International Nuclear Information System (INIS)
Oldendorf, W.; Oldendorf, W. Jr.
1991-01-01
Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Defense Primer: DOD Contractors
2017-02-10
functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Majid, Shahn
2002-05-01
Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.
Ekstrom, Claus Thorn
2011-01-01
Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i
Directory of Open Access Journals (Sweden)
David L Nordstrom
2012-06-01
Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.
Cryer, CW
2014-01-01
Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula
El primer virreinato americano
Directory of Open Access Journals (Sweden)
Cassá, Roberto
2006-12-01
Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the
logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.
El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.
Leopold, Luna Bergere; Langbein, Walter Basil
1960-01-01
When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to
Promotion primer. Foerderfibel
Energy Technology Data Exchange (ETDEWEB)
1981-01-01
This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.
Liu, Xiaojing; Locasale, Jason W
2017-04-01
Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Beauchaine, Theodore P.
2009-01-01
Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222
International Nuclear Information System (INIS)
Aigner, R.; Melzer, E.; Seissler, H.
1986-01-01
This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de
Freshwater Wetlands: A Citizen's Primer.
Catskill Center for Conservation and Development, Inc., Hobart, NY.
The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
Leonhardt, U.
2001-01-01
Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
A primer of multivariate statistics
Harris, Richard J
2014-01-01
Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
A primer on pseudorandom generators
Goldreich, Oded
2010-01-01
A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...
A Primer on Observational Measurement.
Girard, Jeffrey M; Cohn, Jeffrey F
2016-08-01
Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.
Barenghi, Carlo
2016-01-01
The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN
Directory of Open Access Journals (Sweden)
Yuli Kurniawati
2015-05-01
Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well
Meadows, Donella H
2008-01-01
In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
A practical primer on geostatistics
Olea, Ricardo A.
2009-01-01
has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
Menopause 101: A Primer for the Perimenopausal
... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Canadian municipal carbon trading primer
International Nuclear Information System (INIS)
Seskus, A.
2002-01-01
The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
A primer on motor vehicle air pollution.
1973-01-01
This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...
A Primer on Basic Effect Size Concepts.
Elmore, Patricia B.; Rotou, Ourania
The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…
Scrimer: designing primers from transcriptome data
Czech Academy of Sciences Publication Activity Database
Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.
2015-01-01
Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015
Forest Interpreter's Primer on Fire Management.
Zelker, Thomas M.
Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Bayesian models a statistical primer for ecologists
Hobbs, N Thompson
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili
Signals and systems primer with Matlab
Poularikas, Alexander D
2006-01-01
Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Primer on CDM programme of activities
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)
2009-07-01
As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)
Bayesian models: A statistical primer for ecologists
Hobbs, N. Thompson; Hooten, Mevin B.
2015-01-01
Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup
This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.
Great Lakes rivermouths: a primer for managers
Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul
2013-01-01
Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described
Complex and adaptive dynamical systems a primer
Gros, Claudius
2015-01-01
This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...
Complex and adaptive dynamical systems a primer
Gros, Claudius
2007-01-01
We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...
Complex and Adaptive Dynamical Systems A Primer
Gros, Claudius
2011-01-01
We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...
Complex and adaptive dynamical systems a primer
Gros, Claudius
2013-01-01
Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...
MCNPTM criticality primer and training experiences
International Nuclear Information System (INIS)
Briesmeister, J.; Forster, R.A.; Busch, R.
1995-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP
Primer for criticality calculations with DANTSYS
International Nuclear Information System (INIS)
Busch, R.D.
1996-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses
The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.
Zellweger, Polle T.; Mackinlay, Jock D.
A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Relativistic Astrophysics and Cosmology: A Primer
International Nuclear Information System (INIS)
Abramowicz, Marek A
2007-01-01
'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Primer on electricity futures and other derivatives
Energy Technology Data Exchange (ETDEWEB)
Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.
1998-01-01
Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.
A primer on systematic reviews in toxicology.
Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya
2017-07-01
Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.
Primer on electricity futures and other derivatives
International Nuclear Information System (INIS)
Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.
1998-01-01
Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Designing for transportation management and operations : a primer.
2013-02-01
This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo
Castillo Canales, Braulio
2017-01-01
En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
Lucas, D.S.
2004-10-03
This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.
Primers As Socializing Agents in American and Finnish Schools.
Hyona, Jukka; And Others
1995-01-01
Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Development of specific primers for genus Fusarium and F. solani ...
African Journals Online (AJOL)
Yomi
2012-01-05
Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.
Development of a microsatellite primer set to investigate the genetic ...
Indian Academy of Sciences (India)
Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.
Blood Donation and Transfusion: A Primer for Health Educators.
Felts, W. Michael; Glascoff, Mary A.
1991-01-01
Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)
A Primer on Concepts and Applications of Proteomics in Neuroscience
DEFF Research Database (Denmark)
Hosp, Fabian; Mann, Matthias
2017-01-01
The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...
Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.
Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe
2018-01-17
In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.
Note: Primer Amysat 001; Fragment size is 211bp
Indian Academy of Sciences (India)
Renuka
Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.
Characteristics of the population employed in primer sector in Turkey
Directory of Open Access Journals (Sweden)
Bayar Rüya
2006-01-01
Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.
Controlling Air Pollution; A Primer on Stationary Source Control Techniques.
Corman, Rena
This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-09-27
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson
1998-12-10
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL
International Nuclear Information System (INIS)
Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.
2000-01-01
This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums
Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis
Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli
2015-01-01
Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...
A primer on the mortgage market and mortgage finance
Daniel J. McDonald; Daniel L. Thornton
2008-01-01
This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.
Primer on molecular genetics. DOE Human Genome Program
Energy Technology Data Exchange (ETDEWEB)
1992-04-01
This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.
Transient Heat Transfer Model for Car Body Primer Curing
D. Zabala; N. Sánchez; J. Pinto
2010-01-01
A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...
Small Commercial Building Re-tuning: A Primer
Energy Technology Data Exchange (ETDEWEB)
Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas
2013-09-30
To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Sensory reception of the primer pheromone ethyl oleate
Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang
2012-05-01
Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.
Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer
Energy Technology Data Exchange (ETDEWEB)
D. S. Lucas
2004-10-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
Energy Technology Data Exchange (ETDEWEB)
Bulgakov, R.T.; Gazizov, A.Sh.; Gabdullin, R.G.; Yusupov, I.G.
1976-01-01
The problems of limiting the influx of water into oil wells are examined. On the basis of studies, systemization, and generalization of the reasons for the premature flooding of wells, the improvement of strata by polymer-cement solutions with consolidating liquid phases is considered. A detailed description is given of the technology and results of cementing well using solutions based on plugging cement and water-soluble phenol-formaldehyde resins of the TSD-9 type. Results are reported on the study of the properties of selective water-insulating substances based on acrylamide monomers and hydrolyzed polyacrylonitriles. Industrial testing of these materials is generalized. An economic evaluation is made of the efficiency of measures undertaken to prevent water influx into oil wells.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Plan de negocio de una escuela infantil (primer ciclo)
San Román Gómez, Ana de
2014-01-01
El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...
A primer on physical-layer network coding
Liew, Soung Chang; Zhang, Shengli
2015-01-01
The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader
Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders
Energy Technology Data Exchange (ETDEWEB)
Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.
2004-02-10
This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
A finite element primer for beginners the basics
Zohdi, Tarek I
2014-01-01
The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th
Discrete random signal processing and filtering primer with Matlab
Poularikas, Alexander D
2013-01-01
Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe
Accelerating MATLAB with GPU computing a primer with examples
Suh, Jung W
2013-01-01
Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for
Automated guided vehicle systems a primer with practical applications
Ullrich, Günter
2015-01-01
This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.
Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition
Barrett, Steven F
2012-01-01
This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega
Adhesion of epoxy primer to hydrotalcite conversion coated AA2024
Leggat, Robert Benton, III
Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR
Transport phenomena in Newtonian fluids a concise primer
Olsson, Per
2013-01-01
This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum. The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid. Also provided at
Primer: Fracture mechanics in the nuclear power industry
International Nuclear Information System (INIS)
Wessel, E.T.; Server, W.L.; Kennedy, E.L.
1990-01-01
This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping
De neurocirujano a primer ministro de Salud de la Argentina
Directory of Open Access Journals (Sweden)
Karina Inés Ramacciotti
2008-01-01
Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.
FullSSR: Microsatellite Finder and Primer Designer
Directory of Open Access Journals (Sweden)
Sebastián Metz
2016-01-01
Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.
Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification
Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo
2012-01-01
Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397
Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae
Directory of Open Access Journals (Sweden)
Warren B. Chatwin
2014-10-01
Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers
Danford, M. D.; Mendrek, M. J.; Walsh, D. W.
1995-01-01
The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
Primer Vector Optimization: Survey of Theory, new Analysis and Applications
Guzman
This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and
Primer and interviews: The dynamic stem cell niche.
Kiefer, Julie C
2011-03-01
A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.
Demystifying eResearch a primer for librarians
Martin, Victoria
2014-01-01
Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...
Primer Part 1-The building blocks of epilepsy genetics.
Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C
2016-06-01
This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.
ITS primers for the identification of marketable Boletus.
Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola
2006-02-10
Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.
A matter of degrees: A primer on global warming
International Nuclear Information System (INIS)
1993-01-01
A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs
A health and safety primer for the practicing health physicist
International Nuclear Information System (INIS)
Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.
1996-01-01
Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Sediment transport primer: estimating bed-material transport in gravel-bed rivers
Peter Wilcock; John Pitlick; Yantao Cui
2009-01-01
This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...
Móvil remisión de V. cinta del primer móvil.
2011-01-01
[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.
The Universal Primer - An open source solution for archiving, organizing and streaming live lectures
DEFF Research Database (Denmark)
Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej
2011-01-01
. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics
DEFF Research Database (Denmark)
Busk, Peter Kamp
2014-01-01
of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
A Primer on Alberta’s Oil sands Royalties
Directory of Open Access Journals (Sweden)
Sarah Dobson
2015-12-01
Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Collider physics within the standard model a primer
Altarelli, Guido
2017-01-01
With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...
Neurociencia y bilingüismo: efecto del primer idioma
Directory of Open Access Journals (Sweden)
Germary Díaz-Sánchez
2013-08-01
Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.
Esteatosis en un burro (Equus asinus. Primer reporte en Colombia
Directory of Open Access Journals (Sweden)
José Cardona Á.
2011-12-01
Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.
Primer reporte de alcaptonuria en el Perú
Directory of Open Access Journals (Sweden)
Daniel Guillén-Mendoza
Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.
Genetic analysis of presbycusis by arrayed primer extension.
Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris
2008-01-01
Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.
The corrosion mechanisms for primer coated 2219-T87 aluminum
Danford, Merlin D.; Knockemus, Ward W.
1987-01-01
To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus
2005-01-01
A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....
Profitability primer: a guide to profitability analysis in the electric power industry
International Nuclear Information System (INIS)
Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.
1996-06-01
As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated
THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY
Directory of Open Access Journals (Sweden)
Prima Ditahardiyani
2008-01-01
Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.
Molecular passportization of clones of karelian birch using PCRwith semi-specific primers
Directory of Open Access Journals (Sweden)
Tatyana V Matveeva
2008-09-01
Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets
Energy Technology Data Exchange (ETDEWEB)
Warwick, William M.
2002-06-03
This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.
DEFF Research Database (Denmark)
Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine
2015-01-01
) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
Binary electrokinetic separation of target DNA from background DNA primers.
Energy Technology Data Exchange (ETDEWEB)
James, Conrad D.; Derzon, Mark Steven
2005-10-01
This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.
A primer for trading greenhouse gas reductions from landfills
International Nuclear Information System (INIS)
2000-06-01
This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which
Pharmacological chaperoning: a primer on mechanism and pharmacology.
Leidenheimer, Nancy J; Ryder, Katelyn G
2014-05-01
Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast
El menor infractor que comete su primer delito
Directory of Open Access Journals (Sweden)
Antonia Luzón García
2014-10-01
Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social
Making the connection: advancing traffic incident management in transportation planning : a primer.
2013-07-01
"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...
Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.
Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J
2015-07-28
Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018
2018-01-18
This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...
Routes to effective evacuation planning primer series : evacuating populations with special needs.
2009-04-01
Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...
2016-03-01
This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
Ares, Janus, Globalization: A Primer For The Military Leader in NATO
National Research Council Canada - National Science Library
Clemons, Dean
2002-01-01
...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...
Incorporating travel-time reliability into the congestion management process : a primer.
2015-02-01
This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...
The UVM primer a step-by-step introduction to the universal verification methodology
Salemi, Ray
2013-01-01
The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft
2011-08-17
system Significant hexavalent chrome reduction in finish system Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)
2015-04-01
A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.
Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong
2015-01-01
Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
The sorption of iodine by an inorganic zinc primer
Energy Technology Data Exchange (ETDEWEB)
Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry
1996-12-01
The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.
Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer
Directory of Open Access Journals (Sweden)
Ratna Sitompul
2017-04-01
Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus. Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Directory of Open Access Journals (Sweden)
Christopher Ryan Penton
2013-09-01
Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis
Directory of Open Access Journals (Sweden)
Kartika Maharani
2015-12-01
Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi. Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings
Energy Technology Data Exchange (ETDEWEB)
Lech, L.M. [DuPont, Parkersburg, WV (United States)
1999-11-01
Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.
D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto
2018-02-01
Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
The effect of various primers on shear bond strength of zirconia ceramic and resin composite.
Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat
2013-11-01
To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Summary of the primer on tumor immunology and the biological therapy of cancer
Directory of Open Access Journals (Sweden)
Margolin Kim
2009-01-01
Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Temas de Física para Ingeniería: Primer principio de la termodinámica
Beléndez Vázquez, Augusto
1992-01-01
Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.
Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers
DEFF Research Database (Denmark)
Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.
2011-01-01
BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.
Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J
2010-03-01
Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
GST-PRIME: an algorithm for genome-wide primer design.
Leister, Dario; Varotto, Claudio
2007-01-01
The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.
