WorldWideScience

Sample records for primer sets initially

  1. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  2. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  3. Initial data sets for the Schwarzschild spacetime

    International Nuclear Information System (INIS)

    Gomez-Lobo, Alfonso Garcia-Parrado; Kroon, Juan A. Valiente

    2007-01-01

    A characterization of initial data sets for the Schwarzschild spacetime is provided. This characterization is obtained by performing a 3+1 decomposition of a certain invariant characterization of the Schwarzschild spacetime given in terms of concomitants of the Weyl tensor. This procedure renders a set of necessary conditions--which can be written in terms of the electric and magnetic parts of the Weyl tensor and their concomitants--for an initial data set to be a Schwarzschild initial data set. Our approach also provides a formula for a static Killing initial data set candidate--a KID candidate. Sufficient conditions for an initial data set to be a Schwarzschild initial data set are obtained by supplementing the necessary conditions with the requirement that the initial data set possesses a stationary Killing initial data set of the form given by our KID candidate. Thus, we obtain an algorithmic procedure of checking whether a given initial data set is Schwarzschildean or not

  4. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  5. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  6. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  7. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  8. Test set for initial value problem solvers

    NARCIS (Netherlands)

    W.M. Lioen (Walter); J.J.B. de Swart (Jacques)

    1998-01-01

    textabstractThe CWI test set for IVP solvers presents a collection of Initial Value Problems to test solvers for implicit differential equations. This test set can both decrease the effort for the code developer to test his software in a reliable way, and cross the bridge between the application

  9. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  10. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  11. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  12. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  13. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  14. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  15. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  16. A primer on standards setting as it applies to surgical education and credentialing.

    Science.gov (United States)

    Cendan, Juan; Wier, Daryl; Behrns, Kevin

    2013-07-01

    Surgical technological advances in the past three decades have led to dramatic reductions in the morbidity associated with abdominal procedures and permanently altered the surgical practice landscape. Significant changes continue apace including surgical robotics, natural orifice-based surgery, and single-incision approaches. These disruptive technologies have on occasion been injurious to patients, and high-stakes assessment before adoption of new technologies would be reasonable. We reviewed the drivers for well-established psychometric techniques available for the standards-setting process. We present a series of examples that are relevant in the surgical domain including standards setting for knowledge and skills assessments. Defensible standards for knowledge and procedural skills will likely become part of surgical clinical practice. Understanding the methodology for determining standards should position the surgical community to assist in the process and lead within their clinical settings as standards are considered that may affect patient safety and physician credentialing.

  17. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  18. Comparing initial-data sets for binary black holes

    International Nuclear Information System (INIS)

    Pfeiffer, Harald P.; Cook, Gregory B.; Teukolsky, Saul A.

    2002-01-01

    We compare the results of constructing binary black hole initial data with three different decompositions of the constraint equations of general relativity. For each decomposition we compute the initial data using a superposition of two Kerr-Schild black holes to fix the freely specifiable data. We find that these initial-data sets differ significantly, with the ADM energy varying by as much as 5% of the total mass. We find that all initial-data sets currently used for evolutions might contain unphysical gravitational radiation of the order of several percent of the total mass. This is comparable to the amount of gravitational-wave energy observed during the evolved collision. More astrophysically realistic initial data will require more careful choices of the freely specifiable data and boundary conditions for both the metric and extrinsic curvature. However, we find that the choice of extrinsic curvature affects the resulting data sets more strongly than the choice of conformal metric

  19. Early visual cortex reflects initiation and maintenance of task set

    Science.gov (United States)

    Elkhetali, Abdurahman S.; Vaden, Ryan J.; Pool, Sean M.

    2014-01-01

    The human brain is able to process information flexibly, depending on a person's task. The mechanisms underlying this ability to initiate and maintain a task set are not well understood, but they are important for understanding the flexibility of human behavior and developing therapies for disorders involving attention. Here we investigate the differential roles of early visual cortical areas in initiating and maintaining a task set. Using functional Magnetic Resonance Imaging (fMRI), we characterized three different components of task set-related, but trial-independent activity in retinotopically mapped areas of early visual cortex, while human participants performed attention demanding visual or auditory tasks. These trial-independent effects reflected: (1) maintenance of attention over a long duration, (2) orienting to a cue, and (3) initiation of a task set. Participants performed tasks that differed in the modality of stimulus to be attended (auditory or visual) and in whether there was a simultaneous distractor (auditory only, visual only, or simultaneous auditory and visual). We found that patterns of trial-independent activity in early visual areas (V1, V2, V3, hV4) depend on attended modality, but not on stimuli. Further, different early visual areas play distinct roles in the initiation of a task set. In addition, activity associated with maintaining a task set tracks with a participant's behavior. These results show that trial-independent activity in early visual cortex reflects initiation and maintenance of a person's task set. PMID:25485712

  20. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  1. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  2. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  3. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  4. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  5. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  6. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  7. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    Science.gov (United States)

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  8. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, Petr; Sudová, Radka; Janoušková, Martina; Čtvrtlíková, Martina; Hejda, Martin; Pánková, Hana; Slavíková, Renata; Štajerová, Kateřina; Vosátka, Miroslav; Sýkorová, Zuzana

    2014-01-01

    Roč. 68, Jan 2014 (2014), s. 482-493 ISSN 0038-0717 R&D Projects: GA ČR GAP504/10/0781; GA ČR GAP504/10/1486; GA ČR(CZ) GAP505/11/1112 Institutional support: RVO:67985939 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  9. WHAT SETS THE INITIAL ROTATION RATES OF MASSIVE STARS?

    International Nuclear Information System (INIS)

    Rosen, Anna L.; Krumholz, Mark R.; Ramirez-Ruiz, Enrico

    2012-01-01

    The physical mechanisms that set the initial rotation rates in massive stars are a crucial unknown in current star formation theory. Observations of young, massive stars provide evidence that they form in a similar fashion to their low-mass counterparts. The magnetic coupling between a star and its accretion disk may be sufficient to spin down low-mass pre-main-sequence (PMS) stars to well below breakup at the end stage of their formation when the accretion rate is low. However, we show that these magnetic torques are insufficient to spin down massive PMS stars due to their short formation times and high accretion rates. We develop a model for the angular momentum evolution of stars over a wide range in mass, considering both magnetic and gravitational torques. We find that magnetic torques are unable to spin down either low-mass or high-mass stars during the main accretion phase, and that massive stars cannot be spun down significantly by magnetic torques during the end stage of their formation either. Spin-down occurs only if massive stars' disk lifetimes are substantially longer or their magnetic fields are much stronger than current observations suggest.

