pour le trimestre qui a pris fin le 30 septembre 2012

International Development Research Centre (IDRC) Digital Library (Canada)

acray

30 sept. 2012 ... recommande de lire ce rapport en parallèle avec les états financiers non audités (à la page 9). L'information et les .... développement ont augmenté de 56,9 % par rapport au même trimestre de l'exercice 2011-2012 ..... IFRS) telles que publiées par le Conseil des normes comptables internationales (CNCI).

Caries dental asociada a factores de riesgo durante el embarazo

Directory of Open Access Journals (Sweden)

Antonio Cecilio Pérez Oviedo

2011-06-01

Full Text Available El periodo gestacional se relaciona con una mayor incidencia de caries dental, aunque la asociación entre gestación e incremento de caries no ha podido aún ser científicamente demostrada. Se propuso realizar un estudio para determinar la presencia de caries dental y algunos factores de riesgo asociados en el primer y tercer trimestre del embarazo, para detectar la aparición de lesiones cariosas nuevas y cambios relacionados con los factores de riesgo entre ambos trimestres. Se realizó un estudio descriptivo longitudinal desde diciembre de 2006 a febrero de 2008 en el municipio de Florida, Camagüey, Cuba. El universo de estudio estuvo constituido por 38 embarazadas y la muestra por 21, que fueron interrogadas y examinadas en ambos trimestres con el objetivo de determinar la presencia de caries y los factores de riesgo asociados como: higiene bucal deficiente, dieta cariogénica, pH salival bajo, ocurrencia de vómitos y embarazo previo. La información necesaria fue recogida en un formulario confeccionado al efecto. En el primer trimestre el 80,95 % estaban afectadas por caries dental y se observó aparición de lesiones nuevas en 6 embarazadas, en el tercer trimestre. Los factores de riesgo presentados con mayor frecuencia en el primer trimestre fueron la dieta cariogénica en el 66,66 % y la higiene bucal deficiente en el 47,61 % de las pacientes. Ninguna embarazada modificó la dieta durante el embarazo, sin embargo la higiene bucal deficiente persistió en el 14,28 %. El 52,38 % de las embarazadas afectadas en el primer trimestre consumían dieta cariogénica y el 47,61 % habían tenido embarazo previo. Se concluyó que hubo afectación por nuevas caries durante el embarazo, los factores de riesgo que predominantes fueron la dieta cariogénica, la higiene bucal deficiente y el embarazo previo. Las pacientes no modificaron la dieta durante el embarazo, pero sí mejoraron la higiene bucal. Todas las que presentaban vómitos y pH salival

MethPrimer: designing primers for methylation PCRs.

Science.gov (United States)

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

[The work of Santiago Ramón y Cajal in the Revista Trimestral Micrográfica (Trabajos del Laboratorio de Investigaciones Biológicas)].

Science.gov (United States)

Gamundí, A; Timoner, G; Nicolau, M C; Rial, R V; Esteban, S; Langa, M A

This paper is based on a study of Revista Trimestral Micrografica (Trabajos del Laboratorio de Investigaciones Biologicas) between its creation by Santiago Ramon y Cajal in 1896 and his death in 1934. The journal Revista Trimestral Micrografica was the main way in which Santiago Ramon y Cajal and his school published their work since its creation. Ramon y Cajal created the journal for two main reasons: first, he needed a rapid system to publish his own work; second, the journal could serve to encourage his pupils. The journal published many important reports defending the neuronal theory which expanded the cellular one to include the nervous system.

Percepción en la salud bucal de adolescentes embarazadas

Directory of Open Access Journals (Sweden)

Maria Luiza da Matta Felisberto Fernandes

2012-02-01

Full Text Available Objetivo: Verificar la interferencia del embarazo en las percepciones en salud bucal de adolescentes embarazadas de 12 a 18 años, con baja condición socio-económica, residentes en Belo Horizonte, Minas Gerais. Material y Métodos: Se realizó un estudio cualitativo con las adolescentes (n=60 divididas en dos grupos: embarazada (n=30 o no embarazada (n=30. Entre las gestantes, diez estaban en el primer trimestre de gestación, trece en el segundo, y siete en el último trimestre de gestación. Los datos fueron recolectados a través de entrevistas individuales. Se realizó el análisis del contenido. Resultados: Tres categorías de análisis surgieron a través del contenido manifestado en ambos grupos: consciencia de determinantes de la salud bucal (conocimientos y actitudes, reacciones emocionales relativas a la salud bucal (sentimientos positivos, pasividad y sentimientos negativos y valores en salud bucal (apariencia, función social de los padres. Conclusión: Entre las jóvenes se observó que la experiencia del embarazo no interfirió en las percepciones en salud bucal.

Análise de custo-efetividade de métodos preventivos para superfície oclusal de acordo com o risco de cárie: resultados de um ensaio clínico controlado

Directory of Open Access Journals (Sweden)

Elaine Pereira da Silva Tagliaferro

2013-11-01

Full Text Available Este estudo apresenta o resultado de uma avaliação de custo-efetividade conduzida ao longo de um ensaio clínico controlado para avaliar a efetividade do selamento com ionômero de vidro modificado por resina (Vitremer, 3M ESPE e da aplicação de verniz fluoretado (Duraphat, Col-gate em superfícies oclusais de primeiros molares permanentes, em crianças de 6 a 8 anos (N = 268, segundo o risco de cárie (alto risco; baixo risco. As crianças foram examinadas semestralmente, ao longo de 24 meses, pelo mesmo dentista calibrado, após alocação em seis grupos: controle alto risco e baixo risco (educação em saúde bucal trimestral; verniz alto risco e baixo risco (educação em saúde bucal trimestral + aplicação semestral de verniz; e selante alto risco e baixo risco (educação em saúde bucal trimestral + única aplicação do selante. A análise mostrou que o selamento de primeiros molares permanentes em crianças de alto risco apresentou razão de C/E de R$ 225,21(US$ 119,80 por superfície oclusal salva, e razão incremental de C/E de R$ 203,71(US$ 108,36 por superfície oclusal adicional salva. Conclui-se que uma única aplicação de selante, em escolares de alto risco, foi a intervenção mais custo-efetiva.

Estudio bibliométrico de la Revista CorSalud

Directory of Open Access Journals (Sweden)

Grenedys Teresa López Tápanes

2013-10-01

Full Text Available Objetivos: Se hizo un estudio bibliométrico de algunos indicadores en los primeros 199 artículos publicados en CorSalud, con el objetivo de conocer el estado actual y la evolución de sus contenidos. Método: Se realizó de un estudio descriptivo y transversal de forma retrospectiva, analizando los artículos publicados en la Revista CorSalud entre el primer trimestre del año 2009 y el primer trimestre del año 2013 ambos inclusive, por origen de procedencia del primer autor, tema de publicación, composición y actualización de las fuentes de referencia y número de autores firmantes. Resultados: Se analizaron un total de 199 artículos, el 73,36% de los mismos provenían de Villa Clara, la Cardiología predominó con un 50,25% de la temática, las fuentes de referencias más utilizadas fueron las revistas impresas 79,96% y la actualización de las mismas tuvo una tendencia decreciente anual del 7,78% aunque se mantuvo con una media del 47,05% y el Índice de Colaboración entre los autores alcanzó una media de 3,75%. Conclusiones: La mayoría de los artículos provenían la región central, los artículos originales, breves, de revisión y especiales fueron la generalidad. Preponderaron los temas de Cardiología, las fuentes de referencias utilizadas mayormente fueron las revistas impresas, la actualización de las mismas se mantiene en niveles comparables internacionalmente, al igual del Índice de Colaboración entre los autores que mostró además, una tendencia creciente.

Actualización en marcadores genéticos ultrasonográficos del 1º trimestre del embarazo

Directory of Open Access Journals (Sweden)

Felicia Amaralis Trull Martínez

2010-01-01

Full Text Available Se aborda el tema de los marcadores ultrasonográficos del 1º trimestre del embarazo, brindando una actualización del tema. Se hace énfasis en los marcadores predictivos de las anomalías congénitas más frecuentes y se concluyó con importantes aspectos a tener en cuenta para una correcta interpretación de estos hallazgos.

BUENAS PRÁCTICAS DE AULAS VIRTUALES EN LA DOCENCIA UNIVERSITARIA SEMIPRESENCIAL

Directory of Open Access Journals (Sweden)

Manuel Area Moreira

2010-02-01

Full Text Available En este artículo presentamos el diseño y resultados de un estudio realizado en la Universidad de La Laguna (ULL destinado a identificar buenas prácticas de aulas virtuales en la docencia universitaria desarrolladas bajo la modalidad de blended learning o enseñanza semipresencial. El estudio se desarrolló en el primer trimestre del año 2008 y analizó una importante muestra de las aulas virtuales (N= 107 existentes en el Campus Virtual de dicha universidad en el periodo 2005-07. Se seleccionaron seis ejemplos de aulas virtuales, clasificados por campos científicos, caracterizadas por la incorporación de recursos de información, de comunicación y de aprendizaje experiencial.

Resultados de aprendizaje en América Latina a partir de las evaluaciones nacionales

OpenAIRE

Murillo Torrecilla, Francisco Javier; Román, Marcela

2008-01-01

El artículo analiza y compara los resultados del desempeño escolar de estudiantes de los últimos cursos de Educación Primaria y primeros grados de Educación Secundaria de 15 países América Latina. Lo hace desde la información y datos obtenidos de los reportes que han elaborado las propias unidades de evaluación de los Ministerios de Educación de los respectivos países para trabajar y difundir los resultados. El estudio analiza, en primer lugar, la situación actual del rendimiento escolar a pa...

Proteína C reactiva plasmática en el segundo trimestre para predicción de parto pretérmino

Directory of Open Access Journals (Sweden)

I. Suarez-Torres

2016-06-01

Conclusión: Las concentraciones plasmáticas de proteína C reactiva en el segundo trimestre están elevadas en las embarazadas que posteriormente presentan parto pretérmino, pero no son útiles en la predicción de este.

Primer3_masker: integrating masking of template sequence with primer design software.

Science.gov (United States)

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

El impacto del liderazgo en los resultados de los estudiantes: Un análisis de los efectos diferenciales de los tipos de liderazgo

OpenAIRE

Robinson, Viviane M. J.; Lloyd, Claire A.; Rowe, Kenneth J.

2014-01-01

El propósito de este estudio fue examinar el impacto relativo de los diferentes tipos de liderazgo en los resultados académicos y no académicos de los estudiantes. La metodología consistió en el análisis de los resultados de 27 estudios publicados sobre la relación entre liderazgo y resultados de los estudiantes. El primer meta-análisis, que incluyó 22 de los 27 estudios, implicó una comparación de los efectos de la transformación y liderazgo instructivo en los resultados de los estudiantes. ...

Proyecto DIL-D: Grado de Desarrollo de políticas y estrategias de Integración Laboral de las personas con Discapacidad en las organizaciones que operan en territorio nacional. Informe de investigación Resultados del primer año

OpenAIRE

Romeo, Marina; Yepes-Baldó, Montserrat; Boria, Sefa; Pascual, Carlos; Berger, Rita; Barbancho, Fernando; Torres, Luis

2013-01-01

El presente informe expone los principales resultados alcanzados en el primer año de andadura de la Cátedra UB – Fundación Adecco para la Integración Laboral de Personas con Discapacidad. Esta Cátedra parte de la necesidad de analizar y evaluar el impacto que tiene en las empresas una estrategia de Responsabilidad Social Corporativa (RSC) orientada a la integración laboral de las personas con discapacidad, en la calidad de vida laboral y en los niveles de efectividad organizacional. Los resul...

Comportamento de lactentes nascidos a termo pequenos para a idade gestacional no primeiro trimestre da vida

OpenAIRE

Mello,Bernadete Balanin A.; Gonçalves,Vanda M. Gimenes; Souza,Elisabete Abib P.

2004-01-01

O objetivo foi comparar o comportamento de lactentes nascidos a termo com peso adequado (AIG) a lactantes pequenos para a idade gestacional (PIG), no primeiro trimestre de vida. A amostra foi de 20 lactentes, avaliados no 1º, 2º e 3º meses. Foram utilizadas as Escalas Bayley de Desenvolvimento Infantil - II, com ênfase na Escala de Classificação do Comportamento (ECC). Houve diferença significativa entre os grupos no 2º mês, com maior número de lactentes PIG classificados como alterados na EC...

Precariedad laboral de jóvenes asalariados en la ciudad de Toluca, 2005-2010

Directory of Open Access Journals (Sweden)

Yuliana Gabriela Román-Sánchez

2015-01-01

Full Text Available El nuevo contexto laboral está caracterizado por la precarización de la mano de obra, problema que afecta sobre todo a los jóvenes. Bajo este preámbulo, el objetivo del artículo es analizar las condiciones laborales de la población asalariada en la ciudad de Toluca desde una perspectiva de género. De manera precisa, se pretende estimar diferentes niveles de la precariedad laboral según grandes grupos de edad, así como de hombres y mujeres entre los 14 y 29 años de edad. Esto se realizó a través de la estimación del Índice de Precariedad Laboral con datos de la Encuesta Nacional de Ocupación y Empleo (enoe del primer trimestre de 2005 y primer trimestre de 2010.

UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

Directory of Open Access Journals (Sweden)

Nomin Batnyam

2012-01-01

Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

Otra forma de evaluar: Análisis de resultados.

Directory of Open Access Journals (Sweden)

Segovia González, Mª Manuela

2007-01-01

Full Text Available Desde el curso 2002-2003 se viene aplicando en la asignatura de Matemáticas de primer curso de la Diplomatura de Ciencias Empresariales en la Universidad Pablo de Olavide un método de evaluación especial (llamado Plan de Calidad debido al elevado número de no presentados y suspensos en la citada asignatura.En la primera parte de este trabajo se describe el método de evaluación aplicado y la innovación docente que se ha hecho en la asignatura. En la segunda parte se ha realizado un análisis para ver si con esta nueva metodología los resultados obtenidos por los alumnos son mejores.

Resultados maternos e perinatais em gestantes portadoras de leucemia Maternal and perinatal outcomes in pregnant women with leukemia

Directory of Open Access Journals (Sweden)

Roseli Mieko Yamamoto Nomura

2011-08-01

Full Text Available RESUMO OBJETIVO: Descrever as complicações maternas e os resultados perinatais entre as gestantes com diagnóstico de leucemia que foram acompanhadas no pré-natal e no parto em hospital universitário. MÉTODOS: Estudo retrospectivo do período de 2001 a 2011, que incluiu 16 gestantes portadoras de leucemia acompanhadas pela equipe de pré-natal especializado em hemopatias e gestação. Nas leucoses agudas, diagnosticadas após o primeiro trimestre, a recomendação foi realizar a quimioterapia apesar da gestação em curso. Nas gestantes com leucoses crônicas, quando controladas do ponto de vista hematológico, foram mantidas sem medicação durante a gravidez, ou, foi introduzida terapêutica antineoplásica após o primeiro trimestre. Foram analisadas as complicações maternas e os resultados perinatais. RESULTADOS: A leucemia linfoide aguda (LLA foi diagnosticada em cinco casos (31,3%, a leucemia mieloide aguda (LMA em dois casos (12,5% e a leucemia mieloide crônica (LMC em nove casos (56,3%. Nos casos de leucemias agudas, dois (28,6% casos foram diagnosticados no primeiro trimestre, dois (28,6% no segundo e três (42,9% no terceiro. Duas gestantes com LLA diagnosticada no primeiro trimestre optaram pelo aborto terapêutico. Quatro casos de leucemia aguda receberam tratamento quimioterápico na gestação, com diagnóstico estabelecido após a 20ª semana. Em um caso de LLA com diagnóstico tardio (30ª semana a quimioterapia foi iniciada após o parto. Todas as gestantes com leucemia aguda evoluíram com anemia e plaquetopenia, quatro casos (57,1% evoluíram com neutropenia febril. Das gestantes com LMC, quatro utilizavam mesilato de imatinibe quando engravidaram, três delas suspenderam no primeiro trimestre e uma no segundo. Durante a gravidez, três (33,3% não necessitaram de terapêutica antineoplásica após suspensão do imatinibe; e em seis (66,7% foram utilizadas as seguintes drogas: interferon (n=5 e/ou hidroxiureia (n=3. No

Clorhidrorrea congénita:: primer reporte en Cuba Congenital chlorhydria:: first report in Cuba

Directory of Open Access Journals (Sweden)

Carlos Ramírez Pérez

2009-12-01

Full Text Available En el presente trabajo se exponen los antecedentes prenatales, perinatales y posnatales de un lactante de 6 meses de edad, del sexo masculino, con clorhidrorrea congénita, así como el cuadro clínico, diagnóstico y tratamiento utilizado. Un elemento significativo lo constituyó la expulsión anal de abundante líquido no meconial desde las primeras horas de nacido, así como alcalosis metabólica grave y la presencia de desnutrición rápidamente progresiva. En los exámenes complementarios se constató hipocloremia de un 50 % con respecto a las cifras de referencia y un pH sanguíneo mayor de 7,50. El diagnóstico confirmatorio se obtuvo al comprobar concentraciones de cloro en heces fecales superiores a las de la suma de sodio y potasio. Se proponen indicadores diagnósticos prenatales entre los que tienen gran valor la consanguinidad, el polihidramnios y los resultados del ultrasonido en el tercer trimestre del embarazo. El diagnóstico precoz permitió establecer el tratamiento y evitó el frecuente desenlace fatal. Es el primer caso de esta enfermedad que se informa en el país.In present paper are showed the prenatal, perinatal and postnatal backgrounds from a male breast-fed baby aged 6 months presenting with congenital chlorhydria, as well as the clinical picture, diagnosis and treatment applied. A significant element was the anal expulsion of non-meconium abundant fluid from the first hours of born, as well as a severe metabolic alkalosis and the presence of a quickly progressive malnutrition. In complementary examinations was confirmed a 50% hypochloremia regarding the reference figures and a blood pH over 7,50. Confirmatory diagnosis was achieved verifying the chlorine concentrations in feces higher to that of the sum of sodium and potassium. Prenatal diagnostic indicators are proposed those with higher value including the consanguinity, polyhydramnios and the US results during the third trimester of pregnancy. Early diagnosis

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

Science.gov (United States)

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Determinantes de la transmisión vertical del VIH en Cataluña (1997-2001: ¿es posible su eliminación?

Directory of Open Access Journals (Sweden)

Ramos F.

2003-01-01

Full Text Available Objetivos: Identificar y describir los factores que han hecho posible la existencia de nuevas infecciones de VIH por transmisión vertical desde la implementación del tratamiento antirretroviral en la gestante seropositiva (1997-2001 en Cataluña. Métodos: Revisión sistemática de casos identificados en servicios de pediatría de todos los hospitales de Cataluña. Resultados: Se identificaron 28 casos de infección pediátrica por VIH: 9, 9, 8, 2 y 0 por año de nacimiento de 1997 a 2001, respectivamente. De 16 madres con diagnóstico de infección por VIH conocido antes o durante el embarazo, 9 realizaron profilaxis antirretroviral durante éste (5 con buena adhesión, uno desconocido y el resto con mala adhesión y 7 no realizaron profilaxis (6 por rechazo y uno no se conoce. De 12 diagnosticadas después del parto, 5 fueron embarazos no controlados y el resto poco o bien controlados. De estos últimos, en 6 no se practicó serología para VIH y en uno fue negativa en el primer trimestre. Conclusiones: La transmisión vertical del VIH en Cataluña ha disminuido en los últimos años, pero se han producido infecciones por la mala implementación en algún caso de las medidas preventivas conocidas. Debería ofrecerse la prueba diagnóstica para VIH a toda gestante no sólo en el primer trimestre de embarazo sino también al final, si se sospecha exposición al virus, y en caso de gestaciones no controladas hay que usar pruebas diagnósticas de lectura rápida en la sala de partos.

Normal development of fetal hepatic haematopoiesis during the second trimester of gestation is upregulated by fibronectin expression in the stromal cells of the portal triads El desarrollo normal de la hematopoyesis hepática fetal durante el segundo trimestre de embarazo está regulado al alza por la expresión de fibronectina en las células del estroma de las tríadas portales

Directory of Open Access Journals (Sweden)

D. Tamiolakis

2007-10-01

-renovación, la proliferación y el crecimiento de las células madre hematopoyéticas, al interactuar con las células progenitoras hematopoyéticas. Se sabe que las glucoproteínas de la MEC producidas por las células del estroma desempeñan un papel crítico en la regulación del crecimiento y la diferenciación celulares. Se han documentado numerosos factores solubles y de membrana que regulan directamente la hematopoyesis, pero se sabe poco de la actividad de las células del estroma hepático y de la proteína (fibronectina de la matriz extracelular en el feto en relación con la hematopoyesis hepática. La unión de las células eritroides tardías a la fibronectina está bien tipificada y se cree que es crítica para las etapas terminales de la diferenciación eritroide. La intención de este artículo es determinar el papel de la fibronectina en la proliferación y diferenciación hematopoyética del hígado fetal en las distintas etapas del desarrollo. Material y método: examinamos y comparamos la expresión inmunohistoquímica de fibronectina en los campos portales del estroma hepático durante los trimestres primero, segundo y tercero del embarazo en relación con la aparición de células progenitoras hematopoyéticas CD34, progenitoras del estroma y endoteliales vasculares, respectivamente. Resultados: nuestros resultados mostraron una diferencia cuantitativa en cuanto a expresión de fibronectina en el estroma del tejido conjuntivo de los campos portales en el segundo trimestre de embarazo respecto al primero (p < 0,0001, prueba de la t y respecto al tercero (p < 0,0001, prueba de la t. Se hallaron también cambios similares en cuanto a la expresión de CD34 respecto al primer (p < 0,0001, prueba de la t y el tercer trimestres (p < 0,0001, prueba de la t, lo que indica la participación directa de la fibronectina en el mantenimiento de la actividad hematopoyética. Conclusiones: nuestros datos aportan pruebas de que un componente de la glucoproteina de la MEC, la

El primer encuentro del padre con el bebé prematuro en la Unidad de Cuidados Intensivos Neonatales

Directory of Open Access Journals (Sweden)

Fernanda Martins Castro

2015-06-01

Full Text Available Objetivo: Describir el primer encuentro del padre con el hijo en la Unidad de Cuidados Intensivos Neonatales (UCIN y analizar el significado de este momento en la perspectiva de los padres. Método: estudio cualitativo, con ocho padres de niños prematuros, a través de entrevistas semi-estructuradas. Los datos se analizaron a través del análisis temático. Resultados: Surgieron tres núcleos temáticos: "primer encuentro con hijo prematuro: sentimientos paternales y emociones", "construcción de la relación entre los profesionales y los padres de los recién nacidos a partir del primer encuentro" y reconocimiento de la paternidad en el contexto de la UCIN. Conclusión: El primer encuentro del padre con su hijo en la UCIN provoca sentimientos y sorpresa, dolor, incertidumbre, alegría y esperanza. El equipo de salud debe estar preparado para brindar apoyo emocional, información y establecer una comunicación efectiva desde la primera visita.

Polyacid macromolecule primers

Science.gov (United States)

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

2011-01-01

containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

Science.gov (United States)

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Caries dental asociada a factores de riesgo durante el embarazo The dental caries associated with risk factor during pregnancy

Directory of Open Access Journals (Sweden)

Antonio Cecilio Pérez Oviedo

2011-06-01

Full Text Available El periodo gestacional se relaciona con una mayor incidencia de caries dental, aunque la asociación entre gestación e incremento de caries no ha podido aún ser científicamente demostrada. Se propuso realizar un estudio para determinar la presencia de caries dental y algunos factores de riesgo asociados en el primer y tercer trimestre del embarazo, para detectar la aparición de lesiones cariosas nuevas y cambios relacionados con los factores de riesgo entre ambos trimestres. Se realizó un estudio descriptivo longitudinal desde diciembre de 2006 a febrero de 2008 en el municipio de Florida, Camagüey, Cuba. El universo de estudio estuvo constituido por 38 embarazadas y la muestra por 21, que fueron interrogadas y examinadas en ambos trimestres con el objetivo de determinar la presencia de caries y los factores de riesgo asociados como: higiene bucal deficiente, dieta cariogénica, pH salival bajo, ocurrencia de vómitos y embarazo previo. La información necesaria fue recogida en un formulario confeccionado al efecto. En el primer trimestre el 80,95 % estaban afectadas por caries dental y se observó aparición de lesiones nuevas en 6 embarazadas, en el tercer trimestre. Los factores de riesgo presentados con mayor frecuencia en el primer trimestre fueron la dieta cariogénica en el 66,66 % y la higiene bucal deficiente en el 47,61 % de las pacientes. Ninguna embarazada modificó la dieta durante el embarazo, sin embargo la higiene bucal deficiente persistió en el 14,28 %. El 52,38 % de las embarazadas afectadas en el primer trimestre consumían dieta cariogénica y el 47,61 % habían tenido embarazo previo. Se concluyó que hubo afectación por nuevas caries durante el embarazo, los factores de riesgo que predominantes fueron la dieta cariogénica, la higiene bucal deficiente y el embarazo previo. Las pacientes no modificaron la dieta durante el embarazo, pero sí mejoraron la higiene bucal. Todas las que presentaban vómitos y pH salival

La demanda de cigarrillos y el aumento de impuestos en El Salvador

Directory of Open Access Journals (Sweden)

Alejandro Ramos-Carbajales

Full Text Available RESUMEN Objetivo Analizar las elasticidades de corto plazo y de largo plazo de la demanda de cigarrillos en El Salvador como instrumento para apoyar recomendaciones sobre aumentos de impuestos para reducir la prevalencia y el consumo vía aumento de precios. Métodos Se analizó la demanda de cigarrillos en El Salvador mediante un modelo econométrico de series de tiempo con una base de datos proveniente de la Dirección General de Impuestos Internos (DGII y la Dirección General de Estadística y Censos (DIGESTYC de El Salvador. El período de análisis fue trimestral: 2000Q1-2012T4. Se realizaron las pruebas habituales para evitar que la estimación econométrica fuera espuria. Se halló que las variables ventas en volumen, los precios reales de venta y el ingreso real per cápita estaban cointegradas de primer orden; este resultado permite utilizar un modelo de corrección de error con estimaciones de las elasticidades en el corto plazo y en el largo plazo. Resultados Se halló que solo las elasticidades de largo plazo son estadísticamente significativas al 5% de probabilidad. Los resultados señalan una elasticidad precio de largo plazo (cinco trimestres de -0,9287 e ingreso de 0,9978. Conclusiones El nivel del valor absoluto de la elasticidad precio es algo elevada, aunque está dentro de los niveles estimados en otros estudios en los países de menores ingresos per cápita. Un aumento del impuesto de un monto base de USD (dólares estadounidenses 1,04 por cajetilla de 20 cigarrillos a USD 1,66 en un período de tres años reduciría la demanda entre 20% y 31% y aumentaría los ingresos fiscales entre 9% y 22%.

Relevancia valorativa del resultado global y sus Componentes frente al resultado neto

Directory of Open Access Journals (Sweden)

Núria Arimany Serrat

2011-08-01

Full Text Available Este trabajo tiene como objeto verificar si el resultado global presenta mayor relevancia valorativa respecto al resultado tradicional, y si es así cuáles son los componentes del resultado global que explican las diferencias. El estudio muestra que el resultado global es una variable relevante tanto para explicar el valor intrínseco de la empresa como para explicar su rentabilidad. Sin embargo, sólo al explicar la rentabilidad el resultado global y su incremento aumentan la relevancia valorativa del resultado neto y su incremento. De los componentes analizados del resultado global, tan sólo los resultados por diferencias de conversión de la moneda extranjera a la moneda de presentación añaden poder explicativo adicional al del resultado neto, aunque sólo en los modelos de rentabilidad. Ni los resultados por valoración de instrumentos financieros a valor razonable con cambios en patrimonio ni los resultados por coberturas de flujos de efectivo aportan un mayor poder explicativo al del resultado neto.

Factores asociados al rendimiento académico en estudiantes de medicina

Directory of Open Access Journals (Sweden)

Alberto Vélez van Meerbeke

Full Text Available Objetivos: Determinar y evaluar los factores que estuvieran incidiendo en el desempeño académico de nuestros estudiantes de primer semestre de medicina. Metodología: Se caracterizó la población en búsqueda de factores que se analizaron posteriormente para determinar asociación y predicción, a través de un modelo de regresión logística, del rendimiento académico final. Resultados: Se analizaron 80 estudiantes de edades comprendidas entre 17 y 18, la mayoría mujeres, procedentes de Bogotá, de colegios mixtos, privados y monolingües. El grupo fue homogéneo por factores sociodemográficos, culturales, escolaridad y de motivaciones. Se detectaron rasgos de violencia intrafamiliar, de consumo de alcohol y cigarrillo pero no de drogas psicoactivas. Los resultados obtenidos en la prueba de aptitudes diferenciales y generales (BADyGs del aprendizaje fueron bajos. El análisis mostró que el no leer como pasatiempo, la presencia de violencia intrafamiliar, el haber fumado marihuana, el provenir de un colegio mixto, el no haber realizado estudios profesionales, de quien se depende económicamente, las notas de biología, bioquímica y del promedio trimestral fueron los factores que se asocian con fracaso académico o pérdida de cupo. La variable que predice fracaso académico cuando se controla por los otros factores incluidos en el modelo es el promedio trimestral y la que determina pérdida de cupo es la nota del laboratorio de bioquímica. Conclusiones: Aunque existen factores previos al ingreso que puedan explicar el desempeño académico, es importante evaluar el rendimiento durante el semestre para intervenir rápidamente y evitar el fracaso.

FACTORES AMBIENTALES Y GENÉTICOS QUE INFLUYEN SOBRE LA EDAD AL PRIMER PARTO EN HEMBRAS DE LA RAZA ROMOSINUANO

Directory of Open Access Journals (Sweden)

Marco Suárez

2006-05-01

Full Text Available Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto dehembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer partode hembras de la raza Romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA,Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizóel análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995.Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%.El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativasde variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entremedias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en laedad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y elsexo de la cría no se constituyen en características importantes a tener en cuenta.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

Science.gov (United States)

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

EL EMPLEO PRECARIO DE JÓVENES ASALARIADOS EN MÉXICO. EL CASO DE TOLUCA, TIJUANA Y MÉRIDA (2005-2010

Directory of Open Access Journals (Sweden)

YULIANA GABRIELA ROMÁN SÁNCHEZ

2013-01-01

Full Text Available La globalización y la reestructuración productiva han configurado una nueva dinámica en los mercados de trabajo a nivel mundial. Este nuevo contexto laboral está caracterizado por la precari- zación de las condiciones laborales, fenómeno que no es exclusivo de algún sector de la población pero que los afecta de manera diferenciada, siendo los jóvenes uno de los grupos más vulnerables. El objetivo de este artículo es analizar las condiciones laborales de la población joven asalariada de tres ciudades mexicanas: Toluca, Tijuana y Mérida. Para ello, se estimó para estas tres ciudades un índice de precariedad laboral para el primer trimestre de 2005 y 2010. Los resultados muestran que la ciudad de Toluca registra una mayor proporción de jóvenes en empleos precarios, contra la ciudad de Tijuana donde se registran mejores condiciones laborales.

Evaluación del impacto de la intervención educativa-motivacional "Como Jugando" para prevenir la obesidad en escolares del Cercado de Lima: resultados al primer año

Directory of Open Access Journals (Sweden)

Juan Pablo Aparco

Full Text Available RESUMEN Objetivo. Determinar el impacto, al primer año, de la intervención educativa-motivacional "Como Jugando" sobre el índice de masa corporal (IMC, conocimientos en alimentación, niveles de actividad física y patrones de consumo alimentario en escolares del 1.° al 4.° grado de primaria, de cuatro instituciones educativas (IE del Cercado de Lima. Materiales y métodos. Estudio cuasiexperimental, controlado. Se evaluó el IMC, conocimientos en nutrición, frecuencia de consumo de alimentos y nivel de actividad física. "Como Jugando" incluyó actividades lúdicas y vivenciales para escolares e involucró a docentes y padres. El impacto se estimó aplicando la prueba de McNemar para muestras relacionadas y modelos de regresión de diferencias en diferencias ajustados por variables relativas al escolar y la madre. Resultados. El estudio incluyó a 696 escolares de 2 IE de intervención y 2 IE de control, el puntaje Z de IMC y las prevalencias de obesidad no variaron durante el periodo de estudio. La intervención mostró impacto en mejorar los conocimientos en nutrición (OR: 1,46; IC95%: 1,17-1,81 redujo el riesgo de tener un nivel malo de actividad física (OR: 0,63; IC95%: 0,46-0,87 y mejoró los patrones de consumo de todos los alimentos, salvo verduras (grupo intervención. Conclusiones. La intervención "Como Jugando", al primer año de implementación, no redujo el Puntaje Z del IMC, sin embargo, tuvo impacto sobre los conocimientos en nutrición, redujo la probabilidad de tener un nivel malo de actividad física y mantuvo o aumentó la frecuencia adecuada del consumo de frutas, agua sin azúcar, jugos envasados y galletas dulces y saladas. Es necesario continuar evaluando la intervención "Como Jugando" para estimar el impacto sobre indicadores biológicos.

Relevancia valorativa del resultado global y sus componentes frente al resultado neto

Directory of Open Access Journals (Sweden)

Núria Arimany Serrat

2011-12-01

Full Text Available Este trabajo tiene como objeto verificar si el resultado global presenta mayor relevancia valorativa respecto al resultado tradicional, y si es así cuáles son los componentes del resultado global que explican las diferencias. El estudio muestra que el resultado global es una variable relevante tanto para explicar el valor intrínseco de la empresa como para explicar su rentabilidad. Sin embargo, sólo al explicar la rentabilidad el resultado global y su incremento aumentan la relevancia valorativa del resultado neto y su incremento. De los componentes analizados del resultado global, tan sólo los resultados por diferencias de conversión de la moneda extranjera a la moneda de presentación añaden poder explicativo adicional al del resultado neto, aunque sólo en los modelos de rentabilidad. Ni los resultados por valoración de instrumentos financieros a valor razonable con cambios en patrimonio ni los resultados por coberturas de flujos de efectivo aportan un mayor poder explicativo al del resultado neto.This study analyses if comprehensive income is more value relevant than the net income and, if that is the case, what are the elements of the comprehensive income explaining the difference. Our study shows that comprehensive income is a relevant variable both to explain the value of the company and also to explain its return. However, comprehensive income and its variation show to be more relevant than the net income and its variation only when explaining return. As for the components of the comprehensive income, foreign currency adjustments increase usefulness in the return models but cash flow hedges and adjustments due to fair value valuation do not add value relevance to the net income.

NUEVO ESTUDIO SOBRE EL PERFIL DE LOS ALUMNOS DE PRIMER CURSO DE LA ESCUELA DE INGENIERIA TECNICA INDUSTRIAL

Directory of Open Access Journals (Sweden)

Angel Valea

2014-01-01

Full Text Available El trabajo estudia la valoración de las respuestas a un cuestionario respondido por los alumnos que cursan la asignatura de Quí mica del primer curso universitario , mater ia obligatoria de la Ingeniería Industrial, y que pertenecen a las especialidades de Mecánica y de Qu í mica Industrial. El cuestionario está configurado en base a 30 preguntas de selección múltiple, y que pertenecen a 4 áreas significativas (contenidos de l a asignatura, metodología, profesorado y alumnado. Con los resultados se ha realizado una agrupación seleccionando 12 bloques significativos sobre los que se aportan resultados estadísticos y/o interpretación de los resultados. Se pretende conocer desde l a perspectiva de los alumnos, las costumbres y las debilidades como estudiantes.