DEFF Research Database (Denmark)
Hansen, A C; Grunwald, T; Lund, Anders Henrik
2001-01-01
could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Directory of Open Access Journals (Sweden)
Diana Sari
2015-05-01
Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Gold nanoparticle-assisted primer walking for closing the human chromosomal gap
DEFF Research Database (Denmark)
Li, H; Shi, B; Li, X
2013-01-01
The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema
Johnston, Nessa
2012-01-01
Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...
Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben
2004-01-01
Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation
DEFF Research Database (Denmark)
Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa
2014-01-01
Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. Methods and Results: Microsatellite loci were enriched...
RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.
1990-01-01
We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer
Directory of Open Access Journals (Sweden)
S Hamid Raji
2011-01-01
Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.
Hemorragias obstétricas en el primer y segundo trimestre del embarazo
García Rodríguez, Blanca
2013-01-01
Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico
Evaluation of genetic diversity in open pollinated guava by iPBS primers
International Nuclear Information System (INIS)
Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.
2013-01-01
DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)
Development of specific primers for the detection of HVA1 from ...
African Journals Online (AJOL)
aghomotsegin
2014-01-22
Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...
A primer on polymer nomenclature: Structure-based, sourced-based and trade names
Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...
A new set of validated SSR primers for application in mulberry ...
Indian Academy of Sciences (India)
user
2018-01-11
Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.
Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.
Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce
2009-01-01
Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú
Directory of Open Access Journals (Sweden)
Luis A. Gomez-Puerta
2014-05-01
Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.
Towards a global antibiotic resistance surveillance system : a primer for a roadmap
Grundmann, Hajo
The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future
Targeted reduction of highly abundant transcripts using pseudo-random primers.
Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles
2016-04-01
Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
What Are the Odds of that? A Primer on Understanding Logistic Regression
Huang, Francis L.; Moon, Tonya R.
2013-01-01
The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Primer on theory and operation of linear accelerators in radiation therapy
International Nuclear Information System (INIS)
Karzmark, C.J.; Morton, R.J.
1981-12-01
This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Directory of Open Access Journals (Sweden)
Esther Lantero
2017-07-01
Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control
The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers
Oude Essink, B. B.; Berkhout, B.
1999-01-01
Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by
Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools
Directory of Open Access Journals (Sweden)
Melissa Agsalda
2009-01-01
Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.
Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys
Directory of Open Access Journals (Sweden)
Michael D. Blanton
2012-09-01
Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.
Optimisation of the PCR-invA primers for the detection of Salmonella ...
African Journals Online (AJOL)
A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.
Energy Technology Data Exchange (ETDEWEB)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-07-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.
2006-01-01
Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...
International Nuclear Information System (INIS)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-01-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW
1998-01-01
Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest
The astrobiology primer: an outline of general knowledge--version 1, 2006.
Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S
2006-10-01
The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Directory of Open Access Journals (Sweden)
Pérez-Rey David
2010-08-01
Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.
In vivo effect of a self-etching primer on dentin.
Milia, E; Lallai, M R; García-Godoy, F
1999-08-01
To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.
Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong
2008-09-01
We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.
Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics
Directory of Open Access Journals (Sweden)
Stephen Larson
2014-03-01
Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review
Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method
International Nuclear Information System (INIS)
Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.
1996-05-01
The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual
PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA
BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO
2004-01-01
Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.
Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers
Czech Academy of Sciences Publication Activity Database
Kotík, Michael; Faměrová, Veronika
2012-01-01
Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012
PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.
Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh
2013-01-01
Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/
Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.
Energy Technology Data Exchange (ETDEWEB)
Lestelle, Lawrence C.; Mobrand, Lars E.
1996-05-01
The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.
Demonstration Of A Nanomaterial-Modified Primer For Use In Corrosion-Inhibiting Coating Systems
2011-11-01
resin packages/binders, can cause a high-build coating thickness that can be prone to chipping and “mud cracking ” if not properly applied. The...for all non-magnetic coatings on a ferrous (magnetic) substrate, e.g. paint, plastic, enamel , powder, rubber, ceramic, galvanising, zinc, sprayed... cracking during the scribing process due to the brittle coating system on the intermediate primer coupons (16 and 22) as well as coupon 11. Mildew
An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)
Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming
2013-01-01
Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.
Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera
2010-01-01
Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...
Facebook targeted advertisement for research recruitment: A primer for nurse researchers.
Carter-Harris, Lisa
2016-11-01
Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.
Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M
2011-11-22
Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.
Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer
International Nuclear Information System (INIS)
D. S. Lucas
2004-01-01
A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com
Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui
2018-01-01
Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.
Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis
2015-01-01
Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
International Nuclear Information System (INIS)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang
1994-01-01
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Energy Technology Data Exchange (ETDEWEB)
Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)
1994-07-15
This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.
Czech Academy of Sciences Publication Activity Database
Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.
2014-01-01
Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014
Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying
2017-01-01
for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study
Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 A in thickness) were deposited onto 6111-T4 aluminum substrates in radio frequency and microwave powered reactors and used as primers for structural adhesive bonding. Processing variables such as substrate pre-treatment,...
2002-01-01
This primer was written for transportation professionals and public safety officials from cities, counties, and States who are responsible for day-to-day management and operations within a metropolitan region. It is intended to help agencies and orga...
Bond strength of primer/cement systems to zirconia subjected to artificial aging.
Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke
2016-11-01
Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond
Directory of Open Access Journals (Sweden)
Julio J. Masquijo
2014-10-01
Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.
Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets
Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G
2016-01-01
Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
Energy Technology Data Exchange (ETDEWEB)
Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)
2011-01-15
Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy
International Nuclear Information System (INIS)
Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo
2011-01-01
Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.
International Nuclear Information System (INIS)
Karonis, N.T.
1995-01-01
This document provides a quick introduction to EZCA, a library that was designed to provide an easy to use interface to Channel Access (CA). As such, this document is not a user's manual, where a more detailed explanation of EZCA can be found. In short, this document is designed to get users to a state where they can be writing EZCA code as quickly as possible. It is not a document that answers all EZCA questions
Energy Technology Data Exchange (ETDEWEB)
Padilla, G.C.; Thompson, S.L.
1980-10-01
VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.
Directory of Open Access Journals (Sweden)
Joseph Becker
2013-05-01
Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.
Joseph Becker
2013-01-01
A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.
Directory of Open Access Journals (Sweden)
Marco Suárez
2006-05-01
Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
International Nuclear Information System (INIS)
Jothikumar, N.; Hill, Vincent R.
2013-01-01
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Energy Technology Data Exchange (ETDEWEB)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
2013-06-28
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Directory of Open Access Journals (Sweden)
Cheng-Hong Yang
Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
In Vitro Evaluation of Shear Bond Strength of Self Etching Primers to Dentin
Directory of Open Access Journals (Sweden)
Reena Vora
2012-01-01
Full Text Available Objectives: To evaluate and compare the shear bond strength of four self etching primer adhesives to dentin. Materials & Methods: A total of 75 extracted human maxillary and mandibular molars were selected for the study. The teeth were divided into 5 groups of 15 teeth each, Group A- AdheSE (Ivoclar Vivadent, Group B-Adper prompt (3M ESPE, Group C- i bond (Heraeus-Kulzer, Group D-XenoIII (Dentsply, De Trey Group E-Single bond (3M ESPE was used and served as control. All the adhesives were applied according to the manufacturer′s instructions. Composite post was built on these bonded surfaces using Z-100 hybrid composite. The teeth were subjected to thermocycling for 500 cycles between 5°C to 55°C. The teeth were then mounted on universal testing machine and fractured under a shearing load, applied at a speed of 0.2mm/min. The readings were noted, tabulated and shear bond strength calculated in Mega Pascal (Mpa units. Results: There was significant difference in the mean shear bond strength of the four self etching primers, adhesives tested. Shear strength values were in the range of 16.57 to 21.73 Mpa. Xeno III gave the highest mean of shear bond strength whereas Adhe SE showed the lowest value of shear strength. Conclusion: Based on the results of the study, it can be concluded that contemporary self etching primer adhesives bond successfully to dentin. Moreover the bonding ability of Self Etching Systems seems to be comparable to the conventional Total Etch Systems.
Effect of a whitening agent application on enamel bond strength of self-etching primer systems.
Miyazaki, Masashi; Sato, Hikaru; Sato, Tomomi; Moore, B Keith; Platt, Jeffrey A
2004-06-01
Though reduction in bond strength after tooth whitening has been reported, little is known about it's effect on enamel bond strength of two-step bonding systems that exclude phosphoric acid etching prior to bonding agent application. The purpose of this study was to determine the effect of whitening procedure using an in-office whitening agent on enamel bond strength of self-etching primer systems. Three self-etching primer systems, Imperva Fluoro Bond, Mac Bond II, Clearfil SE Bond, and a one-bottle adhesive system Single Bond as a control material, were used. Bovine mandibular incisors were mounted in self-curing resin and the facial enamel or dentin surfaces were ground wet on 600-grit SiC paper. An in-office whitening agent, Hi-Lite was applied on the tooth surface according to the manufacturer's instruction. Bonding procedures were done soon after rinsing off the whitening agent or after 24 hours storage in distilled water. Specimens without whitening procedure were prepared as controls. Fifteen specimens per test group were stored in 37 degrees C distilled water for 24 hours, then shear tested at a crosshead speed of 1.0 mm/minute. One-way ANOVA followed by Duncan multiple range test were used for statistical analysis of the results. For the specimens made soon after rinsing off the whitening agent, a significant decrease in enamel bond strength was observed for all the bonding systems used. For the specimens made after 24 hours storage in water, a small decrease in enamel bond strength was observed and no significant differences were found compared to those of controls (without whitening). From the results of this study, enamel bond strengths of the self-etching primer systems might be affected to a lesser degree after rinsing with water followed by 24 hours storage in water.
Directory of Open Access Journals (Sweden)
Harold Castañeda-Peña
2010-01-01
Full Text Available Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas. Se encuentra que el 55% de los estudiantes de primer año de una universidad con carreras profesionales tiende a recolectar información y que el 78% de los estudiantes de primer año de una universidad con carreras tecnológicas tiende a contrastar y verificar información, en tanto que sólo entre 3% y 4% tiende a manejar la información críticamente. Se discute que, al asumir una tarea académica, estos estudiantes vinculan sus prácticas de competencia informacional a sus propias historias de vida y escolares, y que la edad y los antecedentes académicos parecen influir en tales prácticas. Los casos analizados se ubican dentro de perfiles de competencia informacional: recolectores, verificadores y reflexivos. Estos perfiles no son fijos, sino más bien fluidos, y se concretan de manera diferente según la tarea académica. Se recomienda realizar estudios de perfiles informacionales en estudiantes tanto de secundaria como universitarios, para diseñar políticas educativas sobre competencia informacional.
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Christiaan Barnard: 40 años del primer transplante de corazón humano.
Jorge Reynolds; Juan Fernando Cediel; César Payán
2009-01-01
Fueron éstas las palabras pronunciadas por Christiaan Neethling Barnard para referirse al domingo 3 de diciembre de 1967 cuando, en el Hospital Groote Schuur de Cape Town, Sudáfrica, dirigió al equipo que realizó el primer transplante cardíaco efectuado en un ser humano1. Después de 40 años, se recuerda al doctor Barnard, no sólo como cirujano excepcional, sino como un luchador incansable que revolucionó conceptos tan trascendentales en la ciencia médica como el de la muerte cerebral1,2.Chris...
Valdez, Fernando; Cossios, E. Daniel
2017-01-01
Se reporta un caso de canibalismo en el gecko de Lima, Phyllodactylus sentosus Dixon & Huey, 1970 donde un macho adulto devoró a un juvenil. Tras una búsqueda de literatura, no se encontró casos reportados en otras especies del mismo género, por lo que se considera que este es el primer reporte de canibalismo en Phyllodactylus. We report a case of cannibalism for the Lima leaf-toed gecko, Phyllodactylus sentosus, in which an adult male devoured a juvenile. No reported cases were found in o...
The compleat strategyst being a primer on the theory of games of strategy
Williams, J D
1986-01-01
When J. D. Williams wrote this entertaining, witty introduction for the nonscientist, Game Theory was still a somewhat mysterious subject familiar to very few scientists beyond those researchers, like himself, working for the military. Now, over thirty years after its original publication as a Rand Corporation research study, his light-hearted though thoroughly effective primer is the recognized classic introduction to an increasingly applicable discipline. Used by amateurs, professionals, and students throughout the world in the classroom, on the job, and for personal amusement, the book has
Energy Technology Data Exchange (ETDEWEB)
Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.
2009-09-01
One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.
Gonzalez-Soto, L.; Orozco-Morales, A.R.
2017-01-01
Propósito: Exponer la experiencia de medir en algún grado el impacto social de un proceso socioeducativo anual, desarrollado con 800 estudiantes de primer ingreso provenientes de diversos lugares del país, con limitadas condiciones socioeconómica y quienes son beneficiarios de beca para sus estudios. El proceso consistió en establecer 4 o 5 eventos anuales y trabajar con metodologías lúdicas temas alusivos a estilos de vida saludables. Material y método: Se aplicó la técnica de grupo focal al...
La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno
González Capitel, Antón
1996-01-01
1. La arquitectura tardía de Frank Lloyd Wright, el primer maestro moderno l. l. Un Wright renovado. Talleres y residencias l. l. l. Nuevas casas de Wright en su segunda «edad de oro»: un neoplasticismo orgánico en la casa de la Cascada l. l. 2. Geometrías y disposiciones alternativas l. 2. Arquitectura y ciudad orgánicas 1. 2. 1. El desarrollo de la arquitectura orgánica 1. 3. Arquitecturas relacionadas con la de Frank Lloyd Wright entre los emigrados europeos: Schindler y...
Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon
Directory of Open Access Journals (Sweden)
Irma Suriyani
2015-05-01
Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi
Assessment of fungal diversity in deep-sea sediments by multiple primer approach
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...
PRIMER REPORTE DE LA PRESENCIA DE Diaphorina citri (HEMIPTERA: LIVIIDAE EN MANABÍ
Directory of Open Access Journals (Sweden)
José Bernardo Navarrete Cedeño
2016-12-01
Full Text Available Diaphorina citri (Hemiptera: Liviidae, conocido como el psílido asiático de los cítricos, es considerada una plaga clave de la citricultura mundial, debido a que es vector de la bacteria “Candidatus Liberibacter”, agente causal de la enfermedad “Huanglongbing”, que tiene efectos letales sobre vegetales dentro de la familia Rutaceae. En este documento se reporta la presencia de D. citri infestando Murraya spp., un arbusto de la familia Rutaceae, en la zona urbana del cantón Portoviejo. Este es el primer reporte de la plaga en la provincia de Manabí-Ecuador
Directory of Open Access Journals (Sweden)
Akinori Kuzuya
2011-12-01
Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.