  10. Interprofessional oral health initiative in a nondental, American Indian setting.

    Science.gov (United States)

    Murphy, Kate L; Larsson, Laura S

    2017-12-01

    Tooth decay is the most common chronic childhood disease and American Indian (AI) children are at increased risk. Pediatric primary care providers are in an opportune position to reduce tooth decay. The purpose of this study was to integrate and evaluate a pediatric oral health project in an AI, pediatric primary care setting. The intervention set included caregiver education, caries risk assessment, and a same-day dental home referral. All caregiver/child dyads age birth to 5 years presenting to the pediatric clinic were eligible (n = 47). Most children (n = 35, 91.1%) were scored as high risk for caries development. Of those with first tooth eruption (n = 36), ten had healthy teeth (27.8%) and seven had seen a dentist in the past 3 months (19.4%). All others were referred to a dentist (n = 29) and 21 families (72.4%) completed the referral. In fewer than 5 min per appointment (x = 4.73 min), the primary care provider integrated oral health screening, education, and referral into the well-child visit. Oral health is part of total health, and thus should be incorporated into routine well-child visits. ©2017 American Association of Nurse Practitioners.

  11. The telephone effect: Overcoming initiation deficits in two settings.

    Science.gov (United States)

    Vickers, Kayci L; Keesler, Michael E; Williams, Kelli S; Charles, Jeremy Y; Hamilton, Roy H

    2018-04-19

    Disorders of motivation substantially impair an individual's ability to communicate with their families, therapists, and doctors. One method of overcoming initiation deficits is by utilizing the telephone effect, which is the ability for individuals with severe motivation deficits to communicate more readily when speaking on a telephone. However, little is available in the extant literature on how this effect works or how best to integrate this into patient care. This article aims to provide the first report of a proposed mechanism underlying the telephone effect and the first published procedures for eliciting this effect. This is largely a review article that also contains descriptions of clinical procedures for eliciting the telephone effect with 2 patient populations: acute inpatients following brain injury and dementia residents. A case vignette is also provided. We propose that the telephone effect is the result of an interaction between the patient and environment, and occurs because of Gibson's (1979) law of affordances. The use of this theory provides an explanation of the behaviors often observed when attempting to elicit this effect (i.e., disruption of the effect when using a cellular phone). Moreover, we argue that this can, and does, apply to social interactions as well. The telephone effect is an understudied phenomenon that provides a means of improving care for individuals with disorders of motivation. Future directions include systematic research into the telephone effect and further investigation of the mechanism underlying this effect. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  12. Digital breast tomosynthesis (DBT): initial experience in a clinical setting

    International Nuclear Information System (INIS)

    Skaane, Per; Gullien, Randi; Eben, Ellen B.; Haakenaasen, Unni; Naess Jebsen, Ingvild; Krager, Mona; Bjoerndal, Hilde; Ekseth, Ulrika; Jahr, Gunnar

    2012-01-01

    Background: Digital breast tomosynthesis (DBT) is a promising new technology. Some experimental clinical studies have shown positive results, but the future role and indications of this new technique, whether in a screening or clinical setting, need to be evaluated. Purpose: To compare digital mammography and DBT in a side-by-side feature analysis for cancer conspicuity, and to assess whether there is a potential additional value of DBT to standard state-of-the-art conventional imaging work-up with respect to detection of additional malignancies. Material and Methods: The study had ethics committee approval. A total of 129 women underwent 2D digital mammography including supplementary cone-down and magnification views and breast ultrasonography if indicated, as well as digital breast tomosynthesis. The indication for conventional imaging in the clinical setting included a palpable lump in 30 (23%), abnormal mammographic screening findings in 54 (42%), and surveillance in 45 (35%) of the women. The women were examined according to present guidelines, including spot-magnification views, ultrasonography, and needle biopsies, if indicated. The DBT examinations were interpreted several weeks after the conventional imaging without knowledge of the conventional imaging findings. In a later session, three radiologists performed a side-by-side feature analysis for cancer conspicuity in a sample of 50 cases. Results: State-of-the-art conventional imaging resulted in needle biopsy of 45 breasts, of which 20 lesions were benign and a total of 25 cancers were diagnosed. The remaining 84 women were dismissed with a normal/definitely benign finding and without indication for needle biopsy. The subsequent DBT interpretation found suspicious findings in four of these 84 women, and these four women had to be called back for repeated work-up with knowledge of the tomosynthesis findings. These delayed work-ups resulted in two cancers (increasing the cancer detection by 8%) and two

  13. The Role of Proprioception in the Sagittal Setting of Anticipatory Postural Adjustments During Gait Initiation

    OpenAIRE

    Pereira Marcelo P.; Pelicioni Paulo H. Silva; Gobbi Lilian T.B.

    2015-01-01

    Purpose. Previous studies have studied the role of proprioception on the setting of anticipatory postural adjustments (APA) during gait initiation. However, these studies did not investigate the role of proprioception in the sagittal APA setting. We aimed to investigate the role of proprioception manipulation to induce APA sagittal adaptations on gait initiation. Methods. Fourteen healthy adults performed gait initiation without, and with, vibration applied before movement onset, and during m...

  14. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  15. A Test Set for stiff Initial Value Problem Solvers in the open source software R: Package deTestSet

    NARCIS (Netherlands)

    Mazzia, F.; Cash, J.R.; Soetaert, K.

    2012-01-01

    In this paper we present the R package deTestSet that includes challenging test problems written as ordinary differential equations (ODEs), differential algebraic equations (DAEs) of index up to 3 and implicit differential equations (IDES). In addition it includes 6 new codes to solve initial value

  16. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  17. 75 FR 62686 - Health Information Technology: Revisions to Initial Set of Standards, Implementation...

    Science.gov (United States)

    2010-10-13

    ... Health Information Technology: Revisions to Initial Set of Standards, Implementation Specifications, and... Health Information Technology (ONC), Department of Health and Human Services. ACTION: Interim final rule... Coordinator for Health Information Technology, Attention: Steven Posnack, Hubert H. Humphrey Building, Suite...

  18. Core outcome sets in dermatology: report from the second meeting of the International Cochrane Skin Group Core Outcome Set Initiative.