Teenage pregnancy: use of drugs in the third trimester and prevalence of psychiatric disorders Gravidez na adolescência: uso de drogas no terceiro trimestre e prevalência de transtornos psiquiátricos

Directory of Open Access Journals (Sweden)

Sandro Sendin Mitsuhiro

2006-06-01

Full Text Available OBJECTIVE: To determine the prevalence of psychiatric disorders during pregnancy, the prevalence of cocaine and marijuana use during the third trimester of gestation and the socio-demographic characteristics of a population of low-income teenagers. METHOD: One thousand pregnant teenagers were evaluated using the Composite International Diagnostic Interview, and a socio-demographic and socio-economic questionnaire at the obstetric center of a public hospital in São Paulo, Brazil. Hair sample was collected for analysis. RESULTS: Of the 1000 pregnant teenagers interviewed, 53.6% were poor, 90.4% were unemployed, 92.5% were financially dependant and 60.2% dropped out of school. Those using drugs during the third trimester of pregnancy were equal to 6% (marijuana: 4%, cocaine: 1.7%, both: 0.3%. Those having at least one psychiatric disorder equaled 27.6%. The most frequent diagnoses were depression (12.9%, posttraumatic stress disorder (10.0% and anxiety disorders (5.6%. DISCUSSION: Unstructured families, dropping out of school, unemployment and a low level of professional training are all contributing factors to the maintenance of an unfavorable socio-economic environment in which there is a high prevalence of cocaine and marijuana use during the third trimester of pregnancy and an abnormally high incidence of psychiatric disorders.OBJETIVO: Determinar, em adolescentes de baixa renda, a prevalência de transtornos psiquiátricos durante a gravidez, a prevalência de uso de cocaína e maconha no terceiro trimestre de gestação e descrever suas características sociodemográficas. MÉTODO: Mil adolescentes grávidas foram avaliadas por meio do Composite International Diagnostic Interview e de um questionário sociodemográfico e socioeconômico no centro obstétrico de um hospital público de São Paulo. Dessas, foi colhida amostra para análise de fios de cabelo. RESULTADOS: Das mil pacientes entrevistadas, 53,6% têm baixa renda, 60,2% abandonaram

Lactancia materna, alimentación artificial y el primer contacto con azúcar

Directory of Open Access Journals (Sweden)

Fabian Calixto Fraiz

2013-01-01

Full Text Available Objetivo: Este estudio evaluó los cambios en el patrón de lactancia materna, alimentación artificial y en la introducción de azúcar en la dieta de niños de 0 a 36 meses, a través de dos estudios, con un intervalo de 13 años en la ciudad de Curitiba, Paraná, Brasil. Material y métodos: Poblaciones semejantes de una misma región geográfica fueron evaluadas a través de un cuestionario, en los años de 1993 y 2006, envolviendo, respectivamente, las madres de 180 y 94 niños. Introducción de azúcar en la dieta fue considerada precoz cuando ocurrió antes del 6º mes completo de vida. Los datos fueron analizados estadísticamente a través del test de qui-cuadrado y test exacto de Fisher (α= 0,05. Resultados: Hubo diferencias en la frecuencia del primer contacto con azúcar (p <0,001, que ocurrió en el primer mes de vida en 61,7% de los niños del primer estudio y en sólo 3,2% de los niños del segundo estudio. Hubo diferencias en el patrón de lactancia materna (p = 0,02, siendo la prevalencia de niños amamantados mayor en el segundo estudio. No fueron encontradas diferencias estadísticamente significativas en la prevalencia de uso de biberón, uso de biberón durante la noche y lactancia materna durante la noche, así como en el uso de biberón conteniendo azúcar. Conclusiones: Estos resultados indican que la lactancia materna puede, además de sus varias ventajas, también promover el aplazamiento de la introducción de azúcar en la dieta infantil. Nuevas investigaciones son necesarias para confirmar esta hipótesis.

Los pacientes trasladados desde otro centro: fuente de infección de microorganismos multiresistentes. resultados de seis años de programa de vigilancia activa

Directory of Open Access Journals (Sweden)

E. Beatrice Hervé, Dra.

2014-05-01

Resultados: En los años estudiados la tasa de positividad para MOMR osciló entre 16,4% y 9,8%. La distribución por MOMR, para el conjunto de los años en estudio, fue la siguiente: SAMR un 20–25%; ERV, entre 35 y 49% y; B Gram negativos un 38–60%. Por otro lado, la sensibilidad del sistema de vigilancia evaluada durante el primer semestre de 2010 fue de un 91% para aislamiento y de un 93% para los cultivos. En base a los resultados obtenidos durante primer semestre de 2011 de características de pacientes colonizados, se estableció el 2012 un algoritmo que considera: centro de origen, edad, tiempo de permanencia en centro de origen y unidad de destino, para definir la necesidad de dejar o no a un paciente trasladado con medidas de aislamiento. Esto permite realizar una acción más racional y costo-efectiva para el control de MOMR en nuestro establecimiento, reduciendo la carga de aislamientos y cultivos en un 20%.

Correlation between the Doppler velocimetry findings of the uterine arteries during the first and second trimesters of pregnancy Correlação entre os achados doppplervelocimétricos das artérias uterinas no primeiro e segundo trimestres da gestação

Directory of Open Access Journals (Sweden)

Adolfo Wenjaw Liao

2009-01-01

édio foi descrita e diferentes percentis calculados. Também foi anotada a presença ou ausência de incisura uterina protodiastólica. Os achados dopplervelocimétricos observados no primeiro trimestre foram correlacionados com os achados do segundo trimestre. RESULTADOS: Trezentos e quarenta e quatro mulheres com gestações únicas de desfecho normal foram examinadas inicialmente em idade gestacional média de 12,7 semanas. Os valores correspondentes aos percentis 50 e 95 para o IP médio foram de 1,69 e 2,48, respectivamente. Incisura bilateral foi observada em 44% dos casos e unilateral em 19%. Na segunda avaliação, realizada em idade gestacional média de 23,2 semanas, os valores correspondentes aos percentis 50 e 95 do IP médio foram de 1,03 e 1,57, respectivamente. Incisura bilateral foi observada em 4,4% dos casos na segunda avaliação. Os índices dopplervelocimétricos do primeiro exame se correlacionaram de forma significativa e positiva com os valores do segundo trimestre (r= 0,42; p<0,0001. CONCLUSÃO: O estudo dopplervelocimétrico endovaginal das artérias uterinas pode ser realizado de forma satisfatória e incorporado nos exames ultrassonográficos oferecidos como parte da rotina de acompanhamento pré-natal no primeiro e segundo trimestres da gestação. Índices dopplervelocimétricos uterinos médios observados entre 11 e 14 semanas são significativamente maiores do que entre 20 e 25 semanas, e esses valores se correlacionam de forma positiva e significativa.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

Science.gov (United States)

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

30 CFR 56.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Diagnóstico prenatal citogenético mediante amniocentesis durante los trimestres II y III de gestación en Costa Rica

Directory of Open Access Journals (Sweden)

Isabel Castro Volio

2001-12-01

Full Text Available El objetivo de este estudio fue identificar cromosomopatía fetal en voluntarias con embarazos de alto riesgo genético, brindar adecuada atención obstétrica y pediátrica y asesoramiento genético. En 842 embarazadas se obtuvo células fetales mediante amniocentesis, realizadas desde 1986 hasta 1999 inclusive. Las punciones se realizaron en hospitales del sistema de seguridad social y en la consulta privada. La indicación del 48 % de las amniocentesis fue el examen ultrasonográfico anormal y el 35 % de las punciones fue por edad materna avanzada. El 66 % de las veces el estudio se realizó en el II trimestre del embarazo y el 34 % en el III trimestre. Se utilizó el sistema cerrado de histocultivo y la cosecha por suspensión. El resultado final se obtuvo en 14 días (mediana. De las 842 muestras de líquido amniótico, en 217 no fue posible obtener resultados. Los 625 cariotipos fetales fueron anormales en 55 casos (9 %: 33 cariotipos trisómicos (incluyendo una trisomía 13 por translocación Robertsoniana de los cromosomas 13 y 14, ocho casos con síndrome de Turner (45,X, tres mosaicos cromosómicos (incluyendo una trisomía 22 en mosaico y 11 cariotipos anormales por otras causas. Al comparar la cantidad de defectos cromosómicos en relación a la indicación para efectuar la amniocentesis, se encontró un 17 % de cromosomopatía en los casos estudiados por ultrasonograma anormal y 2.5 % en los casos investigados por razón de la edad materna. En el seguimiento de 211 casos se encontró concordancia entre el cariotipo y el fenotipo del recién nacido, al igual que entre el diagnóstico ultrasonográfico fetal y la condición del neonato. El diagnóstico prenatal de cromosomopatía permitió el asesoramiento genético y el manejo obstétrico y pediátrico de los casos de manera adecuada. En los embarazos con cariotipo normal, esta información alivió la preocupación de muchos de los padresThe identification of fetal abnormal

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

International Nuclear Information System (INIS)

Bowman, Stephen M.

2008-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

Homofobia y/o ser enfermero. Primer evento científico de violencia. Segundo trimestre del año 2009. Pinar del Río Homophobia and/or to be a male nurse. 1st Scientific Event of Violence on the second quarter of 2009. Pinar del Rio

Directory of Open Access Journals (Sweden)

Marisol Rodríguez Lazo

2011-06-01

Full Text Available La homofobia significa un terror irracional e injustificado hacia a los homosexuales y la homosexualidad. Se realizó un estudio descriptivo, a un grupo determinado de hombres del municipio de Pinar del Río con el objetivo de reflexionar sobre la homofobia en cuanto a los enfermeros homosexuales, durante el segundo trimestre del año 2009. El universo estuvo constituido por 147 hombres del municipio de Pinar del Río, a los cuales se le aplicó una encuesta, la muestra fue de 100 hombres seleccionados por el método estadístico al azar simple, lo que indica que se encuesto el 68,02%, obteniéndose los siguientes resultados, el 100% de los encuestados si conocen que es la homofobia, el 77% de los encuestados si sienten rechazo por los homosexuales, la totalidad de los encuestados no consideran que todos los enfermeros sean homosexuales, un 29% consideran que el trabajo de los enfermeros homosexuales es mejor, y el 70% de los encuestados opinan que la mayoría de los enfermeros que optan por su profesión tienen orientación por personas de su mismo sexo.Homophobia means an irrational and unjustified fear to homosexuals and homosexuality. A descriptive study was conducted to a determined group of men in Pinar del Rio municipality. This research was aimed at reflecting on homophobia regarding male homosexual nurses during the second quarter of 2009. The target group included 147 men in Pinar del Rio municipality, this group was polled. The sample was comprised of 100 men chosen at a simple random, which indicated that 68, 02% were surveyed, results showed that: 100% knew what homophobia was, 77% felt aversion to homosexuals, the totality of those polled did not consider all male nurses were homosexuals, 29% considered male homosexual nurses performed their job better, and 70% expressed the opinion that the majority of the male choosing nursing profession experience same-sex attraction.

Las Acciones Sistemáticas en Salud Mejoran el Control y Seguimiento Ponderal de las Embarazadas

Directory of Open Access Journals (Sweden)

Danay Hernández Díaz

2016-02-01

Full Text Available Introducción: El seguimiento sistemático y personalizado de la ganancia de peso gestacional puede constituir una herramienta útil a nivel primario de salud para el binomio madre-hijo para su salud presente y futura. Método: Estudio observacional analítico para determinar si existen diferencias en la evolución ponderal en dos grupos  según sistematicidad en intervención sobre estilos de vida y cultura alimentaria en 256 embarazadas del policlínico Chiqui Gómez en Santa Clara, Cuba desde octubre 2012 a septiembre 2014; las mismas fueron vistas en los tres trimestres de la gestación (190 o sólo en el primero y en el tercer trimestre (66, las que conformaron los dos grupos analizados de acuerdo por la sistematicidad en la asistencia a los encuentros presenciales (consultas. Se calcularon y compararon las ganancias de peso según grupo de pertenencia y estado nutricional pregestacional.  Se usaron métodos de estadística descriptiva y de comparación de grupos por estado nutricional. Resultados: Las gestantes con mayor asistencia a las consultas mostraron durante el segundo trimestre un mayor ajuste a  las ganancias de peso recomendadas, lo cual no pudo comprobarse estadísticamente en el tercer trimestre; no obstante la cuantía de ganancia de peso en las obesas y sobrepeso, en este trimestre, fue menor  que en aquellas que no asistieron regularmente a las consultas.  Conclusiones: La sistematicidad  y personalización de acciones ejecutadas en embarazadas, se asoció a mejor adherencia a la ganancia de peso recomendadas en el segundo trimestre; así como con una disminución de la cuantía de ganancia ponderal, en aquellas pacientes con sobrepeso y obesidad durante el tercer trimestre.

Achados Ultra-Sonográficos em Pacientes com Ameaça de Abortamento no Primeiro Trimestre da Gestação Ultrasound Findings in First-trimester Threatened Abortion

Directory of Open Access Journals (Sweden)

Luiz Carlos Watanabe

2000-06-01

Full Text Available Objetivo: avaliar os achados ultra-sonográficos nas gestantes com ameaça de abortamento no primeiro trimestre da gestação. Métodos: exames de ultra-som obstétrico transabdominal e transvaginal foram realizados nas pacientes com sangramento vaginal e teste de gravidez positivo. Foram incluídas as gestantes entre 6 a 14 semanas de gestação pela data da última menstruação ou pelo exame ultra-sonográfico, que apresentavam colo do útero impérvio ao exame clínico. Foram excluídas as gestações múltiplas ou aquelas que realizaram tentativa de abortamento por meio de drogas ou manipulação. Resultados: em 132 dos 247 casos (53.4% foi diagnosticada gestação viável e em 46.6% (115/247, gestação inviável. Abortamento incompleto foi identificado em 19% (47/247, abortamento completo em 8,5% (21/247, abortamento retido em 7,7% (19/247, gestação anembrionada em 6,1% (15/247, gestação ectópica em 4,5% (11/247 e mola hidatiforme em 0,8% (2/247. Conclusão: aproximadamente metade (46,6% das gestações com ameaça de abortamento no primeiro trimestre apresentaram diagnóstico de inviabilidade da gestação. O exame ultra-sonográfico pode ajudar a definir esta condição e a conduta obstétrica.Objective: to evaluate ultrasound findings in pregnant women with threatened abortion in the first trimester of pregnancy. Methods: transabdominal and transvaginal ultrasound scans were performed in patients with vaginal bleeding with previous positive pregnancy test. Patients with 6-14-week gestation (by the last menstrual period or ultrasound scan, with closed cervix on clinical evaluation were included. Multiple pregnancies and those patients who have tried abortion by using abortive drugs or manipulation were excluded. Results: in 132 of 247 (53.4% the pregnancy was viable and in 46.6% (115/247 the pregnancy was nonviable. Incomplete miscarriage was found in 19% (47/247, complete miscarriage in 8.5% (21/247, missed abortion in 7.7% (19

Crecimiento longitudinal posnatal del primer metatarsiano. [Longitudinal postnatal growth of the first metatarsal bone

Directory of Open Access Journals (Sweden)

Julio J. Masquijo

2014-10-01

Full Text Available Introducción: si bien el crecimiento prenatal y posnatal del pie ha sido documentado hace varios años, el crecimiento longitudinal del primer metatarsiano en particular no ha sido estudiado previamente. El objetivo del estudio es determinar el patrón de crecimiento longitudinal posnatal de este hueso y compararlo con el del pie y los huesos largos del miembro inferior. Materiales y Métodos: mediante una búsqueda informatizada, se identificaron pacientes <18 años de edad con radiografías informadas como “normal” por el radiólogo. Se analizó una muestra de 886 pacientes divididos en 18 grupos según la edad (0-11 meses, 1 año, 2 años, etc. y el sexo. El análisis de las imágenes se realizó con un software de imágenes Kodak Carestream PACS. Resultados: el largo promedio en el primer grupo fue de 19,91 mm (3,20; 15,22-25,62. El largo promedio en el último grupo fue de 66,13 mm (5,33; 52,50-77,18. La tasa de crecimiento anual fue de 2,71 mm. La edad promedio al momento del cierre de la fisis fue de 14.85 años (± 1.64 para los varones y 14.77 años (± 3.63 para las niñas. Conclusión: el crecimiento del primer metatarsiano acompaña el crecimiento longitudinal del pie, pero no el de los huesos largos del miembro inferior. Las curvas de crecimiento del primer metatarsiano descritas en este artículo pueden ser aplicadas en patologías que afectan el desarrollo del pie o que requieren cirugía de corrección sobre el primer metatarsiano, o se las puede emplear como estándar de referencia en futuros estudios.

The Los Alamos primer

CERN Document Server

Serber, Robert

2018-01-01

Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

Expectativas y aspiraciones laborales de jóvenes que cursan primer año de la escuela media

OpenAIRE

Batlle, Silvia; Vidondo, Marcela; Rodríguez, M. F.; Nuñez, María Clara; Dueñas, Mercedes

2009-01-01

En este trabajo se presentarán algunos resultados y conclusiones sobre las expectativas y aspiraciones laborales de jóvenes estudiantes de primer año, entendiendo que éstas son dimensiones claves en la construcción de proyectos laborales. Esta información nos permitirá conocer mejor los posicionamientos actuales de los jóvenes hacia el trabajo, y las representaciones que van conformando respecto a las posibilidades de inserción en el mercado laboral.

Cuidado popular de familias con un adulto mayor sobreviviente del primer accidente cerebrovascular

Directory of Open Access Journals (Sweden)

Lucero López-Díaz

2016-01-01

Full Text Available Introducción: el accidente cerebrovascular afecta a numerosas personas en el mundo y se constituye en la principal causa de muer- te. Los sobrevivientes pueden padecer discapacidad y sufrir modificaciones en las actividades cotidianas. La familia es el principal apoyo del sobreviviente y al ser parte de una misma cultura, construye acciones de cuidado en búsqueda del bienestar. Objetivo: describir las acciones del cuidado popular de las familias con un adulto mayor sobreviviente del primer accidente cerebrovascular. Método: estudio etnográfico, con observación participante y entrevistas en profundidad. Participaron siete familias bogotanas (siete adultos mayores entre los dos y diez meses posteriores al primer accidente cerebrovascular y los siete cuidadores principales respectivos. Resultados: cuidadores y adulto mayor comparten acciones de cuidado para la recuperación, relacionadas con la alimentación, el cuidado personal y la ingesta de medicamentos permeadas por la creencia religiosa, fuente de soporte y vínculo afectivo. Conclusión: conocer el cuidado popular de esta población posibilita proponer acciones culturalmente congruentes con sus valores y creencias para potencializar las ca- pacidades familiares e intermediar en los procesos de tratamiento.

La innovación en la organización de servicios con el Sistema Metropolitano de la Solidaridad en Perú

Directory of Open Access Journals (Sweden)

Juan Arroyo

2013-06-01

Full Text Available OBJETIVO: Tomando como referencia los resultados logrados hasta el momento por el Sistema Metropolitano de la Solidaridad (SISOL en Perú, el presente trabajo tuvo como objetivo analizar su contribución a la innovación de modelos de organización en la provisión de servicios de salud. MÉTODOS: Se evaluaron los indicadores de desempeño de SISOL, contrastándolos con los de otros modelos de prestación sanitaria del país, con base en datos de una encuesta a 4570 usuarios de SISOL efectuada en el último trimestre del 2011, en las Encuestas Nacionales de Hogares de los años 2003 a 2011 e información estadística del Ministerio de Salud y el Seguro Social peruanos. RESULTADOS: El estudio arrojó resultados positivos para SISOL en términos de crecimiento de la demanda atendida en Lima, la productividad de consultas por recurso humano y los niveles de satisfacción de los usuarios. Tales resultados se explican por a la presencia de especialistas en el primer nivel de atención; b una estructura público-privada innovadora, diferente de la tercerización, y c un sistema de incentivos basado en la gestión de riesgos compartidos. CONCLUSIONES: Los resultados apoyan la necesidad de renovar la atención primaria en salud, en particular para las zonas urbanas, corrigiendo el innecesario escalonamiento que predomina en la actualidad. Muestran además la posibilidad de alianzas público-privadas sinérgicas, donde ambos sectores compartan riesgos y actúen colaborativamente en un solo sistema de servicios. Por último, los resultados convocan a la articulación de la atención primaria en los modelos segmentados.

Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

DEFF Research Database (Denmark)

Lund, Anders Henrik; Duch, M; Lovmand, J

1997-01-01

, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

Papel de la abuela en la lactancia materna

Directory of Open Access Journals (Sweden)

Marta Elena Losa-Iglesias

2013-01-01

(94,7 %, como en el de obstáculo (26,7 %. En cuanto a la decisión de la madre sobre el patrón de alimentación de sus hijos, el 78 % refiere haber tomado la decisión antes del embarazo o en el primer trimestre. La convivencia con la abuela tuvo asociación positiva con dar agua o infusiones (PR regresión de Cox con IC 95 %: 1,51 [1,10-2,09]; p = 0,011. Conclusiones: a la luz de la revisión, la influencia detractora o no que ejerce la abuela sobre la lactancia materna la da sobre los tres factores principales. La influencia detractora ejercida por los consejos de la abuela parece estar relacionada con conocimientos erróneos adquiridos como “generación del biberón” más que con la intencionalidad, y es susceptible de modificarse con información adecuada, con resultados favorables sobre el patrón de alimentación.

Demanda turística internacional por el turismo naturaleza en Costa Rica: Indicadores socio-demográficos y de condición de viaje

Directory of Open Access Journals (Sweden)

Daniel Villalobos-Céspedes

2009-07-01

Full Text Available En Costa Rica, la demanda por actividades turísticas exhibe un posicionamiento relativo del turismo naturaleza. La presente investigación analiza la intención de demanda del turista internacional por turismo naturaleza, según variables sociodemográficas y de condición de viaje. El estudio comprende las modalidades caminata por senderos, visita a volcanes, observación de flora y fauna, observación de aves y canopy. Se sustenta en la base de datos del Instituto Costarricense de Turismo (ICT4, de la Encuesta Aérea del primer trimestre del año 2007 a turistas no residentes mayores de 18 años, y que salieron por el aeropuerto Juan Santamaría. Se encontró que las condiciones viajar con familia, en pareja y procedencia del turista, tienen potencial influencia favorable en la intención de demanda en la mayor parte de esas actividades. Los resultados permiten esbozar una estrategia que orienta las políticas y acciones en materia de turismo naturaleza en el país.

Nanotechnology: A Policy Primer

Science.gov (United States)

2013-06-24

savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

MPprimer: a program for reliable multiplex PCR primer design

Directory of Open Access Journals (Sweden)

Wang Xiaolei

2010-03-01

Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

Predictive maintenance primer

International Nuclear Information System (INIS)

Flude, J.W.; Nicholas, J.R.

1991-04-01

This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

La Hipótesis de la Utilización del Impuesto sobre Beneficios para Evitat Pérdidas y Descensos en Resultados

Directory of Open Access Journals (Sweden)

Mª Carmen Gonzalo Angulo

2007-12-01

Full Text Available En este trabajo, centrado en la gestión del resultado en empresas españolas cotizadas, comprobamos en primer lugar, la existencia de una discontinuidad en el punto cero en las funciones de densidad del resultado antes de impuesto y neto. En segundo lugar, investigamos el efecto que el reconocimiento del gasto por impuesto sobre beneficios genera en las distribuciones de los resultados. Beaver, McNichols y Nelson (2007 argumentan que la discontinuidad observada en los histogramas de frecuencias puede no ser producto de una gestión intencionada por parte de los administradores sino que puede deberse al efecto asimétrico que juegan dos partidas concretas: el impuesto sobre beneficios y las partidas especiales (por el diferente reconocimiento de los ingresos y gastos, motivado por el sesgo conservador del principio de prudencia. Los resultados encontrados en la muestra española sostienen la hipótesis de Beaver, McNichols y Nelson (2007 para el primer periodo estudiado 1996-2000 y respalda la idea de que la discontinuidad en los puntos clave de los valores del resultado puede ser explicado por la lógica inherente al propio modelo contable, y en especial por el principio de prudencia valorativa, que tiene prevalencia sobre los demás en España, para este periodo considerado. No obstante, esta hipótesis se relaja a partir del ejercicio 2001, coincidiendo con la aprobación de Ley 24/2001.In the first part of this paper, we examine whether there is a discontinuity at zero (i.e., a “kink” in the distribution of profits and increases of profits. Second, we investigated the effect that the recognition of tax expenses generates in the distribution of earnings. Beaver, McNichols and Nelson (2007 have defended that the observed discontinuity in earnings couldn’t be enough to confirm the manipulation of results by management. In contrast, they argue that the observed discontinuity in earnings could be due to the asymmetric effect from two

China Energy Primer

Energy Technology Data Exchange (ETDEWEB)

Ni, Chun Chun

2009-11-16

Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

ANÁLISIS DEL EFECTO INMEDIATO Y DIFERIDO DE LA ORIENTACIÓN AL MERCADO SOBRE LOS RESULTADOS ORGANIZACIONALES. UN ESTUDIO LONGITUDINAL

Directory of Open Access Journals (Sweden)

Cauzo Bottala, Lourdes

2012-09-01

Full Text Available El objetivo del presente trabajo se centra en analizar el efecto, tanto inmediato como diferido, de la orientación al mercado (OM sobre los resultados organizacionales. Para ello, se ha realizado un estudio longitudinal, en un horizonte temporal de 3 años, en el sector financiero español. Respecto a la metodología, hemos desarrollado, de una parte, un método cualitativo con el fin de medir el grado de OM de las entidades consideradas, y ello a través de un análisis de contenido. Una vez obtenido un indicador de dicho análisis, hemos aplicado una metodología cuantitativa de ecuaciones estructurales, para contrastar las hipótesis del modelo propuesto. De los resultados obtenidos, destacamos, en primer lugar, que las entidades bancarias que implantan un enfoque de OM son propensas a mantener dicho enfoque en periodos sucesivos; en segundo término, que no se constatan efectos inmediatos de la OM sobre los resultados; y finalmente que la OM no registra efectos diferidos sobre aquellos indicadores de rentabilidad considerados.

Efectos de un entrenamiento propioceptivo (TRAL de tres meses sobre el control postural en jóvenes deportistas.

Directory of Open Access Journals (Sweden)

Pedro de Antolín Ruiz

2009-03-01

Full Text Available Introducción: Es un estudio de intervención de diseño longitudinal con una duración de 6 meses, de grupo único con evaluación antes-después, que pretende evaluar la eficacia de un programa propioceptivo como método para mejorar el control postural en jóvenes deportistas. Métodos: La muestra de estudio fue de 28 jugadores/as de voleibol (15-18 años. Se tomaron datos una primera vez antes de un primer trimestre sin intervención, una segunda ocasión, una vez finalizado este periodo, y en una tercera ocasión después de un segundo trimestre con entrenamiento. El entrenamiento propioceptivo utilizado se realizó mediante el método Terapia Reequilibradora del Aparato Locomotor (TRAL. La estabilidad corporal se midió calculando el área de desviación del centro de presiones mediante una plataforma de fuerzas con sensores electrónicos Buratto Advanced. Las posiciones analizadas fueron la posición unipodal con ojos abiertos y cerrados de las dos piernas. Resultados: Reducción significativa del área de desviación del centro de presiones en los cuatro tests en el caso de las chicas y sólo reducción significativa en uno de los tests con el grupo de chicos. Conclusiones: El entrenamiento con TRAL mejora el control postural en chicas y produce tendencia a la mejoría en el caso de los chicos. Son necesarios nuevos estudios con grupo control y mayor muestra.

Factores que impactan los resultados empresariales: un estudio comparativo entre empresas chilenas y españolas

Directory of Open Access Journals (Sweden)

Patricia Carolina Huerta Riveros

2015-04-01

Full Text Available Los resultados empresariales representan un tema que sigue concentrando el interés de los investigadores y que aún no está resuelto. Es por ello que el presente estudio persigue dos objetivos: en primer lugar, realizar una revisión bibliográfica de los factores que impactan sobre los resultados empresariales; en segundo lugar, contrastar los planteamientos anteriores para aportar evidencia empírica al respecto, a través de un análisis comparativo entre dos países. Metodológicamente se realiza un contraste sobre paneles completos de empresas industriales chilenas y españolas, utilizando dos bases de datos: (i la Encuesta Nacional Industrial Anual (ENIA y (ii la base de datos de la Encuesta Sobre Estrategias Empresariales (ESEE, respectivamente, para el periodo 2000-2007. Utilizando análisis de componentes de varianza se identifican los factores que explican más del 90% de los resultados empresariales y, empleando técnicas para datos de panel, se descubre que estos factores también influyen en los resultados obtenidos. De este modo, el presente artículo avanza en la discusión del tema, a través de su aplicación a empresas de un país en vías de desarrollo como Chile, además de analizar un aspecto descuidado en la literatura como es el estudio de la influencia de los factores, sin concentrarse únicamente en el análisis del porcentaje de explicación de los factores identificados sobre los resultados empresariales; de igual manera, este trabajo actualiza el periodo tradicionalmente investigado e incorpora un factor relevante pero menos analizado en este tipo de estudios, como es la localización geográfica, factor que contribuye a explicar significativamente el modelo propuesto. Dentro de las repercusiones que implican el estudio, es evidente que sus resultados permitirán a los directivos y dueños de empresas comprender los elementos que influyen en los resultados organizacionales, los cuales son la base de su existencia y

MEMORIA DE TRABAJO Y RENDIMIENTO ACADÉMICO EN ESTUDIANTES DE PRIMER SEMESTRE DE UNA UNIVERSIDAD DE LA CIUDAD DE BARRANQUILLA

Directory of Open Access Journals (Sweden)

Luis Felipe Zapata

2009-01-01

Full Text Available La memoria de trabajo puede ser un componente de gran influencia en el rendimiento académico, aunque no es el único que lo determina. Este artículo muestra los resultados de una investigación en la que se intentó determinar la correlación que existe entre la memoria de trabajo y el rendimiento académico en estudiantes de primer semestre de diferentes programas de una universidad de Barranquilla. No se encontró correlación entre ninguna de las medidas de memoria de trabajo utilizadas y el rendimiento académico de los participantes. Estos resultados pueden ser explicados por los efectos que otras variables tienen en el rendimiento académico, como la cognición, la motivación, el afecto y el contexto.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

Directory of Open Access Journals (Sweden)

Kitchen James L

2012-11-01

Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

Science.gov (United States)

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

Prevalência da colonização vaginal e anorretal por estreptococo do grupo B em gestantes do terceiro trimestre Prevalence of vaginal and anorectal colonization by group B streptococcus in pregnant women in the last three months of gestation

Directory of Open Access Journals (Sweden)

Cláudio Beraldo

2004-08-01

Full Text Available OBJETIVOS: estudar a prevalência da colonização por estreptococo do grupo B em gestantes do terceiro trimestre, atendidas em um hospital regional, e avaliar a associação da colonização com as variáveis maternas demográficas e clínicas. MÉTODOS: no período de 8 de outubro de 2002 a 26 de março de 2003, foi realizado um estudo transversal (de prevalência com 309 gestantes no terceiro trimestre. Amostras de secreção vaginal e anorretal foram coletadas e testadas para identificação presuntiva do estreptococo do grupo B. Foram incluídas as gestantes com gestação maior ou igual a 36 semanas datadas por ultra-sonografia e excluídas as que se recusaram a participar, as em uso de antibioticoterapia e as que haviam sido submetidas a exame ginecológico pelo período mínimo de 24 horas antes da coleta. As gestantes foram caracterizadas por variáveis demográficas (raça, idade, grau de escolaridade, renda familiar e número de gestações e clínicas (idade gestacional, ocorrência de infecção urinária durante a gestação atual, ruptura prematura de membranas e tempo de bolsa rota, febre materna intraparto, corioamnionite, líquido amniótico com mecônio, via de parto utilizada, febre materna pós-parto e endometrite. RESULTADOS: das gestantes, 46 estavam colonizadas pelo estreptococo do grupo B, sendo que 26 (56,5% tiveram a cultura vaginal positiva, 8 (17,4% a cultura anorretal positiva e 12 (26,5% tiveram tanto a cultura vaginal como a retal positivas. Nenhuma das variáveis analisadas neste estudo foi estatisticamente significativa quanto à colonização pelo estreptococo do grupo B. Os resultados obtidos foram submetidos à análise bivariada pelo teste do chi2 e teste exato de Fisher quando apropriado. CONCLUSÃO: a taxa de prevalência da colonização vaginal e anorretal pelo estreptococo do grupo B em gestantes no terceiro trimestre, foi de 14,9%. Não houve associação entre fatores de risco (primigestação, idade

High-speed measurement of firearm primer blast waves

OpenAIRE

Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

2012-01-01

This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

Hexavalent Chromium IV-Free Primer Development

Science.gov (United States)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Multiplexing Short Primers for Viral Family PCR

Energy Technology Data Exchange (ETDEWEB)

Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

2008-06-26

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

International Nuclear Information System (INIS)

Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

2013-01-01

To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

International Nuclear Information System (INIS)

Busch, R.D.

2003-01-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

Primer on spontaneous heating and pyrophoricity

Energy Technology Data Exchange (ETDEWEB)

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

30 CFR 57.6304 - Primer protection.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

Bebê de risco: acompanhando o crescimento infantil no primeiro ano de vida Bebé de riesgo: acompañando el crecimiento infantil en el primer año de vida At-risk infants: monitoring children's growth in the first year of life

Directory of Open Access Journals (Sweden)

Anelize Helena Sassá

2011-01-01

Full Text Available OBJETIVO: Acompanhar o crescimento de bebês de risco no primeiro ano de vida. MÉTODOS: Estudo analítico, do tipo coorte, realizado com 237 bebês nascidos em Maringá - PR, entre 1º de maio a 31 de outubro de 2008, incluídOs no Programa de Vigilância do Bebê de Risco. RESULTADOS: As alterações de crescimento estiveram presentes em 188 (79,3% bebês e ocorreram sobretudo, após o 1º trimestre de vida. A velocidade de crescimento abaixo da esperada apresentou associação estatística com idade materna menor que 18 anos, tempo de estudo inferior a 8 anos, presença de anomalia congênita, peso ao nascer maior ou igual a 2.500g e nascimento a termo. CONCLUSÃO: A avaliação do crescimento dos bebês de risco deve abarcar uma análise multidimensional, considerando os aspectos biológicos e maturacionais específicos a cada condição de risco e a adaptação do bebê e de sua família nesse percurso evolutivo.OBJETIVO: Acompañar el crecimiento de bebés de riesgo en el primer año de vida. MÉTODOS: Se trata de un estudio analítico, de tipo cohorte, realizado con 237 bebés nacidos en Maringá - PR, entre el 1º de mayo al 31 de octubre del 2008, incluídos en el Programa de Vigilancia del Bebé de Riesgo. RESULTADOS: Las alteraciones de crecimiento estuvieron presentes en 188 (79,3% bebés y ocurrieron sobre todo, después del 1º trimestre de vida. La velocidad de crecimiento debajo de la esperada presentó asociación estadística con edad materna menor de 18 años, tiempo de estudio inferior a 8 años, presencia de anomalía congénita, peso al nacer mayor o igual a 2.500 gr. y nacimiento a término. CONCLUSIÓN: La evaluación del crecimiento de los bebés de riesgo debe abarcar un análisis multidimensional, considerando los aspectos biológicos y de madurez específicos a cada condición de riesgo y la adaptación del bebé y su familia en ese recorrido evolutivo.OBJECTIVE: To monitor the growth of high-risk babies in the first

Rust transformation/rust compatible primers

Science.gov (United States)

Emeric, Dario A.; Miller, Christopher E.