The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.
Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K
1996-07-01
To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.
2016-01-01
Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular
Directory of Open Access Journals (Sweden)
Lucero López-Díaz
2016-01-01
Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.
Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.
Directory of Open Access Journals (Sweden)
Indhu Kanakaraj
Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.
International Nuclear Information System (INIS)
Kumar, A.V.R.; Nigam, R.K.
1998-01-01
The phase analysis of the rusts generated beneath the primer containing micaceous iron oxide (MIO) and micaceous iron oxide in combination with red lead (RL), zinc phosphate (ZP), basic lead silicochromate (BLSC) and zinc chromate (ZC) has been carried out by Moessbauer spectroscopy at room temperature. The rust beneath the coating obtained after immersion of the painted panel for six months in 3% NaCl, consists mainly of non-stoichiometric magnetite together with small fractions of γ-, α-FeOOH except in the case of panel painted with RL containing MIO showed only a central doublet indicating the formation of γ-FeOOH and SPM α-FeOOH. Non-stoichiometry of magnetite as calculated from the ratio of B/A sites of the peaks of magnetite in the spectrum has been found depending on the nature of anticorrosive pigment present in the primer coating. The order of non-stoichiometry has been found to be in order of ZC > BLSC > ZP > MIO. (author)
Primer reporte de miasis hospitalaria por Lucilia cuprina (Diptera: Calliphoridae en Costa Rica
Directory of Open Access Journals (Sweden)
Lucía Quesada-Lobo
2012-12-01
Full Text Available Introducción. Las miasis hospitalarias son entidades con una importancia manifiesta en salud pública. La documentación de este tipo de casos es escasa en la literatura biomédica regional y mundial. Objetivo. Informar un caso de miasis hospitalaria en Costa Rica, donde el agente etiológico implicado fue Lucilia cuprina (Diptera: Calliphoridae. Este caso de miasis hospitalaria figura como el primer informe para Latinoamérica asociado con este agente etiológico. Presentación del caso. Una paciente de 91 años de edad, con signos de inmunosupresión, afectación grave de la función pulmonar y asistencia respiratoria mecánica, presentó larvas en ambas fosas nasales al séptimo día después del ingreso hospitalario. Varios ejemplares fueron recolectados y procesados para su identificación. La identificación taxonómica de los ejemplares recolectados estableció que la especie de los muscomorfos correspondía a L. cuprina. Conclusión. El presente constituye el primer caso de miasis hospitalaria por L. cuprina en la literatura biomédica de Costa Rica y el primero registrado en Latinoamérica. doi: http://dx.doi.org/10.7705/biomedica.v32i4.690
Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions
Directory of Open Access Journals (Sweden)
Retno Asti Werdhani
2017-04-01
Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer Family Acts in Cases Management In Primary Care through The Five Family Oriented Question Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were
Directory of Open Access Journals (Sweden)
Mayya Nurbayanti Shobary
2016-03-01
Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif
Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor
2016-01-01
Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Directory of Open Access Journals (Sweden)
Laura Navarro-Sampedro
2012-11-01
Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.
Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won
2018-02-01
The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing
DEFF Research Database (Denmark)
Liu, Yilan; Chen, Jinjin; Thygesen, Anders
2018-01-01
Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...
DEFF Research Database (Denmark)
Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth
intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...
DEFF Research Database (Denmark)
Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth
2015-01-01
the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...
Directory of Open Access Journals (Sweden)
Fernando L. Mantelatto
Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
Pitta, João; Branco, Teresa C; Portugal, Jaime
2018-05-01
Saliva contamination has been shown to decrease bonding to zirconia. Adopting a less contamination-sensitive cement system may be an alternative to decontamination. The purpose of this in vitro study was to assess the ability of different primer/cement systems to promote a durable bond to zirconia after saliva contamination. Zirconia blocks (Lava Plus) (N=320) were airborne-particle abraded (50 μm Al 2 O 3 ) and divided into 32 experimental groups (n=10) according to the variables in the study: saliva contamination; primer/cement system (Panavia SA [PSA]; RelyX Unicem 2 [RU2]; Bifix SE [BSE]; Panavia F2.0 [PF2]; Scotchbond Universal + RelyX Ultimate [SBU+RXU]; Futurabond M+ + Bifix QM [FBM+BQM]; All-Bond Universal + Duo-link [ABU+DL]; Z-Prime Plus + Duo-link [ZPP+DL]; and aging period (72 hours; 30 days with 10 000 thermocycles at 5°C to 55°C). After half of the blocks had been contaminated with fresh human saliva for 10 minutes, rinsed with water, and air-dried, each primer/cement was applied. Polymerized composite resin disks were then placed over the cement, and the resin cement was light-polymerized for 20 seconds each at 2 opposite margins. After the aging time, the specimens were tested in shear (1 mm/min). The failure mode was classified as adhesive, cohesive, or mixed. Statistical analysis of the shear bond strength (SBS) data was performed with ANOVA followed by Tukey honest significant difference post hoc tests. Chi-square tests were used to analyze the failure mode data (α=.05). The mean SBS ranged between 4.2 and 34.5 MPa. Shear bond strength was influenced (Pcontamination, aging time). SBU+RXU and FBM+BQM showed a higher mean SBS than those of the other experimental groups (Pcontamination (P>.05). Failure was predominantly classified as adhesive. In general, saliva contamination and aging decreased bonding efficacy. Two systems, combining an application of a universal adhesive and a resin cement (SBU+RXU and FBM+BQM) were not affected by
Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai
2014-01-01
The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase
Lactancia materna, alimentación artificial y el primer contacto con azúcar
Directory of Open Access Journals (Sweden)
Fabian Calixto Fraiz
2013-01-01
Full Text Available Objetivo: Este estudio evaluó los cambios en el patrón de lactancia materna, alimentación artificial y en la introducción de azúcar en la dieta de niños de 0 a 36 meses, a través de dos estudios, con un intervalo de 13 años en la ciudad de Curitiba, Paraná, Brasil. Material y métodos: Poblaciones semejantes de una misma región geográfica fueron evaluadas a través de un cuestionario, en los años de 1993 y 2006, envolviendo, respectivamente, las madres de 180 y 94 niños. Introducción de azúcar en la dieta fue considerada precoz cuando ocurrió antes del 6º mes completo de vida. Los datos fueron analizados estadísticamente a través del test de qui-cuadrado y test exacto de Fisher (α= 0,05. Resultados: Hubo diferencias en la frecuencia del primer contacto con azúcar (p <0,001, que ocurrió en el primer mes de vida en 61,7% de los niños del primer estudio y en sólo 3,2% de los niños del segundo estudio. Hubo diferencias en el patrón de lactancia materna (p = 0,02, siendo la prevalencia de niños amamantados mayor en el segundo estudio. No fueron encontradas diferencias estadísticamente significativas en la prevalencia de uso de biberón, uso de biberón durante la noche y lactancia materna durante la noche, así como en el uso de biberón conteniendo azúcar. Conclusiones: Estos resultados indican que la lactancia materna puede, además de sus varias ventajas, también promover el aplazamiento de la introducción de azúcar en la dieta infantil. Nuevas investigaciones son necesarias para confirmar esta hipótesis.
Genetics on the Fly: A Primer on the Drosophila Model System
Hales, Karen G.; Korey, Christopher A.; Larracuente, Amanda M.; Roberts, David M.
2015-01-01
Fruit flies of the genus Drosophila have been an attractive and effective genetic model organism since Thomas Hunt Morgan and colleagues made seminal discoveries with them a century ago. Work with Drosophila has enabled dramatic advances in cell and developmental biology, neurobiology and behavior, molecular biology, evolutionary and population genetics, and other fields. With more tissue types and observable behaviors than in other short-generation model organisms, and with vast genome data available for many species within the genus, the fly’s tractable complexity will continue to enable exciting opportunities to explore mechanisms of complex developmental programs, behaviors, and broader evolutionary questions. This primer describes the organism’s natural history, the features of sequenced genomes within the genus, the wide range of available genetic tools and online resources, the types of biological questions Drosophila can help address, and historical milestones. PMID:26564900
Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei
2017-08-01
One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.
Eduardo Krapf (1901-1963: Primer Presidente de la Sociedad Interamericana de Psicología
Directory of Open Access Journals (Sweden)
Hugo Klappenbach
2004-01-01
Full Text Available El trabajo, de carácter historiográfico, examina la trayectoria de Eduardo Krapf, quien se recibió de médico en Alemania y posteriormente revalidó su titulo en la Argentina. Se analiza su inserción en la Asociación Psicoanalítica Argentina y sus trabajos sobre psiquiatría y psicología al promediar el siglo XX. En particular, se analizan los intereses que condujeron a Eduardo Krapf a vincularse con la psicología y en particular con la Sociedad Interamericana de Psicología, de la que fue Primer Presidente en 1951. Metodológicamente, se han obtenido los datos principalmente de fuentes primarias, particularmente textos y documentos de archivo existentes en la Facultad de Ciencias Médicas de la Universidad de Buenos Aires
Murphy, Glen; Salomone, Sonia
2013-03-01
While highly cohesive groups are potentially advantageous they are also often correlated with the emergence of knowledge and information silos based around those same functional or occupational clusters. Consequently, an essential challenge for engineering organisations wishing to overcome informational silos is to implement mechanisms that facilitate, encourage and sustain interactions between otherwise disconnected groups. This paper acts as a primer for those seeking to gain an understanding of the design, functionality and utility of a suite of software tools generically termed social media technologies in the context of optimising the management of tacit engineering knowledge. Underpinned by knowledge management theory and using detailed case examples, this paper explores how social media technologies achieve such goals, allowing for the transfer of knowledge by tapping into the tacit and explicit knowledge of disparate groups in complex engineering environments.
The replisome uses mRNA as a primer after colliding with RNA polymerase.
Pomerantz, Richard T; O'Donnell, Mike
2008-12-11
Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.
Antonio Roalas. Un pintor del primer tercio del siglo XVII en Madrid
Directory of Open Access Journals (Sweden)
Rodríguez Rebollo, Ángel
2004-03-01
Full Text Available El conocimiento que actualmente se tiene sobre los pintores del barroco madrileño ha avanzado mucho desde que Ángulo y Pérez Sánchez publicaran los dos volúmenes dedicados al primer y segundo tercio del siglo XVII. Posteriormente han ido viendo la luz estudios más pormenorizados, a veces en forma de exposiciones, que han clarificado aún más la importancia de los artistas que trabajaron en torno a la Corte de los llamados «los Austrias menores»; sin embargo, existen aún hoy un buen número de pintores sólo conocidos a través de contratos o inventarios de la época. La absoluta desinformación que tenemos de ellos, acrecentada por la inexistencia de obras firmadas, no permite a los historiadores dedicarles al menos un estudio parcial de su arte…
Review of The Atheist’s Primer and Atheism for Beginners
Directory of Open Access Journals (Sweden)
Andrew J Bissette
2014-05-01
Full Text Available The New Atheists are occasionally accused of lacking nuance and sophistication, or of existing in an intellectual vacuum. To some it may seem that Dawkins 'et al'. are naïve logical positivists; this perspective may be reinforced by recent authors’ explicit rejection of the value of philosophy and other non-scientific approaches to knowledge (cf. Lawrence Krauss, Stephen Hawking. Into the fray steps Michael Palmer, offering his attempt to popularise a version of atheism that is underpinned by a long tradition of philosophical inquiry. 'The Atheist’s Primer', a condensed version of Palmer’s previous work, is aptly named: it is a crash course on the history and major arguments of atheism from a firmly philosophical angle. Its companion text, 'Atheism For Beginners', is a coursebook aimed at tutors seeking to teach this material.
A primer on industrial ecosystems : a strategy for sustainable industrial development
Energy Technology Data Exchange (ETDEWEB)
Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies
2003-07-01
Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.
Bolívar, primer diplomático de la libertad americana
Directory of Open Access Journals (Sweden)
Rafael Gómez Hoyos
1969-03-01
Full Text Available Don Miguel Luis Amunátegui, primer biógrafo de don Andrés Bello, recopilador y comentarista meritorio de sus obras, nos dejó una falsa visión de Bolívar como diplomático de la libertad. Basado en los recuerdos del anciano humanista, cuando ya le flaqueaba la memoria, o gracias a un error suyo de apreciación, al comentar los incidentes de la misión encomendada ante el gobierno británico por la Junta Suprema de Caracas, nos relata increíble falta de tacto y descuido imperdonable en Simón Bolívar, Jefe de la Misión.
Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.
Duina, Andrea A; Miller, Mary E; Keeney, Jill B
2014-05-01
The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.
Directory of Open Access Journals (Sweden)
Paul G. Nevill
2013-05-01
Full Text Available Premise of the study: Microsatellite primers were developed for Eucalyptus victrix (Myrtaceae to evaluate the population and spatial genetic structure of this widespread northwestern Australian riparian tree species, which may be impacted by hydrological changes associated with mining activity. Methods and Results: 454 GS-FLX shotgun sequencing was used to obtain 1895 sequences containing putative microsatellite motifs. Ten polymorphic microsatellite loci were identified and screened for variation in individuals from two populations in the Pilbara region. Observed heterozygosities ranged from 0.44 to 0.91 (mean: 0.66 and the number of alleles per locus ranged from five to 25 (average: 11. Conclusions: These microsatellite loci will be useful in future studies of population and spatial genetic structure in E. victrix, and inform the development of seed sourcing strategies for the species.