    Science.gov (United States)

    Kottner, J; Jacobi, L; Hahnel, E; Alam, M; Balzer, K; Beeckman, D; Busard, C; Chalmers, J; Deckert, S; Eleftheriadou, V; Furlan, K; Horbach, S E R; Kirkham, J; Nast, A; Spuls, P; Thiboutot, D; Thorlacius, L; Weller, K; Williams, H C; Schmitt, J

    2018-04-01

    Results of clinical trials are the most important information source for generating external clinical evidence. The use of different outcomes across trials, which investigate similar interventions for similar patient groups, significantly limits the interpretation, comparability and clinical application of trial results. Core outcome sets (COSs) aim to overcome this limitation. A COS is an agreed standardized collection of outcomes that should be measured and reported in all clinical trials for a specific clinical condition. The Core Outcome Set Initiative within the Cochrane Skin Group (CSG-COUSIN) supports the development of core outcomes in dermatology. In the second CSG-COUSIN meeting held in 2017, 11 COS development groups working on skin diseases presented their current work. The presentations and discussions identified the following overarching methodological challenges for COS development in dermatology: it is not always easy to define the disease focus of a COS; the optimal method for outcome domain identification and level of detail needed to specify such domains is challenging to many; decision rules within Delphi surveys need to be improved; appropriate ways of patient involvement are not always clear. In addition, there appear to be outcome domains that may be relevant as potential core outcome domains for the majority of skin diseases. The close collaboration between methodologists in the Core Outcome Set Initiative and the international Cochrane Skin Group has major advantages for trialists, systematic reviewers and COS developers. © 2018 British Association of Dermatologists.

  19. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

    Directory of Open Access Journals (Sweden)

    Weiguo Hou

    2018-05-01

    Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  20. 75 FR 44589 - Health Information Technology: Initial Set of Standards, Implementation Specifications, and...

    Science.gov (United States)

    2010-07-28

    ... Part III Department of Health and Human Services 45 CFR Part 170 Health Information Technology... Secretary 45 CFR Part 170 RIN 0991-AB58 Health Information Technology: Initial Set of Standards... of the National Coordinator for Health Information Technology (ONC), Department of Health and Human...

  1. The Role of Proprioception in the Sagittal Setting of Anticipatory Postural Adjustments During Gait Initiation

    Directory of Open Access Journals (Sweden)

    Pereira Marcelo P.

    2015-12-01

    Full Text Available Purpose. Previous studies have studied the role of proprioception on the setting of anticipatory postural adjustments (APA during gait initiation. However, these studies did not investigate the role of proprioception in the sagittal APA setting. We aimed to investigate the role of proprioception manipulation to induce APA sagittal adaptations on gait initiation. Methods. Fourteen healthy adults performed gait initiation without, and with, vibration applied before movement onset, and during movement. In addition, the effects of two different vibration frequencies (80 and 120Hz were tested. Vibration was applied bilaterally on the tibialis anterior, rectus femoris and trapezius superior. The first step characteristics, ground reaction forces and CoP behaviour were assessed. Results. Vibration improved gait initiation performance regardless of the moment it was applied. CoP velocity during the initial phase of APA was increased by vibration only when it was applied before movement. When vibration was applied to disturb the movement, no effects on the CoP behaviour were observed. Manipulation of vibration frequency had no effects. Conclusions. Rather than proprioception manipulation, the results suggest that post-vibratory effects and attentional mechanisms were responsible for our results. Taken together, the results show that sagittal APA setting is robust to proprioception manipulation.

  2. Developing a service improvement initiative for people with learning disabilities in hospice settings.

    Science.gov (United States)

    Springall, Fiona

    2018-03-21

    People with learning disabilities are often marginalised in healthcare, including in hospice settings, and as a result may not receive effective end of life care. Research in hospice settings has identified that many staff lack confidence, skills and knowledge in caring for people with learning disabilities, which can have a negative effect on the care these individuals receive. To address these issues, the author has proposed a service improvement initiative, which she developed as part of her learning disability nursing degree programme. This proposed initiative aimed to enhance end of life care for people with learning disabilities through the implementation of a community learning disability link nurse in the hospice setting. ©2018 RCN Publishing Company Ltd. All rights reserved. Not to be copied, transmitted or recorded in any way, in whole or part, without prior permission of the publishers.

  3. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  4. Low Complexity Track Initialization from a Small Set of Non-Invertible Measurements

    Directory of Open Access Journals (Sweden)

    Wolfgang Koch

    2008-02-01

    Full Text Available Target tracking from non-invertible measurement sets, for example, incomplete spherical coordinates measured by asynchronous sensors in a sensor network, is a task of data fusion present in a lot of applications. Difficulties in tracking using extended Kalman filters lead to unstable behavior, mainly caused by poor initialization. Instead of using high complexity numerical batch-estimators, we offer an analytical approach to initialize the filter from a minimum number of observations. This directly pertains to multi-hypothesis tracking (MHT, where in the presence of clutter and/or multiple targets (i low complexity algorithms are desirable and (ii using a small set of measurements avoids the combinatorial explosion. Our approach uses no numerical optimization, simply evaluating several equations to find the state estimates. This is possible since we avoid an over-determined setup by initializing only from the minimum necessary subset of measurements. Loss in accuracy is minimized by choosing the best subset using an optimality criterion and incorporating the leftover measurements afterwards. Additionally, we provide the possibility to estimate only sub-sets of parameters, and to reliably model the resulting added uncertainties by the covariance matrix. We compare two different implementations, differing in the approximation of the posterior: linearizing the measurement equation as in the extended Kalman filter (EKF or employing the unscented transform (UT. The approach will be studied in two practical examples: 3D track initialization using bearingsonly measurements or using slant-range and azimuth only.

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Patterns of opioid initiation at first visits for pain in United States primary care settings.

    Science.gov (United States)

    Mundkur, Mallika L; Rough, Kathryn; Huybrechts, Krista F; Levin, Raisa; Gagne, Joshua J; Desai, Rishi J; Patorno, Elisabetta; Choudhry, Niteesh K; Bateman, Brian T

    2018-05-01

    The primary objective of this study was to characterize variation in patterns of opioid prescribing within primary care settings at first visits for pain, and to describe variation by condition, geography, and patient characteristics. 2014 healthcare utilization data from Optum's Clinformatics™ DataMart were used to evaluate individuals 18 years or older with an initial presentation to primary care for 1 of 10 common pain conditions. The main outcomes assessed were (1) the proportion of first visits for pain associated with an opioid prescription fill and (2) the proportion of opioid prescriptions with >7 days' supply. We identified 205 560 individuals who met inclusion criteria; 9.1% of all visits were associated with an opioid fill, ranging from 4.1% (headache) to 28.2% (dental pain). Approximately half (46%) of all opioid prescriptions supplied more than 7 days, and 10% of prescriptions supplied ≥30 days. We observed a 4-fold variation in rates of opioid initiation by state, with highest rates of prescribing in Alabama (16.6%) and lowest rates in New York (3.7%). In 2014, nearly half of all patients filling opioid prescriptions received more than 7 days' of opioids in an initial prescription. Policies limiting initial supplies have the potential to substantially impact opioid prescribing in the primary care setting. Copyright © 2017 John Wiley & Sons, Ltd.