1993-01-01

Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

Diseño de mobiliario escolar mediante el aprendizaje basado en proyectos programación trimestral para la materia de tecnología industrial para 1º Bachillerato

OpenAIRE

Ortí Amela, Marta

2015-01-01

Treball Final de Màster Universitari en Professor/a d'Educació Secundària Obligatòria i Batxillerat, Formació Professional i Ensenyaments d'Idiomes. Codi: SAP129. Curs: 2014/2015 planteamiento del Aprendizaje Basado en Proyectos (ABP) de la asignatura de Tecnología Industrial I de 1º de Bachillerato, secuenciada en un trimestre, contextualizada en el centro donde realicé las prácticas, IES Penyagolosa de Castellón. Dado que el docente debe ser competente para ser capaz de organizar, pl...

Empresas nanotecnológicas en México: hacia un primer inventario

Directory of Open Access Journals (Sweden)

Edgar Záyago Lau

2013-01-01

Full Text Available En este artículo presentamos un inventario inicial de compañías mexicanas que venden productos que son manufacturados a partir de nanotecnología, o que utilizan nanotecnología en sus operaciones. El inventario permite a los interesados identificar el número de empresas, su ubicación geográfica y los sectores industriales en los que se insertan. Esto es, de hecho, un primer acercamiento para el análisis los vínculos productivos de la nanotecnología en México. Los resultados muestran una alta concentración de empresas en dos estados: Nuevo León y la ciudad de México. Esto sucede en un contexto donde no hay una iniciativa nacional, ni una política pública específica ni datos disponibles públicamente o bases de datos que contienen información relevante.

An iterative method for selecting degenerate multiplex PCR primers.

Science.gov (United States)

Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

2007-01-01

Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

Directory of Open Access Journals (Sweden)

Dunn Sade N

2008-06-01

Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

Bioinformatic tools and guideline for PCR primer design | Abd ...

African Journals Online (AJOL)

Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

Medium Caliber Lead-Free Electric Primer. Version 2

Science.gov (United States)

2012-09-01

2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

Avaliação do perfil e dos cuidados no pré-natal de mulheres com diabetes mellitus gestacional

Directory of Open Access Journals (Sweden)

Francisca Adriele Vieira Neta

2014-01-01

Full Text Available El objetivo fue identificar el perfil sociodemográfico, clínico y obstétrico, así como la atención prenatal de mujeres con diabetes mellitus gestacional. Estudio transversal, con 50 mujeres, en una maternidad pública de Fortaleza, CE, Brasil, de noviembre 2012 a septiembre 2013. Se constató edad promedia de 31,34 años, atención prenatal temprana en el primer trimestre (76,0%, parto abdominal (63,6% y tratamiento no farmacológico (78,0%. Las patologías asociadas fueron hipertensión arterial (18,0%, ruptura prematura de membranas (16,0% y desprendimiento precoz de la placenta (16,0%. En 18.0%, la glucosa no fue evaluada en la admisión hospitalaria, así como la comprobación de la presión arterial 2,0%; 8,0% no tenían la evaluación de la auscultación de los batimientos del corazón del feto y 4,0% de la altura uterina. Estos resultados señalan la necesidad de intervenciones que garanticen a la embarazada con diabetes mellitus asistencia adecuada, previniendo complicaciones al binomio madre e hijo.

CARACTERÍSTICAS DO PRÉ-NATAL DE ADOLESCENTES EM CAPITAIS DAS REGIÕES SUL E NORDESTE DO BRASIL

Directory of Open Access Journals (Sweden)

Rita Fernanda Monteiro Fernandes

2015-01-01

Full Text Available cuantitativo descriptivo que objetivó describir algunos aspectos de la atención prenatal de adolescentes en hospitales de enseñanza de la región Sur y Nordeste de Brasil, basado en los criterios de calidad del Programa de Humanización del Prenatal. Es un recorte de la “pesquisa “Redes sociales de apoyo a la paternidad en la adolescencia”. La colecta de los datos ocurrió de diciembre de 2008 a diciembre de 2009. La amuestra se constituyó de 559 puérperas adolescentes. Los resultados evidenciaron que 98% de las pesquisadas realizaron prenatal, 67,2% frecuentaron seis o más consultas médicas y 62,5% empezaron en el primer trimestre de gestación. Cuanto a los análisis de rutina, ni todos fueron realizados y 41,8% negaron haber recibido informaciones acerca del trabajo de parto y parto durante las consultas prenatales. Se concluye que la mayoría de las adolescentes realizó el prenatal conforme los criterios preconizados por el Programa, pero todavía hacen falta acciones educativas y orientaciones durante las consultas.

Simple sequence repeat marker loci discovery using SSR primer.

Science.gov (United States)

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Hipotiroidismo en el embarazo

OpenAIRE

Macchia, Carla Lorena; Sánchez-Flórez, Javier Augusto

2007-01-01

Introducción: el hipotiroidismo se presenta entre el 0,5 y 2,5% de todos los embarazos. La frecuencia es mayor si se consideran poblaciones de riesgo, como pacientes portadoras de enfermedades autoinmunes. Durante la gestación temprana existe dependencia de hormonas tiroideas maternas, puesto que la tiroides fetal es incapaz de elaborar sus productos hasta después del primer trimestre. En este periodo, toda situación de carencia puede ejercer efectos indeseables. Objetivo: el objetivo del pre...

Género y efectividad de la metodología enfermera en pacientes con insuficiencia cardiaca

Directory of Open Access Journals (Sweden)

Cipriano Viñas-Vera

2016-01-01

Full Text Available Estudios recientes demostraron que una intervención enfermera de educación sanitaría en la insuficiencia cardiaca (IC evita descompensaciones. Por otro lado, dado que existen diferencias de género en los patrones de la IC, las intervenciones tendrán también efectos distintos. Objetivos: determinar la existencia de posibles diferencias según el género de los pacientes, en el efecto de una intervención enfermera respecto al autocuidado. Materiales y métodos: se realizó un estudio cuasiexperimental con pacientes atendidos en consulta de IC (129, seleccionados en dos tiempos, primer trimestre año grupo control (62, y segundo trimestre año grupo intervención (67. Todos se evaluaron tres veces: primera consulta, tres y seis meses. Al grupo intervención se aplicó en cada visita una intervención enfermera que consistía en educación terapéutica, control y seguimiento de su IC. Resultados: Inicio: T.A. sistólica hombres 133,90 ± 0,96 (DE 27,77; mujeres 119,64 ± 0,57 (DE 18,72. Cuidador 93 % hombres, 63 % mujeres. Conducta terapéutica 2,07 ± 0,02 (DE 0,20 hombres; 3,04 ± 0,01 (DE 0,31 mujeres. Final: autocuidado -16,00 ± 2,08 (DE 10,99 hombres; -9,68 ± 2,22 (DE 12,92 mujeres. Adherencia terapéutica 1,32 ± 0,35 (DE 1,83 hombres, 2,94 ± 1,87 (DE 10,93 mujeres. Mejoría muy similar de la Nursing Outcomes Classification (NOC en todos. Conclusiones: en el grupo de estudio participaron más mujeres. Los hombres tuvieron más comorbilidad, consumo de tabaco, alcohol. Inicialmente los hombres presentaban mejor calidad de vida. Después de la intervención mejora el autocuidado en todos los participantes pero el doble en hombres. También mejora adhesión terapéutica en todos, en las mujeres mejora el doble. Todos los pacientes mejoran respecto a la calidad de vida y resultados NOC.

Value for money assessment for public-private partnerships : a primer.

Science.gov (United States)

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

Autonomía y ajuste académico: un estudio con estudiantes portugueses de primer año

Directory of Open Access Journals (Sweden)

Ana Paula Soares

2007-01-01

Full Text Available Los niveles de autonomía psicológica de los alumnos desempeñan un papel importante en su ajuste a las presiones y desafíos de la vida universitaria. En este sentido, el presente estudio descriptivo analiza las relaciones entre los niveles de autonomía de los estudiantes en su entrada en la Enseñanza Superior y la calidad de su ajuste académico al final del primer año. Se aplicó el Iowa Developing Autonomy Inventory (IDAI en el inicio del año lectivo y el Questionário de Vivências Académicas (QVA al final de ese año a una muestra de 420 alumnos de primer año de la Universidade do Minho. Los resultados revelan que los alumnos poseen percepciones bastante positivas en cuanto a sus niveles de autonomía en las áreas de Gestión del tiempo, Movilidad e Interdependencia, y niveles más bajos en la Gestión del dinero, observándose algunas oscilaciones en función del género. Por otro lado, los alumnos cuya entrada en la Enseñanza Superior no implicó su abandono del hogar familiar, especialmente los de sexo masculino, presentan niveles más elevados de ajuste académico. Finalmente, los resultados sugieren que el ajuste académico se encuentra asociado a los niveles de autonomía de los alumnos, en particular en lo que concierne a la Gestión del tiempo, Independencia emocional de sus compañeros e Interdependencia.

Expectativas de laborar en el primer nivel de atención de salud de los estudiantes de una facultad de medicina de Lima, Perú

Directory of Open Access Journals (Sweden)

Carolina B Tarqui-Mamani

2015-01-01

Full Text Available Introducción: La situación sanitaria del Perú requiere que más profesionales de la salud brinden atención en los establecimientos de salud del primer nivel de atención, ubicados principalmente en las zonas periféricas, rurales o más pobres del país. Objetivo: Identificar expectativas laborales y personales de los futuros profesionales de la salud que son formados en una facultad de medicina de Lima, particularmente trabajar en el primer nivel de atención de salud. Diseño: Estudio observacional, descriptivo y exploratorio. Lugar: Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Participantes: Estudiantes pre internado de las Escuelas Académico Profesionales. Intervenciones: El muestreo fue por conveniencia y se incluyó a 278 estudiantes de las 5 escuelas que conforman la facultad de medicina. Se aplicó un cuestionario ad hoc donde se preguntó aspectos relativos a las expectativas laborales, económicas y visión de los estudiantes como futuros profesionales. Se calculó promedios, desviación estándar, distribución de frecuencias, los intervalos de confianza al 95% con la prueba de Poissón y chi cuadrado. Principales medidas de resultados: Expectativa de laborar en el primer nivel de atención de salud. Resultados: El 50% de los estudiantes manifestó que les gustaría desarrollarse en el área asistencial; solo 14,5% expresó su intención de trabajar en el primer nivel de atención de salud (puestos y centros de salud, 87,1% consideró que estudiar en una universidad emblemática es una fortaleza que favorece su vida profesional y 57,6% que seguirá estudios de posgrado; 58,6% de los estudiantes señaló la intención de trabajar en Lima, 21,9% en provincias y 16,2% en el extranjero. El promedio de expectativa económica mensual fue el equivalente a 1 577 nuevos soles o poco más de 2 sueldos mínimos vitales previstos para el 2012. Conclusiones: La expectativa de los futuros profesionales de la

Gerenciamento de resultados em bancos com uso de TVM: validação de modelo de dois estágios Securities-based earnings management in nanks: validation of a two-stage model

Directory of Open Access Journals (Sweden)

José Alves Dantas

2013-04-01

Full Text Available Estudos sobre gerenciamento de resultados em bancos têm se preocupado especialmente com o uso da provisão para créditos de liquidação duvidosa (PCLD e utilizam principalmente modelos de dois estágios para a identificação da ação discricionária da administração. Outro tipo de registro que tem recebido atenção dos pesquisadores na identificação dessa prática em bancos é a classificação e a mensuração do valor justo dos títulos e valores mobiliários (TVM. Nesse caso, porém, têm prevalecido modelos de um estágio. Este estudo tem por objetivo desenvolver e validar um modelo de dois estágios para a identificação da discricionariedade nos resultados com TVM. O modelo incorpora preceitos dos poucos estudos sobre o tema, parâmetros utilizados nos modelos para identificação da PCLD discricionária em bancos, além de indicadores macroeconômicos e características específicas de composição da carteira de TVM. Os testes empíricos tiveram por base as informações dos bancos comerciais, bancos múltiplos e caixas econômicas em atuação no mercado brasileiro, entre o terceiro trimestre de 2002 e o quarto trimestre de 2010. Para a validação do modelo proposto, os seus resultados foram cotejados com os decorrentes da aplicação de um modelo de um estágio - metodologia difundida na literatura sobre o tema. Os testes realizados com os dois modelos revelam evidências da prática de alisamento de resultados com o uso de TVM, bem como a utilização da classificação em títulos disponíveis para venda nessas ações de gerenciamento. A consistência dos resultados encontrados nos dois modelos evidencia a validação do modelo proposto, contribuindo para o desenvolvimento de pesquisas sobre o tema que se preocupem não apenas em constatar se há a prática ou não do gerenciamento, mas também associá-la a outras variáveis. Neste estudo, por exemplo, foi constatado que essa prática é mais relevante nos bancos de

Caries dental aguda del primer molar permanente en niños de 12 años

Directory of Open Access Journals (Sweden)

Daniel Enrique Reyes Romagosa

Full Text Available Introducción: el primer molar permanente es considerado la llave de la oclusión dentaria, la presencia de caries en éste es elevada, lo que dificulta el logro de las metas trazadas por organizaciones de salud a nivel mundial en este grupo de edad. Objetivo: determinar el comportamiento de la caries dental aguda en primer molar permanente en una población de 12 años de edad atendida en la Clínica Estomatológica Santa Cruz de la Parroquia Goaigoaza. Métodos: se realizó un estudio descriptivo transversal en la Clínica Estomatológica Santa Cruz. Parroquia Goaigoaza, municipio Puerto Cabello, estado Carabobo, en el período comprendido entre abril del 2009 a abril 2010. Se seleccionaron 97 pacientes de 12 años de edad los que constituyeron el universo y la muestra. Acudieron a la consulta por dolor debido a la presencia de caries dental aguda. Se registraron las variables: edad, sexo, grado clínico de la caries dental, estímulos externos que provocaron dolor, la cara dental y la arcada dentaria más afectadas. La información fue recogida mediante interrogatorio y examen clínico. Resultados: el sexo masculino representó el 63,9 %. La caries dental de 3er grado estuvo presente en un 68 %. Los estímulos externos que provocaron dolor fueron: el frío presente en 75,2 % y los alimentos dulces en 69,1 % en ambos sexos. El primer molar inferior derecho resultó más afectado (46,4 % que el izquierdo (36,1 %, así como la arcada dentaria inferior (25,8 % y la cara oclusal (64,9 %. Conclusiones: predominaron el sexo masculino y la caries dental aguda de 3er grado. El frío y los alimentos dulces fueron los estímulos externos más frecuentes. Los más afectados resultaron el primer molar inferior derecho, la cara oclusal y la arcada dentaria inferior.

Medición de la cultura de seguridad del paciente en un hospital público de primer nivel en el municipio de Villeta

OpenAIRE

Lopez Pinzon, Vicente; Puentes Vega, Milton Augusto; Ramirez, Ana Lucia

2016-01-01

Esta investigación midió la percepción del personal asistencial sobre la cultura de seguridad de los pacientes en un hospital de primer nivel de complejidad por medio de un estudio descriptivo de corte transversal. Se utilizó como herramienta de medición la encuesta ‘Hospital Survey on Patient Safety Cultura’ (HSOPSC) de la Agency of Healthcare Research and Quality (AHRQ) versión en español, la cual evalúa doce dimensiones. Los resultados mostraron fortalezas como el aprendizaje organizaciona...

Economics : pricing, demand, and economic efficiency : a primer.

Science.gov (United States)

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Semantic Web Primer

NARCIS (Netherlands)

Antoniou, Grigoris; Harmelen, Frank van

2004-01-01

The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

Coal Bed Methane Primer

Energy Technology Data Exchange (ETDEWEB)

Dan Arthur; Bruce Langhus; Jon Seekins

2005-05-25

During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

Quick spacecraft charging primer

International Nuclear Information System (INIS)

Larsen, Brian Arthur

2014-01-01

This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

Competitividad de la economía mexicana, resultados en el periodo 1997-2007

Directory of Open Access Journals (Sweden)

Cecilia Jiménez-García

2011-01-01

Full Text Available La competitividad es una variable determinante en el desarrollo económico y social de una nación. Implica factores como innovación, eficiencia, productividad y calidad; además se ve influida por otros factores que tienen que ver con el entorno. México es un país débil en algunos de estos factores, principalmente porque no realiza innovación tecnológica suficiente para crear ventajas competitivas que promuevan mejores niveles de productividad, eficiencia y calidad. En lo relativo al entorno, el país presenta deficiencia en sectores clave como educación, energía y transportes, lo cual es el resultado de un ambiente macroeconómico inestable. En el ranking de países competitivos del Instituto Mexicano para la Competitividad, A.C. (IMCO, México ha perdido posiciones en los últimos años, su posición ha cambiado del primer lugar de América Latina en el año 2004, a los últimos sitios de la lista en años recientes.

Primer design for a prokaryotic differential display RT-PCR.

Science.gov (United States)

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Climate Change, Health, and Communication: A Primer.

Science.gov (United States)

Chadwick, Amy E

2016-01-01

Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

Marketing Information Products and Services : A Primer for ...

International Development Research Centre (IDRC) Digital Library (Canada)

Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

El benchmarking, un paso más hacia la excelencia: la comparación de resultados de encuestas de satisfacción de usuarios y clima laboral.

OpenAIRE

Martínez Olea, Antonio

2010-01-01

El autor aborda en primer lugar el concepto de Benchmarking como medio para alcanzar la excelencia y la conveniencia de integrarlo en el marco global que proporciona el Modelo EFQM. Se centra a continuación en un aspecto concreto del benchmarking, la evaluación comparativa de los criterios de resultados de clientes y personas a través de las encuestas de satisfacción y clima laboral. Para ello plantea la realización de una encuesta específica de clientes para las bibliotecas a efectos de la c...

Variación espacial, temporal y espectral de la contaminación lumínica y sus fuentes: Metodología y resultados

OpenAIRE

Sánchez de Miguel, Alejandro

2016-01-01

A partir de las imágenes nocturnas en banda pancromática obtenidas por los satélites de observación de la tierra (DMSP/OLS y SNPP/VIIRS/DNB) se ha estudiado la evolución temporal (a nivel global y regional) del gasto en alumbrado público. Para ello se ha diseñado un método de intercalibración de los datos de diferentes misiones que ha proporcionado, como primer resultado y usando los datos del satélite DMSP/OLS, la reconstrucción de la evolución del gasto en alumbrado público en España entre ...

An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

Energy Technology Data Exchange (ETDEWEB)

Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

2011-01-15

Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

Microsatellite primers for fungus-growing ants

DEFF Research Database (Denmark)

Villesen, Palle; Gertsch, P J; Boomsma, JJ

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Microsatellite Primers for Fungus-Growing Ants

DEFF Research Database (Denmark)

Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

2002-01-01

We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

Análisis de productividad, calidad y costos en laboratorios del primer nivel: la biometría hemática

Directory of Open Access Journals (Sweden)

Leticia Avila

1999-04-01

Full Text Available OBJETIVO: Conocer el grado de eficiencia con la que funcionan los laboratorios clínicos del primer nivel mediante una evaluación que integre: la productividad, la calidad y los costos. MÉTODOS: Se seleccionaron 10 laboratorios clínicos de un total de 52 existentes en la Ciudad de México; se utilizó el modelo de Donabedian en sus componentes de estructura, proceso y resultado utilizando la biometría hemática como rastreador. RESULTADOS: Los principales problemas fueron: inadecuada distribución del recurso humano calificado; malas condiciones del material de vidrio; inadecuado proceso analítico y baja productividad. Estos problemas se reflejaron en un incremento de un 200% en los costos unitarios respecto al costo ideal. Solamente son confiables los resultados de 50% de los laboratorios analizados. Veinte porciento de los laboratorios analizados son eficientes. CONCLUSIONES: La solución a los problemas encontrados requiere de estrategias integrales que comprometen a diferentes ámbitos, por lo que su solución se plantea difícil. Se recomienda analizar el costo-beneficio de crear un laboratorio central y dejar a los demás laboratorios como sitios para la toma de muestras exclusivamente.

El declive del estado de resultados tradicional ante la irrupción actual del excedente limpio. Perspectiva histórica y conceptual

Directory of Open Access Journals (Sweden)

Francisco Sousa Fernández

2010-01-01

Full Text Available Con la adopción del resultado global (comprehensive income a partir de la década de los noventa del siglo XX por los organismos emisores de normas contables más relevantes en el concierto mundial, entre los que cabe destacar el International Accounting Standards Board (iasb y el Financial Accounting Standards Board (fasb, estamos asistiendo a un posicionamiento a favor del enfoque del excedente limpio. Como consecuencia el resultado empresarial queda más vinculado a las oscilaciones de los precios de los títulos y a los tipos de cambio, frente al enfoque del excedente sucio que nos lleva a la determinación del mismo desde una óptica más restrictiva y, por ello, mucho menos conectado con la realidad de los mercados. En este trabajo nos planteamos como primer objetivo el estudio desde una óptica histórica y conceptual del antiguo y controvertido debate del enfoque del excedente limpio versus el enfoque del excedente sucio, circunscrito esencialmente a los países del área de influencia anglosajona. Posteriormente, queremos constatar que con la revisión de la Norma Internacional de Contabilidad 1 (nic 1 del International Accounting Standards Board (iasb en el año 2007 cobra más fuerza el resultado global; con ello se confirman los planteamientos a favor del enfoque del excedente limpio, lo que origina la desaparición del estado de resultados tradicional del conjunto completo de estados financieros si las empresas, según dicha norma, optan por revelarlo en el estado de resultados globales; todo ello con el propósito de reportar más utilidad a los inversionistas, quienes son considerados usuarios primordiales en los modelos contables anglosajones a los que tendemos.

A physicists guide to The Los Alamos Primer

International Nuclear Information System (INIS)

Reed, B Cameron

2016-01-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

La escritura como práctica situada en el primer ciclo: promoción de procesos cognitivos y metacognitivos

Directory of Open Access Journals (Sweden)

OLGA YAMIRA PEÑA GALEANO

2016-01-01

Full Text Available Este trabajo tiene como objetivo presentar resultados de la investigación titulada “El modelo metasociocognitivo. Una alternativa para situar la escritura en contexto” que está fundamentada en la perspectiva sociocultural, el modelo metasociocognitivo y la noción de cognición situada. A nivel metodológico, se aborda el diseño de Investigación Acción, por lo cual se acude a la observación participante, encuestas, entrevistas y registros de clase. En este sentido, se parte del análisis del rastreo de trabajos investigativos, acorde con tres categorías: la escritura en el ciclo uno, los procesos cognitivos y los procesos metacognitivos. Luego se presentan los resultados, organizados en seis hechos, que se derivan del análisis de los procesos de enseñanza y aprendizaje en la producción escrita de los niños en el primer ciclo: estudiantes de grado primero y segundo de básica primaria. Finalmente, se exponen las conclusiones en el ámbito pedagógico, disciplinar e investigativo.

Uso de herramientas estadísticas para la predicción estacional del campo de precipitación en América Central como apoyo a los Foros Climáticos Regionales. 2: Análisis de Correlación Canónica.

Directory of Open Access Journals (Sweden)

Berny Fallas López

2012-12-01

Full Text Available Se elaboró un pronóstico climático estacional en América Central basado en el Análisis de Correlación Canónica (ACC. Como predictores se usaron las temperaturas superficiales del mar de los océanos circundantes al istmo y como predictante el campo de precipitación, de 146 estaciones meteorológicas en Mesoamérica con registros mensuales para el período 1971-2000. El área oceánica asociada en el campo de la temperatura superficial del mar fue 60 # N- 60 # S y 270-0 # O. En general, para cada uno de los períodos sobre los cuales se realizaron los pronósticos, se utilizaron las temperaturas superficiales del mar del trimestre anterior. El ACC, mostró los mejores resultados para el trimestre de ASO, trimestre de máxima precipitación anual en la vertiente del Pacífico. Algunos de los modos identificados en el análisis presentaron patrones espaciales asociados a fuentes de variabilidad conocidas como el ENOS, por lo que el ACC aparte de ser una herramienta útil para realizar pronósticos estacionales, también resultó útil para explicar predictores y asociaciones con otros índices climáticos. Los resultados de este trabajo mostraron que la introducción del ACC puede ayudar a los pronósticos estacionales de la región centroamericana, realizados en los foros de predicción climática de América Central, con análisis objetivos sobre las relaciones predictivas encontradas en el istmo.

Síndrome de Waardenburg tipo 1 en gemelos monocigóticos y su familia

Directory of Open Access Journals (Sweden)

Gustavo Andrés Duque

2016-04-01

Los hallazgos aquí reportados muestran la variabilidad de las manifestaciones fenotípicas del síndrome de Waardenburg tipo 1 dentro de una familia y especialmente en gemelos monocigóticos, lo que se ha explicado por la expresión variable de genes específicos o por la interacción de ellos con genes modificadores. Cabe resaltar que los gemelos fueron expuestos a alcohol en el primer trimestre del embarazo, por lo cual se propone que la expresión variable del SW fue influenciada por exposiciones a agentes medioambientales.

Estudio transversal de leptospirosis y muerte fetal en Yucatán, México

OpenAIRE

María Fidelia Cárdenas-Marrufo; Ignacio Vado-Solis; Gaspar Fernando Peniche-Lara; Carlos Perez-Osorio; José Correa-Segura

2016-01-01

Introducción: Leptospirosis es una enfermedad zoonótica que afecta principalmente la población humana de bajos recursos. Infección aguda por leptospirosis durante el embarazo se ha asociado con aborto espontáneo y muerte fetal durante el primer trimestre del embarazo.Objetivo: Estimar la frecuencia de infección por Leptospira interrogans en mujeres con aborto espontáneo en el estado de Yucatán, México.Métodos: Se efectuó un estudio trasversal en 81 mujeres con aborto espontáneo. La prueba de ...

Conocimiento sobre Medicina Natural y Tradicional por residentes de Medicina General Integral

OpenAIRE

González Rodríguez, Raidel; Cardentey García, Juan

2016-01-01

Introducción: los residentes de Medicina General Integral requieren conocimientos de Medicina Natural y Tradicional para su práctica asistencial. Objetivo: evaluar el conocimiento de la Medicina Natural y Tradicional por residentes de Medicina General Integral. Materiales y Métodos: se realizó una investigación descriptiva, transversal y analítica en el Policlínico Docente "Raúl Sánchez Rodríguez" de Pinar del Río en el primer trimestre del año 2016. El universo estuvo conformado por 50 resid...

Producción y consumo sustentable : medidas aplicables para frenar la crisis alimentaria

Directory of Open Access Journals (Sweden)

Diego Andrade Ortiz

2013-09-01

Full Text Available La actual crisis alimentaria inició en el 2007 por múltiples razones, muchas de las cuales demandarían un extenso debate. Sin embargo, solamente en el primer trimestre de 2008, la crisis generó un fuerte impacto, dados los altos precios de los alimentos a nivel mundial y los numerosos debates en torno a los agrocombustibles y al cambio climático. Los índices de precios de alimentos publicados por la FAO mostraron crecimientos exorbitantes en productos como maíz, trigo y arroz.

Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

OpenAIRE

Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

2001-01-01

Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

RUCS: Rapid identification of PCR primers for unique core sequences

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

2017-01-01

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

Do we need primer for orthodontic bonding? A randomized controlled trial.

Science.gov (United States)

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

Primer on consumer marketing research : procedures, methods, and tools

Science.gov (United States)

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

Directory of Open Access Journals (Sweden)

Ma Xiaoying

2017-02-01

Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

Directory of Open Access Journals (Sweden)

Andrea Fuso

Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

Criticality calculations with MCNP trademark: A primer

International Nuclear Information System (INIS)

Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

1994-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

Science.gov (United States)

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

UniPrime2: a web service providing easier Universal Primer design.

Science.gov (United States)

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

Science.gov (United States)

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

MOLA HIDATIDIFORME PARCIAL CON FETO VIVO DEL SEGUNDO TRIMESTRE

OpenAIRE

Juárez Azpilcueta, Arturo; Islas Domínguez, Luis; Durán Padilla, Marco Antonio

2010-01-01

La mola hidatidiforme es un embarazo que se caracteriza por una degeneración hidrópica de las vellosidades coriales y habitualmente la ausencia del feto. La mola parcial se caracteriza por ser resultado de una triploidía diándrica y por la presencia de cambios hidatiformes progresivos lentos con capilares vellosos funcionantes, que afectan solamente a algunas de las vellosidades; se asocia con un feto o embrión anormal identifcable (vivo o muerto), membranas o eritrocitos fetales. Se analiza ...

Determinantes de la Calidad del Resultado

Directory of Open Access Journals (Sweden)

Carmen Pineda González

2000-06-01

Full Text Available El concepto de calidad del resultado hace referencia a la posibilidad de que el resultado contable sea percibido por los usuarios de la información contable por encima o por debajo de su cuantificación numérica, o, de otro modo, a la posibilidad de percibir como diferentes los resultados de varias compañías aun cuando en términos cuantitativos sean de igual valor; de forma que será de mayor calidad aquél resultado que en mayor medida contribuya a limitar o a reducir el riesgo inherente al proceso de toma de decisiones. Este concepto general, sin embargo, ha tenido diferentes concreciones que requieren un estudio detallado. En consecuencia, el objetivo de este trabajo es revisar las diferentes definiciones de calidad del resultado que recoge la bibliografía contable y analizar los factores que la determinan, es decir; las decisiones empresariales, las normas contables, la manipulación, la estabilidad, el contenido monetario y los componentes permanentes del resultado. The concept of earnings quality refers to the possibility that accounting results are valued either above or below their numerical quantification, or; put another way, to the possibility of detecting differences in the results of various companies even though in quantitative terms they are of equal value, such that the results of the highest quality will be those which limit, or reduce, to the greatest extent the risk inherent in the decision making process. This general concept, however; has had different forms that require detailed study. In consequence, this paper aims both to review the different definitions of earnings quality present in the accounting literature, and to analyse the factors that determine earnings quality including: corporate decisions, accounting standards and the manipulation, stability, monetary content and permanent components of earnings.

La Evaluación Del Alumnado Normalista Cordobés En El Primer Tercio Del Siglo Xx. Investigación Basada En Una Metodología Cuantitativa

Directory of Open Access Journals (Sweden)

Antonia Ramírez García

2014-01-01

Full Text Available Este trabajo ofrece los resultados de la evaluación del alumnado de las Escuelas Normales de Córdoba durante los tres planes de estudio existentes en el primer tercio del siglo XX en función del sexo, plan de estudios cursado, procedencia geográfica, extracción social y modalidad de enseñanza cursada. La metodología seguida ha sido predominantemente cuantitativa, los datos se han obtenido de una muestra estratificada de 618 sujetos y para el análisis de los mismos se ha recurrido a la estadística descriptiva e inferencial. Los resultados muestran que la evaluación del alumnado estuvo condicionada por el plan de estudios, el sexo y la modalidad de estudios cursada. No obstante, la procedencia geográfica y la extracción social del alumnado no determinaron los resultados alcanzados por estos alumnos. La evaluación del alumnado encuentra en la Historia un referente para evitar errores del pasado o para incorporar aspectos positivos a los actuales planes de estudio.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

Science.gov (United States)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

GOOD PRACTICES FOR VIRTUAL CLASSROOM IN UNIVERSITARY BLENDED LEARNING BUENAS PRÁCTICAS DE AULAS VIRTUALES EN LA DOCENCIA UNIVERSITARIA SEMIPRESENCIAL

Directory of Open Access Journals (Sweden)

Manuel Area Moreira

2010-02-01

Full Text Available We present the design and results of a study conducted at the University of La Laguna (ULL to identify best practices in virtual classrooms in Higher Education developed in the form of blended learning. The study was conducted in the first quarter of 2008 and analyzed a large sample of virtual classrooms (N = 107 in the Virtual Campus of the University during the period 2005-07. This article presents six examples of virtual classrooms by scientific fields characterized by the incorporation of information resources, communication and experiential learning. En este artículo presentamos el diseño y resultados de un estudio realizado en la Universidad de La Laguna (ULL destinado a identificar buenas prácticas de aulas virtuales en la docencia universitaria desarrolladas bajo la modalidad de blended learning o enseñanza semipresencial. El estudio se desarrolló en el primer trimestre del año 2008 y analizó una importante muestra de las aulas virtuales (N= 107 existentes en el Campus Virtual de dicha universidad en el periodo 2005-07. Se seleccionaron seis ejemplos de aulas virtuales, clasificados por campos científicos, caracterizadas por la incorporación de recursos de información, de comunicación y de aprendizaje experiencial.

Impacto emocional da gestação materna para primogênitos em idade pré-escolar

Directory of Open Access Journals (Sweden)

Débora Silva de Oliveira

2015-01-01

Full Text Available Se investigó el impacto emocional de la gestación materna al primogénitos preesco - lar, evaluados por el Test de las Fábulas, comparándolos con los hijos únicos. Parti - ciparon 46 niños, entre dos y seis años (21 únicos y 25 primogénitos cuyas madres estaban en el tercer trimestre de gestación, de distintos niveles socioeconómicos y residentes en el región metropolitana de Porto Alegre, Rio Grande do Sul. El instru - mento se aplicó individualmente, y los datos fueron analizados desde el sistema de clasificación propuesto por los autores del test. Los resultados muestran que los hijos de las madres embarazadas mostran una mayor frecuencia fantasías de privación, rechazo y abandono, defensas y expresiones de sentimientos. También muestran una mayor movilización delante de la separación en relación a la madre, en busca de otras figuras de apoyo. El Test de las Fábulas facilitó la expresión inconsciente, permi - tiendo la escucha del complejo proceso de convertirse en un hermano, que comienza incluso antes del nacimiento del primer hermano.

Pluralismo informativo y medios públicos. La involución de TVE en el contexto del cambio político (2012-2013

Directory of Open Access Journals (Sweden)

ML Humanes

2015-04-01

Full Text Available Introducción: Se describe y analizan las políticas adoptadas en España con respecto al modelo de gobierno de TVE tras ganar el Partido Popular las elecciones de 2011. Se abordan las reformas y sus implicaciones para los Servicios Informativos de Televisión Española, así como las consecuencias en la información y el nivel de pluralismo. Metodología: Se ha realizado un análisis de contenido sobre dos muestras de tres semanas del primer trimestre delos años 2012 y 2013 (1294 unidades de análisis. Resultados y conclusiones: La regubernamentalización de los órganos de gestión de RTVE ha incrementado la banalización de los contenidos de la televisión pública, en detrimento de los grandes temas de actualidad. Se advierte una reducción de los puntos de vista y del número de fuentes en la información laboral. Asimismo, esta regubernamentalización se acompaña de un predominio del periodismo interpretativo sobre el descriptivo, con un incremento del tono positivo en las informaciones de carácter económico.

Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

DEFF Research Database (Denmark)

Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

2014-01-01

, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

Publicación Estudiantil en Revistas Médicas Venezolanas, 2001 - 2005

Directory of Open Access Journals (Sweden)

Rafael Angulo

2008-01-01

Full Text Available Objetivo: Cuantificar la participación estudiantil en la publicación de contribuciones originales en revistas médicas venezolanas. Diseño: estudio observacional ,retrospectivo. Lugar: Hemeroteca de la Facultad de Medicina de la Universidad de Los Andes y en la página web de SciELO Venezuela. Población: artículos originales, comunicaciones cortas y cartas al editor, publicadas en el periodo 2001 al 2005, en los volúmenes de revistas de periodicidad trimestral actualizadas. Intervenciones: revisión de la filiación de los autores (estudiante o profesional, universidad y escuela de procedencia, tipo de artículo y revista de publicación. Principales resultados: frecuencia y porcentaje de artículos con participación estudiantil. Resultados: se incluyeron 333 contribuciones originales de tres revistas, en 3,9% (11 hubo participación estudiantil en la autoría. La Revista de la Sociedad Venezolana de Microbiología fue la que publicó más artículos estudiantiles (5. El año 2002 se registraron seis publicaciones, sin encontrar una tendencia por año. Todas las publicaciones fueron realizadas entre profesionales y estudiantes, en todos los casos un profesional fue el primer autor. Conclusiones: la participación estudiantil en la publicación de artículos en revistas médicas venezolanas está presente pero en un bajo porcentaje. Se recomienda orientar a los estudiantes en la publicación de sus investigaciones.

A database of PCR primers for the chloroplast genomes of higher plants

Science.gov (United States)

Heinze, Berthold

2007-01-01

Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

A database of PCR primers for the chloroplast genomes of higher plants

Directory of Open Access Journals (Sweden)

Heinze Berthold

2007-02-01

Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

Información sobre la lactancia materna de las gestantes en su tercer trimestre Information on breast feeding found in pregnant women in their third trimester of gestation

Directory of Open Access Journals (Sweden)

Remigio Rafael Gorrita Pérez

2012-12-01

Full Text Available Introducción: son universalmente reconocidas las virtudes de la lactancia materna -y es obvio que la mujer está dotada fisiológicamente para el amamantamiento y en un gran número de organizaciones internacionales de salud de diferentes países se han diseñado políticas con el objetivo de promover adecuadamente esta inigualable práctica- pero aún son múltiples los obstáculos que se presentan a su establecimiento exitoso, y los resultados, a largo plazo, no son satisfactorios. Objetivo: evaluar la información que, sobre lactancia materna, poseen las gestantes en el tercer trimestre de su embarazo, que pertenecen al Policlínico "Mártires del 9 de Abril", del municipio San José de las Lajas. Métodos: se realizó un estudio descriptivo, transversal, para conocer el nivel de información sobre lactancia materna, en el tercer trimestre, de 114 gestantes del Policlínico "Mártires del 9 de Abril", de San José de las Lajas. Se valoraron sus historias de salud individual y familiar, y se les aplicó un cuestionario con 22 preguntas que se evaluó cualitativa y cuantitativamente. Resultados: solo la quinta parte de las gestantes poseía la información suficiente sobre lactancia materna, aunque la mayoría había asumido que sí los tenía. Más de la mitad de los 17 aspectos explorados, eran deficientes en más del 50 % de las encuestadas. Los errores más frecuentes fueron: momento de dar agua al niño con lactancia materna exclusiva, cuándo brindar otro alimento, hasta cuándo mantener la lactancia materna, cómo debe ser la dieta de la madre, el alternamiento y el aseo de los pechos, y los impedimentos de la madre para la lactancia. Conclusiones: gran número de gestantes evidencian desconocimientos o actitudes equivocadas de diversa índole en relación con la lactancia materna exclusiva, aunque creen tener dominio del tema. Se deben explorar otros aspectos, además de los conocimientos sobre la lactancia, que, sin duda, atentan

Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

Directory of Open Access Journals (Sweden)

Puntipar Sonthiphand

Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

The ability of T2/B4 primers to detect Leishmania infantum among ...

African Journals Online (AJOL)

SERVER

2008-04-03

Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

Multimedios y el desarrollo de destrezas lingüísticas del Idioma Inglés de estudiantes de Primer Año de Bachillerato en la Unidad Educativa Picaihua.

OpenAIRE

Montoya Parra, Diego Gustavo

2017-01-01

1. Introducción. --2. Planteamiento de la Propuesta de Trabajo. --3. Marco Teórico. --4. Marco Metodológico. --5. Resultados. --6. Conclusiones y Recomendaciones. El poco uso de herramientas tecnológicas durante la enseñanza de la lengua extranjera genera un limitado aprendizaje en los estudiantes de primer año de Bachillerato de la Unidad Educativa Picaihua. Por ende, el proyecto investigativo tiene como objetivo determinar la utilización de herramientas multimedia en el desarrollo de l...

Universal primers that amplify RNA from all three flavivirus subgroups

Directory of Open Access Journals (Sweden)

Barnard Ross T

2008-01-01

Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

Science.gov (United States)

Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

2013-09-01

New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

Relación del desempeño académico de estudiantes de primer año de universidad en Chile y los instrumentos de selección para su ingreso

Directory of Open Access Journals (Sweden)

Gastón Vergara-Díaz

2017-01-01

Full Text Available Si bien el rendimiento académico del estudiantado que ingresa a las universidades chilenas ha sido objeto de múltiples estudios, pocas investigaciones han analizado la relación que tienen los instrumentos de selección de ingreso y el rendimiento académico posterior. En una muestra de 440 estudiantes de Ingeniería Comercial de la Universidad Austral de Chile, pertenecientes a cinco promociones de primer año, se estudiaron los instrumentos de admisión a la carrera, y se determinó cuáles explican mejor el rendimiento académico. Para ello se utilizaron los resultados de las pruebas de selección universitaria (PSU y las notas de enseñanza media (NEM obtenidos por el estudiantado, en relación con el promedio semestral ponderado (PSP del primer año universitario. Se determinó que el promedio de NEM explica mejor el rendimiento académico estudiantil, al presentar la mejor correlación con el rendimiento académico del primer semestre y de manera más fuerte en el segundo.

Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

Directory of Open Access Journals (Sweden)

Ni Luh Putu Indi Dharmayanti

2016-07-01

Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

Estado nutricional del hierro en gestantes adolescentes, Medellín, Colombia / Nutritional status of iron in pregnant adolescents, Medellín, Colombia

Directory of Open Access Journals (Sweden)

Beatriz E. Parra S

2014-04-01

Full Text Available Objetivo: analizar el estado nutricional del hierro en gestantes adolescentes de tercer trimestre. Metodología: estudio analítico de corte transversal con 276 adolescentes entre 10 y 19 años, en tercer trimestre de gestación de la Empresa Social del Estado (ese Metrosalud (Medellín, 2011-2012, con datos de hemoglobina, volumen corpuscular medio, concentración de hemoglobina corpuscular media e ingesta de suplemento de hierro. La ferritina sérica se analizó en 178 gestantes, controlada por proteína C-reactiva. Se utilizaron medidas de tendencia central, dispersión, porcentajes y pruebas de Chi2 , anova, Kruskal-Wallis y U de Mann-Whitney. Resultados: la prevalencia de anemia fue 17,1% en el tercer trimestre de gestación y por deficiencia de hierro, 51%. La mediana de ferritina sérica fue 13,3 µg/L (RQ: 7,7 µg/L-17,9 µg/L; sólo el 5,6% (n = 9 presentó valores adecuados de ferritina. Las madres que tomaron suplemento de hierro diariamente presentaron mejores concentraciones de hemoglobina y ferritina, frente a aquellas que no lo hicieron, Hb 12,1g/dL vs. 11,7 g/dL (p = 0,019 y ferritina sérica 14,6 µg/L vs. 7,0 µg/L (p = 0,000. Discusión: hubo altas prevalencias de anemia y ferropenia en las gestantes, asociadas con la no adherencia al suplemento de hierro Objetivo: analizar el estado nutricional del hierro en gestantes adolescentes de tercer trimestre. Metodología: estudio analítico de corte transversal con 276 adolescentes entre 10 y 19 años, en tercer trimestre de gestación de la Empresa Social del Estado (ese Metrosalud (Medellín, 2011-2012, con datos de hemoglobina, volumen corpuscular medio, concentración de hemoglobina corpuscular media e ingesta de suplemento de hierro. La ferritina sérica se analizó en 178 gestantes, controlada por proteína C-reactiva. Se utilizaron medidas de tendencia central, dispersión, porcentajes y pruebas de Chi2 , anova, Kruskal-Wallis y U de Mann-Whitney. Resultados: la prevalencia

Design of a Percussion and Electric Primer Gun Firing Power Supply

Science.gov (United States)

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

Science.gov (United States)

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

Science.gov (United States)

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

Bioinformatic tools for PCR Primer design

African Journals Online (AJOL)

ES

Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

Directory of Open Access Journals (Sweden)

Alexandre R. Zuntini

2013-08-01

Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

TRATAMIENTO DE LA DIABETES EN EL EMBARAZO: ¿ALGO NUEVO?

OpenAIRE

S., Gloria López

2016-01-01

La diabetes (DM) en embarazo es pregestacional (DPG), incluye a la diagnosticada en primer trimestre y gestacional (DG). La prevalencia DM creciente de obesidad y DM2 y embarazos tardíos, han aumentado la DG y DPG tipo 2. Persiste controversia en diagnóstico de DG. Las metas glucídicas son más estrictas en la gestación. Tratamiento en DPG: Programación del embarazo, buen control glicémico y complicaciones de su DM ausentes o tratadas. La DM1 intensifica la insulinoterapia y la DM2 la inici...

Real-time PCR (qPCR) primer design using free online software.

Science.gov (United States)

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

A Hearing Aid Primer 1

Science.gov (United States)

Yetter, Carol J.

2009-01-01

This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

DNA Extraction and Primer Selection

DEFF Research Database (Denmark)

Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

A classical primer for QCD

International Nuclear Information System (INIS)

Moriyasu, K.

1981-01-01

A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

Science.gov (United States)

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

Tools for Ultraspecific Probe/Primer Design

National Research Council Canada - National Science Library

Fofanov, Yurly

2006-01-01

.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

Diversity of internal structures in inhibited epoxy primers

Directory of Open Access Journals (Sweden)

Anthony E. Hughes

2015-10-01

Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

Directory of Open Access Journals (Sweden)

El-Sayed Negim

2016-01-01

Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

Bond strength of compomers to dentin using acidic primers.

Science.gov (United States)

Tate, W H; You, C; Powers, J M

1999-10-01

To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

CONOCIMIENTOS TEÓRICOS Y ESTRATEGIAS METODOLÓGICAS QUE EMPLEAN DOCENTES DE PRIMER CICLO EN LA ESTIMULACIÓN DE LAS INTELIGENCIAS MÚLTIPLES

Directory of Open Access Journals (Sweden)

Aida María Mainieri Hidalgo

2015-01-01

Full Text Available Resumen: Este artículo presenta los resultados de la investigación "Conocimientos teóricos y estrategias metodológicas que emplean docentes de primer ciclo en la estimulación de las inteligencias múltiples", desarrollada en la Maestría en Psicopedagogía de la Universidad Estatal a Distancia, Costa Rica. Se busca conocer las conceptualizaciones teóricas y las estrategias metodológicas que utiliza el profesorado de primer ciclo en la aplicación de la Teoría de las Inteligencias Múltiples (TIM en el currículo. Se realizó con una metodología cualitativa y un enfoque interpretativo, se analizaron fuentes documentales y se aplicaron entrevistas en profundidad a docentes y expertos, utilizando un muestreo de tipo teórico, observación en el campo de trabajo y grupos focales en dos centros educativos privados, uno en San José, Costa Rica y otro en David-Panamá. Del análisis obtenido se extrae dos modelos de implementación para la estimulación de las inteligencias múltiples; los cuales sirven de referencia para indagar la puesta en práctica de esta teoría en tres escuelas públicas costarricenses. Como resultado se evidencian estrategias pedagógicas y evaluativas muy particulares que brindan una amplia perspectiva con respecto a las contribuciones de este enfoque educativo al proporcionar una base de partida más amplia para el desarrollo de las potencialidades, el aprendizaje y la construcción del conocimiento. Los aportes se traducen en una práctica docente innovadora que afecta positivamente la integridad de estudiantes y docentes en el proceso de aprendizaje basado en proyectos.

Perfil de ingreso de alumnos con buen desempeño académico en el primer año de estudios. El caso de la Escuela de Diseño de la Universidad De La Salle Bajío

Directory of Open Access Journals (Sweden)

María Daniela Esparza Olmos

2011-01-01

Full Text Available Introducción: El sistema educativo universitario se ha enfrentado a varios retos en los últimos tiempos, lo que ha implicado establecer políticas de admisión que permitan seleccionar a los estudiantes que cumplan con el perfil de ingreso, permitiendo generar estrategias para mejorar su desempeño académico a lo largo de sus estudios, y con ello elevar las cifras de la eficiencia terminal. Es así como el objetivo de esta investigación fue caracterizar el perfil de ingreso de los alumnos que mostraron un buen desempeño académico en el primer año de la licenciatura de diseño industrial, diseño de modas y calzado, diseño gráfico y diseño ambiental de la Universidad De La Salle Bajío. Método: La distribución final de la muestra estuvo formada por 256 alumnos de ambos sexos al analizarse estadísticamente los resultados de sus pruebas en el proceso de admisión de las cohortes del 2005 al 2008, para posteriormente correlacionarlas con el promedio del primer año de sus estudios. Resultados: Los resultados permitieron observar las semejanzas y diferencias entre las cuatro licenciaturas con respecto al perfil general de ingreso en la Escuela de Diseño. Asimismo, se encontró que los alumnos que presentaron en periodo de excelencia, obtuvieron mejor desempeño académico en el primer año de estudios. Conclusión: Conocer el perfil de ingreso servirá de parámetro en los siguientes procesos de admisión, además permitirá diseñar estrategias que fortalezcan las capacidades y habilidades de los alumnos al ingresar a la educación superior, de tal manera que se eleven los índices de eficiencia terminal y con ello mejorar la calidad en los programas académicos de licenciatura en la Escuela de Diseño.

Longitud (número de preguntas y resultado de un examen Length (number of questions and exams results

Directory of Open Access Journals (Sweden)

R. Sarrias-Ramis

2010-09-01

Full Text Available Objetivo. Este artículo presenta dos estudios sobre la relación entre el número de preguntas de un examen y sus resultados. Estos dos estudios se realizaron en respuesta a dos problemas concretos presentados en dos facultades de ciencias de la salud de dos universidades catalanas. Sujetos y métodos. El primer estudio, realizado en la Facultad de Medicina de la Universitat Autònoma de Barcelona, compara los resultados reales obtenidos en pruebas de elección múltiple en tres asignaturas con los resultados que hubieran obtenido los estudiantes con la mitad de las preguntas. La dificultad del examen en ambas situaciones fue prácticamente la misma y los resultados académicos también fueron similares. El segundo estudio, llevado a cabo en la Facultad de Ciencias de la Salud y de la Vida de la Universitat Pompeu Fabra de Barcelona, compara los resultados reales obtenidos en pruebas de ensayo de dos asignaturas de los estudios de Biología con los hipotéticos que se hubieran obtenido con la mitad de las preguntas. Los resultados obtenidos globalmente fueron muy parecidos. Conclusión. La conclusión general del estudio es que la evaluación del rendimiento académico no dependería fundamentalmente del número de preguntas y que sería más importante buscar la representatividad y relevancia de éstas.Aim. This paper resents two studies about the relationship between the number of questions that appear in an exam and their results. These studies have been done in response to two concrete problems found in two Spanish universities. Subjects and methods. The first study, done at the Faculty of Medicine of the Autonomous University of Barcelona, compared the real results achieved in three subjects which use MCQ-tests with the theoretical results which the students would have achieved if half of the questions had been used. The difficulty of the exams in both situations was practically the same and the student's academic results were very similar

Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

OpenAIRE

Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

2014-01-01

Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

Ingesta de hierro y folatos durante el embarazo y su relación con indicadores bioquímicos maternos = Iron and folate intake during pregnancy and its relationship with maternal biochemical indicators

Directory of Open Access Journals (Sweden)

Restrepo Mesa, Sandra Lucía

2012-07-01

Full Text Available Introducción: la anemia en gestantes es un problema de salud pública en América Latina incluida Colombia.Objetivo: evaluar los indicadores bioquímicos del estado nutricional del hierro y el folato en un grupo de mujeres gestantes pobres vinculadas a un programa nutricional de la Gobernación de Antioquia (Colombia.Materiales y métodos: estudio cuasiexperimental en 26 gestantes, beneficiarias de un programa de educación nutricional, complemento alimentario fortificado con micronutrientes y suplemento de hierro, ácido fólico y vitamina C. Se evaluaron la ingesta dietética por recordatorio de 24 horas, y se midieron la ferritina sérica, la hemoglobina, el volumen corpuscular medio, la proteína C reactiva y el folato sérico; se hizo un coprológico para parásitos intestinales. Se aplicaron la prueba de Pearson para correlacionar la ingesta de folatos con la concentración sérica de los mismos, la prueba de Spearman para correlacionar la ingesta de hierro con la concentración sérica de ferritina, ANOVA de mediciones repetidas para comparación entre los trimestres de gestación y análisis de regresión simple y múltiple para establecer la dependencia de la ferritina, la hemoglobina y el folato sérico con las variables de interés. Se consideró significativo p < 0,05.Resultados: la anemia se previno en 84,6%; la variable más explicativa del cambio en la hemoglobina del tercer trimestre fue su valor en el segundo trimestre. Disminuyó la microcitosis (p = 0,02, pero las gestantes con menor ingesta de hierro tuvieron mayor prevalencia de esta en el tercer trimestre (p = 0,009. La ferropenia aumentó en el transcurso del embarazo (p < 0,001 y se halló correlación positiva entre la ingesta de hierro y la concentración de ferritina en el tercer trimestre (r = 0,64; p < 0,001. La concentración sérica de folato aumentó en el segundo y tercer trimestres (p = 0,018 y se observó una tendencia a la correlación positiva con la ingesta

Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

Directory of Open Access Journals (Sweden)

Francesco Dal Grande

2013-03-01

Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

40 CFR 63.745 - Standards: Primer and topcoat application operations.

Science.gov (United States)

2010-07-01

... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

Prevalence of sexual dysfunction during pregnancy Prevalência da disfunção sexual na gravidez

Directory of Open Access Journals (Sweden)

Alessandra Plácido Lima Leite

2009-01-01

feminina, em cada trimestre gestacional. RESULTADOS: Existiu diferença significante para os escores médios dos domínios do FSFI ao longo da gestação, mais especificamente no terceiro trimestre, onde houve diminuição significativa dos escores de todos os domínios do FSFI quando comparado ao segundo trimestre (p<0,001. Quando a função sexual foi comparada de acordo com a idade da paciente, existiu diferença estatisticamente significante entre as gestantes adolescentes e adultas no terceiro trimestre (p=0,008. A disfunção sexual entre as gestantes adolescentes foi de 40,8% no primeiro trimestre, 31,2% no segundo e 63,2% no terceiro. Entre as grávidas adultas, foi de 46,6%, 34,2% e 73,3% no primeiro, segundo e terceiro trimestres, respectivamente. Não existiu diferença significativa na prevalência da disfunção sexual quando comparada por faixa etária; entretanto, ao comparar por trimestre gestacional, houve diferença significante entre o segundo e o terceiro trimestre (p<0,001. CONCLUSÃO: A função sexual é afetada durante a gravidez, com significativo declínio de todos os domínios do FSFI no terceiro trimestre, tanto nas adolescentes quanto nas adultas. A prevalência da disfunção sexual é elevada durante a gestação, atingindo níveis mais elevados no terceiro trimestre, em ambos os grupos etários, contudo as adolescentes apresentaram melhores índices de função sexual.

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

Science.gov (United States)

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

Science.gov (United States)

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

Science.gov (United States)

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Targeted reduction of highly abundant transcripts using pseudo-random primers.

Science.gov (United States)

Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

2016-04-01

Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

Violencia contra mujeres embarazadas entre las usuarias del Instituto Mexicano del Seguro Social: un estudio sobre determinantes, prevalencia y severidad

OpenAIRE

Roberto Castro; Gregorio Agustín Ruiz; María de la Luz Arenas Monreal; Sergio Juárez Márquez; Nora Barrios Martínez Rojas

2002-01-01

Se presentan los resultados de una encuesta entre 446 mujeres usuarias de los servicios de salud del Instituto Mexicano del Seguro Social (IMSS) en Morelos, que se encontraban en su tercer trimestre de embarazo. El objetivo era indagar si la violencia contra mujeres se incrementa durante el embarazo o si, por el contrario, disminuye. Se encontró que la prevalencia no varió en ambos periodos (aproximadamente 15 por ciento, en general). En cambio, la severidad de l...

PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

Directory of Open Access Journals (Sweden)

S. DÍEZ

1999-11-01

Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

Defense Primer: DOD Contractors

Science.gov (United States)

2017-02-10

functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

Directory of Open Access Journals (Sweden)

Li Kelvin

2012-11-01

Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

Freshwater Wetlands: A Citizen's Primer.

Science.gov (United States)

Catskill Center for Conservation and Development, Inc., Hobart, NY.

The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

Quantitative Microbial Risk Assessment Tutorial - Primer

Science.gov (United States)

This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

DEFF Research Database (Denmark)

Busk, Peter Kamp

2014-01-01

of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

A cluster-randomized controlled trial of handrubs for prevention of infectious diseases among children in Colombia Ensayo controlado aleatorizado por conglomerados sobre el uso de antisépticos para las manos para la prevención de enfermedades infecciosas en los niños en Colombia

Directory of Open Access Journals (Sweden)

Juan C. Correa

2012-06-01

continuar llevando a cabo las prácticas de lavado de las manos habituales (grupo de referencia: 21 centros/933 niños. Los casos de enfermedades diarreicas agudas e infecciones respiratorias agudas fueron identificados mediante la notificación de los signos y síntomas de enfermedad por los maestros. Se efectuó un seguimiento de los acontecimientos adversos. Se obtuvieron las razones de riesgos instantáneos (HR usando modelos de regresión multivariante de riesgos proporcionales de Cox con fragilidad compartida. RESULTADOS: Se alcanzó un total de 336 038 niño-días de vigilancia. La pérdida de contacto durante el seguimiento fue de 14,5%. Durante el primer trimestre del estudio no hubo diferencias en las razones de riesgo para las enfermedades diarreicas agudas ni para las infecciones respiratorias agudas. En el segundo y tercer trimestres se encontraron disminuciones significativas del riesgo de enfermedades diarreicas agudas en el grupo de intervención en comparación con el grupo de referencia (HR = 0,55, P < 0,001 y HR = 0,44, P < 0,001, respectivamente. Para las infecciones respiratorias agudas se observaron disminuciones significativas del riesgo durante el segundo trimestre (HR = 0,80, P < 0,05 y el tercer trimestre (HR = 0,69, P < 0,001 del ensayo. No ocurrieron eventos adversos. CONCLUSIONES: Los antisépticos para las manos a base de alcohol son eficaces para prevenir las enfermedades diarreicas agudas y las infecciones respiratorias agudas y son seguros. Las políticas nacionales de salud pública de Colombia para la prevención de estas enfermedades deben incluir su uso, especialmente en los ámbitos donde el lavado de las manos con agua y jabón está limitado por la disponibilidad de agua

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

Science.gov (United States)

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

Sensory reception of the primer pheromone ethyl oleate

Science.gov (United States)

Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

2012-05-01

Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

Science.gov (United States)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

Directory of Open Access Journals (Sweden)

Nora Scheuer

2010-10-01

Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

El aprendizaje de distintos dominios notacionales según niños de preescolar y primer grado

Directory of Open Access Journals (Sweden)

Nora Scheuer

2010-01-01

Full Text Available Se investiga si las concepciones de los niños acerca del aprendizaje adoptan matices diferentes según tres dominios notacionales: dibujo, escritura y notación numérica. Se entrevistó individualmente a 120 alumnos de preescolar (60 y primer grado (60 de escuelas públicas en Argentina. Se aplicó la lexicometría a las transcripciones de sus respuestas completas a tres preguntas referidas a la actividad, dificultades y metas en relación al propio aprendizaje del dibujo, escritura o notación numérica. Los resultados revelan diferencias significativas en cómo los niños refieren el contenido de aprendizaje y a sí mismos como aprendices según el dominio, indicando una teoría interpretativa del aprendizaje en relación al dibujo y la notación numérica, y una teoría directa en relación a la escritura.

PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

Science.gov (United States)

Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

2015-01-01

Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

GST-PRIME: an algorithm for genome-wide primer design.

Science.gov (United States)

Leister, Dario; Varotto, Claudio

2007-01-01

The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

Trasplante simultáneo de páncreas y riñón: reporte del primer caso realizado en el Perú

Directory of Open Access Journals (Sweden)

José De Vinatea

2010-04-01

Full Text Available El trasplante simultáneo de páncreas y riñón es la opción terapéutica ideal para pacientes con diabetes mellitus tipo 1 con insuficiencia renal crónica. Permite recuperar la insulino-independencia y evita la necesidad de diálisis, mejorando notablemente la calidad de vida. Así mismo, la restitución de la euglicemia logra que las complicaciones tardías de la diabetes no progresen e incluso regresionen, prolongando la supervivencia global de estos pacientes. Estos beneficios superan a los riesgos de la cirugía y de la inmunosupresión inherentes al trasplante. A nivel mundial, desde 1966, en que se llevó a cabo el primer trasplante de páncreas en Minnesota (Estados Unidos, se han registrado más de 20 000 trasplantes de páncreas, con resultados cada vez mejores gracias al refinamiento en las técnicas quirúrgicas y a los nuevos esquemas de inmunosupresión. En el presente caso clínico, se reporta y describe la realización del primer trasplante simultáneo de páncreas y riñón en el Perú.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

Science.gov (United States)

Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

2018-01-17

In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

The R primer

CERN Document Server

Ekstrom, Claus Thorn

2011-01-01

Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

Diferencias en la Predictividad de la Lectura Entre Primer Año y Cuarto Año Básicos Differences in the Predictability of Reading Between First Grade and Fourth Grade

Directory of Open Access Journals (Sweden)

Luis Bravo Valdivieso

2006-05-01

Full Text Available Este artículo presenta los resultados obtenidos en un seguimiento de 227 niños durante cuatro años. Fueron evaluados al iniciar el primer año básico con diversas pruebas psicolingüísticas predictivas y luego en lectura a fines del primero y del cuarto año. Se estudió la variación de la predictividad de la lectura entre ambos cursos, mediante matriz de correlaciones y regresión step-wise. Los resultados indican que el conocimiento de las letras y la conciencia fonológica fueron los mejores predictores de la lectura del primer año. En cambio el conocimiento de las letras, de palabras escritas y de estructuras textuales predijo mejor la lectura a fines del cuarto año.The aim of this article is to present the issues of a follow-up study between 227 children of first and fourth grade of elementary school. They were tested with several psycholinguistic tests at the beginning of first grade and thereafter they were tested in reading at the end of the first and fourth grade. The variability in the prediction of the initial tests over the first and fourth grades was calculated by correlations and step-wise regression. The results show that there is variability among the predictive variables between these grades. In first grade the most predictive tests were letter naming and phonological awareness. For fourth grade the most predictive tests were letter naming and knowledge ot written words and textual structures.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

Science.gov (United States)

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

Directory of Open Access Journals (Sweden)

Prima Ditahardiyani

2008-01-01

Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

Directory of Open Access Journals (Sweden)

José Cardona Á.

2011-12-01

Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

EL IGF-II ESTIMULA LA ACTIVIDAD DE MMP-9 Y MMP-2 EN UN MODELO DE TROFOBLASTO HUMANO

Directory of Open Access Journals (Sweden)

Myriam Sánchez-Gómez

2011-01-01

Full Text Available La invasión del útero por el trofoblasto extravelloso de placenta de primer trimestre depende de la secreción de metaloproteasas de matriz (MMPs las cuales degradan la matriz extracelular; dentro de las cuales las gelatinasas MMP-9 y MMP-2 juegan un papel muy importante. El objetivo de este trabajo fue determinar el efecto de los ligandos del sistema de factores de crecimiento similares a la insulina (IGF en la actividad de gelatinasas en una línea celular establecida de trofoblasto extravelloso invasivo, HTR8/SVneo. Mediante ensayos de zimografía se encontró que el tratamiento con IGF-II 10 nM estimula la actividad de proMMP-9 y proMMP-2 únicamente a las 24 horas. Dosis mayores de IGF-II mostraron un efecto inhibitorio en la actividad proteasa. Adicionalmente, el IGF-II 10 nM estimuló la actividad de otras dos gelatinasas no identificadas de peso molecular 52 kDa tras tratamiento por 24 horas. Ni la insulina ni el IGF-I en concentraciones 10 nM mostraron un efecto estimulador en la actividad de las gelatinasas. Estos resultados muestran el papel potencial del sistema IGF en la regulación de la invasión celular y ayudan a comprender el desarrollo del crecimiento maligno.

Revisión con agujas y uso de mitomicina C en bulas de filtración encapsuladas Needle revision and use of Mitomycin-C to manage encapsulated filtering blebs

Directory of Open Access Journals (Sweden)

Francisco Fumero González

2012-01-01

Full Text Available La trabeculectomía es uno de los tratamientos de elección en los pacientes con glaucoma. La causa más común de fallo de esta cirugía en su primer trimestre es la bula de filtración encapsulada. Usualmente es resultado de la proliferación fibrótica subconjuntival que lleva a fallo de la bula, como por ejemplo en los glaucomas traumáticos. La revisión con agujas y la mitomicina C constituyen una opción efectiva y relativamente segura para restaurar la función de la cirugía de filtración. Se presenta un paciente donde se restableció el flujo de humor acuso con este proceder.Trabeculectomy is the surgical treatment of choice for many patients with glaucoma. The most common cause of failure during the first trimester after trabeculectomy is encapsulated bleb. Generally, that results from scarring in the subconjunctival space with a resultant intrableb fibrosis and the development of a failed bleb, for example in traumatic glaucoma. Needling bleb revision with mitomycin-C appears to be an effective and relatively safe way to revive the function of the filtration surgery. This was the case report of a patient whose aqueous humor flow was reestablished with this treatment.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

Science.gov (United States)

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

OpenAIRE

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

Directory of Open Access Journals (Sweden)

Tatyana V Matveeva

2008-09-01

Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

Análisis del comportamiento de la inflación trimestral en Colombia bajo cambios de régimen: Una evidencia a través del modelo "Switching" de Hamilton.

Directory of Open Access Journals (Sweden)

Luis Fernando Melo

2010-05-01

Full Text Available Este trabajo tiene como propósito estudiar la evolución de la inflación trimestral en Colombia, durante el período comprendido entre 1954 y 1996, a través de la metodología de Hamilton(1989 y segundo presentar algunos conceptos relacionados con dicha metodología, la cual introduce cambios de régimen en el análisis convencional de series de tiempo. En general, esta metodología permite estimar modelos ARIMA con parámetros o varianzas cambiantes en el tiempo. En este caso, tales cambios en el modelo de la inflación se suponen asociados a posibles regímenes distintos donde la inflación presenta cambios en su nivel o en su variabilidad. Esta modelación posibilita el reconocimiento de los distintos regímenes a través del tiempo (por ejemplo dos regímenes: inflación alta e inflación baja en lo referente a su tiempo promedio de duración y a la probabilidad asociada de cada uno de ellos, es decir, la probabilidad de estar en un régimen particular en un momento dado del tiempo. Las probabilidades de transición estimadas, permiten concluir, por ejemplo, que al estar en un régimen de inflación trimestral moderado, la probabilidad de permanecer en éste es muy alta (0.94, en tanto que pasar de éste a un régimen de inflación promedio alta tiene una probabilidad de (0.05, la cual es cinco veces mayor que la estimada para la transición de moderada a baja (0.01. Adicionalmente, se puede observar que la máxima probabilidad de permanecer en un mismo régimen se tiene en aquel caracterizado como de inflación y variabilidad moderadas.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

Science.gov (United States)

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

Science.gov (United States)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

El primer virreinato americano

Directory of Open Access Journals (Sweden)

Cassá, Roberto

2006-12-01

Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

Tendinopatia patelar: resultados tardios do tratamento cirúrgico

Directory of Open Access Journals (Sweden)

Marcos Henrique Frauendorf Cenni

2015-10-01

Full Text Available resumo Objetivo: Avaliar os resultados tardios do tratamento cirúrgico na tendinopatia patelar (TP com o uso do escore Visa (Victorian Institute of Sport Tendon Study Group e o método de Verheyden. Métodos: Estudo retrospectivo que avaliou os resultados pós-operatórios de 12 pacientes, ou 14 joelhos, entre julho de 2002 e fevereiro de 2011. Foram incluídos os pacientes com tendinopatia patelar refratários ao tratamento conservador e que não apresentavam outras lesões cirúrgicas concomitantes. Pacientes que não foram devidamente acompanhados no período pós-operatório foram excluídos. Resultados: Pelo método de Verheyden, nove pacientes foram considerados muito bons, dois bons e um ruim. Em relação ao Visa, a média foi de 92,4 pontos, com apenas dois pacientes abaixo de 70 pontos (66 e 55 pontos. Conclusão: O tratamento cirúrgico da tendinopatia patelar, quando corretamente indicado, tem bons resultados em longo prazo.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Science.gov (United States)

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Conocimientos teóricos y estrategias metodológicas que emplean docentes de primer ciclo en la estimulación de las inteligencias múltiples

Directory of Open Access Journals (Sweden)

Mainieri Hidalgo, Aida María

2015-01-01

Full Text Available Este artículo presenta los resultados de la investigación "Conocimientos teóricos y estrategias metodológicas que emplean docentes de primer ciclo en la estimulación de las inteligencias múltiples", desarrollada en la Maestría en Psicopedagogía de la Universidad Estatal a Distancia, Costa Rica. Se busca conocer las conceptualizaciones teóricas y las estrategias metodológicas que utiliza el profesorado de primer ciclo en la aplicación de la Teoría de las Inteligencias Múltiples (TIM en el currículo. Se realizó con una metodología cualitativa y un enfoque interpretativo, se analizaron fuentes documentales y se aplicaron entrevistas en profundidad a docentes y expertos, utilizando un muestreo de tipo teórico, observación en el campo de trabajo y grupos focales en dos centros educativos privados, uno en San José, Costa Rica y otro en David-Panamá. Del análisis obtenido se extrae dos modelos de implementación para la estimulación de las inteligencias múltiples; los cuales sirven de referencia para indagar la puesta en práctica de esta teoría en tres escuelas públicas costarricenses. Como resultado se evidencian estrategias pedagógicas y evaluativas muy particulares que brindan una amplia perspectiva con respecto a las contribuciones de este enfoque educativo al proporcionar una base de partida más amplia para el desarrollo de las potencialidades, el aprendizaje y la construcción del conocimiento. Los aportes se traducen en una práctica docente innovadora que afecta positivamente la integridad de estudiantes y docentes en el proceso de aprendizaje basado en proyectos

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

Directory of Open Access Journals (Sweden)

Andrew L. Krohn

2013-07-01

Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

In vivo effect of a self-etching primer on dentin.