Cancer of the Esophagus and Esophagogastric Junction: An Eighth Edition Staging Primer
Rice, Thomas W.; Ishwaran, Hemant; Ferguson, Mark K.; Blackstone, Eugene H.; Goldstraw, Peter
2017-01-01
This primer for eighth edition staging of esophageal and esophagogastric epithelial cancers presents separate classifications for the clinical (cTNM), pathologic (pTNM), and postneoadjuvant pathologic (ypTNM) stage groups, which are no longer shared. For pTNM, pT1 has been subcategorized as pT1a and pT1b for the subgrouping pStage I adenocarcinoma and squamous cell carcinoma. A new, simplified esophagus-specific regional lymph node map has been introduced. Undifferentiated histologic grade (G4) has been eliminated; additional analysis is required to expose histopathologic cell type. Location has been removed as a category for pT2N0M0 squamous cell cancer. The definition of the esophagogastric junction has been revised. ypTNM stage groups are identical for both histopathologic cell types, unlike those for cTNM and pTNM. PMID:27810391
Testing of Model Water Chiller System with Hidrokarbon as a Primer Refrigeran
Directory of Open Access Journals (Sweden)
Nengah Suarnadwipa
2012-11-01
Full Text Available Now days, there are two issues that give a negative impact on the environment due to the uses of synthetic refrigerant on therefrigeration system and air conditioning system. The first issue was the Ozon Layer Depletion and the second issue was theGlobal Warming. Regarding those condition, it will be investigated the design and examination of performance the use of thesplit type AC system as water chiller system and using hydrocarbon as a primer refrigerant. As a result, in the examination ofthe standard split type AC system using refrigerant R-22, it founded that the cooling rate of 1958 Watt and COP of 5.29.While the examination on the modified split type AC system into water chiller system using hydrocarbon (hycool 22, hasgiven cooling rate of 1832 Watt and COP of 4.19. Finally, it could be councluded that the split type AC system could be usedas water chiller system.
An electrochemical study of the corrosion behavior of primer coated 2219-T87 aluminum
Danford, M. D.; Higgins, R. H.
1985-01-01
The corrosion behavior for 2219-T87 aluminum coated with various primers, including those used for the external tank and solid rocket boosters of the Space Shuttle Transportation System, were investigated using electrochemical techniques. Corrosion potential time, polarization resistance time, electrical resistance time, and corrosion rate time measurements were all investigated. It was found that electrical resistance time and corrosion rate time measurement were most useful for studying the corrosion behavior of painted aluminum. Electrical resistance time determination give useful information concerning the porosity of paint films, while corrosion rate time curves give important information concerning overall corrosion rates and corrosion mechanisms. In general, the corrosion rate time curves all exhibited at least one peak during the 30 day test period, which was attributed, according to the proposed mechanisms, to the onset of the hydrogen evolution reaction and the beginning of destruction of the protective properties of the paint film.
Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.
Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D
2010-10-01
Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.
Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize
Directory of Open Access Journals (Sweden)
Badar‑uz‑Zaman
2012-08-01
Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.
Directory of Open Access Journals (Sweden)
reni heryani
2017-12-01
Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami menstruasi dengan nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan
Los paisajes de Carlos V : primer viaje a España (1517-1518
Directory of Open Access Journals (Sweden)
Pilar Bosqued Lacambra
2011-01-01
Full Text Available Laurent Vital escribió la Relación del primer viaje de Carlos V a España, que inició en 1517 cuando salió de Gante para embarcar en Flesinga y emprender por mar la travesía hasta España, donde llegó a Asturias. Durante el verano de aquel año Carlos V disfrutó del paisaje de su tierra natal y recorrió durante el primer mes del otoño una parte de la cornisa cantábrica, desde Villaviciosa hasta San Vicente de la Barquera. Siguiendo el relato, se analizan y describen los paisajes que recorrió y las situaciones y sensaciones que vivió a lo largo del mencionado trayecto, tanto en sus territorios flamencos como en tierras españolas, a las que vino para ser proclamado como rey.Laurent Vital wrote the report of the first journey of Carlos V to Spain, that started in 1517 when he departed from Ghent to embark in Vlissingen and undertake through sea the crossing until Spain, arriving in Asturias. During that year’s summer, Carlos V enjoyed the landscape of his native land and roamed part of the Cantabric coast during the first month of that year’s Autumn , from Villaviciosa to San Vicente de la Barquera. In the story, the landscapes that he travelled through were analysed and described as well as the situations and feelings that he lived during the mentioned travel through his Flemish territories and Spanish grounds to which he became appointed as king.
Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.
Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José
2018-04-01
Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.
INFORMACIÓN EN EL PRIMER NIVEL DE ATENCIÓN
Directory of Open Access Journals (Sweden)
Orzuza, Gloria Beatriz
2013-01-01
Full Text Available En América Latina y el Caribe existen algunos limitantes al acceso de la atención médica como la escasez de recursos, la distancia física y cultural entre la oferta pública y la población demandante. En este sentido, en la definición de políticas de salud formuladas por los Estados no podrá estar ausente la incorporación de tecnologías de información y comunicación, ya que el concepto de salud electrónica engloba las aplicaciones de registros médicos electrónicos, servicios de telemedicina, portales de salud y sistemas de gestión hospitalaria.En Argentina existía un gran interés de los profesionales médicos por la telemedicina e informática en salud, así en 1992 se realiza el Primer Congreso Mundial. Comienzan entonces muchas iniciativas en telemedicina, educación a distancia, portales de salud y en registros médicos electrónico.Las investigaciones en salud a nivel nacional, concluyen que Misiones pertenece al grupo de provincias argentinas que se encuentra en una situación más desfavorable respecto a las otras provincias. En este marco, se contribuirá con lineamientos estratégicos generales para un sistema de información a ser desarrollado en el primer nivel de atención, con el propósito de obtener la información necesaria para la toma de decisión y favorecer en la optimización de la gestión.
Primer Certamen Frenopático Español (1883: estructura asistencial y aspectos administrativos
Directory of Open Access Journals (Sweden)
Villasante Armas, Olga
1997-06-01
Full Text Available In the latter part of the XIX century, an important group of physicians worked in Nueva Belén, a Mental Hospital located near Barcelona. Juan Giné y Partagás, the Director of Nueva Belén and his colleagues undertook investigation, clinical and academic work. This group organized the most important scientific meeting on Psychiatry in the last century in Spain, although Psychiatry had not yet been recognized as an independent science.
The present article describes the organization and contents of the "Primer Certamen Frenopático Español" using the original records. It is mainly focused on the Congress communications which deal with administrative and asistencial aspects of that time.
En el último tercio del siglo XIX un grupo de profesionales de la Medicina trabajaba en Nueva-Belén, hospital psiquiátrico localizado en las proximidades de Barcelona. Juan Giné y Partagás, director de este manicomio, y sus colaboradores, realizaban una labor clínica, académica y de investigación. Fue este grupo el que organizó la reunión más importante sobre Psiquiatría que tuvo lugar en el pasado siglo en España, en un momento en el que la especialidad no era, aún, reconocida como una disciplina científica independiente del resto de la Medicina.
El presente artículo describe la organización y contenidos del "Primer Certamen Frenopático Español" utilizando como material las actas originales del Congreso. Se centra en el análisis de las comunicaciones presentadas, cuyos contenidos temáticos son los aspectos administrativos y asistenciales de la frenopatología de la época.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells
Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.
1994-01-01
Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between
Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da
2016-07-15
Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hamidreza Monavari
2013-12-01
Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.
Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...
El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales
Directory of Open Access Journals (Sweden)
Fernanda Martins Castro
2015-06-01
Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.
Czech Academy of Sciences Publication Activity Database
Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla
2016-01-01
Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?
Directory of Open Access Journals (Sweden)
Ana Paula Morales Cobra Carvalho
2009-06-01
Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.
Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 Å in thickness) were deposited onto aluminum substrates (6111-T4 alloy) in radio frequency (RF) and microwave (MW) powered reactors to be used as primers for structural adhesive bonding. Processing variables such as sub...
Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi
2010-08-01
We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Alejandro Gonzalez-Martinez
2015-01-01
Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Foyet, A; Wu, T.H.; Kodentsov, A.; Ven, van der L.G.J.; With, de G.; Benthem, van R.A.T.M.
2009-01-01
The corrosion of AA-2024 aluminum alloy protected with a chromate free primer is investigated afterimmersion in a 0.5MNaCl aqueous solution. Thewater uptake by the coating increases continuouslywhenthe film, applied on an aluminum AA-2024 substrate, is placed in the 0.5MNaCl solution. This increase
Directory of Open Access Journals (Sweden)
Douglas de Almeida Pereira
2015-09-01
Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.
Simple sequence repeat technology based on expressed sequence tag (EST-SSR) is a useful genomic tool for genome mapping, characterizing plant species relationships, elucidating genome evolution, and tracing genes on alien chromosome segments. EST-SSR primers developed from three perennial diploid T...
Directory of Open Access Journals (Sweden)
Denilce Meneses Lopes
2010-01-01
Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia
2010-04-01
Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N
2015-07-01
The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.
An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum
Mendrek, M. J.
1992-01-01
A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.
Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.
2017-08-01
The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.
Directory of Open Access Journals (Sweden)
Anderson Pinheiro de Freitas
2004-06-01
Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do
Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi
2018-01-01
Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.
Rothgeb, Matthew J.; Kessel, Kurt R.
2015-01-01
safety, while typically specifying that performance must be equal to or greater than existing systems. The overall objective of the collaborative effort between NASA TEERM and ESA is to test and evaluate coating systems (pretreatments, pretreatments with primer, and pretreatments with primer and topcoat) as replacements for hexavalent chrome coatings in aerospace applications. This objective will be accomplished by testing promising coatings identified from previous NASA, ESA, Department of Defense (DOD), and other project experience. Additionally, several new materials will be analyzed according to ESA-identified specifications.
Quality assurance and quality control of geochemical data—A primer for the research scientist
Geboy, Nicholas J.; Engle, Mark A.
2011-01-01
interpreting results. This primer has been developed to provide basic information and guidance about developing QA/QC protocols for geochemical studies. It is not intended to be a comprehensive guide but rather an introduction to key concepts tied to a list of relevant references for further reading. The guidelines are presented in stepwise order beginning with presampling considerations and continuing through final data interpretation. The goal of this primer is to outline basic QA/QC practices that scientists can use before, during, and after chemical analysis to ensure the validity of the data they collect with the goal of providing defendable results and conclusions.
Control Basado en Eventos de Sistemas de Primer Orden Con Retardo
Directory of Open Access Journals (Sweden)
Ángel Ruiz
2013-07-01
Full Text Available Resumen: La teoría de control PID en su vertiente discreta, apoyándose en una gestión periódica de los muestreos (eventos planificados en tiempo se considera un área madura dentro del paradigma del control automático. Por el contrario, la planificación por eventos deriva, casi inevitablemente, en muestreos asíncronos planteando, problemas adicionales que necesitan ser caracterizados y estudiados. Bajo este escenario, aspectos como la sintonía de los controladores y las condiciones para la estabilidad global o la ausencia de ciclos límite siguen siendo temas que todavía están lejos de ser completamente resueltos. Con el trabajo actual se presenta un nuevo esquema de muestreo y control basado en eventos para sistemas de primer orden con retardo para el que se han analizado los aspectos anteriores. El esquema se basa en el Predictor de Smith para la compensación de los retardos, y en el algoritmo de muestreo SSOD (Symmetric Send- On-Delta para la generación de los eventos. En base a este esquema, se desarrolla el análisis de estabilidad y se propone una metodología de sintonía con una interpretación intuitiva y eficaz. Abstract: PID control theory based on periodic managing of samples has become a well-known area in automatic control. Asynchronous sampling inherent to event-based scheduling causes non-linear dynamics. Under this situation, complex problems arise that must be studied. Issues such as controller tuning, conditions for global stability and the absence of limit cycles are topics that are far from being fully solved yet. In this work, a new event-based scheme of sampling and control for FOPTD processes is presented. The scheme is based on the Smith Predictor structure for delay compensation and the SSOD (Symmetric-Send-On- Delta scheme for events generation. By means of the proposed scheme, a stability analysis is addressed and a simple tuning methodology with effective interpretation is proposed. Palabras clave
Sarafianou, Aspasia; Seimenis, Ioannis; Papadopoulos, Triantafillos
2008-05-01
There is a need for achieving reliable chemical bond strength between veneering composites resins and casting alloys through the use of simplified procedures. The purpose of this study was to examine the shear bond strength of an indirect composite resin to a Ni-Cr alloy, using 4 primers and 2 airborne-particle-abrasion procedures. Fifty-six Ni-Cr (Heraenium NA) discs, 10 mm in diameter and 1.5 mm in height, were fabricated. Twenty-four discs were airborne-particle abraded with 50-microm Al2O3 particles, while another 24 were airborne-particle abraded with 250-microm Al2O3 particles. The following primers were applied on 6 discs of each airborne-particle-abrasion treatment group: Solidex Metal Photo Primer (MPP50, MPP250), Metal Primer II (MPII50, MPII250), SR Link (SRL50, SRL250), and Tender Bond (TB50, TB250). The Rocatec system was used on another 6 discs, airborne-particle abraded according to the manufacturer's recommendations, which served as the control group (R). Two more discs were airborne-particle abraded with 50-microm and 250-microm Al2O3 particles, respectively, to determine the Al content on their surfaces, without any bonding procedure. The indirect composite resin used was Sinfony. Specimens were thermally cycled (5 degrees C and 55 degrees C, 30-second dwell time, 5000 cycles) and tested in shear mode in a universal testing machine. The failure mode was determined with an optical microscope, and selected specimens were subjected to energy dispersive spectroscopy (EDS). Mean bond strength values were analyzed using 2-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05) and compared to the control group using 1-way ANOVA followed by Tukey's multiple comparison tests (alpha=.05). The groups abraded with 50-microm particles exhibited significantly higher bond strength compared to the groups abraded with 250-microm particles. Group MPII50 exhibited the highest mean value (17.4 +/-2 MPa). Groups MPP50, MPP250, and TB50, TB250 showed
Patil, Basanagouda S; Rao, Bk Raghavendra; Sharathchandra, Sm; Hegde, Reshma; Kumar, G Vinay
2013-09-01
The aim of the present study was to investigate the effectiveness of the one total-etch self-priming adhesive, one two-step self-etching primer adhesive, and one 'all-in-one' self-etching adhesive system on the adhesion of a resin composite to enamel. Thirty-six freshly extracted human mandibular molars were selected for this study. A fat area about 5 mm in diameter was created on the exposed mesial surface of enamel of each tooth by moist grinding with 320, 420 and 600 grit silicon carbide paper. Twelve teeth were randomly assigned into three groups. In group 1, Adper Easy One (3M ESPE), a one step self-etching primer adhesive was applied and light curing unit for 10 seconds. In group 2, Adper SE Plus, a two-step self-etching primer with bottle A containing the aqueous primer and bottle B containing the acidic adhesive was applied and light cured for 10 seconds. Group 3 (control)-etchant 37% phosphoric acid is applied to the surface for 15 seconds and rinsed with water and air dried and adhesive (single bond 2) is applied to the surface and tube is placed and light cured for 20 seconds. Composite material (Z350) was placed in the tube and light cured for 40 seconds in all the groups. Bond strength testing was done using universal testing machine at the enamel-composite interface. The debonded enamel surface was evaluated in stereomicroscope to assess the cohesive, adhesive or mixed fracture. Data was statistically analyzed by one way analysis of variance (ANOVA). Group 1 performed least among all groups with a mean score of 19.46 MPa. Group 2 had a mean score of 25.67 MPa. Group 3 had a mean score of 27.16 MPa. Under the conditions of this in vitro study, the bond strength values of the two-step self-etching primer systems tested were similar to the total-etch. And, one step self-etching primers have lower bond strength compared to the total-etch.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR
International Nuclear Information System (INIS)
Ben salem, Issam
2007-01-01
Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)
Solar energetic particles a modern primer on understanding sources, acceleration and propagation
Reames, Donald V
2017-01-01
This concise primer introduces the non-specialist reader to the physics of solar energetic particles (SEP) and systematically reviews the evidence for the two main mechanisms which lead to the so-called impulsive and gradual SEP events. More specifically, the timing of the onsets, the longitude distributions, the high-energy spectral shapes, the correlations with other solar phenomena (e.g. coronal mass ejections), as well as the all-important elemental and isotopic abundances of SEPs are investigated. Impulsive SEP events are related to magnetic reconnection in solar flares and jets. The concept of shock acceleration by scattering on self-amplified Alfvén waves is introduced, as is the evidence of reacceleration of impulsive-SEP material in the seed population accessed by the shocks in gradual events. The text then develops processes of transport of ions out to an observer. Finally, a new technique to determine the source plasma temperature in both impulsive and gradual events is demonstrated. Last but not ...