  7. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  8. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  9. Conditional Probabilities in the Excursion Set Theory. Generic Barriers and non-Gaussian Initial Conditions

    CERN Document Server

    De Simone, Andrea; Riotto, Antonio

    2011-01-01

    The excursion set theory, where density perturbations evolve stochastically with the smoothing scale, provides a method for computing the dark matter halo mass function. The computation of the mass function is mapped into the so-called first-passage time problem in the presence of a moving barrier. The excursion set theory is also a powerful formalism to study other properties of dark matter halos such as halo bias, accretion rate, formation time, merging rate and the formation history of halos. This is achieved by computing conditional probabilities with non-trivial initial conditions, and the conditional two-barrier first-crossing rate. In this paper we use the recently-developed path integral formulation of the excursion set theory to calculate analytically these conditional probabilities in the presence of a generic moving barrier, including the one describing the ellipsoidal collapse, and for both Gaussian and non-Gaussian initial conditions. The non-Markovianity of the random walks induced by non-Gaussi...

  10. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  11. Building clinicians-researchers partnerships: lessons from diverse natural settings and practice-oriented initiatives.

    Science.gov (United States)

    Castonguay, Louis G; Youn, Soo Jeong; Xiao, Henry; Muran, J Christopher; Barber, Jacques P

    2015-01-01

    In this concluding paper, we identify the type of studies conducted by 11 teams of contributors to a special issue on building clinicians-researchers partnerships. Those studies were conducted across a variety of clinical settings. We also integrate the lessons that have emerged from their collaborative initiatives in terms of obstacles faced, strategies adopted to address these challenges, benefits gained, and general recommendations offered to facilitate studies conducted with or by clinicians. The paper ends with the authors' thoughts about the future success of practice-oriented research in general.

  12. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  13. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  14. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  15. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  16. Managing the clinical setting for best nursing practice: a brief overview of contemporary initiatives.

    Science.gov (United States)

    Henderson, Amanda; Winch, Sarah

    2008-01-01

    Leadership strategies are important in facilitating the nursing profession to reach their optimum standards in the practice environment. To compare and contrast the central tenets of contemporary quality initiatives that are commensurate with enabling the environment so that best practice can occur. Democratic leadership, accessible and relevant education and professional development, the incorporation of evidence into practice and the ability of facilities to be responsive to change are core considerations for the successful maintenance of practice standards that are consistent with best nursing practice. While different concerns of management drive the adoption of contemporary approaches, there are many similarities in the how these approaches are translated into action in the clinical setting. Managers should focus on core principles of professional nursing that add value to practice rather than business processes.

  17. California Breast Cancer Prevention Initiatives: Setting a research agenda for prevention.

    Science.gov (United States)

    Sutton, P; Kavanaugh-Lynch, M H E; Plumb, M; Yen, I H; Sarantis, H; Thomsen, C L; Campleman, S; Galpern, E; Dickenson, C; Woodruff, T J

    2015-07-01

    The environment is an underutilized pathway to breast cancer prevention. Current research approaches and funding streams related to breast cancer and the environment are unequal to the task at hand. We undertook the California Breast Cancer Prevention Initiatives, a four-year comprehensive effort to set a research agenda related to breast cancer, the environment, disparities and prevention. We identified 20 topics for Concept Proposals reflecting a life-course approach and the complex etiology of breast cancer; considering the environment as chemical, physical and socially constructed exposures that are experienced concurrently: at home, in the community and at work; and addressing how we should be modifying the world around us to promote a less carcinogenic environment. Redirecting breast cancer research toward prevention-oriented discovery could significantly reduce the incidence and associated disparities of the disease among future generations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Automated work packages architecture: An initial set of human factors and instrumentation and controls requirements

    Energy Technology Data Exchange (ETDEWEB)

    Agarwal, Vivek [Idaho National Lab. (INL), Idaho Falls, ID (United States); Oxstrand, Johanna H. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Le Blanc, Katya L. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2014-09-01

    The work management process in current fleets of national nuclear power plants is so highly dependent on large technical staffs and quality of work instruction, i.e., paper-based, that this puts nuclear energy at somewhat of a long-term economic disadvantage and increase the possibility of human errors. Technologies like mobile portable devices and computer-based procedures can play a key role in improving the plant work management process, thereby increasing productivity and decreasing cost. Automated work packages are a fundamentally an enabling technology for improving worker productivity and human performance in nuclear power plants work activities because virtually every plant work activity is accomplished using some form of a work package. As part of this year’s research effort, automated work packages architecture is identified and an initial set of requirements identified, that are essential and necessary for implementation of automated work packages in nuclear power plants.

  19. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  3. Systemic characterization and evaluation of particle packings as initial sets for discrete element simulations

    Science.gov (United States)

    Morfa, Carlos Recarey; Cortés, Lucía Argüelles; Farias, Márcio Muniz de; Morales, Irvin Pablo Pérez; Valera, Roberto Roselló; Oñate, Eugenio

    2018-07-01

    A methodology that comprises several characterization properties for particle packings is proposed in this paper. The methodology takes into account factors such as dimension and shape of particles, space occupation, homogeneity, connectivity and isotropy, among others. This classification and integration of several properties allows to carry out a characterization process to systemically evaluate the particle packings in order to guarantee the quality of the initial meshes in discrete element simulations, in both the micro- and the macroscales. Several new properties were created, and improvements in existing ones are presented. Properties from other disciplines were adapted to be used in the evaluation of particle systems. The methodology allows to easily characterize media at the level of the microscale (continuous geometries—steels, rocks microstructures, etc., and discrete geometries) and the macroscale. A global, systemic and integral system for characterizing and evaluating particle sets, based on fuzzy logic, is presented. Such system allows researchers to have a unique evaluation criterion based on the aim of their research. Examples of applications are shown.

  4. Systemic characterization and evaluation of particle packings as initial sets for discrete element simulations

    Science.gov (United States)

    Morfa, Carlos Recarey; Cortés, Lucía Argüelles; Farias, Márcio Muniz de; Morales, Irvin Pablo Pérez; Valera, Roberto Roselló; Oñate, Eugenio

    2017-10-01

    A methodology that comprises several characterization properties for particle packings is proposed in this paper. The methodology takes into account factors such as dimension and shape of particles, space occupation, homogeneity, connectivity and isotropy, among others. This classification and integration of several properties allows to carry out a characterization process to systemically evaluate the particle packings in order to guarantee the quality of the initial meshes in discrete element simulations, in both the micro- and the macroscales. Several new properties were created, and improvements in existing ones are presented. Properties from other disciplines were adapted to be used in the evaluation of particle systems. The methodology allows to easily characterize media at the level of the microscale (continuous geometries—steels, rocks microstructures, etc., and discrete geometries) and the macroscale. A global, systemic and integral system for characterizing and evaluating particle sets, based on fuzzy logic, is presented. Such system allows researchers to have a unique evaluation criterion based on the aim of their research. Examples of applications are shown.