Science.gov (United States)

Milia, E; Lallai, M R; García-Godoy, F

1999-08-01

To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

Population study of depressive symptoms and risk factors in pregnant and parenting Mexican adolescents Estudio poblacional sobre los síntomas depresivos y los factores de riesgo en adolescentes mexicanas embarazadas o con hijos

Directory of Open Access Journals (Sweden)

María Asunción Lara

2012-02-01

Epidemiological Studies Depression Scale [CES-D] 16 a 23 y CES-D > 24 y la situación de embarazo o de crianza. RESULTADOS: Los síntomas depresivos (CES-D de 16 a 23 variaron de 2,3% en el primer semestre después del parto a 32,5% en el segundo trimestre del embarazo; los síntomas depresivos graves (CES-D > 24 fueron desde 3,0% en el segundo semestre posparto hasta 24,7% en las madres de un niño mayor de 1 año de edad. Se observaron diferencias significativas entre los grupos en las madres que se encontra-ban en el segundo trimestre de la gestación, que presentaron significativamente más síntomas que las mujeres que nunca habían estado embarazadas y que las que estaban en el primer semestre posparto. En las mujeres con síntomas graves, no se observaron diferencias significativas entre los grupos. Mediante un modelo de regresión logística polinómico usado para calcular la probabilidad de depresión se detectó un mayor riesgo de padecer síntomas depresivos (CES-D 16 a 23 en las mujeres sin una pareja que se encontraban en el primer, segundo o tercer trimestre del embarazo; en el segundo semestre después del parto; y en las mujeres con un niño mayor de 1 año. En las mujeres que no concurrían a la escuela y en aquellas con un niño mayor de 1 año se encontró un mayor riesgo de presentar síntomas graves (CES-D > 24. CONCLUSIONES: Los síntomas depresivos implican una carga de morbilidad impor-tante para la madre y riesgos para la salud mental del lactante; por lo tanto, las acciones de prevención y de intervención deben dirigirse a las madres.

Characteristics of the population employed in primer sector in Turkey

Directory of Open Access Journals (Sweden)

Bayar Rüya

2006-01-01

Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

Science.gov (United States)

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Menopause 101: A Primer for the Perimenopausal

Science.gov (United States)

... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

Directory of Open Access Journals (Sweden)

Santoro Claudio

2008-08-01

Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

DISPLASIA CUBITAL, PRESENTACIÓN CLÍNICA Y RESULTADOS EN UNA SERIE RETROSPECTIVA DE DIEZ AÑOS

Directory of Open Access Journals (Sweden)

Enrique Vergara Amador

2010-04-01

Full Text Available Antecedentes. La displasia cubital es una alteración en el desarrollo embriológico del lado cubital del antebrazo y la mano. Las deformidades comprometen manos, muñecas y codos; sólo el 11% de los pacientes tienen dedos completos y hasta el 38% de los casos cursan con sindactilias. Objetivo. Describir el perfil epidemiológico y las características clínicas, radiológicas y el tratamiento y los resultados en 14 niños. Material y métodos. Es un estudio descriptivo tipo serie de casos, retrospectivo 14 niños (18 miembros superiores, se evaluaron las características clínicas y radiológicas. Resultados. El compromiso bilateral fue del 28.5 %. Los tipos II y IV de Bayne fueron los predominantes con un 66.5%. Las cirugías múltiples fueron el 41%. Funcionalmente no fue posible homogeneizar un instrumento pre y posoperatorio. El tipo de pinza mejoró de lateral a bidigital o tridigital en el 72.2% de los pacientes, indicador de un progreso funcional significativo. El 84% presentó prensión buena y mejoría en las actividades básicas cotidianas. Conclusión. No existe una clasificación que pueda integrar la diversidad de anomalías. A pesar que la clasificación de Bayne engloba a una gran cantidad de ellos, hay unas difíciles de encasillar como algunos casos con similitud a focomelias y deficiencias transversas del antebrazo. El manejo es específico para cada caso en particular. Sabemos que el compromiso del codo y del primer metacarpiano, son determinantes en el pronóstico funcional. La mejoría de la pinza fue lograda en el 72.2% de los casos llevados a cirugía.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Science.gov (United States)

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Correlação entre Índice de massa Corporal (IMC pré-natal e peso ao nascer – um estudo longitudinal - doi: 10.5020/18061230.2012.p356

Directory of Open Access Journals (Sweden)

Saurabh Rambiharilal Shrivastava

2012-11-01

Full Text Available Objetivos: Estudar a correlação entre Índice de Massa Corporal (IMC no período pré-natal e o peso de nascimento da criança, bem como, os determinantes sócio-demográficos de peso ao nascer. Métodos: Um estudo longitudinal de um ano de duração, de junho 2010 a maio de 2011, foi realizado em uma favela urbana de Mumbai, Índia. O método de amostragem universal foi aplicado, incluindo como sujeitos todas as mulheres grávidas que realizaram pré-natal com, no mínimo, duas visitas, incluindo pelo menos uma no terceiro trimestre, registradas no centro urbano de saúde, de junho a agosto de 2010. Mulheres com qualquer estado mórbido pré-existente ou com histórico de gestações com nascimento de gêmeos ou de criança com qualquer má-formação congênita, ou inda, com ocorrência de natimorto ou parto em casa, foram excluídas do estudo. Estas mulheres foram acompanhadas durante os próximos meses até o parto. O peso materno foi medido em cada visita e calculado o IMC, ou o IMC médio, no caso de mais de uma visita em qualquer trimestre. O peso ao nascer foi registrado a partir de dados do hospital ou maternidade. Resultados: A prevalência de Baixo Peso ao Nascer (BPN foi de 26,7%. Correlação entre o IMCmaterno do terceiro trimestre e o peso ao nascer foi moderadamente positiva. 60,8% da variabilidade no peso ao nascer podem ser preditos pelo IMC materno no terceiro trimestre. Conclusão: O IMC materno no terceiro trimestre pode ser usado como um preditor de peso ao nascimento neonatal. Informação, Educação e Aconselhamento (IEC sobre a utilização do pré-natal podem ajudar na redução da incidência de Baixo Peso ao Nascer (BPN.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

Science.gov (United States)

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Índice de dispersión poblacional distrital (IDP para la estimación de necesidades de recursos humanos en salud del primer nivel de atención

Directory of Open Access Journals (Sweden)

Carmela Álvarez

2015-01-01

Full Text Available Introducción: El Ministerio de Salud de Perú (MINSA viene implementando políticas y estrategias orientadas a garantizar el acceso a atención con equidad, oportunidad y calidad; para lo cual se requiere contar con recursos humanos (RHUS suficientes y adecuadamente distribuidos en los diferentes niveles de atención. Así, es fundamental estimar la brecha de RHUS especialmente en el primer nivel de atención, incorporando en particular como criterio, la dispersión poblacional presente en el país. Objetivos: Diseñar, validar y aplicar un índice de dispersión poblacional distrital (IDP que caracterice la dispersión distrital y aporte en la estimación de brecha de RHUS en el primer nivel de atención. Diseño: Estudio observacional y analítico, análisis multivariado. Lugar: Dirección General de Gestión del Desarrollo de Recursos Humanos MINSA, Perú. Participantes: Se consideró como unidad de análisis la totalidad de los distritos del Perú. Intervenciones: Análisis factorial exploratorio que considera variables demográficas, sociales, económicas y de acceso a los servicios de salud, obtenidas de los Censos de Población y Vivienda (2005 y 2007 y la Encuesta Nacional Continua (2006. Principales medidas de resultado: Índice de dispersión poblacional distrital. Resultados: El IDP fue estructurado y validado con la relación oficial de municipios rurales y la percepción de los operadores sanitarios de los Gobiernos Regionales del país. De las 1 831 municipalidades evaluadas, se clasificó los 1 277 distritos considerados rurales de acuerdo a la clasificación de Presidencia de Consejo de Ministros (PCM como dispersos por la metodología; se identificó un 82% de concordancia. Conclusiones: El IDP diseñado y validado aporta en la estimación de brechas de RHUS para los servicios asistenciales del primer nivel de atención en el Perú.

Math primer for engineers

CERN Document Server

Cryer, CW

2014-01-01

Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

A Quantum Groups Primer

Science.gov (United States)

Majid, Shahn

2002-05-01

Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

Influência das Alterações Hemodinâmicas Maternas sobre o Desenvolvimento Fetal

Directory of Open Access Journals (Sweden)

Borges Vera Therezinha Medeiros

2001-01-01

Full Text Available Objetivo: avaliar as alterações hemodinâmicas e estruturais cardíacas maternas nos três trimestres da gestação e relacioná-las com a classificação do recém-nascido, de acordo com o peso/idade gestacional. Métodos: foi realizada avaliação ecocardiográfica em 22 gestantes, sem patologias, para estudo do débito cardíaco, pressão arterial média, diâmetro do átrio esquerdo e resistência periférica, em três períodos da gestação: antes da 12ª , na 26ª e na 36ª semanas de gestação. Dezessete gestantes deram à luz recém-nascidos com peso adequado, quatro, recém-nascidos pequenos, e uma gestante, recém-nascido grande para a idade gestacional. Resultados: nas mães que deram à luz recém-nascidos pequenos para a idade gestacional, o débito cardíaco e o diâmetro do átrio esquerdo mantiveram-se inalterados, com tendência de elevação da pressão arterial média e aumento de 28% da resistência periférica, durante a gestação. As mães que deram à luz recém-nascidos adequados para idade gestacional tiveram aumento médio do débito cardíaco de 19% entre o primeiro e segundo trimestres e de 8% entre o segundo e terceiro trimestres da gestação. O diâmetro do átrio esquerdo elevou-se próximo de 9% durante a gestação, com manutenção da pressão arterial média e tendência de queda da resistência periférica. Conclusões: os resultados obtidos nesse trabalho suportam a associação entre adaptação hemodinâmica e peso do RN

A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

Directory of Open Access Journals (Sweden)

Wang Xiaowei

2008-12-01

Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

Scrimer: designing primers from transcriptome data

Czech Academy of Sciences Publication Activity Database

Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

2015-01-01

Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

Science.gov (United States)

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

Tasa de depreciación de capital humano: Evidencia empírica para Argentina

OpenAIRE

Vignoli, Guido

2012-01-01

El presente trabajo tiene por objeto demostrar la existencia de la Tasa de Depreciación del Capital Humano en Argentina, haciendo uso de un modelo sencillo que permita incorporar la obsolescencia de sus dos principales fuentes de acumulación, escolaridad y experiencia. Usando los datos provistos por la EPH elaborada por INDEC para el IV trimestre de 2011, se pudo obtener los resultados que prueban dicha hipótesis, evidenciando además que la misma no es constante. Al permitir la identificación...

Profitability primer: a guide to profitability analysis in the electric power industry

International Nuclear Information System (INIS)

Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

1996-06-01

As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

Science.gov (United States)

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Temas de Física para Ingeniería: Primer principio de la termodinámica

OpenAIRE

Beléndez Vázquez, Augusto

1992-01-01

Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

A primer on motor vehicle air pollution.

Science.gov (United States)

1973-01-01

This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

Primer on CDM programme of activities

Energy Technology Data Exchange (ETDEWEB)

Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

2009-07-01

As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

Caracterización de la fibrosis quística en el primer año de vida

Directory of Open Access Journals (Sweden)

Gladys Fuentes Fernández

Full Text Available Introducción: la fibrosis quística es una enfermedad multisistémica, genética y letal, con daño pulmonar temprano y progresivo en los casos típicos. Objetivo: caracterizar el diagnóstico de la fibrosis quística en niños menores de un año. Métodos: estudio transversal, descriptivo, a pacientes diagnosticados con fibrosis quística según sospecha clínica, en el primer año de vida, en el Hospital Pediátrico Centro Habana, en el período 1993-2013, según datos obtenidos de los registros clínicos. Resultados: del total de 44 pacientes diagnosticados en el periodo, 35 clasificaron como enfermedad pulmonar típica, de ellos 13 fueron diagnosticados durante el primer año de vida, 7/21 en el periodo 1993-2003 (33,3 % y 6/14 entre 2004-2013 (42,8 %. Cuando se suman las formas clínicas no típicas, el total de niños diagnosticados durante su primer año fue de 16, con edad media al diagnóstico de 4,9 meses; en 11 niños (68,8 % el diagnóstico fue antes de los 6 meses, con predominio de los varones (10-62,5 %. La desnutrición estuvo presente en el 62,5 %. La forma típica con insuficiencia pancreática se evidenció en el 75 % de los menores de un año estudiados, y se aisló Pseudomona aeruginosa en el 68,8 %. Predominaron las manifestaciones respiratorias como la polipnea y el tórax hiperinsuflado (15 niños, 93,8 %, así como el tiraje (14 niños, 87,5 %, mientras que la distensión abdominal (11, 68,8 % y la esteatorrea (10, 62,5 %, fueron las más frecuentes alteraciones digestivas. La radiografía torácica mostró algún grado de alteración en todos los niños. Conclusiones: es importante una alta sospecha clínica para el diagnóstico temprano de las formas típicas de la fibrosis quística.

Infección pulmonar por Mycobacterium avium en paciente VIH/SIDA: Primer reporte en Perú

Directory of Open Access Journals (Sweden)

Juan Carrasco

Full Text Available El complejo Mycobacterium avium (MAC es un patógeno que se encuentra en el medioambiente y causa infecciones tanto en pacientes inmunocompetentes como inmunocomprometidos. Se presenta el caso de un paciente VIH positivo varón de 38 años infectado por P. jirovecii y aparentemente infectado por Mycobacterium tuberculosis desde el año 2009, el cual fue tratado con antibioticoterapia para pneumocistosis y terapia antituberculosis (TB logrando mejoría parcial. En el año 2012 se le realizó nuevamente examen de cultivo y un nuevo tratamiento anti TB, frente a la sospecha de estar en presencia de una cepa de TB multidrogorresistente se recomienda realizar la identificación micobacteriana. El examen de cultivo fue positivo y el resultado genotípico resultó positivo para MAC. Se reporta el primer caso de un paciente VIH/SIDA con infección pulmonar por MAC en el Perú, así como una breve revisión de los aspectos epidemiológicos, clínicos y de tratamiento

Forest Interpreter's Primer on Fire Management.

Science.gov (United States)

Zelker, Thomas M.

Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

Locus de Controle e escolha do método anticoncepcional Locus de Control y método anticonceptivo elegido Locus of Control and choice of contraceptive method

Directory of Open Access Journals (Sweden)

Aline Salheb Alves

2007-06-01

Full Text Available Objetivou-se avaliar a relação entre o Locus de Controle e o tipo de método contraceptivo escolhido. Foi utilizada a Escala Multidimensional de Locus de Controle de Levenson e entrevistadas 191 mulheres. As usuárias de preservativo masculino apresentaram maior Internalidade do que as usuárias de injetável mensal. Quanto ao locus Externalidade Outros Poderosos, as usuárias de implante apresentavam menor externalidade do que as usuárias de preservativo masculino, laqueadura, injetável trimestral e DIU. Considerando-se o locus Externalidade Acaso, as usuárias de implante apresentaram menores escores do que as mulheres que optaram pela laqueadura, injetável trimestral e DIU. Observou-se ainda, menor Externalidade Acaso entre as usuárias de injetável mensal em relação às mulheres que fizeram opção pelo injetável trimestral.El objetivo es validar la relación entre el Locus de Control y el tipo de método anticonceptivo elegido. Fue usada la Escala Multidimensional de Locus de Control de Levenson. Fueron entrevistadas 191 mujeres. Las usuarias de condón masculino presentaron Internalidad más grande que las usuarias de inyectable mensual. Considerado el Locus Externalidad - Otro poderoso, las usuarias de implante presentaron menor externalidad de que las usuarias de condón masculino, laqueadura, inyectable trimestral y DIU. Considerado el Locus Externalidad - Quizá, las usuarias del implante presentaron menores resultados que las mujeres que eligieron por la laqueadura, inyectable trimestral y DIU. Se observo que las mujeres usuarias de inyectable mensual presentaron menor Externalidad - Quizá que las mujeres usuarias de inyectable trimestral.The purpose was to assess the relationship between locus of control and the contraceptive method chosen. It was used the Levenson's Multidimensional Locus of Control Scale and 191 women was interviewed. Users of male condoms presented greater Internality than the monthly contraceptive

Designing for transportation management and operations : a primer.

Science.gov (United States)

2013-02-01

This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

Evaluation of genetic diversity in open pollinated guava by iPBS primers

International Nuclear Information System (INIS)

Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

2013-01-01

DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

Estrategia de motivación para estudiantes de primer año de Medicina, Universidad San Sebastián, Concepción, Chile

Directory of Open Access Journals (Sweden)

P. Jorquera-Aguayo

Full Text Available Introducción. En el marco de un nuevo modelo educativo formativo, la Universidad San Sebastián apunta al desarrollo de estrategias pedagógicas que sitúan al estudiante en el centro de las acciones. Es así como surge la necesidad de incrementar la motivación en los jóvenes que ingresan a la carrera de medicina, profesión desde siempre ligada a los valores sociales y el altruismo. Este trabajo explora la relevancia del contacto temprano con el paciente y el hospital como fuentes de motivación en primer año. Sujetos y métodos. Todos los estudiantes de primer año de medicina (n = 115 fueron invitados a visitar voluntariamente un hospital. Allí, los estudiantes recorrieron el establecimiento y sostuvieron una conversación libre con un paciente. Las opiniones se recogieron a través de un escrito libre. Resultados. Se inscribieron 95 estudiantes, de los cuales 68 concurrieron a la visita. Al consultar sobre la vivencia con el paciente, los estudiantes se refirieron positivamente a ésta. La ansiedad al inicio de la conversación fue uno de los aspectos más mencionados, al igual que la importancia de conocer el futuro lugar de trabajo. Conclusiones. La experiencia evidenció un alto interés en participar. Asimismo reveló elementos de la vida afectiva de los estudiantes, pilar fundamental de la educación médica. Finalmente, se aconseja la temprana relación con el paciente y con el hospital como agentes motivacionales en primer año. Se sugiere incorporar tareas y complementar la evaluación con herramientas que permitan obtener información objetiva sobre los aprendizajes adquiridos.

The UVM primer a step-by-step introduction to the universal verification methodology

CERN Document Server

Salemi, Ray

2013-01-01

The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

Otosclerose: resultados de estapedotomias

Directory of Open Access Journals (Sweden)

Testa José Ricardo Gurgel

2002-01-01

Full Text Available Introdução: Otospongiose ou otosclerose é uma moléstia heredo-degenerativa da cápsula labiríntica relativamente comum e que ocorre principalmente em mulheres entre 20 e 30 anos de idade. Nas últimas décadas a estapedotomia tem sido uma técnica preferida por muitos cirurgiões para o tratamento da otosclerose. Assim, esse trabalho analisa os resultados de 59 estapedotomias realizadas no Hospital Paulista de Otorrinolaringologia nos últimos 7 anos. Forma de estudo: Clínico randomizado. Materiais e Métodos: Estudo retrospectivo de 59 pacientes com otosclerose, submetidos a estapedotomia por um mesmo cirurgião, e com seguimento clínico e audiométrico. Resultados: Melhora auditiva comprovada pelo fechamento do gap na audiometria em 53 pacientes (90%. Complicações ocorridas são relacionadas por ordem decrescente de freqüência: deslocamento da prótese (7%, alterações no paladar (7%, paralisia facial (3%, vertigem (3%, extrusão total da prótese (1,5%, tinnitus persistente (1,5%, perfuração da membrana timpânica (1,5%. Conclusão: A estapedotomia vem se mostrando uma boa opção terapêutica, já que, em geral, apresenta baixa morbidade e altas taxas de sucesso, proporcionando melhor qualidade de vida para os portadores de otosclerose.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

Energy Technology Data Exchange (ETDEWEB)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

Science.gov (United States)

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Desarrollo de un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de educación general básica

OpenAIRE

Chaglla Cholota, Kléber Fabián

2016-01-01

1. Introducción. --2. Plantemiento de la Propuesta de Trabajo. --3. Marco Teórico. --4. Metodología. --5. Resultados. --6. Conclusiones y Recomendaciones. El presente proyecto de investigación propone desarrollar un sitio web para capacitación en herramientas tecnológicas de producción de material educativo para docentes de primer año de Educación General Básica en la Unidad Educativa Intercultural Bilingüe “Huayna Capac”. Con el uso de este sitio web los docentes podrán generar material e...

Configuraciones en el sector hotelero basadas en las prioridades competitivas y su relación con el tamaño, categoría y el resultado organizativo

Directory of Open Access Journals (Sweden)

Tomas Francisco Espino-Rodríguez

2017-01-01

Full Text Available En el sector turístico y en concreto en el sector hotelero, no hay trabajos que definan una taxonomía de las estrategias de operaciones basadas en el énfasis de las prioridades competitivas (coste, calidad, servicio, flexibilidad y medio ambiente. Por ello este trabajo trata de definir una taxonomía de las diferentes estrategias de operaciones en el sector hotelero. Una vez identificadas las diferentes configuraciones, se establece si existen diferencias significativas entre los grupos de hoteles con respecto al resultado organizativo, considerado desde su doble vertiente: financiera y no financiera. Por otra parte, se analiza si la categoría hotelera puede determinar el tipo de configuración hotelera. Se ha analizado una muestra representativa de hoteles (65 hoteles de Gran Canaria por ser unos de los principales destinos para los turistas europeos. Los resultados indican que existen tres grupos diferenciados de hoteles en función de las prioridades competitivas. Un primer grupo que enfatiza las prioridades competitivas relacionadas con el coste y la flexibilidad, un segundo grupo que enfatiza todas las prioridades competitivas y un tercer grupo que enfatiza los objetivos de operaciones relacionados con la calidad y el servicio. Asimismo, se demuestra que el resultado organizativo es diferente para algunos grupos de hoteles definidos por las prioridades competitivas. Finalmente, se comprueba que las variables contextuales tienen relación con los grupos de hoteles. Así la categoría y el tamaño tienen relación con las prioridades competitivas enfatizadas.

Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

OpenAIRE

Castillo Canales, Braulio

2017-01-01

En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

Lucas, D.S.

2004-10-03

This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

Móvil remisión de V. cinta del primer móvil.

OpenAIRE

2011-01-01

[ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

Impacto en un programa de trasplante renal de un protocolo de donación tras muerte cardiaca controlada con soporte de ECMO

Directory of Open Access Journals (Sweden)

José Luis Cobo Sánchez

Full Text Available Resumen Objetivo: Analizar el impacto de un protocolo de donación tras muerte cardiaca controlada con soporte de sistema de oxigenación de membrana extracorpórea (PMCC-ECMO en el programa de trasplante renal de nuestro centro. Material y Método: Estudio retrospectivo, observacional, descriptivo en una cohorte de injertos renales (IR procedentes de un PMCC-ECMO. Se evalúan los IR procedentes de 8 pacientes con enfermedad irreversible (EI en los que se aplica limitación del esfuerzo terapéutico y se consideran como potenciales donantes durante el último semestre del 2014 y el primer trimestre de 2015. Se excluyeron los IR enviados fuera de la comunidad. Se evaluaron indicadores del proceso de donación (IPD y resultados clínicos de los injertos (RCI. Resultados: IPD: 100% hombres, edad media 60 años, tiempo medio agónico 9,37 minutos; causa EI 62,5% de origen pulmonar, 37,5% de origen neurológico. Se obtuvieron 13 riñones, 3 hígados y 2 pulmones: 2 IR fuera de la comunidad. Los IR provenientes del PMCC-ECMO supusieron un 20% de los IR del 2014 en nuestro centro. RCI: De los 11 IR trasplantados en nuestro centro, sólo 1 no fue viable por trombosis de las venas renales, y otro IR se retrasó la función renal por causas inmunológicas. Valores medios función IR al mes: creatinina sérica 1,88 mg/dl, aclaramiento creatinina 56,82 mL/min, urea 0,798 g/L. Conclusiónes: El PMCC-ECMO ha tenido un alto impacto en el programa de trasplante renal, tanto por incrementar la tasa de donación, como por la alta tasa de viabilidad de los injertos.

A primer on water

Science.gov (United States)

Leopold, Luna Bergere; Langbein, Walter Basil

1960-01-01

When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

LISTA DE PUBLICACIONES PERIODICAS DEL CENTRO DE DOCUMENTACION DEL MINISTERIO DE SALUD, PARA EL SERVICIO DE ALERTA - 1985

OpenAIRE

Ministerio de Salud

1985-01-01

Accident: Analysis and Prevention. New York. Bimestral
Acodal. Bogotá. Irregular
Acta Chirurgica Scandinavica. Estocolmo. 8 números al año
Acta Psiquiátrica y Psicológica de América Latina. Buenos Aires. Trimestral
Age. Nebrasca. Trimestral
Age and Ageing. Londres. Bimestral
Ageing International. Washington. Trimestral
Alcoholism. Zagreb. Semestral
AMC.Acta Médica Colombiana. Trimestral &l...

Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

2015-04-01

A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Duración del desempleo y canales de búsqueda de empleo en Colombia

OpenAIRE

Carlos Augusto Viáfara L; José Ignacio Uribe G

2009-01-01

Este artículo estudia la duración del desempleo en Colombia como indicador de la efectividad de los canales de búsqueda de empleo, con información de la Encuesta Continua de Hogares (ECH) del segundo trimestre de 2006. Se estiman modelos de duración paramétricos (Weibull de riesgos proporcionales) y no paramétricos (Kaplan-Meier). Los resultados indican que en la duración del desempleo influye considerablemente el canal de búsqueda que usan los empleados para conseguir empleo y los desocupado...

Edición 2015 Volumen 17 Nro 03

OpenAIRE

Escobar Mamani, Fortunato; Universidad Nacional del Altiplano Puno Peru; Collantes Menis, Nestor; Universidad Nacional del Altiplano

2015-01-01

Los editores de la Revista Investigaciones Altoandinas  (Journal of High Andean Research) de la Universidad Nacional del Altiplano, a través de Vice Rectorado de Investigación se complacen en presentar la presente edición en su Vol- 17 N° 03 correspondiente al tercer trimestre del año 2015 (de tres publicaciones al año).  La Revista a consideración, es resultado de propuestas llegadas a nuestra oficina, los mismos que fueron sometidos a una revisión por pares (modalidad doble ciego) de confor...

Factores influyentes en el rendimiento académico de estudiantes del primer año de medicina

Directory of Open Access Journals (Sweden)

Delia Jara

2008-09-01

Full Text Available Introducción: El rendimiento académico dentro de la universidad es el producto de la influencia de múltiples factores, los cuales se ponen de manifiesto desde los primeros años de estudio. Objetivos: Identificar los factores que afectarían el rendimiento académico en los estudiantes de medicina del primer año de estudios. Diseño: Estudio observacional longitudinal. El tipo de muestreo utilizado fue no probabilístico por cuotas. Lugar: Facultad de Medicina de San Fernando, Universidad Nacional Mayor de San Marcos (UNMSM, Lima-Perú. Participantes: Estudiantes de medicina durante el primer año de estudios. Intervenciones: Un cuestionario aplicado a los participantes, examen físico, psicológico y análisis de laboratorio. Principales medidas de resultados: Factores que influyen en el rendimiento académico bajo. Resultados: Se evaluó 40 estudiantes de ambos sexos (14 mujeres y 26 varones, con edades comprendidas entre 18 y 30 años. Procedían de colegio estatal 31 (78% y de colegio privado 9 (23%; en cuanto a hábitos de estudio, 27 (67% refirieron leer las materias propias de la profesión, por lo menos una vez al día, mientras que 13 (33% lo hacía de manera semanal. El número de horas de estudio al día consistió en 1 a 2 horas al día en 10 (25%, 3 a 4 horas de estudio en 18 (45%, 5 a 6 horas de estudio em 10 (25% y 2 de ellos (5% refirieron estudiar solo en fechas de exámenes; 25 alumnos (62% tuvieron como estrategia de estudio solo el uso de la memoria, 7 (18% utilizaron la memoria más los apuntes de clase, 4 de ellos (10%, apuntes más esquemas, y 4 (10%, apuntes más esquemas y textos. El carácter predominante de los alumnos fue alegre en 22 (55% y no alegre en 18 (45%. La autoestima fue considerada alta en 15 de los participantes (37,5%, autoestima moderada en 21 (52,5% y autoestima baja en 4 (10%. El aspecto socioeconómico de los participantes reveló que en 17 de ellos (42,5% el ingreso familiar era igual o menor de

Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

Directory of Open Access Journals (Sweden)

Christopher Ryan Penton

2013-09-01

Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

Directory of Open Access Journals (Sweden)

Aleksić Jelena M.

2016-01-01

Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

Science.gov (United States)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

Energy Technology Data Exchange (ETDEWEB)

Lech, L.M. [DuPont, Parkersburg, WV (United States)

1999-11-01

Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

A Primer to Slow Light

OpenAIRE

Leonhardt, U.

2001-01-01

Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

Necesidades en salud del diabético usuario del primer nivel de atención

Directory of Open Access Journals (Sweden)

Salinas-Martínez Ana M.

2001-01-01

Full Text Available Objetivo. Determinar la magnitud y jerarquizar la necesidad de salud satisfecha del diabético tipo 2, usuario del primer nivel de atención. Material y métodos. Se realizó un estudio transversal comparativo con representatividad rural y urbana, en el Instituto Mexicano del Seguro Social, en Nuevo León, en 1999. Fueron entrevistados, al azar, 256 diabéticos tipo 2 con dos o más años de diagnóstico. La información fue complementada con el expediente clínico y encuesta al proveedor. Se evaluaron cinco áreas y cuatro determinantes de salud, con base en estándares de la Norma Oficial Mexicana y la Asociación Americana de Diabetes. El plan de análisis consistió en estadística descriptiva y estimación de puntajes z. Resultados. Se registró una media de satisfacción global de necesidades de salud de 48.8%. En la zona rural la media de satisfacción fue menor que en la urbana (36.8% vs 53.3%, phttp://www.insp.mx/salud/index.html

Deseos, aptitudes y conocimientos sobre lactancia materna de gestantes en su tercer trimestre Desires, aptitudes and knowledge about breastfeeding in women at their third trimester of pregnancy

Directory of Open Access Journals (Sweden)

Remigio Rafael Gorrita Pérez

2012-06-01

Full Text Available Introducción: la lactancia materna es la única forma natural de alimentar al bebé, y una forma inigualable de facilitar el alimento ideal para su crecimiento y desarrollo. Métodos: se realizó un estudio descriptivo, transversal, para evaluar deseos, aptitudes y conocimientos sobre lactancia materna en el tercer trimestre de 114 gestantes del Policlínico "Mártires del 9 de Abril", de San José de las Lajas. Entre marzo de 2010 y de 2011 se valoraron sus historias de salud individual y familiar, y se aplicó a tal efecto un cuestionario con 22 preguntas. Resultados: la información se incorporó a una base de datos y se utilizó para el análisis el estadígrafo chi cuadrado, que se consideró significativo con pIntroduction: breastfeeding is the only natural way of feeding the baby and an unparallel form of providing him with the ideal food for adequate growth and development. Methods: a cross-sectional and descriptive study was conducted to evaluate the desires, the aptitudes and the knowledge about breastfeeding of 114 women in their third trimester of pregnancy from "Martires del 9 de Abril" polyclinics in San José de las Lajas. From March 2010 to March 2011, their individual and family health histories were assessed through a 22-interrogation questionnaire. Results: data were introduced in a database and chi square statistic was used for statistical analysis, the level of significance was p< 0,05. All the participants expressed their desire to breastfeed their offspring. Two thirds were considered prepared or well-prepared to do so, with the required knowledge to attain this objective; but just over one fifth did prove that they had it. Most of the future mothers aged 20 to 35 years; the schooling was mostly technician or high school education (60 for 52.6 %; the marital status of 45.6 % was cohabitation, 40.3 % were married and 13.2 % (15 were singles. These are aspects that undoubtedly influence the results. Conclusions: in addition

Deconstruyendo el resultado contable convencional para diseñar un resultado contable ambiental

OpenAIRE

José Juan Déniz Mayor; María Concepción Verona Martel

2015-01-01

En el presente trabajo se discute la dificultad de delimitar con precisión los flujos de gastos e ingresos relacionados con la gestión ambiental corporativa, utilizando como hilo argumental el diseno˜ de un modelo algebraico de resultado contable que haga visible las partidas más significativas en esta materia. Las principales conclusiones se centran en la necesidad de vincular los gastos e ingresos ambientales a objetivos específicos a fin de poder evaluar el desempeno˜ ambiental de la empre...

Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

DEFF Research Database (Denmark)

Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

2011-01-01

BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

Energy Technology Data Exchange (ETDEWEB)

Lu Xiangyu [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zuo Yu, E-mail: zuoy@mail.buct.edu.c [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Zhao Xuhui; Tang Yuming; Feng Xingguo [School of Materials Science and Engineering, Beijing University of Chemical Technology, Beijing 100029 (China)

2011-01-15

Research highlights: {yields} A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. {yields} The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. {yields} EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R{sub ct} at the magnesium particle/coating interface decreased and the double-layer capacitance Q{sub dl} increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH){sub 2} in the coating also provided some degree of barrier protection.

The study of a Mg-rich epoxy primer for protection of AZ91D magnesium alloy

International Nuclear Information System (INIS)

Lu Xiangyu; Zuo Yu; Zhao Xuhui; Tang Yuming; Feng Xingguo

2011-01-01

Research highlights: → A Mg-rich epoxy primer was prepared by adding pure magnesium particles in epoxy coating. Cross scratch testing results showed that in 3% NaCl solution the Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. → The open circuit potential of AZ91D alloy in NaCl solution decreased after coated with Mg-rich coating, suggesting that cathodic protection effect of the Mg-rich coating on AZ91D alloy was present. → EIS studies showed that during the immersion tests of AZ91D alloy with Mg-rich coating the magnesium particles in coating dissolved with the charge-transfer resistance R ct at the magnesium particle/coating interface decreased and the double-layer capacitance Q dl increased. While the coating resistance remained stable for a long time and corrosion of the AZ91D alloy substrate was obviously delayed. - Abstract: A Mg-rich epoxy primer was prepared by adding pure magnesium particles to an epoxy coating. The coating properties were studied with electrochemical impedance spectroscopy (EIS), scanning electronic microscopy (SEM) and X-ray diffraction (XRD). The Mg-rich primer showed better protection for AZ91D magnesium alloy than the same epoxy primer without Mg addition. The open circuit potential measurements showed cathodic protection effect of the Mg-rich primer on AZ91D alloy. Cross scratch testing showed that the Mg-rich primer provided better protection for the substrate than original epoxy coating. The precipitation of Mg(OH) 2 in the coating also provided some degree of barrier protection.