Reporte del primer caso humano de infección parasitaria por Mammomonogamus laryngeus en Colombia
Directory of Open Access Journals (Sweden)
Jhon Carlos Castaño
2006-09-01
Full Text Available Los parásitos del género Mammomonogamus afectan el tracto respiratorio de mamíferos domésticos. La especie M. laryngeus es un nemátodo donde la hembra y el macho están unidos en permanente cópula produciendo una forma distintiva de letra "Y" mayúscula. En el mundo han sido reportados hasta el momento poco más de 100 casos de infección en humanos. Este reporte describe el primer paciente infectado en Colombia (Armenia, Quindío, quien presentó como sintomatología tos crónica productiva de dos meses de duración, con inmediata y total recuperación clínica luego de la expulsión del parásito en el esputo durante un fuerte acceso de tos. Este reporte incluye la descripción morfológica del gusano adulto, así como un breve resumen de la epidemiología y manifestaciones clínicas en humanos. También se presentan las fotografías tomadas al parásito, donde se observan algunos de los detalles morfológicos principales, que sirvieron para su identificación.
Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.
Directory of Open Access Journals (Sweden)
Jesse J Chen
Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.
Energy Technology Data Exchange (ETDEWEB)
Naus, Dan J [ORNL
2007-02-01
The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.
Orgon, Casey Roy
Corrosion is the decomposition of metal and metal alloys which threatens the integrity of man-made structures. One of the more efficient methods of delaying the corrosion process in metals is by coatings. In this work, the durability of two polyester powder coatings were investigated for corrosion protection of AA-2024-T3. Polyester powder coatings crosslinked by either triglycidyl isocyanurate (TGIC) or beta-hydroxyalkyl amide (HAA) compounds were prepared and investigated for barrier protection of metal substrates by electrochemical impedance spectroscopy (EIS). Polyester-TGIC coatings were found to provide better long-term protection, which can be attributed to the increased mechanical strength and higher concentration of crosslinking in the coating films. Additionally, the polyester powder coatings, along with a fusion bonded epoxy (FBE) were investigated for their compatibility as a topcoat for magnesium-rich primers (MgRP). Under proper application conditions, powder topcoats were successfully applied to cured MgRP while corrosion protection mechanisms of each system were maintained.
Empresas nanotecnológicas en México: hacia un primer inventario
Directory of Open Access Journals (Sweden)
Edgar Záyago Lau
2013-01-01
Full Text Available En este artículo presentamos un inventario inicial de compañías mexicanas que venden productos que son manufacturados a partir de nanotecnología, o que utilizan nanotecnología en sus operaciones. El inventario permite a los interesados identificar el número de empresas, su ubicación geográfica y los sectores industriales en los que se insertan. Esto es, de hecho, un primer acercamiento para el análisis los vínculos productivos de la nanotecnología en México. Los resultados muestran una alta concentración de empresas en dos estados: Nuevo León y la ciudad de México. Esto sucede en un contexto donde no hay una iniciativa nacional, ni una política pública específica ni datos disponibles públicamente o bases de datos que contienen información relevante.
USING GIS AND AHP FOR PLANNING PRIMER TRANSPORTATION OF FOREST PRODUCTS
Directory of Open Access Journals (Sweden)
A. E. Akay
2017-11-01
Full Text Available Primer transportation is one of the most costly and time consuming forestry activities in extraction of timber from forest lands. Transportation methods are essentially determined based on terrain characteristics, especially ground slope. Besides, unsuitable machine selection and unplanned operations may cause ecological damages such as soil disturbance. Soil damage can lead to long term impacts on forest ecosystem. Thus, the optimum transportation methods should be determined by considering not only economic factors but also topographical factors and soil conditions. In recent decades, some of the advanced features of Geographical Information System (GIS assist decision makers to solve such complex transportation problems with various constraints. In this study, it was aimed to plan forest transportation operation by using GIS integrated Analytical Hierarchy Process (AHP method, considering ground slope, soil type, and available transportation equipment in the region. This method was implemented within the border of İnegöl Forest Enterprise Chief in the city of Bursa in Turkey. Alternative transportation method included cable system, chute system, skidder, and farm tractor. GIS-based method integrated with AHP found that skidder was the optimal transportation method for about 60% of the study area, while farm tractor was the second most suitable method with 25% ground cover. The results indicated that GIS-based decision support systems can be effectively used as rational, quick, and economic tool for forest transportation planning.
Prigigallo, Maria I; Abdelfattah, Ahmed; Cacciola, Santa O; Faedda, Roberto; Sanzani, Simona M; Cooke, David E L; Schena, L
2016-03-01
A metabarcoding method based on genus-specific primers and 454 pyrosequencing was utilized to investigate the genetic diversity of Phytophthora spp. in soil and root samples of potted plants, from eight nurseries. Pyrosequencing enabled the detection of 25 Phytophthora phylotypes distributed in seven different clades and provided a much higher resolution than a corresponding cloning/Sanger sequencing approach. Eleven of these phylotypes, including P. cactorum, P. citricola s.str., P. palmivora, P. palmivora-like, P. megasperma or P. gonapodyides, P. ramorum, and five putative new Phytophthora species phylogenetically related to clades 1, 2, 4, 6, and 7 were detected only with the 454 pyrosequencing approach. We also found an additional 18 novel records of a phylotype in a particular nursery that were not detected with cloning/Sanger sequencing. Several aspects confirmed the reliability of the method: (i) many identical sequence types were identified independently in different nurseries, (ii) most sequence types identified with 454 pyrosequencing were identical to those from the cloning/Sanger sequencing approach and/or perfectly matched GenBank deposited sequences, and (iii) the divergence noted between sequence types of putative new Phytophthora species and all other detected sequences was sufficient to rule out sequencing errors. The proposed method represents a powerful tool to study Phytophthora diversity providing that particular attention is paid to the analysis of 454 pyrosequencing raw read sequences and to the identification of sequence types.
Las relaciones entre Chile y Suecia durante el primer gobierno de Olof Palme, 1969-1976
Directory of Open Access Journals (Sweden)
Fernando Camacho Padilla
2014-06-01
Full Text Available Durante el primer gobierno del socialdemócrata Olof Palme, las relaciones bilaterales entre Chile y Suecia fueron las más intensas de toda su historia, tanto en cercanía como en conflictividad. La razón la encontramos en los distintos fenómenos políticos que vivió Chile en ese periodo, puesto que Palme coincidió temporalmente con tres gobiernos claramente diferenciados: la Democracia Cristiana, la Unidad Popular y el Régimen Militar. Si las relaciones sueco-chilenas tuvieron su mejor momento durante el mandato de Salvador Allende, el golpe de Estado significó todo lo contrario. El compromiso que tuvo el embajador de Suecia, Harald Edelstam, por quienes eran perseguidos en Chile le llevó a su expulsión, lo que se tradujo en un claro deterioro de las relaciones y el inicio de una nueva etapa marcada por el gran contingente de exiliados que comenzaron a llegar a Suecia. Este trabajo analiza los principales acontecimientos diplomáticos ocurridos entre Chile y Suecia así como las consecuencias que tuvieron durante el gobierno de Olof Palme.
Primer registro de la cotorra argentina (Myiopsitta monachus en Chihuahua, México
Directory of Open Access Journals (Sweden)
Ricardo Abel Soto-Cruz
2015-06-01
Full Text Available Reportamos el primer registro de la cotorra argentina (Myiopsitta monachus en las ciudades de Chihuahua y Delicias en Chihuahua, México. Observamos cinco individuos de esta especie de junio a diciembre de 2011 en las instalaciones de la Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua; grupos de 2 a 12 individuos en el área urbana de la ciudad de Chihuahua durante 2012, y cuatro individuos en ciudad Delicias, a 80 km al sureste de la ciudad de Chihuahua, en el 2013. Previamente, en enero de 2011, se reportó, en el portal electrónico de aVerAves, el avistamiento de un individuo en el noroeste del estado. Dada la presencia de nidos activos en las ciudades de Chihuahua y Delicias, la especie podría estar ya establecida en esta parte del país. Recomendamos dar seguimiento a las poblaciones existentes de esta especie a fin de documentar los posibles riesgos a los ecosistemas en la región.
Aut Caesar, aut nihil! La presencia de la romanitas en el primer escrito de Hegel
Directory of Open Access Journals (Sweden)
Valerio Rocco Lozano
2009-08-01
Full Text Available http://dx.doi.org/10.5007/1677-2954.2009v8n2p255 El rol conceptual desempeñado por el mundo romano en la obra de Hegel, y en concreto en los escritos dejuventud, constituye una dimensión necesaria no sólo para comprender su recepción de la cultura clásicay su reacción a determinados acontecimientos de la época, como la Revolución francesa, sino tambiénpara explicar su evolución política desde posiciones republicanas y francófi las hasta el pensamiento demadurez. La Unterredung zwischen Dreien, el primer texto de Hegel, infl uido por las lecturas juvenilesde Shakespeare, Schiller y Rousseau, y comprometido con los valores del republicanismo prerrevolucionario,es el más claro ejemplo de la importante presencia de las refl exiones sobre Roma en el autorde la Fenomenología.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Real-time locating systems (RTLS) in healthcare: a condensed primer.
Kamel Boulos, Maged N; Berry, Geoff
2012-06-28
Real-time locating systems (RTLS, also known as real-time location systems) have become an important component of many existing ubiquitous location aware systems. While GPS (global positioning system) has been quite successful as an outdoor real-time locating solution, it fails to repeat this success indoors. A number of RTLS technologies have been used to solve indoor tracking problems. The ability to accurately track the location of assets and individuals indoors has many applications in healthcare. This paper provides a condensed primer of RTLS in healthcare, briefly covering the many options and technologies that are involved, as well as the various possible applications of RTLS in healthcare facilities and their potential benefits, including capital expenditure reduction and workflow and patient throughput improvements. The key to a successful RTLS deployment lies in picking the right RTLS option(s) and solution(s) for the application(s) or problem(s) at hand. Where this application-technology match has not been carefully thought of, any technology will be doomed to failure or to achieving less than optimal results.
Chartier, Lucas B; Cheng, Amy H Y; Stang, Antonia S; Vaillancourt, Samuel
2018-01-01
Emergency medicine (EM) providers work in a fast-paced and often hectic environment that has a high risk for patient safety incidents and gaps in the quality of care. These challenges have resulted in opportunities for frontline EM providers to play a role in quality improvement (QI) projects. QI has developed into a mature field with methodologies that can dramatically improve the odds of having a successful project with a sustainable impact. However, this expertise is not yet commonly taught during professional training. In this first of three articles meant as a QI primer for EM clinicians, we will introduce QI methodology and strategic planning using a fictional case study as an example. We will review how to identify a QI problem, define components of an effective problem statement, and identify stakeholders and core change team members. We will also describe three techniques used to perform root cause analyses-Ishikawa diagrams, Pareto charts and process mapping-and how they relate to preparing for a QI project. The next two papers in this series will focus on the execution of the QI project itself using rapid-cycle testing and on the evaluation and sustainability of QI projects.
Sexual health and religion: a primer for the sexual health clinician (CME).
Kellogg Spadt, Susan; Rosenbaum, Talli Y; Dweck, Alyssa; Millheiser, Leah; Pillai-Friedman, Sabitha; Krychman, Michael
2014-07-01
Sexual health is an integral part of the multifaceted human experience that is driven both by biological factors and psychological facets. Religion may provide a moral code of conduct or a sexual compass as to sexual norms and behaviors. The aim of this study was to summarize the integration of sexuality and religion. A review of published literature and religious texts was conducted. The integration of religion with country or state politics and laws is a complicated dilemma and will not be discussed in the scope of this article. The extent to which an individual incorporates their religious doctrine into their sexual life is a personal and individualized choice. The sexual medicine health professional will likely encounter a diverse patient population of distinct religious backgrounds, and a primer on religion and sexuality is a much needed adjunctive tool for the clinician. Because religion can influence sexuality and dictate, in part, the behavioral and medical treatments for sexual complaints, the clinician should be familiar with religious guidelines regarding sexuality, and treatment should be customized and individualized. Failure to do so can impact compliance with the therapeutic interventions. Religious awareness also solidifies the therapeutic alliance between clinician and patient as it demonstrates respect and acknowledgment for patient's beliefs and autonomy. © 2014 International Society for Sexual Medicine.