  5. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  6. Fractal analysis on a classical hard-wall billiard with openings using a two-dimensional set of initial conditions

    International Nuclear Information System (INIS)

    Ree, Suhan

    2003-01-01

    Fractal analysis is performed to measure the chaoticity of a classical hard-wall billiard with openings. We use the circular billiard with a straight cut with two openings, and a two-dimensional (2D) set of initial conditions that produce all possible trajectories of a particle injected from one opening. We numerically compute the fractal dimension of singular points of the function that maps an initial condition to the number of collisions with the wall before the exit, using the box-counting algorithm that uses uniformly distributed points inside the 2D set of initial conditions. Finally, the classical chaotic properties are observed while the parameters of the billiard are varied, and the results are compared with those with the one-dimensional set of initial conditions

  7. Initial mechanical ventilator settings and lung protective ventilation in the ED.

    Science.gov (United States)

    Wilcox, Susan R; Richards, Jeremy B; Fisher, Daniel F; Sankoff, Jeffrey; Seigel, Todd A

    2016-08-01

    Mechanical ventilation with low tidal volumes has been shown to improve outcomes for patients both with and without acute respiratory distress syndrome. This study aims to characterize mechanically ventilated patients in the emergency department (ED), describe the initial ED ventilator settings, and assess for associations between lung protective ventilation strategies in the ED and outcomes. This was a multicenter, prospective, observational study of mechanical ventilation at 3 academic EDs. We defined lung protective ventilation as a tidal volume of less than or equal to 8 mL/kg of predicted body weight and compared outcomes for patients ventilated with lung protective vs non-lung protective ventilation, including inhospital mortality, ventilator days, intensive care unit length of stay, and hospital length of stay. Data from 433 patients were analyzed. Altered mental status without respiratory pathology was the most common reason for intubation, followed by trauma and respiratory failure. Two hundred sixty-one patients (60.3%) received lung protective ventilation, but most patients were ventilated with a low positive end-expiratory pressure, high fraction of inspired oxygen strategy. Patients were ventilated in the ED for a mean of 5 hours and 7 minutes but had few ventilator adjustments. Outcomes were not significantly different between patients receiving lung protective vs non-lung protective ventilation. Nearly 40% of ED patients were ventilated with non-lung protective ventilation as well as with low positive end-expiratory pressure and high fraction of inspired oxygen. Despite a mean ED ventilation time of more than 5 hours, few patients had adjustments made to their ventilators. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Evaluation of an Implementation Initiative for Embedding Dialectical Behavior Therapy in Community Settings

    Science.gov (United States)

    Herschell, Amy D.; Lindhiem, Oliver J.; Kogan, Jane N.; Celedonia, Karen L.; Stein, Bradley D.

    2014-01-01

    We examined the effectiveness of Dialectical Behavior Therapy (DBT) training in community-based agencies. Data were gathered at four time points over a two-year period from front-line mental health therapists (N = 64) from 10 community-based agencies that participated in a DBT implementation initiative. We examined change on therapist attitudes towards consumers with Borderline Personality Disorder (BPD), confidence in the effectiveness of DBT, and use of DBT model components. All measures were self-report. Participating in DBT training resulted in positive changes over time, including improved therapist attitudes toward consumers with BPD, improved confidence in the effectiveness of DBT, and increased use of DBT components. Therapists who had the lowest baseline scores on the study outcomes had the greatest self-reported positive change in outcomes over time. Moreover, there were notable positive correlations in therapist characteristics; therapists who had the lowest baseline attitudes towards individuals with BPD, confidence in the effectiveness of DBT, or who were least likely to use DBT modes and components were the therapists who had the greatest reported increase over time in each respective area. DBT training with ongoing support resulted in changes not commonly observed in standard training approaches typically used in community settings. It is encouraging to observe positive outcomes in therapist self-reported skill, perceived self-efficacy and DBT component use, all of which are important to evidence-based treatment (EBT) implementation. Our results underscore the importance to recognize and target therapist diversity of learning levels, experience, and expertise in EBT implementation. PMID:24333657

  9. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  10. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  11. Building the field of population health intervention research: The development and use of an initial set of competencies

    Directory of Open Access Journals (Sweden)

    Barbara Riley

    2015-01-01

    This initial set of competencies, released in 2013, may be used to develop graduate student curriculum, recruit trainees and faculty to academic institutions, plan non-degree professional development, and develop job descriptions for PHIR-related research and professional positions. The competencies provide some initial guideposts for the field and will need to be adapted as the PHIR field matures and to meet unique needs of different jurisdictions.

  12. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  13. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. EXTRA: a digital computer program for the solution of stiff sets of ordinary initial value, first order differential equations

    International Nuclear Information System (INIS)

    Sidell, J.

    1976-08-01

    EXTRA is a program written for the Winfrith KDF9 enabling the user to solve first order initial value differential equations. In this report general numerical integration methods are discussed with emphasis on their application to the solution of stiff sets of equations. A method of particular applicability to stiff sets of equations is described. This method is incorporated in the program EXTRA and full instructions for its use are given. A comparison with other methods of computation is included. (author)

  15. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  16. 75 FR 82397 - Medicaid Program: Initial Core Set of Health Quality Measures for Medicaid-Eligible Adults

    Science.gov (United States)

    2010-12-30

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Office of the Secretary [CMS-2420-NC] Medicaid Program: Initial Core Set of Health Quality Measures for Medicaid-Eligible Adults AGENCY: Office of the Secretary... quality measures recommended for Medicaid-eligible adults, as required by section 2701 of the Affordable...

  17. Employment and risk of injection drug use initiation among street involved youth in Canadian setting.

    Science.gov (United States)

    Richardson, Lindsey; DeBeck, Kora; Feng, Cindy; Kerr, Thomas; Wood, Evan

    2014-09-01

    Youth unemployment has been associated with labour market and health disparities. However, employment as a determinant of high-risk health behaviour among marginalized young people has not been well described. We sought to assess a potential relationship between employment status and initiation of intravenous drug use among a prospective cohort of street-involved youth. We followed injecting naïve youth in the At-Risk Youth Study, a cohort of street-involved youth aged 14-26 in Vancouver, Canada, and employed Cox regression analyses to examine whether employment was associated with injection initiation. Among 422 injecting naïve youth recruited between September 2005 and November 2011, 77 participants transitioned from non-injection to injection drug use, for an incidence density of 10.3 (95% confidence interval [CI]: 8.0-12.6) per 100 person years. Results demonstrating that employment was inversely associated with injection initiation (adjusted hazard ratio: 0.53; 95% CI: 0.33-0.85) were robust to adjustment for a range of potential confounders. A lack of employment among street-involved youth was associated with the initiation of injection drug use, a practice that predisposes individuals to serious long-term health consequences. Future research should examine if reducing barriers to labour market involvement among street-involved youth prevents transitions into high-risk drug use. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Reducing socioeconomic inequalities in COPD care in the hospital outpatient setting - A nationwide initiative

    DEFF Research Database (Denmark)

    Tøttenborg, Sandra Søgaard; Lange, Peter; Thomsen, Reimar W

    2017-01-01

    Objective: Socioeconomic differences in quality of care have been suggested to contribute to inequality in clinical prognosis of COPD. We examined socioeconomic differences in the quality of COPD outpatient care and the potential of a systematic quality improvement initiative in reducing potentia...