Metabolomics: A Primer.

Science.gov (United States)

Liu, Xiaojing; Locasale, Jason W

2017-04-01

Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

Propiedades psicométricas del Cuestionario de Percepciones Académicas para la evaluación de las expectativas de los estudiantes de primer año en Enseñanza Superior

Directory of Open Access Journals (Sweden)

Manuel Deaño

2015-01-01

Full Text Available Desde una concepción multidimensional de las expectativas, este artículo pretende analizar la validez y precisión psicométrica de una escala para su medida en los estudiantes universitarios de primer año. La muestra (N = 759 estaba compuesta por alumnado de primer año, de diversas titulaciones académicas de la Universidad de Vigo-Campus de Ourense y de la Universidad de Minho. El valor de la Mdn de edad fue de 19, siendo sólo el 5.3% mayor de 23 años. A los participantes se les aplicó un conjunto de 56 ítems agrupados en siete dimensiones diferentes de expectativas. Los resultados del análisis factorial confirmatorio, se obtuvieron con el LISREL. Se garantizó la validez factorial, tanto convergente como discriminante de los factores. Ésta junto con su fiabilidad sugieren que el Cuestionario de Percepciones Académicas quedaría finalmente con 42 ítems distribuidos en siete dimensiones de expectativas: Formación para el empleo/carrera, Desarrollo personal y social, Movilidad estudiantil, Implicación política/ciudadanía, Presión social, Calidad de formación e Interacción social. Se comprobó la equivalencia del modelo de medida del instrumento en los dos idiomas y en dos grupos resultantes de la bipartición aleatoria de la muestra. Los resultados de la validez estructural de este estudio avalan la utilización del cuestionario para la medida de las expectativas de los estudiantes que inician por primera vez sus estudios en la Enseñanza Superior.

Primer on Health Surveys

Directory of Open Access Journals (Sweden)

David L Nordstrom

2012-06-01

Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

Directory of Open Access Journals (Sweden)

Diana Sari

2015-05-01

Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

Science.gov (United States)

2011-08-17

system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

Estrategia para mejorar el acceso al tratamiento etiológico para la enfermedad de Chagas en el primer nivel de atención en Argentina

Directory of Open Access Journals (Sweden)

Karen Klein

2017-05-01

Full Text Available RESUMEN Objetivo Mejorar la distribución del tratamiento etiológico para la enfermedad de Chagas mediante la identificación de barreras para su descentralización al primer nivel de atención en Argentina. Métodos Se llevó a cabo un estudio cualitativo, de carácter exploratorio y descriptivo, en base a entrevistas semiestructuradas a actores clave pertenecientes al Programa Nacional de Chagas y miembros de los equipos de salud del primer nivel de atención con el objetivo de identificar barreras para el diagnóstico y tratamiento de la enfermedad de Chagas en diferentes niveles (administrativo, efectores de salud y comunidad que podrían afectar una estrategia descentralizada de distribución. Además, se implementó un piloto de descentralización en diez centros de atención primaria en una provincia argentina. Resultados Se realizaron 22 entrevistas semiestructuradas con responsables de programas y profesionales de la salud. Los principales obstáculos hallados fueron la falta de búsqueda sistemática de casos, la poca articulación entre los niveles de atención y los actores del sistema de salud, la falta de capacitación del equipo de salud respecto al tratamiento, el seguimiento de los pacientes y las barreras asociadas a los pacientes. Se llevó a cabo un programa piloto de descentralización y se evaluaron estrategias para optimizar la intervención a gran escala. Conclusiones Los resultados permitieron mejorar la implementación del plan de descentralización del tratamiento a través de una mejor articulación interprogramática, la capitalización de herramientas de monitoreo y de comunicación ya existentes, y la sensibilización de los equipos de salud. Además, se formularon recomendaciones tendientes a mejorar el diagnóstico y el tratamiento de la enfermedad de Chagas.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

Energy Technology Data Exchange (ETDEWEB)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

2013-06-28

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

International Nuclear Information System (INIS)

Jothikumar, N.; Hill, Vincent R.

2013-01-01

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

Single primer amplification reaction methods reveal exotic and ...

Indian Academy of Sciences (India)

Unknown

mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

Science.gov (United States)

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-09-27

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

Energy Technology Data Exchange (ETDEWEB)

A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

1998-12-10

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

Summary of the primer on tumor immunology and the biological therapy of cancer

Directory of Open Access Journals (Sweden)

Margolin Kim

2009-01-01

Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

Directory of Open Access Journals (Sweden)

Melissa Agsalda

2009-01-01

Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

Science.gov (United States)

Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

2009-01-01

Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

Participação nos Lucros ou Resultados

Directory of Open Access Journals (Sweden)

Luiz Felipe Ferreira

2007-03-01

Full Text Available A participação nos lucros ou resultados é uma forma de remuneração variável, pela qual não há incidência de encargos sociais, além de incentivar o aumento da produtividade, podendo assim ser utilizada pelas empresas como estratégia, para enfrentarem os desafios dinâmicos e competitivos em que atuam. Esta pesquisa caracteriza-se como sendo exploratória, com abordagem qualitativa e tem como objetivo conceituar e explanar as formas pela quais são praticadas a participação nos lucros ou resultados em empresas do setor alimentício em Santa Catarina, que foram escolhidas por meio do critério de acessibilidade e disponibilidade. Dos dados coletados, pode-se verificar que as empresas: COC Alimentos, Moinho Catarinense e Pepsico do Brasil utilizam a participação nos resultados e a Perdigão utiliza a participação mista. A Moinho Catarinense distribui para todos os empregados um salário nominal, como a CDC Alimentos, exceto para os gerentes. A Perdigão beneficia todos os empregados, sendo que 60% da distribuição é pelo lucro líquido e 40% por indicadores de desempenho. A Pepsico do Brasil distribui aos empregados operacionais 50% de um salário nominal e para os empregados da administração central um salário nominal, atrelado ao cumprimento de metas, especificadas no programa de participação nos lucros ou resultados.

MRI Primer

International Nuclear Information System (INIS)

Oldendorf, W.; Oldendorf, W. Jr.

1991-01-01

Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

A primer of multivariate statistics

CERN Document Server

Harris, Richard J

2014-01-01

Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

International Nuclear Information System (INIS)

Zhan Fangfang; Zhou Xiaoming; Xing Da

2013-01-01

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

A Primer on Basic Effect Size Concepts.

Science.gov (United States)

Elmore, Patricia B.; Rotou, Ourania

The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

DEFF Research Database (Denmark)

Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

2011-01-01

. The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

A Brief Taxometrics Primer

Science.gov (United States)

Beauchaine, Theodore P.

2009-01-01

Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

Directory of Open Access Journals (Sweden)

Michael D. Blanton

2012-09-01

Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

Science.gov (United States)

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

NARCIS (Netherlands)

Gamper, H.A.; Leuchtmann, A.

2007-01-01

Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

Science.gov (United States)

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

Directory of Open Access Journals (Sweden)

Nigel C. Brissett

2013-11-01

Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

DEFF Research Database (Denmark)

Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

2005-01-01

A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

The astrobiology primer: an outline of general knowledge--version 1, 2006.

Science.gov (United States)

Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

2006-10-01

The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

RENDIMIENTOS DE LA EDUCACIÓN EN EL NORESTE ARGENTINO EVOLUCIÓN RECIENTE Y ESTRUCTURA ACTUAL

Directory of Open Access Journals (Sweden)

Fernández, Rodrigo A.

2011-06-01

Full Text Available En el presente trabajo se estiman los rendimientos privados de la inversión en educación. Se estimaron las tasas anuales de rendimiento, para los aglomerados del Noreste Argentino (NEA, entre el tercer trimestre del 2003 y tercer trimestre de 2009, utilizando la base de micro-datos de la Encuesta Permanente de Hogares (EPH. En la estimación del rendimiento se propusieron modelos diferentes para los hombres y mujeres, de forma de corregir en estas últimas los problemas de sesgo muestral, evidenciados en su menor participación en la Población Económicamente Activa (PEA. Los resultados obtenidos muestran un rendimiento de la educación mayor para los hombres que para las mujeres, un rendimiento diferencial en el aglomerado Posadas superior a la media del NEA, una elevada penalización por desempeñarse en el sector informal de la economía (trabajo en negro y una relación directa entre el tamaño de la empresa y los rendimientos de los varones que a la vez reportaría una menor volatilidad en su evolución temporal.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

Science.gov (United States)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Promotion primer. Foerderfibel

Energy Technology Data Exchange (ETDEWEB)

1981-01-01

This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

DEFF Research Database (Denmark)

Li, H; Shi, B; Li, X

2013-01-01

The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

2013-01-25

Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

Effect of oligonucleotide primers in determining viral variability within hosts

Directory of Open Access Journals (Sweden)

Moya Andrés

2004-12-01

Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Effect of oligonucleotide primers in determining viral variability within hosts.

Science.gov (United States)

Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

2004-12-09

Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

Science.gov (United States)

This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Luk Ketut Budi Maitriani

2015-10-01

Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

FullSSR: Microsatellite Finder and Primer Designer

Directory of Open Access Journals (Sweden)

Sebastián Metz

2016-01-01

Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

The burden of gestational diabetes mellitus in Jamaican women with a family history of autosomal dominant type 2 diabetes La carga de la diabetes mellitus gestacional en mujeres de Jamaica con antecedentes familiares de diabetes autosómica dominante tipo 2

Directory of Open Access Journals (Sweden)

Rachael R. Irving

2008-02-01

Full Text Available OBJECTIVES: To determine if Jamaican women of African descent with a family history of early onset autosomal dominant type 2 diabetes have greater odds of developing gestational diabetes mellitus (GDM than those without a family history of the disease. METHODS: A comparative study was conducted of two groups of pregnant Jamaican women: the first with a family history of early onset autosomal dominant type 2 diabetes; the second with no history of the disease. Incidence, odds for developing GDM, and metabolic profiles in first and second trimesters were assessed using SPSS 11.5 (SPSS Inc., Chicago, Illinois, United States. RESULTS: The incidence of GDM was 12.0 % in women with a family history of early onset autosomal dominant type 2 diabetes and 1.5% in women without a family history of the disease (P OBJETIVOS: Determinar si las mujeres jamaicanas de ascendencia africana con antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 tienen mayor probabilidad de desarrollar diabetes mellitus gestacional (DMG que las que no tienen esos antecedentes familiares. MÉTODOS: Se realizó un estudio comparativo con dos grupos de mujeres jamaicanas embarazadas: el primero con mujeres que tenían antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 y el segundo con mujeres sin antecedentes familiares de esa enfermedad. Se empleó el programa SPSS v. 11.5 (SPSS Inc., Chicago, Illinois, Estados Unidos de América para analizar los resultados y calcular la incidencia, la probabilidad de desarrollar DMG y los perfiles metabólicos en el primer y el segundo trimestres de gestación. RESULTADOS: La incidencia de DMG fue de 12,0% en las mujeres con antecedentes familiares de inicio temprano de diabetes autosómica dominante tipo 2 y de 1,5% en las mujeres sin antecedentes familiares de esa enfermedad (P < 0,05. Las mujeres del primer grupo tuvieron nueve veces más probabilidades de desarrollar DMG que las

Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

Directory of Open Access Journals (Sweden)

Cheng-Hong Yang

Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

Directory of Open Access Journals (Sweden)

Joseph-Alexander Verreet

2011-01-01

Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

Science.gov (United States)

Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

2015-06-01

Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

Programa 'nieves y glaciares tropicales' (NGT: resultados (1991-1996 obtenidos en Bolivia

Directory of Open Access Journals (Sweden)

1998-01-01

Full Text Available PROGRAMME “NEIGES ET GLACIERS TROPICAUX” (NGT: RÉSULTATS (1991-1996 OBTENUS EN BOLIVIE. Depuis 1991, avec ses partenaires la COBEE, l’IHH et le SENAMHI, l’ORSTOM a progressivement équipé 2 glaciers de la Cordillère Royale de Bolivie, les glaciers de Chacaltaya et Zongo. Cet équipement a permis de réaliser les bilans glaciologiques des 2 glaciers et les bilans hydrologique et énergétique du glacier Zongo. Les principaux résultats, glaciologique, hydrologique et énergétique, sont fournis dans cette communication. Un premier modèle physique du fonctionnement du glacier Zongo a été réalisé, avec des premiers résultats qui permettent d’entreprendre un modèle plus élaboré susceptible d’être généralisé à d’autres glaciers. Des carottages de neige et glace à haute altitude ont confirmé la possibilité d’exploiter ces véritables archives climatologiques. Desde 1991, con sus contrapartes COBEE, IHH y SENAMHI, el ORSTOM ha equipado progresivamente 2 glaciares de la Cordillera Real de Bolivia, los glaciares de Chacaltaya y Zongo. Este equipo ha permitido realizar los balances glaciológicos de los 2 glaciares y los balances hidrológico y energético del glaciar Zongo. Los principales resultados, glaciológicos, hidrológicos y energéticos, son proporcionados en esta comunicación. Se realizó un primer modelo físico del funcionamiento del glaciar Zongo, con primeros resultados que permiten comenzar un modelo más elaborado capaz de ser generalizado a otros glaciares. Extracciones de testigos de nieve y hielo a gran altura confirmaron la posibilidad de aprovechar estos verdaderos archivos climatológicos. PROGRAM “SNOWS AND GLACIERS IN THE TROPICS” (NGT: PRINCIPAL RESULTS IN BOLIVIA (1991-1996. Since 1991, two glaciers of the Royal Cordillera of Bolivia, the glaciers of Chacaltaya and Zongo, have been equipped by ORSTOM with his partners COBEE, IHH and SENAMHI. That equipment allowed to carry out the glaciological

Propuesta de contenidos de danza para la Educación Física en el primer ciclo de la Enseñanza Primaria

Directory of Open Access Journals (Sweden)

Marilys Mesa Fonseca

2007-12-01

Full Text Available En el presente estudio se pretende exponer una propuesta de contenidos específicos de expresión corporal (danza, para el primer ciclo de la enseñaza primaria, con una adecuada base teórica que sustente la propuesta y los resultados de esta investigación sobre la expresión corporal en el ámbito educativo que, a partir, de sus contenidos posibilitará trabajar el movimiento en función de potenciar las habilidades comunicativas en edades tempranas, dirigiendo tareas hacia el desarrollo armónico de la personalidad, permitiendo una equilibrada existencia física y mental y posibilitando además una salida a la imaginación, creatividad, expresividad y originalidad individual La propuesta que se presenta es la visión o el enfoque particular de un trabajo concreto que se desarrolla en la formación integral de la infancia en el primer ciclo de la Educación Física en la enseñanza primaria. Como contenidos específicos se contemplaran: las actividades de interacción, de familiarización con el ritmo, de adaptación a las cualidades del sonido y a los elementos de la música, así como las posibles técnicas de danza apropiadas para esta etapa educativa. Todo ello desde un objetivo muy claro: contribuir a la formación integral del alumno a través de los contenidos de la danza.

Diseño de un servicio de nutrición en una farmacia comunitaria de Sevilla (España y análisis descriptivo de los resultados del primer año

Directory of Open Access Journals (Sweden)

Mª Antonia Merchán Cornello

2017-06-01

Full Text Available Introducción: Un alto porcentaje de pacientes registrados en la base de datos de la farmacia mostraron sobrepeso asociado a malas prácticas alimentarias. Por ello, nos propusimos instaurar un servicio de nutrición para contribuir a mejorar sus hábitos nutricionales. Material y métodos: Durante noviembre-diciembre 2014, se impartieron charlas explicativas y se publicitó el servicio entre los usuarios. En enero de 2015 se inauguró la consulta. Con los datos registrados durante el primer año, a través de entrevistas personalizadas, se realizó un estudio observacional-descriptivo y longitudinal, analizando los hábitos alimentarios del paciente, sus parámetros antropométricos: índice de masa corporal (IMC y perímetro de la cintura (PC y clínicos: presión arterial (PA, así como su evolución en controles sucesivos. Resultados: La muestra (n=77, 25-64 años, 66 mujeres (85,7% y 11 varones (14,3%, presentaba un IMC=33,2±5,6 kg/m2 y un PC=97,2±13,9 cm. El 24,1% mostró sobrepeso, el 57,5% algún tipo de obesidad (I o II y el 11,5% obesidad mórbida (IMC>40. Ansiedad, estreñimiento y enfermedades del tiroides predominaron entre las mujeres (56,6%, 38,2% y 19,7% y la HTA en los varones (54,5% p<0,05; no hubo diferencia en el porcentaje de dislipémicos (27,3% y 27,6%, diabéticos (9,1% y 6,6% ni fumadores (18,2% y 15,8%, pero sí entre los consumidores de bebidas alcohólicas (63,6% hombres y 36,8% mujeres, p<0,05. Una mayoría de entrevistados reconocieron no realizar ejercicio físico. Se registraron 8,6±5,5 visitas/paciente consiguiéndose una pérdida de 4,5±3,8 kg de peso, 1,7±1,5 kg/m2 de IMC (p<0,05 y 4,8±3,8 cm de PC (p<0.05. El 71,4% de ellos alcanzaron los objetivos de peso propuestos. Algunos aceptaron adherirse a otros servicios de la farmacia: seguimiento farmacoterapéutico (SFT (5% y prevención de riesgo cardiovascular (RCV (6%. Conclusiones: Después de un año, el servicio está claramente instaurado, ha

Modelos de gestión de resultados: un estudio transnacional

Directory of Open Access Journals (Sweden)

Nuria Reguera Alvarado

2015-01-01

Así pues, a partir de los modelos desarrollados en la literatura para cuantificar la discrecionalidad contable, el objetivo de este trabajo es determinar si alguno de estos modelos ofrece mejores resultados en cuanto a la cuantificación de la gestión del resultado a partir de las pruebas de especificación y potencia. Para ello se ha utilizado una muestra de 33.410 observaciones correspondientes a empresas no financieras de Estados Unidos, Canadá, Reino Unido, Corea, Japón, Italia, Alemania, Francia, España, Canadá y Australia que han cotizado en mercados de valores a lo largo del periodo 2005-2009. Los resultados ponen de manifiesto la superioridad del modelo de Jones ajustado al ROA con respecto al modelo de Jones y al modelo de Jones modificado.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

Science.gov (United States)

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Evolución del peso en pacientes durante el primer año del trasplante renal

Directory of Open Access Journals (Sweden)

Pilar López Garrigós

Full Text Available Durante el primer año de trasplante renal es frecuente una ganancia de peso, debido, entre otros a la dieta, sedentarismo, e inmunosupresores, pudiendo aumentar los factores de riesgo del síndrome metabólico. Objetivos: Conocer la evolución del peso de nuestros pacientes durante el primer año del trasplante, y analizar la influencia con las distintas variables asociadas al paciente, sexo, edad, IMC, tratamiento inmunosupresor entre otras. Determinar la asociación entre la ganancia de peso y la aparición de factores de riesgo, como hipertensión arterial, diabetes y dislipidemia. Material y Método: Estudio retrospectivo y analítico. Se estudiaron 100 pacientes con un año de evolución en el trasplante, del Hospital Virgen de la Salud de Toledo. Sé analizaron datos antropométricos, demográficos y clínicos. La ganancia de peso se distribuyo según a las variables del estudio. Resultados: La ganancia de peso al año del trasplante afecto a 93 pacientes, con una media de 7,21 kg ±5,87. El 44,1% aumento su peso por encima de la media, y el 23,7% gano > 10 kg. La prevalencia de sobrepeso y obesidad antes del trasplante fue 57% y 76% después del trasplante. Los hombres ganaron ligeramente más peso que las mujeres. Los más jóvenes < 49 años ganaron más peso, media 9,3 kg. Mayor incidencia de diabetes, hipertensión y dislipemias en los pacientes con sobrepeso y obesidad. Conclusiones: La mayoría de los pacientes aumentaron significativamente de peso al año del trasplante, asociándose con varios de los factores del síndrome metabólico. - Importante la educación, por parte de la enfermería, del paciente para fomentar hábitos de vida saludable.

PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

Science.gov (United States)

Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

2013-01-01

Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

International Nuclear Information System (INIS)

Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

2000-01-01

This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

La voz de los estudiantes de primer año en seis países: evaluación de sus experiencias en estudios superiores científico-técnicos

Directory of Open Access Journals (Sweden)

Ángel Vázquez-Alonso

2016-06-01

Full Text Available Resumen Este estudio analiza la valoración de los estudiantes de seis países latinos sobre sus experiencias de primer año en educación superior de ciencias, tecnologías, ingenierías y matemáticas (CTIM. El objetivo es ofrecer pruebas empíricas sobre la importancia de distintos factores determinantes de la permanencia en los cursos universitarios de CTIM. Los estudiantes respondieron el cuestionario del proyecto Interés y Reclutamiento en Ciencia (IRIS; se presentan las respuestas relativas a las percepciones de los estudiantes sobre experiencias, expectativas cumplidas y valoración de resultados académicos. Se identifican los factores más y menos importantes, los perfiles nacionales de los seis países y las diferencias entre hombres y mujeres; aparecen muchas diferencias significativas entre países y algunas diferencias entre hombres y mujeres . Se discuten las implicaciones de los resultados para orientar las políticas institucionales que mejoren el reclutamiento, la retención (evitación del abandono y la equidad de género en los cursos CTIM.

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

Science.gov (United States)

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Evaluación de las prácticas de cuidado materno infantil en áreas con pobreza extrema del Perú, 2012

Directory of Open Access Journals (Sweden)

José Enrique Velásquez Hurtado

Full Text Available Objetivos. Evaluar las prácticas de cuidado materno-infantil en áreas con pobreza extrema del Perú. Materiales y métodos. Estudio transversal realizado entre agosto y septiembre de 2012, con muestreo probabilístico, trietápico y estratificado por departamento. Se seleccionaron 540 hogares que tenían al menos un niño menor de 36 meses (475 hogares y/o mujer gestante (80 hogares en áreas rurales de Cajamarca, Amazonas, Huánuco, Ayacucho, Huancavelica, Apurímac, Cusco, Puno y Ucayali. Resultados. Con relación al último embarazo, 69,0% de la madres refirió haber tenido su primer control prenatal en el primer trimestre; 65,3% haber cumplido más de seis controles a lo largo del embarazo; 81,1% haber dado a luz en un establecimiento de salud, y solo 31,0% haber elegido un método de planificación familiar dentro de los 42 días posparto. Con relación al último niño menor de 3 años, 64,1% tuvo contacto precoz madre-niño, y 62,8% inició la lactancia materna dentro de la hora de nacido. Además, 89,6% de los niños menores de 6 meses recibía lactancia materna exclusiva, y 89,1% de los niños de 6 a 8 meses ya tenía alimentación complementaria. Fiebre, diarrea, vómitos y dificultad respiratoria fueron las señales de peligro más referidas para la búsqueda de atención en niños. Conclusiones. La evaluación ha permitido establecer una línea de base sobre la cual se diseñará e implementará una estrategia que posibilite una mejora en las prácticas clave de cuidado materno-infantil en la población objetivo del Programa de Apoyo a la Reforma del Sector Salud

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

Science.gov (United States)

Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

2015-01-01

Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

Signals and systems primer with Matlab

CERN Document Server

Poularikas, Alexander D

2006-01-01

Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

Science.gov (United States)

Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

2017-01-01

Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

DEFF Research Database (Denmark)

Hansen, A C; Grunwald, T; Lund, Anders Henrik

2001-01-01

could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

Energy Technology Data Exchange (ETDEWEB)

Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

2012-08-01

The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

Science.gov (United States)

Glennon, Kelsey L; Cron, Glynis V

2016-05-01

Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

Efecto de la proporción de genes Bos indicus x Bos taurus sobre peso al destete y edad a primer parto en una población multirracial

Directory of Open Access Journals (Sweden)

Hugo O. Toledo Alvarado

2015-01-01

Full Text Available Se analizaron 1,289 registros de hembras de primer parto con diversas proporciones de genes Bos indicus y Bos taurus (Charolais, Suizo, Simmental, Holstein Friesian y Salers. Tanto animales puros y cruzados de un hato comercial, ubicado en el municipio de Hueytamalco, Puebla, nacidas entre 1966 a 2006, con el objetivo de estimar la combinación óptima de genes Cebú y la retención de heterosis (RVH sobre las características de peso al destete ajustado a 270 días (PD y edad a primer parto (EPP. A partir de modelos de regresión múltiple se identificó la proporción de Cebú con el mejor comportamiento para las dos características de acuerdo al coeficiente de determinación (R 2 y al estadístico de Mallow (CP. La mejor respuesta para PD se encontró en el rango de 42 a 70 % de genes Bos indicus ; mientras que las menores EPP se establecieron entre 27 al 40 % de proporción Cebú. La retención de heterosis que mostró mayor potencial para PD fue de 76 a 78 % y para EPP de 79 a 92 %. Estos resultados manifiestan la importancia de los efectos no aditivos en ambas características, así como la necesidad de realizar cruzamientos dirigidos.

El Programa de la Mujer Agraria en Tabasco: expectativas y resultados

Directory of Open Access Journals (Sweden)

Nélyda Solana Villanueva

2014-01-01

Full Text Available El Programa de la Mujer Agraria (PROMUSAG busca generar empleo para mujeres de áreas rurales y mejorar sus condiciones de vida. Este artículo da cuenta de la evaluación de expectativas y resultados del PROMUSAG en Tabasco en los años 2004 y 2006. Para determinar estos resultados se realizó una encuesta representativa a las beneficiarias. Se encontró que el apoyo recibido representó un ahorro familiar más allá de cambios en sus condiciones de vida. Se comprobó que estas mujeres ceden la operación de sus proyectos productivos. Finalmente, la escasa cobertura da poco margen a resultados positivos.

Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

Science.gov (United States)

Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

2017-01-01

Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

Science.gov (United States)

Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

2016-06-01

Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

NARCIS (Netherlands)

Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

2015-01-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

Science.gov (United States)

Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

2015-07-28

Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

Science.gov (United States)

Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

2013-11-01

To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

Blood Donation and Transfusion: A Primer for Health Educators.

Science.gov (United States)

Felts, W. Michael; Glascoff, Mary A.

1991-01-01

Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

Small Commercial Building Re-tuning: A Primer

Energy Technology Data Exchange (ETDEWEB)

Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

2013-09-30

To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

Results in energy saving obtained with the application of speed variator in fossil power stations; Resultados de ahorro de energia obtenidos con la aplicacion de variadores de velocidad en centrales termoelectricas

Energy Technology Data Exchange (ETDEWEB)

Merlos Rueda, Rosa Maria [Programa de Ahorro de Energia del Sector Electrico (PAESE), Mexico, D. F. (Mexico)

1999-07-01

Subdireccion de Generacion, y promovido por el Programa de Ahorro de Energia del sector Electrico (PAESE), con la puesta en operacion de un equipo en la bomba de condensado de la C. T. Punta Prieta II-U3. Los ahorros de energia observados resultaron substanciales, fluctuando entre el 19.4% en altas cargas (al 90%) y el 71.1% a bajas cargas (al 40%) de la unidad generadora. Dados los resultados anteriores, se decidio extender la cobertura del proyecto con la instalacion de 6 equipos mas para igual numero de Centrales Termoelectricas, ubicadas en 4 de las 5 Regiones de Generacion. Las Centrales Termoelectricas, seleccionadas para esta etapa del proyecto fueron: C. T. Felipe Carrillo Puerto U1, C.T. Lerma U4, C.T. Salamanca U1, C.T. Monterrey U6, C.T. Francisco Villa U3 y la C.T. Punta Prieta II-U1. Los equipos quedaron en operacion durante el primer trimestre de 1998, y los primeros resultados indican ahorros de energia promedio por equipo, entre el 39% y el 52%. La recuperacion de la inversion fluctua entre el 48.4% y el 87.6% en menos de dos anos de operacion, con lo cual se espera un periodo de recuperacion maximo de 3 anos. El potencial estimado de ahorro de energia, considerando la aplicacion de estos dispositivos en bombas de condensado, de agua de alimentacion (donde no se cuente con variador de velocidad), ventiladores de tiro forzado, de tiro inducido y recirculacion de gases, asi como en bombas de agua de circulacion, de las Centrales Generadoras existentes, ascienden a un total de 830,000 MW-h anuales, lo cual representa un 9.4% aproximado del consumo nacional en servicios propios.

Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

Directory of Open Access Journals (Sweden)

Warren B. Chatwin

2014-10-01

Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

Directory of Open Access Journals (Sweden)

Christopher A Gulvik

Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

OpenAIRE

Johnston, Nessa

2012-01-01

Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

Primers As Socializing Agents in American and Finnish Schools.

Science.gov (United States)

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

Energy Technology Data Exchange (ETDEWEB)

D. S. Lucas

2004-10-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

Preliminary clinical outcomes from the Peruvian National Cataract Elimination Plan Resultados clínicos preliminares del Plan Nacional de Lucha contra la Ceguera por Catarata del Perú

Directory of Open Access Journals (Sweden)

Tomasz P. Stryjewski

2010-10-01

Full Text Available OBJECTIVE: To evaluate the clinical outcomes of a publicly funded cataract elimination program. METHODS: Outcomes of all patients (186 who received extracapsular cataract extraction (ECCE surgery free of charge at the Instituto Regional de Oftalmología in northern Peru in the first year (August 2008 to July 2009 of the Peruvian National Cataract Elimination Plan were compared retrospectively with the outcomes of all patients (68 who paid in the highest charge tier for ECCE surgery during the same period. Preoperatively, the median uncorrected visual acuity (UCVA of National Plan patients was Hand Motion; the UCVA of paying patients was Counting Fingers (P = 0.09. Complication frequency and visual acuity (uncorrected visual acuity, pinhole visual acuity, and best correct visual acuity were the primary outcome measures. The World Health Organization (WHO Vision 2020 goal is for 85% of operated eyes to achieve 20/60 vision; the Ministerio de Salud del Perú goal is for 75% of eyes to achieve 20/50. RESULTS: One month postoperatively, only 24% of National Plan patients achieved a UCVA of 20/60. The median UCVA for both groups was 20/100 (P = 0.23. Intraoperative complications occurred in 27% of all patients; postoperative complications occurred in 39%. Patients more likely to have a poor outcome (UCVA OBJETIVO: Evaluar los resultados clínicos de un programa de lucha contra la ceguera por catarata con financiamiento público. MÉTODOS: Los resultados obtenidos de todos los pacientes (186 sometidos a una operación gratuita de extracción extracapsular de catarata (EECC en el Instituto Regional de Oftalmología del norte del Perú, durante el primer año (de agosto del 2008 a julio del 2009 de la ejecución del Plan Nacional de Lucha contra la Ceguera por Catarata del Perú, se compararon retrospectivamente con los resultados de los pacientes (68 que pagaron los honorarios más elevados por una operación quirúrgica de EECC durante el mismo per

Embarazo deseado y planificado, lactancia previa, aptitud para lactar y conocimientos de las madres sobre lactancia

Directory of Open Access Journals (Sweden)

Remigio Rafael Gorrita Pérez

Full Text Available Introducción: la OMS y la Unicef recomiendan lactancia materna exclusiva durante los primeros 6 meses de vida, y complementada, al menos, hasta los 2 años; sin embargo, los resultados no son los esperados. Objetivo: evaluar la relación entre la planificación del embarazo, la lactancia en hijos anteriores, la aptitud referida para lactar y los conocimientos sobre lactancia materna de las gestantes en su tercer trimestre, de los Policlínicos "Luis Augusto Turcios Lima" y "Mártires del 9 de Abril", del municipio San José de las Lajas. Métodos: se realizó un estudio analítico y transversal, entre marzo de 2010 y marzo de 2011. De 192 gestantes en su tercer trimestre, y que cumplieron los criterios de inclusión, se estudiaron: hijos previos y si recibieron lactancia materna, planificación, deseos del embarazo, aptitudes referidas, así como conocimientos sobre la lactancia. Se aplicaron 22 preguntas y se estableció un sistema de puntaje. Resultados: algo más de la mitad de las madres se consideraron aptas para la lactancia, y asumieron que poseían los conocimientos necesarios para lograrlo, pero menos de la quinta parte mostró poseerlos. Las gestantes que obtuvieron valores superiores en el cuestionario fueron: las que tenían un hijo previo, las que ya habían ofrecido lactancia materna exclusiva de 4 a 6 meses, y las que deseaban y habían planificado su embarazo. Conclusiones: aunque la mayoría de las gestantes consideraron que estaban aptas para la lactancia materna, no demostraron tener los conocimientos necesarios para asumirla exitosamente.

Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

NARCIS (Netherlands)

RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

1990-01-01

We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

Resultados do tratamento da pancreatite aguda grave

Directory of Open Access Journals (Sweden)

Franz Robert Apodaca-Torrez

Full Text Available OBJETIVO: Avaliar os resultados do Protocolo de Atendimento de pacientes com diagnóstico de pancreatite aguda grave. MÉTODOS: Foram analisados, consecutivamente, a partir de janeiro de 2002, idade, sexo, etiologia, tempo de internação, tipo de tratamento e mortalidade de 37 pacientes portadores de pancreatite aguda grave. RESULTADOS: A idade dos pacientes variou de 20 a 88 anos (média de 50 anos; 27% foram do sexo feminino e 73% do masculino. O tempo médio global de internação foi 47 dias. Treze pacientes foram tratados cirurgicamente; a média de operações realizadas foi duas por paciente. Ocorreram seis óbitos dentre os pacientes submetidos ao tratamento cirúrgico (46% e dois óbitos no grupo submetido somente ao tratamento clínico (8,3%. A mortalidade global foi 21% CONCLUSÃO: Após a modificação na forma de abordagem dos pacientes com pancreatite aguda grave, houve diminuição da mortalidade e uma tendência para a conduta expectante.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

Science.gov (United States)

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effect of a metal primer on the bond strength of the resin-metal interface Efeito de um primer para metais sobre a força de união da interface metal-resina

Directory of Open Access Journals (Sweden)

Anderson Pinheiro de Freitas

2004-06-01

Full Text Available To evaluate the effect of different surface treatments on shear bond strength between a metallic alloy (Co-Cr-Mo - Remanium CD and a resin cement (Rely X TM and to evaluate the mode of fracture after testing, forty couples of metallic-alloy disks were melted, regularized, polished, submitted to four thermal cycles (Vacuum, 960ºC, 8 minutes and randomly separated into four groups. Each group received a different type of treatment: Group PSP: Polished with sandpaper 600; Group PCP: Polished with sandpaper 600 and application of the metal primer Alloy Primer (Kuraray; Group JSP: Sandblasted with 100µm aluminum oxide; Group JCP: Sandblasted with 100mm aluminum oxide and treated with a metal Primer. The groups were cemented and stored in distilled water at 37ºC for 36 hours and submitted to the shear bond strength test. The mean and standard deviation (in Kgf/cm² obtained for each group was: PSP 4.0/0.4; PCP 88.9/33.6; JSP 163.2/27.6; JCP 144.5/54.0. After the statistical analysis the authors concluded that: the highest values were obtained for the sandblasted groups (JSP, JCP, regardless of the primer application; the Alloy Primer increased the retention between the Rely X cement and the polished surface of the Co-Cr-Mo alloy, yet its bond strength was not greater than that obtained with sandblasting; all specimens showed adhesive failures in the tested interface.Para avaliar o efeito de diferentes tratamentos superficiais sobre a resistência ao cisalhamento da união entre uma liga metálica (Co-Cr-Mo - Remanium CD e um cimento resinoso (Rely X TM e analisar o tipo de fratura durante a separação dos espécimes, quarenta pares de discos metálicos foram fundidos, regularizados e polidos, submetidos a quatro ciclos térmicos (vácuo, 960ºC, 8 minutos e divididos aleatoriamente em quatro grupos. Cada grupo recebeu um tipo de tratamento: Grupo PSP: Polimento com lixa d'água Nº 600; Grupo PCP: Polimento com lixa 600 e aplicação do

Primer: Fracture mechanics in the nuclear power industry

International Nuclear Information System (INIS)

Wessel, E.T.; Server, W.L.; Kennedy, E.L.

