures are associated with excess winter mortality across multiple cities and over multiple years within individual cities, using daily temperature and mortality data from 36 US cities (1985-2006) and 3 French cities (1971-2007). Comparing across cities, we found that excess winter mortality did not depend on seasonal temperature range, and was no lower in warmer vs. colder cities, suggesting that temperature is not a key driver of winter excess mortality. Using regression models within monthly strata, we found that variability in daily mortality within cities was not strongly influenced by winter temperature. Finally we found that inadequate control for seasonality in analyses of the effects of cold temperatures led to spuriously large assumed cold effects, and erroneous attribution of winter mortality to cold temperatures. Our findings suggest that reductions in cold-related mortality under warming climate may be much smaller than some have assumed. This should be of interest to researchers and policy makers concerned with projecting future health effects of climate change and developing relevant adaptation strategies.

  13. Warmed Winter Water Temperatures Alter Reproduction in Two Fish Species.

    Science.gov (United States)

    Firkus, Tyler; Rahel, Frank J; Bergman, Harold L; Cherrington, Brian D

    2018-02-01

    We examined the spawning success of Fathead Minnows (Pimephales promelas) and Johnny Darters (Etheostoma nigrum) exposed to elevated winter water temperatures typical of streams characterized by anthropogenic thermal inputs. When Fathead Minnows were exposed to temperature treatments of 12, 16, or 20 °C during the winter, spawning occurred at 16 and 20 °C but not 12 °C. Eggs were deposited over 9 weeks before winter spawning ceased. Fathead Minnows from the three winter temperature treatments were then exposed to a simulated spring transition. Spawning occurred at all three temperature treatments during the spring, but fish from the 16° and 20 °C treatment had delayed egg production indicating a latent effect of warm winter temperatures on spring spawning. mRNA analysis of the egg yolk protein vitellogenin showed elevated expression in female Fathead Minnows at 16 and 20 °C during winter spawning that decreased after winter spawning ceased, whereas Fathead Minnows at 12 °C maintained comparatively low expression during winter. Johnny Darters were exposed to 4 °C to represent winter temperatures in the absence of thermal inputs, and 12, 16, and 20 °C to represent varying degrees of winter thermal pollution. Johnny Darters spawned during winter at 12, 16, and 20 °C but not at 4 °C. Johnny Darters at 4 °C subsequently spawned following a simulated spring period while those at 12, 16, and 20 °C did not. Our results indicate elevated winter water temperatures common in effluent-dominated streams can promote out-of-season spawning and that vitellogenin expression is a useful indicator of spawning readiness for fish exposed to elevated winter temperatures.

  14. Realization of superconductive films by screen printing

    International Nuclear Information System (INIS)

    Baudry, H.

    1988-01-01

    Screen printing is a promising method to manufacture superconductive lines making use of superconductive ceramics. An ink has been realized with YBa 2 Cu 3 0 7-x' and the process conditions defined by thermal analysis. A superconductive transition is observed after screen printing on MgO. The firing of the layer is made at 920 0 C followed by a reoxidation step at 420 0 C. The silver electrical contacts are also screen printed [fr

  15. Winter Wonderlands

    Science.gov (United States)

    Coy, Mary

    2011-01-01

    Listening to people complain about the hardships of winter and the dreariness of the nearly constant gray sky prompted the author to help her sixth graders recognize and appreciate the beauty that surrounds them for nearly five months of the year in western New York. The author opines that if students could see things more artistically, the winter…

  16. Intrinsic defects in 3D printed materials

    OpenAIRE

    Bolton, Christopher; Dagastine, Raymond

    2015-01-01

    We discuss the impact of bulk structural defects on the coherence, phase and polarisation of light passing through transparent 3D printed materials fabricated using a variety of commercial print technologies.

  17. Inkjet Printed Radio Frequency Passive Components

    KAUST Repository

    McKerricher, Garret

    2015-01-01

    -resonant frequencies around 1GHz. These fully printed devices have quality factors less than 10. Finally, 3D inkjet-printed UV-cured material is utilized with a novel silver organo-complex ink at 80oC providing conductivity of 1x107 S/m. A lumped element filter

  18. A Framework for 3d Printing

    DEFF Research Database (Denmark)

    Pilkington, Alan; Frandsen, Thomas; Kapetaniou, Chrystalla

    3D printing technologies and processes offer such a radical range of options for firms that we currently lack a structured way of recording possible impact and recommending actions for managers. The changes arising from 3d printing includes more than just new options for product design, but also...

  19. Incidental copy-number variants identified by routine genome testing in a clinical population

    Science.gov (United States)

    Boone, Philip M.; Soens, Zachry T.; Campbell, Ian M.; Stankiewicz, Pawel; Cheung, Sau Wai; Patel, Ankita; Beaudet, Arthur L.; Plon, Sharon E.; Shaw, Chad A.; McGuire, Amy L.; Lupski, James R.

    2013-01-01

    Purpose Mutational load of susceptibility variants has not been studied on a genomic scale in a clinical population, nor has the potential to identify these mutations as incidental findings during clinical testing been systematically ascertained. Methods Array comparative genomic hybridization, a method for genome-wide detection of DNA copy-number variants, was performed clinically on DNA from 9,005 individuals. Copy-number variants encompassing or disrupting single genes were identified and analyzed for their potential to confer predisposition to dominant, adult-onset disease. Multigene copy-number variants affecting dominant, adult-onset cancer syndrome genes were also assessed. Results In our cohort, 83 single-gene copy-number variants affected 40 unique genes associated with dominant, adult-onset disorders and unrelated to the patients’ referring diagnoses (i.e., incidental) were found. Fourteen of these copy-number variants are likely disease-predisposing, 25 are likely benign, and 44 are of unknown clinical consequence. When incidental copy-number variants spanning up to 20 genes were considered, 27 copy-number variants affected 17 unique genes associated with dominant, adult-onset cancer predisposition. Conclusion Copy-number variants potentially conferring susceptibility to adult-onset disease can be identified as incidental findings during routine genome-wide testing. Some of these mutations may be medically actionable, enabling disease surveillance or prevention; however, most incidentally observed single-gene copy-number variants are currently of unclear significance to the patient. PMID:22878507

  20. The double copy: gravity from gluons

    Science.gov (United States)

    White, C. D.

    2018-04-01

    Three of the four fundamental forces in nature are described by so-called gauge theories, which include the effects of both relativity and quantum mechanics. Gravity, on the other hand, is described by General Relativity, and the lack of a well-behaved quantum theory - believed to be relevant at the centre of black holes, and at the Big Bang itself - remains a notorious unsolved problem. Recently a new correspondence, the double copy, has been discovered between scattering amplitudes (quantities related to the probability for particles to interact) in gravity, and their gauge theory counterparts. This has subsequently been extended to other quantities, providing gauge theory analogues of e.g. black holes. We here review current research on the double copy, and describe some possible applications.