  19. Provider-initiated HIV testing in health care settings: Should it ...

    African Journals Online (AJOL)

    centered counselling? ... SAHARA-J: Journal of Social Aspects of HIV/AIDS ... To address the resource limitations of the PITC setting, WHO and CDC suggest that patient-provider interactions during PITC may need to focus on providing information ...

  20. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  1. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  2. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  3. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  4. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  5. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  6. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  7. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  8. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  9. Implementation of a Quality Improvement Initiative: Improved Congenital Muscular Torticollis Outcomes in a Large Hospital Setting.

    Science.gov (United States)

    Strenk, Mariann L; Kiger, Michelle; Hawke, Jesse L; Mischnick, Amy; Quatman-Yates, Catherine

    2017-06-01

    The American Physical Therapy Association (APTA) published a guideline for congenital muscular torticollis (CMT) in 2013. Our division adopted the guideline as the institutional practice standard and engaged in a quality improvement (QI) initiative to increase the percentage of patients who achieved resolution of CMT within 6 months of evaluation. The aims of this report are to describe the QI activities conducted to improve patient outcomes and discuss the results and implications for other institutions and patient populations. This was a quality improvement study. In alignment with the Chronic Care Model and Model of Improvement, an aim and operationally defined key outcome and process measures were established. Interventions were tested using Plan-Do-Study-Act cycles. A CMT registry was established to store and manage data extracted from the electronic record over the course of testing. Statistical process control charts were used to monitor progress over time. The QI initiative resulted in an increase in the percentage of patients who achieved full resolution of CMT within a 6-month episode of care from 42% to 61% over an 18-month period. Themes that emerged as key drivers of improvement included: (1) timely, optimal access to care, (2) effective audit and clinician feedback, and (3) accurate, timely documentation. The initiative took place at a single institution with a supportive culture and strong QI resources, which may limit direct translation of interventions and findings to other institutions and patient populations. Improvement science methodologies provided the tools and structure to improve division-wide workflow and increase consistency in the implementation of the APTA CMT guideline. In doing so, significant CMT population outcome improvements were achieved. © 2017 American Physical Therapy Association

  10. Public involvement in the priority setting activities of a wait time management initiative: a qualitative case study.

    Science.gov (United States)

    Bruni, Rebecca A; Laupacis, Andreas; Levinson, Wendy; Martin, Douglas K

    2007-11-16

    As no health system can afford to provide all possible services and treatments for the people it serves, each system must set priorities. Priority setting decision makers are increasingly involving the public in policy making. This study focuses on public engagement in a key priority setting context that plagues every health system around the world: wait list management. The purpose of this study is to describe and evaluate priority setting for the Ontario Wait Time Strategy, with special attention to public engagement. This study was conducted at the Ontario Wait Time Strategy in Ontario, Canada which is part of a Federal-Territorial-Provincial initiative to improve access and reduce wait times in five areas: cancer, cardiac, sight restoration, joint replacements, and diagnostic imaging. There were two sources of data: (1) over 25 documents (e.g. strategic planning reports, public updates), and (2) 28 one-on-one interviews with informants (e.g. OWTS participants, MOHLTC representatives, clinicians, patient advocates). Analysis used a modified thematic technique in three phases: open coding, axial coding, and evaluation. The Ontario Wait Time Strategy partially meets the four conditions of 'accountability for reasonableness'. The public was not directly involved in the priority setting activities of the Ontario Wait Time Strategy. Study participants identified both benefits (supporting the initiative, experts of the lived experience, a publicly funded system and sustainability of the healthcare system) and concerns (personal biases, lack of interest to be involved, time constraints, and level of technicality) for public involvement in the Ontario Wait Time Strategy. Additionally, the participants identified concern for the consequences (sustainability, cannibalism, and a class system) resulting from the Ontario Wait Times Strategy. We described and evaluated a wait time management initiative (the Ontario Wait Time Strategy) with special attention to public

  11. Public involvement in the priority setting activities of a wait time management initiative: a qualitative case study

    Directory of Open Access Journals (Sweden)

    Laupacis Andreas

    2007-11-01

    Full Text Available Abstract Background As no health system can afford to provide all possible services and treatments for the people it serves, each system must set priorities. Priority setting decision makers are increasingly involving the public in policy making. This study focuses on public engagement in a key priority setting context that plagues every health system around the world: wait list management. The purpose of this study is to describe and evaluate priority setting for the Ontario Wait Time Strategy, with special attention to public engagement. Methods This study was conducted at the Ontario Wait Time Strategy in Ontario, Canada which is part of a Federal-Territorial-Provincial initiative to improve access and reduce wait times in five areas: cancer, cardiac, sight restoration, joint replacements, and diagnostic imaging. There were two sources of data: (1 over 25 documents (e.g. strategic planning reports, public updates, and (2 28 one-on-one interviews with informants (e.g. OWTS participants, MOHLTC representatives, clinicians, patient advocates. Analysis used a modified thematic technique in three phases: open coding, axial coding, and evaluation. Results The Ontario Wait Time Strategy partially meets the four conditions of 'accountability for reasonableness'. The public was not directly involved in the priority setting activities of the Ontario Wait Time Strategy. Study participants identified both benefits (supporting the initiative, experts of the lived experience, a publicly funded system and sustainability of the healthcare system and concerns (personal biases, lack of interest to be involved, time constraints, and level of technicality for public involvement in the Ontario Wait Time Strategy. Additionally, the participants identified concern for the consequences (sustainability, cannibalism, and a class system resulting from the Ontario Wait Times Strategy. Conclusion We described and evaluated a wait time management initiative (the Ontario

  12. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  13. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  14. Initial verification of an induction heating set-up for injection molding

    DEFF Research Database (Denmark)

    Menotti, Stefano; Hansen, Hans Nørgaard; Bissacco, Giuliano

    2013-01-01

    Molding of thin and long parts by injection molding leads to special requirements for the mold in order to ensure proper filling and acceptable cycle time. This paper investigates the applicability of embedded induction heating for the improvement of the filling of thin long parts. The object...... selected for the investigation is a thin spiral. For the complete molding of the component, elevated mold temperatures are required. For this propose a new injection molding set-up was developed, which allows rapid heating of the cavity wall by an induction heating system. The temperature was measured...