1990-01-01

This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

Colagem ortodôntica em esmalte com presença ou ausência de contaminação salivar: é necessário o uso de adesivo auto-condicionante ou de adesivo hidrofílico? Orthodontic bonding in dry and saliva contaminated enamel: is a self-etching primer or a moisture-insensitive primer necessary?

Directory of Open Access Journals (Sweden)

Cristiane Becher Rosa

2008-06-01

Full Text Available OBJETIVO: o objetivo deste trabalho foi avaliar a resistência ao cisalhamento da colagem ortodôntica de um adesivo hidrofílico (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Califórnia, de um adesivo auto-condicionante (Transbond Self-Etching Primer, 3M Unitek, Monrovia, Califórnia, e sem uso de adesivo, em superfícies de esmalte secas ou contaminadas por saliva. METODOLOGIA: incisivos bovinos (60 foram divididos em 6 grupos: (1 controle sem contaminação salivar (sem adesivo, (2 controle com contaminação salivar (sem adesivo, (3 adesivo auto-condicionante sem contaminação salivar, (4 adesivo auto-condicionante com contaminação salivar antes do adesivo, (5 adesivo hidrofílico sem contaminação salivar e (6 adesivo hidrofílico com contaminação salivar antes do adesivo. Braquetes metálicos foram colados com compósito (Transbond XT, 3M Unitek, Monrovia, Califórnia. Após a colagem, os corpos-de prova foram armazenados a 37±1ºC em ambiente úmido até a realização do teste de cisalhamento. Diferença estatística foi determinada com valor de probabilidade de 0,05 ou menos (p AIM: The purpose of this study was to evaluate the shear bond strength of orthodontic bonding with the use of a hydrophilic primer (Transbond Moisture-Insensitive Primer, 3M Unitek, Monrovia, Calif., a self-etching primer (Transbond Plus Self-etching Primer, 3M Unitek, Monrovia, Calif. and without primer application, in dry and saliva contaminated enamel surfaces. METHODS: Bovine incisors (60 were divided into 6 groups: (1 uncontaminated control (no primer, (2 control with saliva contamination (no primer, (3 uncontaminated self-etching primer, (4 saliva contamination before self-etching primer, (5 uncontaminated hydrophilic primer and (6 saliva contamination before hydrophilic primer. Stainless steel brackets were bonded with composite resin (Transbond XT, 3M Unitek, Monrovia, Calif.. After bonding, all samples were stored at 37±1°C in a

A method for automatically extracting infectious disease-related primers and probes from the literature

Directory of Open Access Journals (Sweden)

Pérez-Rey David

2010-08-01

Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

Dinámica de objetos transplutonianos: resultados preliminares

Science.gov (United States)

Fernández, S.; Brizuela, H.; Roig, F.; Varela, O.

Se presentan los resultados de una integración numérica de las ecuaciones de movimiento para objetos transplutonianos. Se han calculado los tiempos de Lyapunov para esos objetos y se analiza el comportamiento dinámico de los mismos.

Primer on molecular genetics. DOE Human Genome Program

Energy Technology Data Exchange (ETDEWEB)

1992-04-01

This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

Efectos reales de la política fiscal en Colombia: 1990-2007

Directory of Open Access Journals (Sweden)

Henry Laverde

2009-12-01

Full Text Available La evidencia internacional muestra que la actividad económica se veafectada por los choques de la política fiscal. En este trabajo se caracterizan los efectos dinámicos del gasto y los ingresos del Gobierno nacional colombiano sobre el producto interno bruto (PIB y la demanda agregada para el periodo 1990-2007. Para ello se utiliza un modelo estructural de vectores autorregresivos (SVAR con información trimestral. Los resultados evidencian los efectos keynesianos tanto de la tributación como del gasto gubernamental y de sus componentes (consumo e inversión, aunque sus efectos son de bajapersistencia.

Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

Science.gov (United States)

Leggat, Robert Benton, III

Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

A Primer on Concepts and Applications of Proteomics in Neuroscience

DEFF Research Database (Denmark)

Hosp, Fabian; Mann, Matthias

2017-01-01

The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

Resultados em e-Learning corporativo

OpenAIRE

Cardoso, Fernando de Carvalho

2011-01-01

As empresas estão ampliando muito a utilização do e-learning em seus processos de educação corporativa, este trabalho iniciou-se na busca para responder quais são os impactos da implementação do e-Learning no processo educacional nas corporações. Esta dissertação de mestrado apresenta um estudo dos resultados das ações de e-learning e o contexto em que este está inserido, nas corporações e na sociedade. Para tanto foram utilizados autores que falam sobre educação, educação corporativa, ...

Violencia intrafamiliar en estudiantes de primer año de la Escuela Emergente de Enfermería

Directory of Open Access Journals (Sweden)

Margarita Díaz Lemus

Full Text Available Introducción: la familia como célula fundamental de la sociedad, tiene entre sus funciones la educación de las nuevas generaciones. En ella pueden aparecer episodios de violencia intrafamiliar que resultan difíciles de identificar y de afrontar por los adolescentes. Objetivos: identificar la presencia de violencia en las familias de los estudiantes de enfermería de primer año de la Escuela de Formación Emergente de Enfermería, así como determinar la relación entre el agresor y los tipos de violencia intrafamiliar. Métodos: se realizó una investigación descriptiva de corte transversal. El universo estuvo constituido por 101 estudiantes de la sede del municipio Cotorro. La muestra fue de 72 estudiantes que reconocieron la presencia de violencia intrafamiliar en sus hogares. Se utilizaron métodos teóricos de revisión documental y métodos empíricos de grupos focales y encuesta. Resultados: existe violencia intrafamiliar en la mayoría de los hogares de los estudiantes estudiados, donde los padres y las madres son los agresores fundamentales. Conclusiones: las manifestaciones de violencia intrafamiliar más representadas fueron el abuso emocional y la agresión física.

The effects of pH on N-methacryloyl glycine primer on bond strength to acid-etched dentin.

Science.gov (United States)

Nishiyama, N; Suzuki, K; Asakura, T; Nakai, H; Yasuda, S; Nemoto, K

1996-07-01

To develop a more effective adhesive primer, it is imperative to understand the adhesion mechanisms of the resin to the demineralized dentin through a dentin primer. When the bonding agent was directly applied to the dentin etched by 40 wt % phosphoric acid without a primer pretreatment, the bond strength of the resin to the dentin was 5 MPa. Conversely, when the demineralized dentin was pretreated with the N-methacryloyl glycine (NM alpha A) primer solution with a pH value of 1.5, the bond strength increased considerably to 15 MPa. However, the bond strength dropped dramatically from 15 to 3 MPa when the sodium salt of NM alpha A was added, thereby increasing the pH value of the NM alpha A primer solution from 3.2 to 5.0. When the pH value was increased above 3.5 (pKa value), the number of ionized NM alpha A species increased in the solution. As a result, the bond strength of the resin fell to approximately 3 MPa. This result was obtained despite the 5-micron-thick hybrid layer that was created in the subsurface of the intertubular dentin. The number of unionized NM alpha A species increased by lowering the pH value below 3.5. As a result, the NM alpha A primer provided a higher bond strength of the resin to the demineralized dentin. In contrast, when 10 wt % citric acid containing 3 wt % ferric chloride was applied to the dentin, maximum bond strength was obtained when the pH value of the NM alpha A primer solution was 3.5. The pH dependency of the bond strength obtained following 10 wt % citric acid containing 3 wt % ferric chloride etching is different from the results obtained from 40 wt % phosphoric acid etching. This can be attributed to the difference in the characteristics of the demineralized collageous layer.

Avaliação de efetividade da atenção domiciliar de uma cooperativa médica de Belo Horizonte, Minas Gerais, Brasil

Directory of Open Access Journals (Sweden)

Fernando Martín Biscione

2013-01-01

Full Text Available Foi realizado estudo de coorte retrospectiva com o objetivo de avaliar o impacto do plano de cuidados do Programa de Atenção Domiciliar da Unimed-BH, modalidade Gerenciamento de Casos (PrGC/AD, sobre o tempo livre de hospitalização entre os pacientes com 60 anos ou mais assistidos pelo programa. Utilizou-se o modelo de Cox para avaliar o efeito do intervalo entre as visitas domiciliares dos profissionais do programa sobre o tempo livre de hospitalização de 2.943 idosos, ajustado por idade, medicamentos em uso, via de alimentação, úlcera de pressão, déficit cognitivo, dependência física, oxigenioterapia, consultas ambulatoriais e hospitalizações no trimestre anterior. Foram fatores de risco para menor tempo livre de hospitalização: o grau de dependência física, alimentação enteral, oxigenioterapia suplementar, úlceras de pressão e hospitalizações no trimestre anterior. Observouse efeito protetor dose-resposta da frequência de visitas médicas e de enfermagem. Os resultados sugerem que visitas domiciliares regulares de médico e enfermeiro aumentam significativamente o tempo livre de hospitalização nos pacientes assistidos pelo PrGC/AD.

Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

Science.gov (United States)

2018-01-18

This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

Imagem corporal de gestantes: um estudo longitudinal

Directory of Open Access Journals (Sweden)

Juliana Fernandes Filgueiras Meireles

Full Text Available RESUMO Objetivos Comparar atitudes corporais, atitudes alimentares, sintomas depressivos, autoestima, ansiedade e índice de massa corporal (IMC de gestantes em diferentes momentos ao longo da gestação, bem como verificar a influência que as variáveis estudadas exercem sobre as atitudes corporais no primeiro, segundo e terceiro trimestre gestacional. Métodos Foram incluídas 17 gestantes que frequentavam o exame pré-natal na cidade de Juiz de Fora-MG, entre 22 e 41 anos de idade (média de 30,76 ± 5,65 anos, excluindo-se aquelas com dados incompletos. Como instrumentos de avaliação utilizaram-se: Body Attitudes Questionnaire, Eating Attitudes Test-26, Beck Depression Inventory, Rosenberg Self-esteem Scale, a versão curta do Brazilian State-Trait Anxiety Inventory e o questionário sociodemográfico. Ademais, foram coletados dados antropométricos e obstétricos. Foram realizadas análises estatísticas descritivas, comparativas e correlacionais. Resultados O IMC, as atitudes corporais negativas e a subescala “sentimento de gordura” aumentaram progressivamente ao longo da gestação (p 0,05. Além disso, o IMC explicou 31% da variância das atitudes direcionadas ao corpo no primeiro trimestre, enquanto as atitudes alimentares foram responsáveis por 30% e 46% das atitudes corporais no segundo e terceiro trimestre, respectivamente. Conclusões As atitudes corporais, as atitudes alimentares, os sintomas depressivos, a autoestima e a ansiedade mantiveram-se constantes ao longo da gestação. O IMC e as atitudes alimentares influenciaram a imagem corporal em gestantes. Sugere-se a criação de instrumentos específicos a fim de um melhor entendimento das preocupações relacionadas ao corpo de gestantes.

DIVERSIDAD EDUCATIVA EN EDUCANDOS DEL SISTEMA DE PROTECCION SOCIAL "CHILE SOLIDARIO"1 DE LA COMUNA DE VALPARAISO: RESULTADOS DE UN ESTUDIO EXPLORATORIO[ign]* [title language=en]Educative diversity in pupil of the system of social protection "Shared in common Chile" of the commune of Valparaiso: results of an exploratory study

OpenAIRE

Julio Maturana, Cristina

2009-01-01

El artículo presenta los resultados de un estudio exploratorio sobre la relación entre vulnerabilidad social y educativa en educandos que pertenecen a familias del Programa Puente y cursan segundo ciclo de educación parvularia y primer ciclo de educación básica. La relación se explora desde una perspectiva de educación inclusiva, con el propósito de discutir la "creencia" que plantea que dicha relación es directa, es decir, que por el solo hecho de pertenecer a este segmento socioeconómico te...

Note: Primer Amysat 001; Fragment size is 211bp

Indian Academy of Sciences (India)

Renuka

Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

DEFF Research Database (Denmark)

Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

2014-01-01

Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

Directory of Open Access Journals (Sweden)

S Hamid Raji

2011-01-01

Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

Science.gov (United States)

Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

2010-03-01

Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

Science.gov (United States)

Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

2013-01-01

Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-07-01

Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

Development of a microsatellite primer set to investigate the genetic ...

Indian Academy of Sciences (India)

Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

Development of specific primers for genus Fusarium and F. solani ...

African Journals Online (AJOL)

Yomi

2012-01-05

Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

Science.gov (United States)

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

Science.gov (United States)

Glennon, Kelsey L.; Cron, Glynis V.

2016-01-01

Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

Ares, Janus, Globalization: A Primer For The Military Leader in NATO

National Research Council Canada - National Science Library

Clemons, Dean

2002-01-01

...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

Bayesian models a statistical primer for ecologists

CERN Document Server

Hobbs, N Thompson

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

Directory of Open Access Journals (Sweden)

Lenka Maršálková

2014-07-01

Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

Resultados perinatales en mujeres mexicanas con lupus eritematoso sistémico

OpenAIRE

B. Farfan-Labonne; I. Luis-Vásquez; A. Ávila-Carrasco; J. Ramírez-Peredo; M. Rodríguez-Bosch; J. Beltrán-Montoya; E. Reyes-Muñoz

2017-01-01

Objetivo: Conocer la incidencia de resultados perinatales en mujeres mexicanas con embarazo único y lupus eritematoso sistémico. Materiales y métodos: Estudio de cohorte histórica en el que se incluyeron mujeres diagnosticadas con lupus eritematoso sistémico, embarazo único, control prenatal y resolución entre 2010 y 2015. Se calculó la incidencia de los siguientes resultados perinatales: nacimiento pretérmino, muerte fetal temprana, oligohidramnios, aborto, rotura prematura de membranas, ...

Primer for criticality calculations with DANTSYS

International Nuclear Information System (INIS)

Busch, R.D.

1996-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

Varicocele e infertilidad. Resultados del tratamiento quirúrgico

Directory of Open Access Journals (Sweden)

Julio A. Fariñas Martínez

2015-12-01

Full Text Available Se realizó un estudio observacional analítico, con el objetivo de precisar los resultados del tratamiento quirúrgico en los pacientes con infertilidad causada por varicocele, en el Hospital General Docente “Dr. Ernesto Guevara de la Serna”, de la provincia de Las Tunas; en el período de enero de 2011 hasta abril de 2012. Se revisaron las historias clínicas de 756 pacientes con varicocele e infertilidad, operados por la técnica de Lewis entre enero de 2008 y diciembre de 2011. Se observó la mayor incidencia en el grupo de edades de 26 a 35 años. La calidad del semen mejoró en el 73.3% después de la operación. El grupo de edades que tuvo mejores resultados en cuanto a calidad del semen y embarazos fue el de 26 a 35 años. Lograron el embarazo el 75% de los pacientes.

A web-based adaptive tutor to teach PCR primer design

NARCIS (Netherlands)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

A Web-based Adaptive Tutor to Teach PCR Primer Design

NARCIS (Netherlands)

Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

Radiation protection primer

International Nuclear Information System (INIS)

Aigner, R.; Melzer, E.; Seissler, H.

1986-01-01

This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

Bond strength of primer/cement systems to zirconia subjected to artificial aging.

Science.gov (United States)

Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

2016-11-01

Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

Produção de conhecimento sobre resultados de enfermagem Producción de conocimiento acerca de los resultados de enfermería Knowledge production about nursing outcomes

Directory of Open Access Journals (Sweden)

Deborah Hein Seganfredo

2010-02-01

Full Text Available Esta revisão da literatura buscou identificar e analisar a produção de conhecimento sobre resultados de enfermagem no contexto mundial. Foi realizada uma revisão sistematizada nas bases de dados LILACS e MEDLINE com as palavras-chave: outcomes, nursing e classification. Nenhuma publicação nacional foi identificada. As principais questões levantadas foram: o uso de classificações padronizadas de resultados para mensurar mudanças no estado de saúde do paciente; o uso da Classificação dos Resultados de Enfermagem (NOC como terminologia de escolha na prática profissional; a necessidade de atribuir efetividade às intervenções do enfermeiro por meio da identificação de resultados do paciente sensíveis à profissão com ênfase em tornar a prática de enfermagem rentável às instituições. Destaca-se e importância em desenvolver estudos brasileiros abordando a temática.Esta revisión de la literatura objetivó identificar y analisar la producción de conocimiento acerca de los resultados de la enfermería en el contexto mundial. Fue realizada una revisión sistemátizada en las bases de datos MEDLINE y LILACS con las palabras clave: outcomes, nursing y classification. Publicación nacionales no fueran identificadas. Las principales cuestiones planteadas fueron: el uso de las clasificaciones de los resultados para medir los cambios en el estado de salud del paciente, el uso de la Clasificación de Resultados de Enfermería (NOC y la terminología de elección en la práctica profesional, la necesidad de prestar una asistencia eficaz a la enfermera mediante la identificación de los resultados de los pacientes sensibles a la profesión, con enfasis en tornar la práctica de la enfermería rentable a las instituciones. Es importante desarrollar estudios brasileños con abordaje en la temática.This literature review aimed at identifying and analysing the knowledge production regarding nursing outcomes in a worldwide context. A

Incorporating travel-time reliability into the congestion management process : a primer.

Science.gov (United States)

2015-02-01

This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

Bayesian models: A statistical primer for ecologists

Science.gov (United States)

Hobbs, N. Thompson; Hooten, Mevin B.

2015-01-01

Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

Experimental primers containing synthetic and natural compounds reduce enzymatic activity at the dentin–adhesive interface under cyclic loading

Science.gov (United States)

Sousa, Ana Beatriz Silva; de Mattos Pimenta Vidal, Cristina; Leme-Kraus, Ariene Arcas; de Carvalho Panzeri Pires-de-Souza, Fernanda; Bedran-Russo, Ana K.

2016-01-01

Objective To evaluate the effect of experimental primers (chlorhexidine, enriched mixture of proanthocyanidins and doxycycline) on the adhesive properties and gelatinolytic activity at dentin-resin interfaces of occlusal Class I restorations. Methods The inactivation of enzymes by the experimental primers was assessed by fluorescence assay and gelatin zymography. To assess the adhesive properties, occlusal Class I cavities were prepared in sound human molars, etched with phosphoric acid and restored with one of the primers and an etch-and-rinse adhesive system (Adper Single Bond Plus - 3M ESPE). After the restorative procedures, the specimens were divided into two subgroups (n = 6) consisting of storage in incubation buffer or axial cyclic loading at 50 N and 1,000,000 cycles. Then, the sectioned and sliced specimens were assigned to in situ zymography assay and microtensile bond strength (TBS) test. Results Fluorescence assay and gelatin zymography revealed that the experimental primers inactivated rMMPs. In situ zymography (2-way ANOVA, Tukey, p 0.05). Significance The use of experimental primers impaired the enzymatic activity at the dentin-adhesive interface after cyclic loading and the activity of rMMPs. Cyclic loading did not have a significant effect on the bond strength. PMID:27524231

Efficient One-Step Fusion PCR Based on Dual-Asymmetric Primers and Two-Step Annealing

DEFF Research Database (Denmark)

Liu, Yilan; Chen, Jinjin; Thygesen, Anders

2018-01-01

Gene splicing by fusion PCR is a versatile and widely used methodology, especially in synthetic biology. We here describe a rapid method for splicing two fragments by one-round fusion PCR with a dual-asymmetric primers and two-step annealing (ODT) method. During the process, the asymmetric...... intermediate fragments were generated in the early stage. Thereafter, they were hybridized in the subsequent cycles to serve as template for the target full-length product. The process parameters such as primer ratio, elongation temperature and cycle numbers were optimized. In addition, the fusion products...

Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

International Nuclear Information System (INIS)

D. S. Lucas

2004-01-01

A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

Science.gov (United States)

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (pbracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

Science.gov (United States)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

La formación del profesorado: de las competencias y los resultados de aprendizaje a las estrategias de evaluación en el practicum: análisis comparativo de cuatro universidades españolas

Directory of Open Access Journals (Sweden)

Núria Lorenzo Ramírez

2015-03-01

Full Text Available El objetivo de esta investigación es analizar y comparar las estrategias de evaluación que utilizan cuatro universidades españolas en la asignatura de Prácticas Externas, con el objetivo de ver si se corresponden con los resultados de aprendizajes y las competencias del Grado de Educación Infantil y el Grado de Educación Primaria. El marco teórico y conceptual está marcado por las políticas docentes y laborales en las que crear un Espacio Europeo de Educación Superior a nivel universitario y un Marco Europeo de Cualificaciones Profesionales (EQF. A nivel laboral obliga a las universidades a abordar los procesos de enseñanza y aprendizaje de forma diferente. En este sentido se aborda en primer término el tema de la planificación docente y cómo pasar de las competencias a los resultados de aprendizaje en la educación superior. El término de resultados de aprendizaje nos lleva a pensar las actividades y la evaluación de forma diferente. Es en este sentido que en la investigación que se presenta se analizan los planes de estudios de la asignatura de Prácticas Externas de dos grados (el Grado de Educación Infantil y el Grado de Educación Primaria de cuatro universidades españolas (Universidad de Oviedo, Universidad de León, Universidad de Valencia y Universidad de Barcelona. El objetivo de análisis es comparar las estrategias de evaluación y ver su relación con los resultados de aprendizajes de las asignaturas de prácticas. Finalmente se ofrecen los resultados del análisis, así como propuestas para mejorar la docencia y la calidad de los aprendizajes de los futuros maestros de educación infantil y primaria. Es necesario que desde la universidad hagamos un esfuerzo por hacer visibles cuáles son los resultados de aprendizaje de los estudiantes, cómo en la asignatura de prácticas se integran los aprendizajes adquiridos en el aula universitaria y cómo nos ayudan en esa construcción del conocimiento los centros de prácticas.

A Primer on Observational Measurement.

Science.gov (United States)

Girard, Jeffrey M; Cohn, Jeffrey F

2016-08-01

Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

Modelos de aplicación de ecuaciones diferenciales de primer orden con geogebra: actividades para resolver problemas de mezclas

Directory of Open Access Journals (Sweden)

Cesar Augusto Hernández-Suarez

2016-09-01

Full Text Available El objetivo del estudio es diseñar una actividad para abordar los problemas de mezclas en un curso de ecuaciones diferenciales que permita realizar cambios de representación en los registros gráfico, algebraico y lengua natural mediante la ayuda de software libre Geogebra, esperando así reducir la dificultad que presentan los estudiantes al momento de plantear la ecuación diferencial que modela un problema de mezclas. La actividad se fundamenta en dos marcos, el didáctico y el matemático, los cuales fueron elaborados con los aportes de distintas fuentes consultadas acerca del objeto de investigación. La selección de los participantes fue realizada mediante muestreo intencional y durante el desarrollo de este proceso se eligieron dieciocho (18 estudiantes de un programa académico de Ingeniería Civil de un curso de ecuaciones diferenciales. Se aplicó una encuesta a los estudiantes sobre los modelos de aplicación de ecuaciones diferenciales de primer orden para determinar el modelo a utilizar; los modelos con mayor porcentaje de elección fueron: Mezclas y ley de enfriamiento de Newton, razón por la cual se eligió el modelo de mezclas para el diseño de una actividad tipo test con 3 problemas que para ser resueltos con el Geogebra. Se analizan las respuestas dadas por los estudiantes al resolver una serie de problemas de aplicación de primer orden con el software libre Geogebra. Estos problemas permiten realizar traspasos del registro lenguaje natural al algebraico mediante representaciones ejecutables y preguntas que pretenden orientar al estudiante durante el desarrollo de la misma, con el fin de proporcionar herramientas para plantear la ecuación diferencial que se ajusta a los problemas planteados. Como resultados se obtiene una propuesta del uso del Geogebra como un recurso didáctico para favorecer la resolución de problemas de aplicación de ecuaciones diferenciales de primer orden (problemas de mezclas. Se puede concluir

Deconstruyendo el resultado contable convencional para diseñar un resultado contable ambiental

Directory of Open Access Journals (Sweden)

José Juan Déniz Mayor

2015-01-01

Full Text Available En el presente trabajo se discute la dificultad de delimitar con precisión los flujos de gastos e ingresos relacionados con la gestión ambiental corporativa, utilizando como hilo argumental el diseno˜ de un modelo algebraico de resultado contable que haga visible las partidas más significativas en esta materia. Las principales conclusiones se centran en la necesidad de vincular los gastos e ingresos ambientales a objetivos específicos a fin de poder evaluar el desempeno˜ ambiental de la empresa y el riesgo de adoptar decisiones ambientalmente ineficientes para mejorar la imagen pública gracias a este estado contable. Entre las principales limitaciones del modelo propuesto se encuentran el problema de la vinculación homogeneizada de las magnitudes contables a los objetivos de protección ambiental y la exclusión de las externalidades ambientales.

Aptitud física relacionada con salud en los estudiantes de primer semestre académico de un programa de fisioterapia, 2007

Directory of Open Access Journals (Sweden)

Claudia Lucía Ariza-García

2014-06-01

Full Text Available Objetivo: Evaluar la aptitud física relacionada con salud (AFRS de las estudiantes de primer semestre de fisioterapia de una universidad privada de Santander. Metodología: Estudio descriptivo transversal realizado en 20 estudiantes (17,8 ± 1,33 años de sexo femenino de primer semestre, seleccionadas por conveniencia. Se recolectaron las variables edad, sexo, composición corporal, la flexibilidad de la musculatura posterior, la capacidad aeróbica y la resistencia muscular de miembros superiores y abdominales. Se calcularon medidas de tendencia central, de dispersión, frecuencias y porcentajes. Resultados: En promedio el peso fue de 52,8 ± 9,5 kg, la estatura de 1,58 ± 0,05 m, el IMC de 20,9 ± 3,5 kg/m2. La circunferencia de cintura y de cadera fue de 69,3 ± 9,2 cms y 91,3 ± 7,3 cm, respectivamente. El promedio del cuarto cuartil de las mediciones perímetro de cintura, perímetro de cadera, relación cintura-cadera, frecuencia cardiaca después de 30 s y distancia en la prueba de flexibilidad fueron estadísticamente mayores comparado con los demás cuartiles. El 50% de los pacientes realizó entre 0 y 3 repeticiones de la prueba Push-Up y entre 0 y 21 repeticiones en la prueba Cu rl-Up. El 65% fue físicamente apta hasta en cuatro pruebas y el 35% en 5 y 6 pruebas. Ninguna fue apta en todas las pruebas. Conclusiones: Dado que ninguna de las estudiantes posee una aptitud física relacionada con salud óptima, se sugiere que en los programas de fisioterapia se fomente una AFRS adecuada junto con estilos de vida saldables para prevenir enfermedades crónicas no transmisibles.

LISTA DE PUBLICACIONES PERIODICAS DEL CENTRO DE DOCUMENTACION DEL MINISTERIO DE SALUD, PARA EL SERVICIO DE ALERTA - 1985

Directory of Open Access Journals (Sweden)

Ministerio de Salud

1985-08-01

Full Text Available

Accident: Analysis and Prevention. New York. Bimestral
Acodal. Bogotá. Irregular
Acta Chirurgica Scandinavica. Estocolmo. 8 números al año
Acta Psiquiátrica y Psicológica de América Latina. Buenos Aires. Trimestral
Age. Nebrasca. Trimestral
Age and Ageing. Londres. Bimestral
Ageing International. Washington. Trimestral
Alcoholism. Zagreb. Semestral
AMC.Acta Médica Colombiana. Trimestral
American Industrial Hygiene Association Journal. Ohio. Illinois. Mensual
American Journal of Clinical Nutrition. New York. Mensual
American Journal of Drug and Alcohol Abuse. New York. Trimestral
American Journal of Epidemiology. Maryland. Mensual
American Journal of Nursing. New York. Mensual
American Journal of obstetrics and Gynecology. St. Louis. Quincenal
American Journal ofOrthodontics. St.Louis. Mensual
American Journal of Psychiatry. Washington. Mensual
American Journal of Public Health. Washington. Mensual
American Journal of Sociology. Chicago. Bimestral
American Journal of Tropical 'Medicine and Hygiene. Lawrence. Kansas. Bimestral
ANEC. Irregular. Bogotá...

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

Science.gov (United States)

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

Science.gov (United States)

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

2015-01-01

Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

Directory of Open Access Journals (Sweden)

Douglas de Almeida Pereira

2015-09-01

Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

Resultados de la fase de engorde en invernaderos

OpenAIRE

Sonnenholzner, Stanislaus

2002-01-01

Resultados de la fase de engorde en invernaderos Continuando con la serie de experimentos que se están desarrollando en la estación experimental Pesglasa para evaluar el efecto del tratamiento térmico en la supervivencia del camarón, se realizó la fase de engorde en invernaderos.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

Directory of Open Access Journals (Sweden)

Denilce Meneses Lopes

2010-01-01

Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

MCNPTM criticality primer and training experiences

International Nuclear Information System (INIS)

Briesmeister, J.; Forster, R.A.; Busch, R.

1995-01-01

With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

Science.gov (United States)

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

Resolución experimental y analítica de un problema de dinámica rotacional: interpretación de los resultados

Directory of Open Access Journals (Sweden)

Beatriz Rosario Follari

2016-09-01

Full Text Available http://dx.doi.org/10.5007/2175-7941.2016v33n2p606   La resolución de problemas y las prácticas de laboratorio son parte esencial de las actividades que deben realizar los estudiantes de Física en sus primeros cursos de Física. Se relata una experiencia de aula en la que se propuso a los estudiantes de Física II del primer año de las carreras Profesorado y Licenciatura en Física, el estudio de un carrete que rueda sin deslizar. La misma constó de dos partes: en la primera se les solicitó que planificaran y llevaran a cabo una experiencia para determinar el momento de inercia del carrete; en la segunda se les pidió el desarrollo analítico para encontrar la aceleración y fuerza de rozamiento al hacerlo rodar. La actividad se llevó a cabo en grupo y los resultados fueron expuestos y discutidos. La propuesta resultó positiva ya que llevó a los estudiantes a expresar sus ideas, a la discusión grupal y promovió la autonomía para planificar experiencias sencillas y llevarlas a cabo. Se puso énfasis en la interpretación de las ecuaciones resultantes.

Can previous acid etching increase the bond strength of a self-etching primer adhesive to enamel?

Directory of Open Access Journals (Sweden)

Ana Paula Morales Cobra Carvalho

2009-06-01

Full Text Available Because a greater research effort has been directed to analyzing the adhesive effectiveness of self etch primers to dentin, the aim of this study was to evaluate, by microtensile testing, the bond strength to enamel of a composite resin combined with a conventional adhesive system or with a self-etching primer adhesive, used according to its original prescription or used with previous acid etching. Thirty bovine teeth were divided into 3 groups with 10 teeth each (n= 10. In one of the groups, a self-etching primer (Clearfil SE Bond - Kuraray was applied in accordance with the manufacturer's instructions and, in the other, it was applied after previous acid etching. In the third group, a conventional adhesive system (Scotchbond Multipurpose Plus - 3M-ESPE was applied in accordance with the manufacturer's instructions. The results obtained by analysis of variance revealed significant differences between the adhesive systems (F = 22.31. The self-etching primer (Clearfil SE Bond presented lower enamel bond strength values than the conventional adhesive system (Scotchbond Multipurpose Plus (m = 39.70 ± 7.07 MPa both when used according to the original prescription (m = 27.81 ± 2.64 MPa and with previous acid etching (m = 25.08 ± 4.92 MPa.

Resultado del proceso educativo: el papel de los estilos de aprendizaje y la personalidad

OpenAIRE

Santos Álvarez, María del Valle; Garrido Samaniego, María José

2015-01-01

En esta investigación se plantea el análisis del estilo de aprendizaje y la personalidad eficaz en una muestra de estudiantes universitarios y se analiza su posible asociación con las dimensiones de resultado del proceso educativo: rendimiento académico y satisfacción. Los resultados sugieren que el estilo predominante en los participantes es el reflexivo y que existen relaciones entre los distintos estilos. Se constata también que las dos dimensiones del resultado del proceso educativo (rend...

Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

Science.gov (United States)

Corman, Rena

This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

Science.gov (United States)

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Prevalência e fatores associados ao ganho de peso gestacional excessivo em unidades de saúde do sudoeste da Bahia

Directory of Open Access Journals (Sweden)

Elma Izze da Silva Magalhães

2015-12-01

Full Text Available RESUMO: Objetivo: Determinar a prevalência do ganho de peso semanal excessivo em gestantes e verificar a associação com fatores demográficos, socioeconômicos, obstétricos, antropométricos e comportamentais. Metodologia: Trata-se de um estudo transversal realizado com 328 gestantes assistidas em todas as unidades de saúde da zona urbana de Vitória da Conquista, Bahia. Os dados foram coletados no período de maio de 2010 a junho de 2011. O ganho de peso semanal foi avaliado de acordo com as recomendações atuais do Institute of Medicine (IOM. A associação entre os fatores em estudo e o ganho de peso semanal excessivo foi verificada nas gestantes, no segundo e terceiro trimestres, por meio da análise de regressão de Poisson com variância robusta. Resultados: A prevalência de ganho de peso semanal excessivo nas gestantes do segundo e terceiro trimestres foi de 42,5%. Os fatores determinantes do ganho ponderal semanal excessivo foram: renda familiar < 1 salário mínimo (RP: 2,65; IC95% 1,18 - 4,83 e estado nutricional pré-gestacional sobrepeso/obesidade (RP: 1,33; IC95% 1,01 - 1,75. Conclusão: Os resultados do estudo reforçam a importância do monitoramento do ganho de peso durante a gestação. A avaliação do ganho de peso semanal possibilita a realização de intervenções precoces visando a prevenção do ganho de peso total excessivo e suas consequências para a mãe e para a criança.

Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

OpenAIRE

Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

2015-01-01

Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

A primer on the mortgage market and mortgage finance

OpenAIRE

Daniel J. McDonald; Daniel L. Thornton

2008-01-01

This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

La percepción pública de la ciencia y la tecnología desde la perspectiva de género

OpenAIRE

Pérez Sedeño, Eulalia

2003-01-01

Publicación de los resultados definitivos de la Encuesta de Percepción Social de la Ciencia en España en 2002 y un primer análisis e interpretación de destacados expertos sobre dichos resultados.

Comparison of bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and a universal adhesive.