International Nuclear Information System (INIS)
Naus, Dan J.
2007-01-01
The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program
Reseña del Primer Encuentro Internacional de Institutos de Medicina Tropical 2013
Directory of Open Access Journals (Sweden)
Jorge O Alarcón
2014-04-01
Full Text Available El Primer Encuentro Internacional de Institutos de Medicina Tropical, llevado a cabo en Lima, fue la actividad principal del cincuentenario de la fundación del Instituto de Medicina Tropical Daniel A. Carrión (1963-2013, de la Facultad de Medicina de la UNMSM. Participaron en su organización las principales instituciones científicas del país relacionadas a la investigación y atención de los problemas de salud que afectan a las regiones tropicales y subtropicales. Asistieron alrededor de mil personas. Los temas tratados fueron salud infantil en los trópicos, salud internacional, VIH/sida, dengue, malaria, leishmaniosis, tuberculosis, enfermedad de Carrión y enfermedades emergentes y reemergentes. Los representantes de los nueve institutos de Medicina Tropical de la región, asistentes al evento, suscribieron una declaración, en la que acordaron, entre otros puntos, promover en sus países las recomendaciones adoptadas en la Asamblea Mundial de la Salud y Organización Panamericana de la Salud en relación a enfermedades desatendidas, investigación en salud y recursos humanos en salud; desarrollar programas de posgrado regionales en medicina tropical, epidemiología y salud pública; articular las acciones de este encuentro con otras iniciativas regionales y subregionales, y realizar el Segundo Encuentro Internacional de Institutos de Medicina Tropical en dos años.
Enamel microhardness and bond strengths of self-etching primer adhesives.
Adebayo, Olabisi A; Burrow, Michael F; Tyas, Martin J; Adams, Geoffrey G; Collins, Marnie L
2010-04-01
The aim of this study was to determine the relationship between enamel surface microhardness and microshear bond strength (microSBS). Buccal and lingual mid-coronal enamel sections were prepared from 22 permanent human molars and divided into two groups, each comprising the buccal and lingual enamel from 11 teeth, to analyze two self-etching primer adhesives (Clearfil SE Bond and Tokuyama Bond Force). One-half of each enamel surface was tested using the Vickers hardness test with 10 indentations at 1 N and a 15-s dwell time. A hybrid resin composite was bonded to the other half of the enamel surface with the adhesive system assigned to the group. After 24 h of water storage of specimens at 37 degrees C, the microSBS test was carried out on a universal testing machine at a crosshead speed of 1 mm min(-1) until bond failure occurred. The mean microSBS was regressed on the mean Vickers hardness number (VHN) using a weighted regression analysis in order to explore the relationship between enamel hardness and microSBS. The weights used were the inverse of the variance of the microSBS means. Neither separate correlation analyses for each adhesive nor combined regression analyses showed a significant correlation between the VHN and the microSBS. These results suggest that the microSBS of the self-etch adhesive systems are not influenced by enamel surface microhardness.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
El-Damanhoury, Hatem M; Gaintantzopoulou, Maria D
2018-01-01
This study assessed the effect of pretreatment of hybrid and glass ceramics using a self-etching primer on the shear bond strength (SBS) and surface topography, in comparison to pretreatment with hydrofluoric acid and silane. 40 rectangular discs from each ceramic material (IPS e.max CAD;EM, Vita Mark II;VM, Vita Enamic;VE), were equally divided (n=10) and assigned to one of four surface pretreatment methods; etching with 4.8% hydrofluoric acid followed by Monobond plus (HFMP), Monobond etch & prime (Ivoclar Vivadent) (MEP), No treatment (NT) as negative control and Monobond plus (Ivoclar Vivadent) with no etching (MP) as positive control. SBS of resin cement (Multilink-N, Ivoclar Vivadent) to ceramic surfaces was tested following a standard protocol. Surface roughness was evaluated using an Atomic force microscope (AFM). Surface topography and elemental analysis were analyzed using SEM/EDX. Data were analyzed with two-way analysis of variance (ANOVA) and post-hoc Bonferroni test at a significance level of α=0.05. Pretreatment with HFMP resulted in higher SBS and increased surface roughness in comparison to MEP and MP. Regardless the method of surface pretreatment, the mean SBS values of EM ceramic was significantly higher (pceramics for resin-luting cementation. Copyright © 2017 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Panareda i Clopés, Josep M. (Josep Maria), 1945-; Nuet i Badia, Josep
1983-01-01
El present treball és un primer escrit sobre la cartografia corològica de les plantes vasculars en el massis del Montseny (Serralada Pre-litoral), en el qual exposem el plantejament del projecte i oferim uns primers résultats. Hi incloem també un mapa per espècie prenent com a unitat espacial el quadrat d'1 km de costat del reticle UTM. La presència de 1'espècie a cada quadrat és indicada en très graus d'abundància: espècie présent o rara, espècie fréquent i espècie abundant. L'àrea estudiada...
DEFF Research Database (Denmark)
Huang, Yili; Zeng, Yanhua; Lu, Hang
2016-01-01
Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...
Directory of Open Access Journals (Sweden)
Fábio Mendonça Diniz
2007-03-01
Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.
Directory of Open Access Journals (Sweden)
M Kumaraswamy Anand
2014-01-01
Full Text Available Context: Salivary control and maintenance of a dry operating field is a prime requisite of orthodontic bonding. Moisture insensitive primer (MIP with a clinical significant bond strength values have a better edge over the conventional hydrophobic bonding systems. Aim: The aim of this study is to investigate the effectiveness of two hydrophilic primers with respect to conventional hydrophobic primer by comparing their shear bond strength (SBS and adhesive-failure locations after contamination with saliva and saliva substitute. Materials and Methods: A total of 150 extracted human premolars were randomly divided into five group s ; Group A (Transbond MIP/saliva substitute, Group B (Opal Primo/saliva substitute, Group C (Transbond MIP/natural saliva, Group D (Opal Primo/natural saliva, control group - Group E (Transbond XT/dry, adhesive-Transbond XT used for all five groups and bonded using stainless steel brackets. Shear forces were applied to the samples with a universal testing machine. SBSs was measured in megapascals. The mode of bond failure was determined using the adhesive remnant index (ARI. Results: The mean SBS produced by Transbond MIP was higher than Opal Primo, which was statistically significant according to one-way analysis of variance. Both the tested groups showed lesser bond strength values than Transbond XT (the control. ARI scores revealed that there was no statistically significant difference in the site of bond failure between study groups. ARI scores were found to be lower for study groups suggesting adhesive failure, compared to higher ARI scores for the control group suggesting cohesive failure. Conclusion: Transbond XT adhesive with Transbond MIP or Opal Primo have clinically acceptable bond strength in wet fields. Opal Primo is a viable option to use as a hydrophilic primer clinically.
Hatamleh, Muhanad M; Watts, David C
2011-02-01
To evaluate the effect of three commonly used bond primers on the bending strength of glass fibers and their bond strength to maxillofacial silicone elastomer after 360 hours of accelerated daylight aging. Eighty specimens were fabricated by embedding resin-impregnated fiber bundles (1.5-mm diameter, 20-mm long) into maxillofacial silicone elastomer M511 (Cosmesil). Twenty fiber bundles served as control and did not receive surface treatment with primers, whereas the remaining 60 fibers were treated with three primers (n = 20): G611 (Principality Medical), A-304 (Factor II), and A-330-Gold (Factor II). Forty specimens were dry stored at room temperature (23 ± 1°C) for 24 hours, and the remaining specimens were aged using an environmental chamber under accelerated exposure to artificial daylight for 360 hours. The aging cycle included continuous exposure to quartz-filtered visible daylight (irradiance 760 W/m(2) ) under an alternating weathering cycle (wet for 18 minutes, dry for 102 minutes). Pull-out tests were performed to evaluate bond strength between fiber bundles and silicone using a universal testing machine at 1 mm/min crosshead speed. A 3-point bending test was performed to evaluate the bending strength of the fiber bundles. One-way Analysis of Variance (ANOVA), Bonferroni post hoc test, and an independent t-test were carried out to detect statistical significances (p accelerated daylight aging. Treatment with primer and accelerated daylight aging increased bending strength of glass fibers. © 2011 by The American College of Prosthodontists.
Czech Academy of Sciences Publication Activity Database
Kohout, Petr; Sudová, Radka; Janoušková, Martina; Čtvrtlíková, Martina; Hejda, Martin; Pánková, Hana; Slavíková, Renata; Štajerová, Kateřina; Vosátka, Miroslav; Sýkorová, Zuzana
2014-01-01
Roč. 68, Jan 2014 (2014), s. 482-493 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/0781; GA ČR GAP504/10/1486; GA ČR(CZ) GAP505/11/1112 Institutional support: RVO:67985939 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Directory of Open Access Journals (Sweden)
Fabiana Soares Grecca
2011-02-01
Full Text Available OBJECTIVE: This study tested rat connective tissue response to RealSeal, RealSeal primer or AH Plus after 7, 15, 30, 60 and 90 days of implantation. MATERIAL AND METHODS: Thirty Wistar rats had subcutaneous sockets created on their back and received four implants each of polyethylene tubes containing one of the materials tested according to the groups: AH (AH Plus Sealer; RS (RealSeal Sealer; RP (RealSeal Primer; CG (control group - empty tube. After histological processing, sections were analyzed to identify the presence of neutrophils, lymphocytes and plasma cells, eosinophils, macrophages and giant cells, as well as fibrous capsule and abscesses, by an examiner using light microscope. Kruskal-Wallis and multiple-comparisons test were used for statistical analysis. Significance level was set at 5%. RESULTS: Lymphoplasmacytic infiltrate scores significantly higher than those of the control group were observed at 14 and 60 days in AH group, and at 90 days in RS group (p<0.05. There were no differences in terms of presence of macrophages, giant cells, eosinophils, neutrophils or fibrosis. AH Plus group scored higher for abscesses at 7 days than after any other period (p=0.031. RP group scored higher for lymphoplasmacytic infiltrate at 14 days than at 90 days (p=0.04. CONCLUSION: The main contribution of this study was to demonstrate that issues involved with tissue tolerance of a Resilon-containing sealer, RealSeal Sealer, cannot be attributed to its primer content.
Directory of Open Access Journals (Sweden)
Urba Walter J
2011-01-01
Full Text Available Abstract The Society for Immunotherapy of Cancer, SITC (formerly the International Society for Biological Therapy of Cancer, iSBTc, aims to improve cancer patient outcomes by advancing the science, development and application of biological therapy and immunotherapy. The society and its educational programs have become premier destinations for interaction and innovation in the cancer biologics community. For over a decade, the society has offered the Primer on Tumor Immunology and Biological Therapy of Cancer™ in conjunction with its Annual Scientific Meeting. This report summarizes the 2010 Primer that took place October 1, 2010 in Washington, D.C. as part of the educational offerings associated with the society's 25th anniversary. The target audience was basic and clinical investigators from academia, industry and regulatory agencies, and included clinicians, post-doctoral fellows, students, and allied health professionals. Attendees were provided a review of basic immunology and educated on the current status and most recent advances in tumor immunology and clinical/translational caner immunology. Ten prominent investigators presented on the following topics: innate immunity and inflammation; an overview of adaptive immunity; dendritic cells; tumor microenvironment; regulatory immune cells; immune monitoring; cytokines in cancer immunotherapy; immune modulating antibodies; cancer vaccines; and adoptive T cell therapy. Presentation slides, a Primer webinar and additional program information are available online on the society's website.
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
International Nuclear Information System (INIS)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.
1991-01-01
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation
Directory of Open Access Journals (Sweden)
Yusmadi Yusmadi
2008-04-01
Full Text Available The quality and palatibility of silage and hay complete ration based on organic primer garbage in peranakan etawah (PE poad ABSTRACT. This research was conducted to study the quality and palatability of silage and hay complete ration based on organic primer garbage in nine heads of Peranakan Etawah (PE Goat. The quality of silage and hay was evaluated By measuring pH, total number of lactic acid Bacteria (LAB, palatability, dry matter (DM and organic matter (OM aroma and color of silage. Nine heads of peranakan etawah were grouped based on their lactation periode and randomly assigned to one of tree dietary treatments. The treatments were (1 Control rations; (2 silage complete ration (SRK; and (3 Hay complete ration (HRK. The results indicated that the silage had PH 4.15 and total number of LAB was 2.4 x 10 cfu/g of silage. Dry matter and organic matter digestibility of SRK were better than those of HRK. The palatability of SRK was higher than HRK but less than control. Storage of SRK for did not change dry matter and organic matter content. Organoleptic analysis indicated that texture and color of HRK were changed at after storage, while SRK was still constant. It is concluded that silage composed of organic primer garbage has high quality in terms of physical, chemical and microbial characteristics, prolong storage.
Primer reporte del empleo de marcadores ISTR en Cactaceae (Pilosocereus sp
Directory of Open Access Journals (Sweden)
Grecia Montalvo Fernández
2010-07-01
obtained plants they will be planted under natural conditions, where they will face diverse environmental situations, it is convenient to carry out a study of genetic diversity. The objective of this work was to estimate the genetic variability using the technical Inverse Sequence Tagged Repeat (ISTR. In vitro germination of seeds of Pilosocereus sp and the genetic variability of the obtained seedlings was determined. With the molecular analysis a total of 97 bands were detected, of them 62.8% were polymorphic. The biggest percentage of polymorphism (85.7% was obtained with the primer combination F6/B6. With the primer combinations employed were detected from 4 to 6 different band patterns. The heterocigocity hoped was 0.39. Key words: Cactaceae; variability; extintion; polymorphism.