  15. Testing initiatives increase rates of HIV diagnosis in primary care and community settings: an observational single-centre cohort study.

    Directory of Open Access Journals (Sweden)

    Prini Mahendran

    Full Text Available The primary objective was to examine trends in new HIV diagnoses in a UK area of high HIV prevalence between 2000 and 2012 with respect to site of diagnosis and stage of HIV infection.Single-centre observational cohort study.An outpatient HIV department in a secondary care UK hospital.1359 HIV-infected adults.Demographic information (age, gender, ethnicity, and sexual orientation, site of initial HIV diagnosis (Routine settings such as HIV/GUM clinics versus Non-Routine settings such as primary care and community venues, stage of HIV infection, CD4 count and seroconversion symptoms were collated for each participant.There was a significant increase in the proportion of new HIV diagnoses made in Non-Routine settings (from 27.0% in 2000 to 58.8% in 2012; p<0.001. Overall there was a decrease in the rate of late diagnosis from 50.7% to 32.9% (p=0.001. Diagnosis of recent infection increased from 23.0% to 47.1% (p=0.001. Of those with recent infection, significantly more patients were likely to report symptoms consistent with a seroconversion illness over the 13 years (17.6% to 65.0%; p<0.001.This is the first study, we believe, to demonstrate significant improvements in HIV diagnosis and a shift in diagnosis of HIV from HIV/GUM settings to primary practice and community settings due to multiple initiatives.

  16. Multi-voxel MR spectroscopic imaging of the brain: utility in clinical setting-initial results

    International Nuclear Information System (INIS)

    Parmar, Hemant; Lim, Tchoyoson C.C.; Yin Hong; Chua, Violet; Khin, Lay-Wai; Raidy, Tom; Hui, Francis

    2005-01-01

    Background and purpose: Compared to single voxel methods, MR spectroscopic imaging (MRSI) of the brain provides metabolic information with improved anatomical coverage and spectral resolution, but may be difficult to perform in the clinical setting. We evaluate the factors influencing spectral quality in MRSI using a semi-automated method, focussing on lipid contamination, and phase correction errors related to magnetic field inhomogeneity. Methods: We retrospectively analysed MRSI studies planned by radiologists and radiographers. Two-dimensional MRSI studies using point-resolved spectroscopy (PRESS) localisation, at long echo time (135 or 144 ms) were acquired on a 1.5 T scanner. Studies that contained lipid contamination and abnormally inverted spectra were reviewed and the latter correlated with anatomic location at the base of skull, and with the area of the region of interest (ROI) studied. Results: Of 128 consecutive MRSI studies, six showed abnormal inverted spectra, of which four were acquired at the base of skull. Multivariate logistic regression analysis showed that study location at the base of skull, but not larger ROI, was a significant predictor for the risk of being affected by inverted spectra (RR for base of skull: 11.76, 95% CI: 1.86-74.18, P = 0.009. RR for area of ROI: 3.68, 95% CI: 0.57-23.67, P = 0.170). Seven studies showed lipid contamination; all were in close proximity to the overlying scalp. Conclusion: Using a semi-automated acquisition and post-processing method, MRSI can be successfully applied in the clinical setting. However, care should be taken to avoid regions of high magnetic field inhomogeneity at the base of skull, and lipid contamination in voxels prescribed near the scalp

  17. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  18. Automatic localization of landmark sets in head CT images with regression forests for image registration initialization

    Science.gov (United States)

    Zhang, Dongqing; Liu, Yuan; Noble, Jack H.; Dawant, Benoit M.

    2016-03-01

    Cochlear Implants (CIs) are electrode arrays that are surgically inserted into the cochlea. Individual contacts stimulate frequency-mapped nerve endings thus replacing the natural electro-mechanical transduction mechanism. CIs are programmed post-operatively by audiologists but this is currently done using behavioral tests without imaging information that permits relating electrode position to inner ear anatomy. We have recently developed a series of image processing steps that permit the segmentation of the inner ear anatomy and the localization of individual contacts. We have proposed a new programming strategy that uses this information and we have shown in a study with 68 participants that 78% of long term recipients preferred the programming parameters determined with this new strategy. A limiting factor to the large scale evaluation and deployment of our technique is the amount of user interaction still required in some of the steps used in our sequence of image processing algorithms. One such step is the rough registration of an atlas to target volumes prior to the use of automated intensity-based algorithms when the target volumes have very different fields of view and orientations. In this paper we propose a solution to this problem. It relies on a random forest-based approach to automatically localize a series of landmarks. Our results obtained from 83 images with 132 registration tasks show that automatic initialization of an intensity-based algorithm proves to be a reliable technique to replace the manual step.

  19. Climate Variability and Oceanographic Settings Associated with Interannual Variability in the Initiation of Dinophysis acuminata Blooms

    Directory of Open Access Journals (Sweden)

    Henrick Berger

    2013-08-01

    Full Text Available In 2012, there were exceptional blooms of D. acuminata in early spring in what appeared to be a mesoscale event affecting Western Iberia and the Bay of Biscay. The objective of this work was to identify common climatic patterns to explain the observed anomalies in two important aquaculture sites, the Galician Rías Baixas (NW Spain and Arcachon Bay (SW France. Here, we examine climate variability through physical-biological couplings, Sea Surface Temperature (SST anomalies and time of initiation of the upwelling season and its intensity over several decades. In 2012, the mesoscale features common to the two sites were positive anomalies in SST and unusual wind patterns. These led to an atypical predominance of upwelling in winter in the Galician Rías, and increased haline stratification associated with a southward advection of the Gironde plume in Arcachon Bay. Both scenarios promoted an early phytoplankton growth season and increased stability that enhanced D. acuminata growth. Therefore, a common climate anomaly caused exceptional blooms of D. acuminata in two distant regions through different triggering mechanisms. These results increase our capability to predict intense diarrhetic shellfish poisoning outbreaks in the early spring from observations in the preceding winter.

  20. Pre-capacity building in loosely-coupled collaborations: Setting the stage for future initiatives

    Directory of Open Access Journals (Sweden)

    Cheryl A. Hyde

    2012-08-01

    Full Text Available This article examines the benefits and limitations of ‘loosely-coupled’ research collaborations between university faculty and 12 grassroots community-based organisations (CBOs. The authors assert that community-based research projects that develop the knowledge base within CBOs, and can be described as ‘pre-capacity building’ work, can be an important stepping stone to the subsequent development of more formal and strategic capacity-building partnership ventures. However, such projects must be approached carefully with a clear understanding of the ‘threshold dimensions’ that must be met before proceeding with any collaboration. Written as a cautionary tale, the authors identify some of the problems that arise when the threshold stage is poorly executed, and more generally speak to the dangers of initiating even loosely-coupled collaborations in the absence of an explicit and well-established campus commitment to and support for community engagement and partnerships. Keywords: Community capacity-building, community-university partnerships, community research, collaboration

  1. Mathematical modeling of vibration processes in reinforced concrete structures for setting up crack initiation monitoring

    Science.gov (United States)

    Bykov, A. A.; Matveenko, B. P.; Serovaev, G. S.; Shardakov, I. N.; Shestakov, A. P.