Science.gov (United States)

Lee, Ji-Yeon; Ahn, Jaechan; An, Sang In; Park, Jeong-Won

2018-02-01

The aim of this study is to compare the shear bond strengths of ceramic brackets bonded to zirconia surfaces using different zirconia primers and universal adhesive. Fifty zirconia blocks (15 × 15 × 10 mm, Zpex, Tosoh Corporation) were polished with 1,000 grit sand paper and air-abraded with 50 µm Al 2 O 3 for 10 seconds (40 psi). They were divided into 5 groups: control (CO), Metal/Zirconia primer (MZ, Ivoclar Vivadent), Z-PRIME Plus (ZP, Bisco), Zirconia Liner (ZL, Sun Medical), and Scotchbond Universal adhesive (SU, 3M ESPE). Transbond XT Primer (used for CO, MZ, ZP, and ZL) and Transbond XT Paste was used for bracket bonding (Gemini clear ceramic brackets, 3M Unitek). After 24 hours at 37°C storage, specimens underwent 2,000 thermocycles, and then, shear bond strengths were measured (1 mm/min). An adhesive remnant index (ARI) score was calculated. The data were analyzed using one-way analysis of variance and the Bonferroni test ( p = 0.05). Surface treatment with primers resulted in increased shear bond strength. The SU group showed the highest shear bond strength followed by the ZP, ZL, MZ, and CO groups, in that order. The median ARI scores were as follows: CO = 0, MZ = 0, ZP = 0, ZL = 0, and SU = 3 ( p < 0.05). Within this experiment, zirconia primer can increase the shear bond strength of bracket bonding. The highest shear bond strength is observed in SU group, even when no primer is used.

A primer on pseudorandom generators

CERN Document Server

Goldreich, Oded

2010-01-01

A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

A primer on quantum fluids

CERN Document Server

Barenghi, Carlo

2016-01-01

The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

Making the connection: advancing traffic incident management in transportation planning : a primer.

Science.gov (United States)

2013-07-01

"The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

Autoevaluación de habilidades investigativas e intención de dedicarse a la investigación en estudiantes de primer año de medicina de una universidad privada en Lima, Perú

Directory of Open Access Journals (Sweden)

Rodrigo M Carrillo-Larco

2013-01-01

Full Text Available Objetivo: Determinar el número de habilidades auto-percibidas relacionadas a la investigación biomédica y la proporción de alumnos interesados en dedicar su carrera a la investigación, e identificar los factores asociados a este interés en estudiantes de medicina del primer año de una universidad privada de Lima, Perú. Material y métodos: Se realizó un estudio transversal analítico en estudiantes de medicina del primer año de la Universidad Peruana Cayetano Heredia, matriculados en el 2011. Se usó un cuestionario auto-aplicado, anónimo, validado por expertos y previamente probado, se preguntó sobre las habilidades para la investigación que los alumnos consideraban tener y la intención de dedicar su carrera a la investigación. Resultados: La proporción de respuesta fue del 100% (143 estudiantes. La mediana del número de habilidades auto-percibidas fue de 2,0 (de 7,0 posibles, siendo las habilidades menos frecuentes el análisis estadístico y el cálculo del tamaño de muestra. El 71,2% de los alumnos reportó tener la intención de dedicarse a la investigación como carrera. Luego de ajustar por el sexo, la edad, la modalidad de ingreso y el desarrollo de investigación escolar, las características asociadas a dicha intención fueron la edad y el planear involucrarse en investigación tardíamente en la carrera. Conclusiones: Aunque el nivel de habilidades auto-percibidas para la investigación en estudiantes de medicina del primer año es limitado; ellos poseen un interés significativo por dedicarse a la investigación, constituyendo una potencial fuente de recursos humanos.

Análisis de estabilidad del reactor PFTR para una reacción con cinética de primer orden utilizando la funcional de Lyapunov

Directory of Open Access Journals (Sweden)

Héctor Armando Durán Peralta

2007-01-01

Full Text Available Abunda la literatura referente al análisis de estabilidad de reactores con parámetros globalizados de concentración y temperatura (por ejemplo el CSTR, en cambio es escasa la literatura sobre la estabilidad de reactores con parámetros distribuidos donde existe distribución espacial de concentración y temperatura, como es el caso del reactor tubular PFTR. Este documento analiza la estabilidad del reactor PFTR isotérmico y no isotérmico para una reacción con cinética de primer orden utilizando la funcional de Lyapunov. Se trabaja con una cinética de primer orden pues un objetivo de este artículo es mostrar cómo se aplica la funcional de Lyapunov al análisis de un reactor de parámetros distribuidos, dado que es casi inexistente la literatura sobre el método de la funcional de Lyapunov aplicada a la estabilidad de reactores (técnica usada en el análisis de estabilidad de sistemas en ingeniería eléctrica. El análisis de estabilidad dio como resultado perfiles de temperatura y concentración asintóticamente estables para los casos PFTR isotérmico, no isotérmico con constante cinética independiente de la temperatura y PFTR no isotérmico adiabático. Para el PFTR con retiro de calor el análisis condujo a una región de estabilidad asintótica y a una región incierta donde puede o no haber oscilaciones.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

Science.gov (United States)

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

Science.gov (United States)

Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

2012-01-01

The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

Factores relacionados con la deserción en el primer y segundo año de estudio en la carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica

Directory of Open Access Journals (Sweden)

Paola Michelle Pascua-Cantarero

2016-01-01

Full Text Available Recibido 21 de mayo de 2014 • Corregido 15 de setiembre de 2015 • Aceptado 3 de noviembre de 2015El presente artículo da a conocer detalles sobresalientes obtenidos al realizar una investigación que tuvo entre sus objetivos determinar los factores relacionados con deserción de estudiantes, quienes ingresaron en los años 2007, 2008, 2009, durante el primer y segundo año del Bachillerato y Licenciatura en Enseñanza de la Matemática (carrera de Enseñanza de la Matemática de la Universidad Nacional de Costa Rica. La citada investigación respondió a un estudio mixto, con una fase cuantitativa de carácter descriptivo y una parte cualitativa con un diseño fenomenológico; su fundamentación teórica se basó en investigaciones sobre deserción universitaria en distintas regiones y la teoría de personas expertas como Tinto y Spady con respecto a las causas de esta problemática. Para  el  análisis de la información se empleó una base de datos proporcionada por el Departamento de Registro de la UNA y una entrevista telefónica semi-estructurada aplicada a estudiantes que desertaron de la carrera en forma definitiva. La población en la fase cuantitativa estuvo constituida por la totalidad de participantes que ingresaron en los años 2007, 2008 y 2009 y que desertaron en el primer y segundo año de la carrera. El grupo en estudio para la etapa cualitativa estuvo compuesto por quince informantes pertenecientes a las diferentes cohortes 2007, 2008 y 2009 y quienes desertaron en el primer y segundo año de la carrera. Los resultados mostraron que el fenómeno de  deserción en el primer año tuvo factores similares a la que se produjo en el segundo año de la carrera de Enseñanza de la Matemática. Las conclusiones indican que entre los diversos factores relacionados con la deserción en el primer y segundo año de las cohortes 2007, 2008 y 2009 sobresalieron las expectativas no satisfechas y la falta de integración académica y

A Web-Based Adaptive Tutor to Teach PCR Primer Design

Science.gov (United States)

van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

2012-01-01

When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

RELACIÓN ENTRE TIC Y LA ADQUISICIÓN DE HABILIDADES DE LECTOESCRITURA EN ALUMNOS DE PRIMER GRADO DE BÁSICA PRIMARIA

Directory of Open Access Journals (Sweden)

Rodolfo Ballestas Camacho

2015-01-01

Full Text Available Este artículo muestra los resultados de una investigación cuyo obje - tivo fue comprender la relación que hay entre las TIC y la adquisición de las habilidades de lectoescritura en alumnos de primer grado de básica primaria. Para lo anterior, se diseñó y aplicó una experiencia de aprendizaje basada en elementos tecnológicos con 22 niños y niñas del grado primero de básica primaria de una escuela en el municipio de Cúcuta, Colombia. Para observar los avances, se hizo un diagnóstico entre la población escolar participante, entrevistas a los docentes y grupos focales con algunos niños y niñas que dieron pautas para el di - seño de la experiencia de aprendizaje. Las TIC corresponden a medios didácticos que pueden ser utilizados para la enseñanza-aprendizaje de la lectoescritura. La relación entre estas dos esferas se halla en el campo de la comunicación y mediación ejercida por los docentes.

Development of specific primers for the detection of HVA1 from ...

African Journals Online (AJOL)

aghomotsegin

2014-01-22

Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

De neurocirujano a primer ministro de Salud de la Argentina

Directory of Open Access Journals (Sweden)

Karina Inés Ramacciotti

2008-01-01

Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

A primer on physical-layer network coding

CERN Document Server

Liew, Soung Chang; Zhang, Shengli

2015-01-01

The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

Fundamentos Conceptuales del Resultado Global

Directory of Open Access Journals (Sweden)

Francisco Sousa Fernández

2009-12-01

Full Text Available Con el propósito de reportar una mayor utilidad a los inversores, desde la década de los noventa del siglo XX los organismos emisores de normas contables más influyentes en el panorama internacional, entre los que cabe destacar el IASB y el FASB, han incorporado a sus cuerpos normativos el resultado global, asumido también en la Circular 4/2004 del Banco de España y en el Plan General de Contabilidad 2007.Ante esta concepción novedosa del resultado empresarial para nuestro entorno, este trabajo plantea como objetivo esencial revisar, acotar y sintetizar sus fundamentos teóricos, dispersos a lo largo del siglo XX, fundamentalmente en la literatura contable anglosajona.Una vez delimitado su soporte conceptual, además de destacar la existencia de un gap significativo entre el mismo y la realidad de su regulación actual, queremos analizar la incidencia de su adopción en la práctica, para lo que revisamos las contribuciones empíricas de los últimos años.For the convenience of investors, since the 1990s the most influential accounting standard-setters on the international scene, including the IASB and the FASB, have incorporated the concept of comprehensive income, also adopted in Circular 4/2004 of the Bank of Spain and in the 2007 General Accounting Plan.In view of this new conception of corporate income for our environment, this study aims to review, delimit and synthesize its theoretical foundations, found throughout the 20th Century, predominantly in the Anglo-Saxon accounting literature.Once its conceptual foundations are delimited, besides emphasizing the existence of a significant gap between such conceptual foundations and the reality of present regulations, we will analyze the effect of the adoption of this new conception in practice. To do so, the empirical contributions over the last few years will be taken into consideration.

Disponibilidad de medicamentos esenciales en unidades de primer nivel de la Secretaría de Salud de Tamaulipas, México

Directory of Open Access Journals (Sweden)

Reséndez Cristela

2000-01-01

Full Text Available OBJETIVO: Generar un diagnóstico sobre la disponibilidad de algunos medicamentos esenciales del Cuadro Básico de Insumos (CBI en las unidades de primer nivel de atención de la Secretaría de Salud en el estado de Tamaulipas, México. MATERIAL Y MÉTODOS: Entre septiembre y octubre de 1998 se llevó a cabo una encuesta en todas las unidades de primer nivel de tres jurisdicciones sanitarias de Tamaulipas. La disponibilidad de medicamentos se estudió en todas las unidades de dichas jurisdicciones sanitarias. Como instrumento de medición se utilizó una guía de verificación con una lista de 56 medicamentos y 10 insumos diversos. Para cada medicamento e insumo se calculó el número absoluto y la proporción de unidades que al momento de la verificación no contaban con dicho recurso. En las unidades con disponibilidad de medicamentos se estimó la mediana de la distribución. Como medida de resumen se estimó la mediana del total de medicamentos esenciales disponibles en todas las unidades. Posteriormente, se realizó este mismo ejercicio diferenciado por tipo de unidad. Se hicieron comparaciones directas entre la ausencia de uno o más medicamentos en las unidades y la disponibilidad de los mismos en los almacenes. Todo el proceso de análisis se realizó con el paquete estadístico Stata versión 5.0. RESULTADOS: Ninguna de las unidades visitadas contaba con ejemplares de todos los medicamentos incluidos en la lista. La unidad que más se acercó al total tenía 84% de los medicamentos y la que más se alejó contó apenas con 32%. Los problemas de disponibilidad de antibióticos, antihipertensivos, hipoglucemiantes y medicamentos para el tratamiento de deficiencias de hierro fueron particularmente significativos. En contraste, la disponibilidad de sales de rehidratación oral y métodos anticonceptivos y biológicos fue aceptable. CONCLUSIONES: Las instituciones de salud deberán generar alternativas para mejorar el acceso a los

454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

Directory of Open Access Journals (Sweden)

Alejandro Gonzalez-Martinez

2015-01-01

Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

Great Lakes rivermouths: a primer for managers

Science.gov (United States)

Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

2013-01-01

Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

Science.gov (United States)

Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

2016-02-09

Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

Impacto del género sobre los resultados organizacionales de las empresas chilenas

Directory of Open Access Journals (Sweden)

Patricia Carolina Huerta Riveros

2015-01-01

Full Text Available El impacto del género en los resultados empresariales es un tema de interés en el mundo académico y organizacional. Por lo anterior, el objetivo del presente artículo es determinar el impacto que se produce sobre los resultados empresariales derivado de la presencia de hombres y mujeres, en la propiedad y dirección de las empresas. Para este trabajo el diseño de investigación es no experimental – documental, con un tipo de estudio explicativo, la contrastación se realiza sobre dos paneles de empresas industriales chilenas, utilizando una fuente de información secundaria denominada Encuesta Nacional Industrial Anual (ENIA para el periodo 2001-2007. Con análisis descriptivos se descubrió que las empresas obtienen resultados similares, indiferente del género de los propietarios, a diferencia de la muestra de directivos donde se aprecia que las mujeres obtienen mejores resultados empresariales; asimismo aplicando técnicas de datos de panel, se descubre que el género del propietario impacta sobre los resultados obtenidos, siendo positiva en el caso de los hombres y negativa en el caso de las mujeres. Lo útil y novedoso de este estudio radica en que se aplica a un país en vías de desarrollo, debido a que la mayoría de este tipo de análisis aborda los países desarrollados.

Rotura Uterina Espontánea en embarazo de segundo trimestre: presentación de un caso y revisión de la literatura

Directory of Open Access Journals (Sweden)

Airam Amoroso

2013-09-01

Full Text Available La rotura uterina se define como la solución de continuidad de la pared uterina. Es una complicación obstétrica poco frecuente y potencialmente letal para la madre y el feto, que ocurre generalmente durante el segundo o tercer trimestre de gestación, y que está asociada principalmente a la cirugía uterina previa, constituyendo así un desafío médico por su difícil diagnóstico diferencial y controversial manejo. Se presenta el caso de una paciente de 26 años de edad, con rotura espontánea de útero grávido de 18 semanas de gestación y antecedente de cicatriz uterina. Se realiza laparotomía exploradora obteniendo como hallazgo placenta y cordón umbilical unido a feto sin vida en cavidad abdominal, lo que confirma diagnóstico intraoperatorio. Spontaneous Uterine Rupture in Second Trimester of Pregnancy: Case report and Literature review Abstract Uterine rupture is a solution of continuity of the uterine wall. It is an uncommon and potentially lethal obstetric complication, for both mother and fetus, that mainly occurs during the second or third trimester of pregnancy, and that is mainly associated to previous uterine surgery, thus forming a medical challenge for its difficult differential diagnosis and controversial management. We report the case of a 26 years old patient with a spontaneous gravid uterine rupture, 18 weeks of gestation and cesarean scar background. Laparotomy is conducted finding both placenta and umbilical cord attached to no-living fetus in the abdominal cavity, which confirms intraoperative diagnosis.

El salario emocional y su impacto en la cuenta de resultados

OpenAIRE

García Roldán, Tomás

2017-01-01

Trabajo Final de Máster que aborda la relación entre la gestión activa del salario emocional con el impacto en los resultados financieros de la compañía. También se analiza su implicación con otros factores que redundan en una mejor cuenta de resultados como es la posición como employer branding (atracción y fidelización del talento y, por tanto, del conocimiento tácito), la cultura organizativa o la función de responsabilidad social que trae consigo el salario emocional. Se incluye una encue...

Cambios en la dimensión de la vía aérea en pacientes con secuencia de Pierre-Robin asociada a síndromes malformativos tras distracción mandibular. Planificación del vector de distracción

Directory of Open Access Journals (Sweden)

Adoración Martínez Plaza

2015-04-01

Resultados y conclusiones: Analizando los resultados obtenidos, el vector de distracción horizontal en primer lugar y en segundo lugar el oblicuo son de elección por su repercusión positiva en la vía aérea.

Factores asociados con la intención de fumar y el inicio del hábito tabáquico en escolares: resultados del estudio ESFA en Barcelona

Directory of Open Access Journals (Sweden)

Nebot M.

2002-01-01

Full Text Available Objetivo: Describir los factores asociados con el consumo de tabaco y la intención de fumar en el futuro en una muestra representativa de escolares de primer curso de educación secundaria en Barcelona. Sujetos y métodos: Se seleccionaron 37 escuelas al azar para participar en la evaluación de un programa europeo de prevención del tabaquismo (European Smoking prevention Frame Approach, proyecto ESFA. En estas escuelas 1.041 alumnos de primer curso de Enseñanza Secundaria Obligatoria (ESO contestaron a un cuestionario diseñado por la Universidad de Maastricht para estudiar las actitudes y conductas relacionadas con diversos comportamientos, incluyendo el consumo de tabaco. Resultados: El 9,8% de los chicos y el 12,6% de las chicas manifestaron fumar de forma regular u ocasional. Entre los no fumadores, un 61,4% de los chicos y un 73,3% de las chicas declararon tener intención de fumar en el futuro. En los chicos, los determinantes del consumo son la norma social (odds ratio [OR] = 2,5; intervalo de confianza [IC] del 95%, 1,2-5,2, el consumo de tabaco por parte de los hermanos (OR = 2,4; IC del 95%, 1,1-5,2, las actitudes contrarias al consumo (OR = 0,3; IC del 95%, 0,1-0,6, la práctica de deporte en el tiempo libre (OR = 0,3; IC del 95%, 0,1-0,7 y el dinero semanal disponible (OR = 3,2; IC del 95%, 1,5-6,8, mientras que la intención únicamente se asoció de forma significativa a las actitudes contrarias (OR = 0,3; IC del 95%, 0,2-0,5. Para las chicas, el consumo se asoció a la presión (OR = 2,5; IC del 95%, 1,2-5,0 y el consumo (OR = 6,0; IC del 95%, 2,4-15,4 por parte de los amigos, y las actitudes contrarias (OR = 0,2; IC del 95%, 0,1-0,4, mientras que la intención se halla asociada a las actitudes contrarias (OR = 0,4; IC del 95%, 0,2-0,6 y pasar tiempo libre en la calle (OR = 2,1; IC del 95%, 1,3-3,5. Conclusiones: Los resultados corroboran la necesidad de abordar simultáneamente los distintos factores relacionados con el

Resultados del tratamiento con implantes dentales osteointegrados en la fase quirúrgica

Directory of Open Access Journals (Sweden)

Oviedo Pérez Pérez

Full Text Available Objetivo: evaluar los resultados del tratamiento con implantes dentales osteointegrados en la fase quirúrgica. Métodos: se realizó un estudio longitudinal y prospectivo en 802 pacientes en quienes se colocaron 2 165 implantes, en la Clínica Estomatológica Provincial Docente de Santiago de Cuba y la Facultad de Estomatología de La Habana en el decenio 20002009. Se evaluaron las variables: técnica quirúrgica, longitud y diámetro de los implantes, complicaciones intraoperatorias y complicaciones postoperatorias, los resultados del tratamiento se evaluaron en supervivencia y fracaso. Resultados: se logró la supervivencia de los implantes en 705 pacientes para el 87,9 % y se produjo el fracaso en 97 pacientes para el 12,1 %. Se colocaron 2 165 implantes, se logró efectividad de 2 055 para el 94,9 % y fracasaron 110 que representan el 5,08 %. No existen diferencias significativas de los resultados de acuerdo a la técnica quirúrgica empleada. Los implantes que más fracasaron fueron los de 10 mm, para el 34,9 % y 8 mm con el 13,1 %. La efectividad se incrementa a medida que aumenta el diámetro. En las complicaciones intraoperatorias el fracaso fue mayor en relación con la perforación de la tabla ósea con el 92,9 %, inestabilidad con el 86 % y la dehiscencia ósea con el 57,4 %. En el postoperatorio fue notable que en el 100 % de los casos con dolor existió fracaso de los implantes. Conclusiones: en la etapa quirúrgica existe una fuerte asociación de los resultados con la longitud, diámetro de los implantes y la presencia de complicaciones intraoperatorias y postoperatorias.

Human immunodeficiency virus uses tRNA(Lys,3) as primer for reverse transcription in HeLa-CD4+ cells

NARCIS (Netherlands)

Das, A. T.; Koken, S. E.; Essink, B. B.; van Wamel, J. L.; Berkhout, B.

1994-01-01

Significant amounts of different tRNA molecules are present in retroviral particles, but one specific tRNA species functions as primer in reverse transcription. It is generally believed that the HIV-1 virus uses the tRNA(Lys,3) molecule as primer. This is based on sequence complementarity between

Routes to effective evacuation planning primer series : evacuating populations with special needs.

Science.gov (United States)

2009-04-01

Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

2018-01-01

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

KAUST Repository

Hume, Benjamin C.C.

2018-05-23

The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

Science.gov (United States)

Rockne, Karl J; Strand, Stuart E

2003-09-01

Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

Rastreamento de resultados adversos nas internações do Sistema Único de Saúde

Directory of Open Access Journals (Sweden)

Monica Aguilar Estevam Dias

2012-08-01

Full Text Available OBJETIVO: Descrever a frequência de rastreadores de potenciais resultados adversos em internações no Sistema Único de Saúde. MÉTODOS: Estudo retrospectivo, incluindo as internações de adultos na clínica médica (n = 3.565.811 e clínica cirúrgica (n = 2.614.048 no Brasil em 2007. O Sistema de Informações Hospitalares foi utilizado como fonte de informação. A mensuração dos resultados adversos baseou-se no rastreamento de 11 condições clínicas, definidas em estudos internacionais anteriores, registradas no campo diagnóstico secundário. Foram realizadas análises bivariada e multivariada, no intuito de associar resultado adverso, óbito (variável dependente e outras variáveis como idade, utilização de unidade de terapia intensiva e realização de cirurgia. RESULTADOS: A frequência obtida foi 3,6 potenciais resultados adversos por 1.000 internações para ambas as clínicas, superior na clínica médica (5,3 por 1.000 em relação à clínica cirúrgica (1,3 por 1.000. Houve diferenças no perfil das internações: na clínica médica predominaram idosos, maior tempo médio de permanência, maior taxa de mortalidade e menor custo total de internação. O rastreador de resultado adverso mais frequente foi pneumonia hospitalar. Choque/parada cardíaca apresentou maior risco de óbito (OR = 5,76 em relação aos demais resultados adversos. Os maiores gastos com internações estiveram relacionados à sepse hospitalar. Os rastreadores de potencial resultado adverso apresentaram altas chances de óbito, mesmo com a introdução de variáveis como uso de terapia intensiva e realização de cirurgia. CONCLUSÕES: A alta frequência de resultados adversos em internações indica a necessidade de desenvolver estratégias de monitoramento e melhorias dirigidas para a segurança do paciente.

KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

Directory of Open Access Journals (Sweden)

Yuli Kurniawati

2015-05-01

Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

Science.gov (United States)

Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

2012-01-01

Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

Science.gov (United States)

Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

2015-01-01

The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae and Cross-Amplification in Related Mediterranean Species

Directory of Open Access Journals (Sweden)

Laura Navarro-Sampedro

2012-11-01

Full Text Available Twelve nuclear microsatellite primers (nSSR were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454 data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other Abies species from the Mediterranean Basin, and most of the loci showed higher polymorphisms in the Mediterranean species than in A. pinsapo. These microsatellite markers provide tools for conservation genetic studies in Abies pinsapo as well other Abies species from the Mediterranean Basin.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Transient Heat Transfer Model for Car Body Primer Curing

OpenAIRE

D. Zabala; N. Sánchez; J. Pinto

2010-01-01

A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

NARCIS (Netherlands)

Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

2004-01-01

Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

Science.gov (United States)

Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

2010-08-01

We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

Directory of Open Access Journals (Sweden)

Firuzbakht MM

2011-04-01

Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.

A finite element primer for beginners the basics

CERN Document Server

Zohdi, Tarek I

2014-01-01

The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

Transport phenomena in Newtonian fluids a concise primer

CERN Document Server

Olsson, Per

2013-01-01

This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

Neutralidade científica: aspectos éticos na obtenção de resultados

Directory of Open Access Journals (Sweden)

Duarte da Costa Aznar

2017-01-01

Full Text Available La neutralidad en relación con la comunidad científica y publicación de resultados es esencial, en vista de que toda teoría aplicada en las diversas áreas del conocimiento es generada por in- vestigaciones científicas. La manipulación o falsificación de resultados es una de las prácticas más condenables, ya que difunde datos falsos o incorrectos. Este estudio evaluó si la produc- ción científica y la obtención de resultados estuvieron pautadas en la ética y en el principio de neutralidad, a través de una revisión integradora de la literatura. Los resultados demostraron que en el 100 % de los tr abajos seleccionados existe mala conducta científica, y que esta ha au- mentado significativamente en todo el mundo, siendo difícil su identificación. Los motivos más comunes para la falsificación de datos fueron la búsqueda de reconocimiento y la competencia en el medio académico. Por lo tanto, una conducta responsable y ética de sociedades y comités científicos, y editores de periódicos se torna imprescindible en la credibilidad de los resultados encontrados en las investigaciones científicas.

An evaluation of corrosion protection by two epoxy primers on 2219-T87 and 7075-T73 aluminum

Science.gov (United States)

Mendrek, M. J.

1992-01-01

A comparison of the corrosion protection provided by two amine epoxy primers was made using salt fog, alternate immersion, and total immersion as exposure media. The study is the result of a request to use an unqualified low volatile organic carbon (VOC) primer (AKZO 463-6-78) in place of the current primer (AKZO 463-6-3) because environmental regulations have eliminated use of the current primer in many states. Primed, scribed samples of 2219-T87 and 7075-T73 aluminum were exposed to 5-percent NaCl salt fog and 3.5-percent NaCl alternate immersion for a period of 90 days. In addition, electrode samples immersed in 3.5-percent NaCl were tested using electrochemical impedance spectroscopy (EIS). The EG&G model 368 ac impedance measurement system was used to monitor changing properties of AKZO 463-6-78 and AKZO 463-6-3 primed 2219-T87 aluminum for a period of 30 days. The response of the corroding system of a frequency scan can be modeled in terms of an equivalent circuit consisting of resistors and capacitors in a specific arrangement. Each resistor/capacitor combination represents physical processes taking place within the electrolyte, at the electrolyte/primer surface, within the coating, and at the coating/substrate surface. Values for the resistors and capacitors are assigned following a nonlinear least squares fit of the data to the equivalent circuit. Changes in the values of equivalent circuit parameters during the 30-day exposure allow assessment of the time to and mechanism of coating breakdown.

Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

Directory of Open Access Journals (Sweden)

Irma Suriyani

2015-05-01

Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

Cuestionario de rasgos de personalidad obsesiva (CRPO): resultados preliminares

OpenAIRE

Vallejo Ruiloba, Julio; Marcos, Teodor; Salamero, Manel

1996-01-01

Se presentan los resultados preliminares del cuestionario de rasgos de personalidad obsesiva (CRPO) en tres muestras de población (pacientes obsesivos, pacientes depresivos con melancolía y controles sanos). cuestionario, de 31 ítems, ha demostrado ser útil y válido para discriminar el trastorno obsesivo-compulsivo personalidad.

Freqüência Cardíaca Fetal durante o Primeiro Trimestre da Gestação Fetal Heart Rate in the First Trimester of Pregnancy

Directory of Open Access Journals (Sweden)

Heverton Pettersen

2001-10-01

Full Text Available Objetivos: estabelecer curva de normalidade da freqüência cardíaca fetal (FCF entre a 10ª e a 14ª semana de gestação. Métodos: a FCF foi avaliada em 1078 fetos entre 10 e 14 semanas de gestação. Para uma melhor correlação da FCF com a idade gestacional, os fetos foram divididos em quatro grupos de acordo com a idade gestacional: Grupo I (10 semanas, Grupo II (11 semanas, Grupo III (12 semanas e Grupo IV (13 semanas. Por meio de corte sagital, o coração fetal foi visualizado e o registro da FCF foi realizado usando Modo-B e Modo-M em tempo real. Calculou-se a FCF média eletronicamente por meio da colocação dos cálipers que registravam 3 ciclos consecutivos. Resultados: a FCF variou entre 136 e 178 bpm entre os 1078 fetos estudados. Construiu-se uma curva de normalidade estabelecendo-se a mediana e os percentis 5 e 95 da FCF para cada grupo. No Grupo I a FCF variou de 158 a 184 bpm; no Grupo II, de 155 a 175 bpm; no Grupo III, de 152 a 172 bpm; no Grupo IV, de 149 a 168 bpm. Houve diminuição progressiva e significativa da FCF com o avanço da idade gestacional durante o período estudado. Conclusões: a avaliação da FCF no primeiro trimestre de gestação é um procedimento simples e que deve ser analisado não só na sua forma qualitativa (batimentos cardíacos fetais rítmicos mas também na sua forma quantitativa, já que trabalhos publicados mostram a sua relação com o prognóstico fetal.Purpose: to determine normal ranges for fetal heart rate (FHR between the 10th and 14th week of pregnancy. Methods: a total of 1078 fetuses within a crown-rump length (CRL from the 10th to the 14th week of pregnancy were evaluated. The fetuses were divided into 4 groups: Group I (10 weeks, Group II (11 weeks, Group III (12 weeks, Group IV (13 weeks. The fetal heart was seen using B-mode/M-mode at a sagital plane and FHR was recorded. FHR was electronically calculated using calipers within 3 consecutive cycles without fetal moveiments

Perfil cognitivo y prevalencia de depresión, desesperanza y riesgo suicida en jóvenes vinculados al primer nivel de formación en una escuela militar colombiana

Directory of Open Access Journals (Sweden)

Daniella Abello Luque

2016-01-01

Full Text Available Este estudio evaluó el perfil cognitivo y los niveles de desesperanza, depresión y riesgo suicida en un grupo de jóvenes vinculados al proceso de formación de una escuela militar colombiana. En total participaron 114 sujetos, militares regulares de primer año (MR-1A, que representan la totalidad de un contingente particular; todos ellos hombres, con edades entre los diecisiete y los veintidós años, provenientes de hogares ubicados en la región Caribe (41% y el centro del país (12%, sin ningún tipo de diagnóstico médico o mental relevante. Los resultados indican relaciones lineales y directamente promocionales entre todas las variables, con magnitudes significativas en lo referente a las relaciones depresión-desesperanza (rs= 0,295; ρ= 0,01 y depresión-riesgo suicida (rs= 0,478; ρ= 0,01, siendo esta ultima el reporte más elevado.

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

International Nuclear Information System (INIS)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-01-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

Directory of Open Access Journals (Sweden)

Esther Lantero

2017-07-01

Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

Energy Technology Data Exchange (ETDEWEB)

Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

2017-07-01

Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

Thinking in systems a primer

CERN Document Server

Meadows, Donella H

2008-01-01

In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

Peran Keluarga dalam Pengelolaan Kasus di Layanan Primer Melalui Five Family Oriented Questions

Directory of Open Access Journals (Sweden)

Retno Asti Werdhani

2017-04-01

Full Text Available Pengelolaan kasus di layanan primer dengan pendekatan kedokteran keluarga memperhatikan potensi keluarga sebagai sumber daya pendukung dan atau penghambat keberhasilan penatalaksanaan pasien. Penelitian ini bertujuan untuk melihat gambaran kasus di layanan primer dan persepsi keluarga mengenai pasien melalui five family oriented question (FFOQ. Pengambilan data dilakukan menggunakan kuesioner pada 162 pasien Puskesmas dan Klinik di DKI Jakarta pada tahun 2015–2016. Kuesioner terdiri atas karakteristik pasien dan 5 pertanyaan terbuka FFOQ. Analisis dilakukan secara kuantitatif dan kualitatif. Hasilnya menunjukkan sebagian besar kasus di layanan primer adalah penyakit non-infeksi (82,7% dengan proporsi usia terbanyak adalah >40 tahun (76,5%. Persepsi pasien dan keluarga tentang penyebab penyakit dan cara mengatasinya masih bervariasi. Orang tua, pasangan, dan anak merupakan anggota keluarga yang paling menguatirkan kondisi pasien. Sebanyak 71,6% responden merasa ada stresor dalam keluarganya. Sumber stresor bervariasi antara lain sosial ekonomi, keluarga, pekerjaan, dan diri sendiri. Dukungan kepada pasien berupa dukungan emosional dan finansial yang diberikan oleh anggota keluarga sesuai kemampuan masing-masing. Disimpulkan keluarga berperan sebagai faktor pendukung dan penghambat dalam pengelolaan kasus di layanan primer untuk menunjang pengelolaan lebih berorientasi kepada pasien dan keluarga. Kata Kunci: five family oriented question, keluarga, layanan primer     Family Acts in Cases Management In Primary Care through The Five Family Oriented Question   Abstract Family oriented in primary care sees family as supporting resources/inhibiting case management accomplishment. The aim of this study was describing cases in primary care and family perception of the patient through the five family oriented question (FFOQ. Interviews were conducted in 162 patients from public health centers and clinics in DKI Jakarta year 2015–2016. Data were

Gastrosquisis: resultados en una institución de tercer nivel

Directory of Open Access Journals (Sweden)

A.J. Machuca Vaca

2017-06-01

Conclusión: La gastrosquisis es un defecto de pared abdominal frecuente que debe tratarse por un equipo multidisciplinario en una hospital de tercer nivel de atención. Nuestros resultados son comparables con la literatura internacional.

RESULTADO DEL PROCESO EDUCATIVO: EL PAPEL DE LOS ESTILOS DE APRENDIZAJE Y LA PERSONALIDAD

Directory of Open Access Journals (Sweden)

M.ª del Valle Santos Álvarez

2015-01-01

Full Text Available En esta investigación se plantea el análisis del estilo de aprendizaje y la personalidad eficaz en una muestra de estudiantes universitarios y se analiza su posible asociación con las dimensiones de resultado del proceso educativo: rendimiento académico y satisfacción. Los resultados sugieren que el estilo predominante en los participantes es el reflexivo y que existen relaciones entre los distintos estilos. Se constata también que las dos dimensiones del resultado del proceso educativo (rendimiento académico y satisfacción mantienen relaciones de dependencia desiguales con las variables individuales consideradas en esta investigación (estilos de aprendizaje y personalidad eficaz. En concreto, en el estudio se subraya la relevancia de los estilos de aprendizaje en la determinación de los resultados académicos obtenidos por los alumnos universitarios. Asimismo, se comprueba que las variables de personalidad resultan factores relevantes en la explicación de la satisfacción del alumnado con el proceso educativo.

Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

Directory of Open Access Journals (Sweden)

Shrinivas Ashtekar

2016-01-01

Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

Towards a global antibiotic resistance surveillance system : a primer for a roadmap

NARCIS (Netherlands)

Grundmann, Hajo

The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future