Directory of Open Access Journals (Sweden)
Cristiane Becher Rosa
2008-06-01
Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a
ORIGAMI Automator Primer. Automated ORIGEN Source Terms and Spent Fuel Storage Pool Analysis
Energy Technology Data Exchange (ETDEWEB)
Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thompson, Adam B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bowman, Stephen M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Peterson, Joshua L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2016-04-01
Source terms and spent nuclear fuel (SNF) storage pool decay heat load analyses for operating nuclear power plants require a large number of Oak Ridge Isotope Generation and Depletion (ORIGEN) calculations. SNF source term calculations also require a significant amount of bookkeeping to track quantities such as core and assembly operating histories, spent fuel pool (SFP) residence times, heavy metal masses, and enrichments. The ORIGEN Assembly Isotopics (ORIGAMI) module in the SCALE code system provides a simple scheme for entering these data. However, given the large scope of the analysis, extensive scripting is necessary to convert formats and process data to create thousands of ORIGAMI input files (one per assembly) and to process the results into formats readily usable by follow-on analysis tools. This primer describes a project within the SCALE Fulcrum graphical user interface (GUI) called ORIGAMI Automator that was developed to automate the scripting and bookkeeping in large-scale source term analyses. The ORIGAMI Automator enables the analyst to (1) easily create, view, and edit the reactor site and assembly information, (2) automatically create and run ORIGAMI inputs, and (3) analyze the results from ORIGAMI. ORIGAMI Automator uses the standard ORIGEN binary concentrations files produced by ORIGAMI, with concentrations available at all time points in each assembly’s life. The GUI plots results such as mass, concentration, activity, and decay heat using a powerful new ORIGEN Post-Processing Utility for SCALE (OPUS) GUI component. This document includes a description and user guide for the GUI, a step-by-step tutorial for a simplified scenario, and appendices that document the file structures used.
An Introduction to Programming for Bioscientists: A Python-Based Primer.
Directory of Open Access Journals (Sweden)
Berk Ekmekci
2016-06-01
Full Text Available Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i its straightforward semantics and clean syntax make it a readily accessible first language; (ii it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.. This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.
PCR approach for rapid detection of Escherichia coli in tempe using a specific primer
Directory of Open Access Journals (Sweden)
Siti Harnina Bintari
2014-12-01
Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.
Directory of Open Access Journals (Sweden)
Peter C. Rowe
2017-06-01
Full Text Available Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS is a complex disease that affects children and adolescents as well as adults. The etiology has not been established. While many pediatricians and other health-care providers are aware of ME/CFS, they often lack essential knowledge that is necessary for diagnosis and treatment. Many young patients experience symptoms for years before receiving a diagnosis. This primer, written by the International Writing Group for Pediatric ME/CFS, provides information necessary to understand, diagnose, and manage the symptoms of ME/CFS in children and adolescents. ME/CFS is characterized by overwhelming fatigue with a substantial loss of physical and mental stamina. Cardinal features are malaise and a worsening of symptoms following minimal physical or mental exertion. These post-exertional symptoms can persist for hours, days, or weeks and are not relieved by rest or sleep. Other symptoms include cognitive problems, unrefreshing or disturbed sleep, generalized or localized pain, lightheadedness, and additional symptoms in multiple organ systems. While some young patients can attend school, on a full or part-time basis, many others are wheelchair dependent, housebound, or bedbound. Prevalence estimates for pediatric ME/CFS vary from 0.1 to 0.5%. Because there is no diagnostic test for ME/CFS, diagnosis is purely clinical, based on the history and the exclusion of other fatiguing illnesses by physical examination and medical testing. Co-existing medical conditions including orthostatic intolerance (OI are common. Successful management is based on determining the optimum balance of rest and activity to help prevent post-exertional symptom worsening. Medications are helpful to treat pain, insomnia, OI and other symptoms. The published literature on ME/CFS and specifically that describing the diagnosis and management of pediatric ME/CFS is very limited. Where published studies are lacking, recommendations
Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions
Energy Technology Data Exchange (ETDEWEB)
Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))
2012-03-15
The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second
Rowe, Peter C.; Underhill, Rosemary A.; Friedman, Kenneth J.; Gurwitt, Alan; Medow, Marvin S.; Schwartz, Malcolm S.; Speight, Nigel; Stewart, Julian M.; Vallings, Rosamund; Rowe, Katherine S.
2017-01-01
Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a complex disease that affects children and adolescents as well as adults. The etiology has not been established. While many pediatricians and other health-care providers are aware of ME/CFS, they often lack essential knowledge that is necessary for diagnosis and treatment. Many young patients experience symptoms for years before receiving a diagnosis. This primer, written by the International Writing Group for Pediatric ME/CFS, provides information necessary to understand, diagnose, and manage the symptoms of ME/CFS in children and adolescents. ME/CFS is characterized by overwhelming fatigue with a substantial loss of physical and mental stamina. Cardinal features are malaise and a worsening of symptoms following minimal physical or mental exertion. These post-exertional symptoms can persist for hours, days, or weeks and are not relieved by rest or sleep. Other symptoms include cognitive problems, unrefreshing or disturbed sleep, generalized or localized pain, lightheadedness, and additional symptoms in multiple organ systems. While some young patients can attend school, on a full or part-time basis, many others are wheelchair dependent, housebound, or bedbound. Prevalence estimates for pediatric ME/CFS vary from 0.1 to 0.5%. Because there is no diagnostic test for ME/CFS, diagnosis is purely clinical, based on the history and the exclusion of other fatiguing illnesses by physical examination and medical testing. Co-existing medical conditions including orthostatic intolerance (OI) are common. Successful management is based on determining the optimum balance of rest and activity to help prevent post-exertional symptom worsening. Medications are helpful to treat pain, insomnia, OI and other symptoms. The published literature on ME/CFS and specifically that describing the diagnosis and management of pediatric ME/CFS is very limited. Where published studies are lacking, recommendations are based on the
Scougall-Vilchis, Rogelio J; Zárate-Díaz, Chrisel; Kusakabe, Shusuke; Yamamoto, Kohji
2010-05-01
To determine the shear bond strengths (SBS) of stainless steel brackets bonded with seven light-cured orthodontic adhesives after the enamel was conditioned with the same self-etching primer. A total of 140 extracted human molars were randomly divided into seven groups (N = 20). In all the groups, the enamel was conditioned with Transbond Plus SEP (TPSEP). Stainless steel brackets were bonded with the following orthodontic adhesives: Group I, Transbond XT; Group II, Blūgloo; Group III, BeautyOrtho Bond; Group IV, Enlight; Group V, Light Bond; Group VI, Transbond CC; Group VII, Xeno Ortho. The teeth were stored in distilled water at 37 degrees C for 24 hours and debonded with a universal testing machine. The modified adhesive remnant index (ARI) was also recorded. There were no significant differences in the SBS values among the groups: I (18.0 +/- 7.4 MPa); II (18.3 +/- 5.1 MPa); III (14.8 +/- 4.3 MPa); IV (18.3 +/- 7.0 MPa); V (16.4 +/- 4.3 MPa); VI (20.3 +/- 5.3 MPa); VII (15.9 +/- 6.4 MPa), but significant differences in ARI were found. The seven orthodontic adhesives evaluated in this study can be successfully used for bonding stainless steel brackets when the enamel is conditioned with TPSEP, however, the differences among some groups might influence the clinical bond strengths. In addition, the amount of residual adhesive remaining on the teeth after debonding differed among the adhesives. Further studies are required to better understand the differences in SBS and ARI.
Stres Kerja pada Perawat di Rumah Sakit dan Fasilitas Pelayanan Kesehatan Primer
Directory of Open Access Journals (Sweden)
Herqutanto -
2017-04-01
Full Text Available Stres kerja berhubungan dengan kecelakaan, kekerasan di tempat kerja, organizational strain dalam bentuk absensi, penurunan performa kerja, peningkatan angka cedera dan turn-over karyawan. Perawat adalah profesi yang memiliki risiko tinggi terdampak stres kerja. Tujuan penelitian ini adalah mendapatkan angka stres kerja pada perawat di Indonesia dan faktor-faktor yang memengaruhinya menggunakan instrumen expanded nursing stress scale (ENSS versi Bahasa Indonesia. ENSS adalah instrumen penilaian stres yang dikhususkan bagi perawat dan telah diadaptasi sesuai dengan kondisi pekerjaan spesifik dan budaya Indonesia. Sebanyak 124 perawat direkrut, berasal dari rumah sakit dan beberapa fasilitas pelayanan kesehatan primer (FKTP. Semakin tinggi tingkat stres kerja yang dialami perawat, semakin tinggi nilai pengukuran. Tidak ditemukan hubungan antara karakteristik demografi dan tingkat stres di masing-masing subskala pada kedua kelompok responden. Kata Kunci: Stres kerja, Perawat, ENSS versi Bahasa Indonesia Job Stress in Nurses in Hospitals and Primary Health Care Facilities Abstract Work stress is related to accidents, violence in the workplace, organizational strain in the form of absenteeism, decreased work performance, increased injury rates and employee turnover. Nurses are professionals who have high risks of occupational stress. The purpose of this study is to get the prevalens of work stress in nurses in Indonesia and the that influencing factors, using the instrument of ENSS Indonesian version. ENSS is an instrument of stress assessment specifically designed for nurses. ENSS has been adapted to the specific working conditions and culture of Indonesia. A total of 124 nurses were recruited, coming from hospitals and primary healthcare facilities. The higher the level of work stress experienced by nurses, the higher the value of measurement. No relationship was found between demographic characteristics and the level of stress in each
An Introduction to Programming for Bioscientists: A Python-Based Primer.
Ekmekci, Berk; McAnany, Charles E; Mura, Cameron
2016-06-01
Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.
Titulación académica y posibilidades de acceso al primer empleo
Directory of Open Access Journals (Sweden)
ET. OTROS
2009-11-01
Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job
National Research Council Canada - National Science Library
Downer, Charles
2003-01-01
This document is a primer for use of the Watershed Modeling System (WMS) interface with the physically based, distributed-parameter hydrologic model Gridded Surface Subsurface Hydrologic Analysis (GSSHA...
Wang, Yong; Qian, Pei-Yuan
2009-01-01
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions
International Nuclear Information System (INIS)
Truc, Trinh Anh; Hang, Thi Xuan; Oanh, Vu Ke; Dung, Nguyen Tuan
2004-01-01
Corrosion resistance of coating system consisting of zinc-rich primer (ZRP) and topcoat based on polyurethane resin with the presence of 3-aminopropyl-triethoxysilan (APS) and 2-(benzothialylthio) succinic acid (BSA) was studied by electrochemical impedance and wet adhesion. The interface metal/primer/topcoat was analyzed by scanning electronic microscopy. It was found that the presence of APS and BSA improved adhesion and barrier property of the topcoats
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Directory of Open Access Journals (Sweden)
Elif Çepni
2012-01-01
Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.
Directory of Open Access Journals (Sweden)
Shrinivas Ashtekar
2016-01-01
Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.
PS1-29: Resources to Facilitate Multi-site Collaboration: the PRIMER Research Toolkit
Greene, Sarah; Thompson, Ella; Baldwin, Laura-Mae; Neale, Anne Victoria; Dolor, Rowena
2010-01-01
Background and Aims: The national research enterprise has typically functioned in a decentralized fashion, resulting in duplicative or undocumented processes, impeding not only the pace of research, but diffusion of established best practices. To remedy this, many long-standing networks have begun capturing and documenting proven strategies to streamline and standardize various aspects of the research process. The project, “Partnership-driven Resources to IMprove and Enhance Research” (PRIMER), was funded through the Clinical and Translational Science Awards (CTSA) initiative to leverage the collective expertise from two networks: the HMO Research Network and Practice Based Research Networks (PBRNs). Each network has a shared goal of propagating research resources and best practices. Methods: We created and distributed an online survey to 92 CTSA and PBRN representatives in March, 2009 to define critical needs and existing resources that could inform a resource repository. The survey identified barriers and benefits to forming research partnerships, and assessed the perceived utility of various tools that could accelerate the research process. The study team identified, reviewed and organized tools based on the typical research trajectory from design to dissemination. Results: Fifty-five of 92 invitees (59%) completed the survey. Respondents rated the ability to conduct community-relevant research through true academic-community partnerships as the top-rated benefit of multi-site research, followed by the opportunity to accelerate translation of research into practice. The top two perceived barriers to multi-site research were ‘funding opportunities are not adequate (e.g., too few, not enough to support true collaborations), and ‘lack of research infrastructure to support [all] partners (e.g., no IT support, IRB, dedicated research staff). Respondents’ ratings of the utility of various tools and templates was used to guide development of an online
Amalgam shear bond strength to dentin using single-bottle primer/adhesive systems.
Cobb, D S; Denehy, G E; Vargas, M A
1999-10-01
To evaluate the in vitro shear bond strengths (SBS) of a spherical amalgam alloy (Tytin) to dentin using several single-bottle primer/adhesive systems both alone: Single Bond (SB), OptiBond Solo (Sol), Prime & Bond 2.1 (PB), One-Step (OS) and in combination with the manufacturer's supplemental amalgam bonding agent: Single Bond w/3M RelyX ARC (SBX) and Prime & Bond 2.1 w/Amalgam Bonding Accessory Kit (PBA). Two, three-component adhesive systems, Scotchbond Multi-Purpose (SBMP) and Scotchbond Multi-Purpose Plus w/light curing (S + V) and w/o light curing (S+) were used for comparison. One hundred eight extracted human third molars were mounted lengthwise in phenolic rings with acrylic resin. The proximal surfaces were ground to expose a flat dentin surface, then polished to 600 grit silicon carbide paper. The teeth were randomly assigned to 9 groups (n = 12), and dentin surfaces in each group were treated with an adhesive system according to the manufacturer's instructions, except for S + V specimens, where the adhesive was light cured for 10 s before placing the amalgam. Specimens were then secured in a split Teflon mold, having a 3 mm diameter opening and amalgam was triturated and condensed onto the treated dentin surfaces. Twenty minutes after condensation, the split mold was separated. Specimens were placed in distilled water for 24 hrs, then thermocycled (300 cycles, between 5 degrees C and 55 degrees C, with 12 s dwell time). All specimens were stored in 37 degrees C distilled water for 7 days, prior to shear strength testing using a Zwick Universal Testing Machine at a cross-head speed of 0.5 mm/min. The highest to the lowest mean dentin shear bond strength values (MPa) for the adhesive systems tested were: S + V (10.3 +/- 2.3), SBX (10.2 +/- 3.5), PBA, (6.4 +/- 3.6), SOL (5.8 +/- 2.5), SBMP (5.7 +/- 1.8), S+ (4.8 +/- 2.3), PB (2.7 +/- 2.6), SB (2.7 +/- 1.1) and OS (2.5 +/- 1.8). One-way ANOVA and Duncan's Multiple Range Test indicated significant
Primer hallazgo de Micromamíferos de edad turoliense en la Cuenca de Madrid
Directory of Open Access Journals (Sweden)
Calvo, J. P.
1992-08-01
Full Text Available The Neogene succession cropping out in Mesa de Ocaña (southern Madrid Basin contains a variety of deposits that belong to the so-called Miocene Lower, Intermediate and Upper Units. In this area, the Miocene Upper Unit is formed of terrigenous deposits that grade both laterally and in vertical to palustrine and/or shallow lacustrine carbonate facies. Intercalated with the latter deposits, a large accumulation of fossil micromammal remains has been recognized (Canteras de Iberia mammal site. This site has yielded a fossil mammal association of late Turolian age (MN 13 unit indicative of relatively warm and arid paleoclimatic conditions. The Canteras de Iberia mammal site constitutes the first occurrence of fossil mammals of Turolian age within the Neogene sedimentary record of the Madrid Basin. This occurrence allows to precise the chronostratigraphy of the Miocene Upper Unit of the basin.La Mesa de Ocaña, situada en la parte más meridional de la Cuenca de Madrid, está constituida por una sucesión Neógena dentro de la que se reconocen las Unidades Inferior, Intermedia y Superior del Mioceno de esta cuenca. La Unidad Superior en este área está formada por depósitos detríticos que gradan lateralmente y verticalmente a depósitos carbonáticos de carácter palustre y/o lacustre somero. En estos niveles se ha reconocido la presencia de una importante acumulación de restos de micromamíferos (Yacimiento de Canteras de Iberia que ha suministrado abundantes restos correspondientes a las órdenes Rodentia, Lagomorpha e Insectívora. La asociación faunística obtenida es característica del Turoliense Superior (unidad MN13 y, desde el punto de vista paleocológico, sugiere condiciones climáticas relativamente cálidas y áridas. El yacimiento de Canteras de Iberia constituye el primer yacimiento de edad Turoliense encontrado dentro del registro sedimentario Neógeno de la Cuenca de Madrid permitiendo precisar la edad de la Unidad Superior del
Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba
Directory of Open Access Journals (Sweden)
Carlos Ramírez Pérez
2009-12-01
Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis
Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida
Directory of Open Access Journals (Sweden)
Elia Rosa Lemus Lago
1997-04-01
Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.
Protagonismo de los alumnos en el aprendizaje: Una experiencia en el primer curso de medicina
Directory of Open Access Journals (Sweden)
Agustín Hidalgo
Full Text Available Objetivo. Presentar y analizar la experiencia realizada en una asignatura del primer curso del Grado de Medicina para abordar competencias formativas en documentación, método científico y humanismo médico. Sujetos y métodos. Participaron 151 alumnos distribuidos en grupos de 5-6 estudiantes para realizar los trabajos propuestos en forma de seminarios y aprendizaje basado en problemas (ABP, utilizando, entre otros materiales, narraciones literarias e imágenes de cuadros pictóricos cuyo análisis y discusión se presentaron oralmente. En las prácticas se inició a los estudiantes en la búsqueda y evaluación de la información. Un ensayo y las clases teóricas completan los métodos utilizados. Todos los materiales a utilizar estuvieron disponibles en el campus virtual. Resultados. La asistencia a prácticas, seminarios y ABP fue próxima al 100%, y a clases teóricas, del 67%. Los alumnos mostraron inquietud intelectual en las tareas. El método ha demostrado una elevada implicación en el proceso de autoaprendizaje, capacidad de autorregulación en el trabajo, trabajo en grupo, grado de adquisición de conceptos y capacidad de redactar documentos. La adecuación de los contenidos a los objetivos ha sido considerada favorable por más del 70% de los alumnos. El grado de adquisición de las competencias fue favorable en un 80% de los casos. Conclusiones. Las características de la asignatura pueden fomentar la inquietud científica y el humanismo médico entre los alumnos. La literatura y la lectura de cuadros pueden contribuir a identificar los aspectos del acto médico y a desarrollar la observación de las características físicas y conductuales en los pacientes.
EDAD AL PRIMER PARTO EN VACAS HOLSTEIN DE LECHERÍA ESPECIALIZADA EN COSTA RICA
Directory of Open Access Journals (Sweden)
Mauren Salazar-Carranza
2013-01-01
Full Text Available El objetivo de este trabajo fue determinar la edad al primer parto (EPP en vacas Holstein pu- ras en lecherías especializadas de Costa Rica. Se realizó un es- tudio longitudinal prospectivo histórico con 46 029 animales de raza Holstein pura de lechería especializada de Costa Rica, durante el periodo comprendido entre los años 2000 y 2010. Se incluyeron los datos de vacas que contaban con registros completos para todas las variables del estudio, registrados en el programa VAMPP Bovino 3.0. Se calculó la EPP por las variables de zona ecológica, la época de nacimiento, el año de parto, el índice de endogamia, el número de lactancias de la madre y el tipo de parto que dio origen al animal en estudio. Los datos fueron analizados por medio de estadística descrip- tiva (porcentajes, promedios, desviación estándar [DE] y el cálculo de intervalos de confianza (IC95%. La EPP prome- dio fue 30,7 meses (D.E: 6,8; IC 95%: 30,6 – 30,8. Durante el periodo, el promedio de la EPP varió entre los 30 y 31 meses; sin embargo, en los años 2006 y 2007 mostró una tendencia a disminuir. La EPP presentó diferencias significativas entre estratos según la época de nacimiento, el número de lactancia de la madre, la zona ecológica, el año de nacimiento, el tipo de parto de la madre y el coeficiente de endogamia de la vaca. Al igual que las tendencias mundiales, mostró tendencia a decrecer en Costa Rica; y las variables de animal, tiempo y ambiente mostraron un efecto sobre la EPP. Excepto el coefi- ciente de endogamia (a mediano y largo plazo, esos factores no son modificables en condiciones de pastoreo, que son los imperantes en la gran mayoría de fincas estudiadas.
Etapa familiar que se inicia con el nacimiento del primer hijo
Directory of Open Access Journals (Sweden)
Clara Pérez Cárdenas
2000-02-01
Full Text Available Las etapas evolutivas de la familia como grupo, son un tema poco abordado en la literatura médica, de ahí que nos entusiasmara la idea de profundizar en aquella que se inicia con el nacimiento del primer hijo, por considerarla un período en la vida familiar y personal de muchas expectativas y tareas nuevas a afrontar. Con carácter descriptivo, longitudinal y retrospectivo evaluamos cuál es el conflicto fundamental que perciben los padres en esta etapa, sentimientos que genera el afrontar ese evento que la define y los intentos de solución, a los problemas de este período. Trabajamos con 2 grupos: 1 que tuviera a su descendiente matriculado en el Círculo Infantil, y otro con niños que se desarrollan únicamente en el ambiente familiar. Entre los resultados encontramos que además de ser hijos deseados, los padres refieren participación en la atención de éstos reconociéndose a la madre como figura fundamental en la toma de decisiones. La afectación económica es el conflicto principal percibido por ambos padres en los 2 grupos estudiados, no encontrándose diferencias importantes entre los 2 grupos de familias que participaron en el estudio, al menos en la mayoría de las variables exploradasAs the evolutive stages of the family as a group are little appoached by medical literature, we decided to deepen in that one that starts with the birth of the first child for considering it as a period of many expectations and new tasks to undertake in the family and personal life. A descriptive, longitudinal and retrospective evaluation of the fundamental conflict perceived by the parents in this stage, of the feelings resulting from facing that event that defines it and of the attempts to solve the problems arising during that period was made. We worked with 2 groups: one with the child enrolled in the day care center and the other with children that developed in the family environment only. Among the results, we found that besides being
J. de Morainville y el primer dibujo universal de la quina o cascarilla
Directory of Open Access Journals (Sweden)
2003-01-01
Full Text Available En 1736 la Mission Géodésique Française appartenant à lAcadémie des Sciences de Paris arriva à Quito son but était deffectuer des études et des mesures pour établir la forme de la planète. Ce groupe de chercheurs, dirigé par Louis Godin et Charle-Marie de La Condamine, comprenait J. de Moiranville qui, en 1738, accompagna La Condamine à Saraguro (dans le département de Loja, Équateur, pour laider dans ses travaux et recherches sur larbre de quina ou cascarilla, utilisé pour guérir la malaria. À cette occasion Moiranville réalisa le premier dessin de la cascarilla au niveau mondial. En 1736 arribó a la Presidencia de Quito la Misión Geodésica Francesa, enviada por la Academia de Ciencias de París, con la finalidad de efectuar estudios que permitieran definir la forma del globo terráqueo. Formando parte de la misión, que estuvo bajo el mando de Luis Godin y de Carlos María de La Condamine, se hallaba el ingeniero J. de Morainville quien, en 1738, acompañó a La Condamine hasta el sitio de Zaraguro, ubicado en la Provincia de Loja (Ecuador, con la finalidad de estudiar el árbol de quina o cascarilla, el mismo que se utilizaba para el tratamiento de la malaria. Con esta oportunidad Morainville efectuó el primer dibujo universal de la cascarilla. The French Geodesics Mission under Louis Godin and Charles-Marie de La Condamine command arrived to the Presidency of Quito in 1763. This mission was sent by the Sciences Academy of Paris to carry out studies aimed at defining accurately the Earths shape. One of the members of this Mission was the engineer J. de Morainville who went to the Zaraguro site (Loja Province, Ecuador in 1738 accompanied by La Condamine. The purpose of their trip was to study the quina or cascarilla, a tree which was used to treat malaria. In this occasion, Morainville made the first drawing of the cascarilla.
La política ferroviaria del primer gobierno radical 1916-1922
Directory of Open Access Journals (Sweden)
MARIO JUSTO LÓPEZ
2013-05-01
Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.
Ceramic Surface Treatment with a Single-component Primer: Resin Adhesion to Glass Ceramics.
Prado, Mayara; Prochnow, Catina; Marchionatti, Ana Maria Estivalete; Baldissara, Paolo; Valandro, Luiz Felipe; Wandscher, Vinicius Felipe
2018-04-19
To evaluate the microshear bond strength (μSBS) of composite cement bonded to two machined glass ceramics and its durability, comparing conventional surface conditioning (hydrofluoric acid + silane) to a one-step primer (Monobond Etch & Prime). Machined slices of lithium disilicate ceramic (LDC) (IPS e.max CAD) and feldspathic ceramic (FC) (VITA Mark II) glass ceramics were divided into two groups (n = 10) according to two factors: 1. surface treatment: HF+S (ca 5% hydrofluoric acid [IPS Ceramic Etching GEL] + silane coupling agent [SIL; Monobond Plus]) or MEP (single-component ceramic conditioner; Monobond Etch & Prime); 2. storage condition: baseline (without aging; tested 24 h after cementing) or aged (70 days of water storage + 12,000 thermal cycles). Composite cement (Multilink Automix, Ivoclar Vivadent) was applied to starch matrices on the treated ceramic surfaces and photoactivated. A μSBS test was performed (0.5 mm/min) and the failure pattern was determined. Contact angle and micromorphological analyses were also performed. Data were analyzed with Student's t-test (α = 5%). For both ceramic materials, HF+S resulted in higher mean μSBS (MPa) at baseline (LDC: HF+S 21.2 ± 2.2 > MEP 10.4 ± 2.4; FC: HF+S 19.6 ± 4.3 > MEP 13.5 ± 5.4) and after aging (LDC: HF+S 14.64 ± 2.31 > MEP 9 ± 3.4; FC HF+S: 14.73 ± 3.33 > MEP 11.1 ± 3.3). HF+S resulted in a statistically significant decrease in mean μSBS after aging (p = 0.0001), while MEP yielded no significant reduction. The main failure type was adhesive between composite cement and ceramic. HF+S resuted in the lowest contact angle. Hydrofluoric acid + silane resulted in higher mean μSBS than Monobond Etch & Prime for both ceramics; however, Monobond Etch & Prime had stable bonding after aging.
¿Qué textos leen en primer año los estudiantes de Psicología?
Directory of Open Access Journals (Sweden)
María Micaela Villalonga Penna
2016-11-01
Full Text Available Resumen Qué se lee en las universidades es una de las temáticas que han abordado los estudios realizados desde los enfoques de las Alfabetizaciones Académicas y de la Literacidad crítica. En este sentido, nos preguntamos ¿qué textos leen en primer año los estudiantes de psicología? Teniendo en cuenta este interrogante, en este trabajo presentamos el análisis del material bibliográfico del primer año de la carrera de psicología de una universidad estatal. Esta investigación se realizó desde los enfoques cualitativo y cuantitativo de investigación. Analizamos un corpus de 320 textos que corresponden al material bibliográfico de las nueve materias del primer año de la mencionada carrera. Empleamos las categorías de análisis propuestas por Carlino (2005, Padilla (2013 y Padilla, Douglas y López (2007; 2011, entre otras, y tuvimos en cuenta categorías emergentes también. Los hallazgos dieron a conocer el uso de ´cuadernillos´, que incluyen fotocopias del material bibliográfico que pueden o no contar con elementos que ayuden a contextuarlo como copias de la tapa y contratapa, página con datos de edición, índice y referencias completas. El material bibliográfico está constituido por textos académicos derivados de textos científicos, entre los que priman los capítulos de libros y las fichas de cátedra. Además, estos textos son predominantemente expositivos o argumentativos.