    2015-03-01

    The contemporary construction industry is based on the use of reinforced concrete structures, but emergency situations resulting in fracture can arise in their exploitation. In a majority of cases, reinforced concrete fracture is realized as the process of crack formation and development. As a rule, the appearance of the first cracks does not lead to the complete loss of the carrying capacity but is a fracture precursor. One method for ensuring the safe operation of building structures is based on crack initiation monitoring. A vibration method for the monitoring of reinforced concrete structures is justified in this paper. An example of a reinforced concrete beam is used to consider all stages related to the analysis of the behavior of natural frequencies in the development of a crack-shaped defect and the use of the obtained numerical results for the vibration test method. The efficiency of the method is illustrated by the results of modeling of the physical part of the method related to the analysis of the natural frequency evolution as a response to the impact action in the crack development process.

  2. Do law enforcement interactions reduce the initiation of injection drug use? An investigation in three North American settings.

    Science.gov (United States)

    Melo, J S; Garfein, R S; Hayashi, K; Milloy, M J; DeBeck, K; Sun, S; Jain, S; Strathdee, S A; Werb, D

    2018-01-01

    The prevention of drug injecting is often cited as a justification for the deployment of law enforcement and for the continuation of drug criminalization policies. We sought to characterize the impact of law enforcement interactions on the risk that people who inject drugs (PWID) report assisting others with injection initiation in three North American countries. Cross-sectional data from PWID participating in cohort studies in three cities (San Diego, USA; Tijuana, Mexico; Vancouver, Canada) were pooled (August 2014-December 2016). The dependent variable was defined as recently (i.e., past six months) providing injection initiation assistance; the primary independent variable was the frequency of recent law enforcement interactions, defined categorically (0 vs. 1 vs. 2-5 vs. ≥6). We employed multivariable logistic regression analyses to assess this relationship while controlling for potential confounders. Among 2122 participants, 87 (4.1%) reported recently providing injection initiation assistance, and 802 (37.8%) reported recent law enforcement interactions. Reporting either one or more than five recent interactions with law enforcement was not significantly associated with injection initiation assistance. Reporting 2-5 law enforcement interactions was associated with initiation assistance (Adjusted Odds Ratio=1.74, 95% Confidence Interval: 1.01-3.02). Reporting interactions with law enforcement was not associated with a reduced likelihood that PWID reported initiating others into injection drug use. Instead, we identified a positive association between reporting law enforcement interactions and injection initiation assistance among PWID in multiple settings. These findings raise concerns regarding the effectiveness of drug law enforcement to deter injection drug use initiation. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  4. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  6. Development and initial feasibility of an organizational measure of behavioral health integration in medical care settings.

    Science.gov (United States)

    McGovern, Mark P; Urada, Darren; Lambert-Harris, Chantal; Sullivan, Steven T; Mazade, Noel A

    2012-12-01

    In the advent of health care reform, models are sought to integrate behavioral health and routine medical care services. Historically, the behavioral health specialty has not itself been integrated, but instead bifurcated by substance use and mental health across treatment systems, care providers and even research. With the present opportunity to transform the health care delivery system, it is incumbent upon policymakers, researchers and clinicians to avoid repeating this historical error, and provide integrated behavioral health services in medical contexts. An organizational measure designed to assess this capacity is described: the Dual Diagnosis Capability in Health Care Settings (DDCHCS). The DDCHCS was used to assess a sample of federally-qualified health centers (N=13) on the degree of behavioral health integration. The measure was found to be feasible and sensitive to detecting variation in integrated behavioral health services capacity. Three of the 13 agencies were dual diagnosis capable, with significant variation in DDCHCS dimensions measuring staffing, treatment practices and program milieu. In general, mental health services were more integrated than substance use. Future research should consider a revised version of the measure, a larger and more representative sample, and linking organizational capacity with patient outcomes. Copyright © 2012. Published by Elsevier Inc.

  7. Analysis of Internet Usage Among Cancer Patients in a County Hospital Setting: A Quality Improvement Initiative

    Science.gov (United States)

    Lilley, Lisa; Lodrigues, William; Dreadin-Pulliam, Julie; Xie, Xian-Jin; Mathur, Sakshi; Rao, Madhu; Harvey, Valorie; Leitch, Ann Marilyn; Rao, Roshni

    2014-01-01

    Background Cancer is one of the most common diseases that patients research on the Internet. The Commission on Cancer (CoC) recommended that Parkland Memorial Hospital (PMH) improve the oncology services website. PMH is Dallas County’s public health care facility, serving a largely uninsured, minority population. Most research regarding patient Internet use has been conducted in insured, Caucasian populations, raising concerns that the needs of PMH patients may not be extrapolated from available data. The PMH Cancer Committee, therefore, adopted a quality improvement initiative to understand patients’ Internet usage. Objective The objective of the study was to obtain and analyze data regarding patients’ Internet usage in order to make targeted improvements to the oncology services section of the institutional website. Methods A task force developed an 11-question survey to ascertain what proportion of our patients have Internet access and use the Internet to obtain medical information as well as determine the specific information sought. Between April 2011 and August 2011, 300 surveys were administered to newly diagnosed cancer patients. Multivariate analyses were performed. Results Of 300 surveys, 291 were included. Minorities, primarily African-American and Hispanic, represented 78.0% (227/291) of patients. Only 37.1% (108/291) of patients had Internet access, most (256/291, 87.9%) having access at home. Younger patients more commonly had Internet access, with a mean age of 47 versus 58 years for those without (PInternet research was to develop questions for discussion with one’s physician. Patients most frequently sought information regarding cancer treatment options, outcomes, and side effects. Conclusions Less than one-half of PMH oncology patients have Internet access. This is influenced by age, educational level, and ethnicity. Those with access use it to obtain information related to their cancer diagnosis. The most effective way of addressing our

  8. Family planning in a rural setting in Uganda, the USHAPE initiative.

    Science.gov (United States)

    Clark, Emily; Goodhart, Clare

    2016-01-01

    The total fertility rate in Uganda is 5.9 children per woman, and women admit to having nearly two more children than they actually want. The maternal mortality rate remains stubbornly high. Family planning saves lives. It prevents maternal deaths by delaying motherhood, helping women limit their family size and avoid unwanted pregnancies. It also reduces infant mortality. USHAPE (Ugandan Sexual Health and Pastoral Education) is an initiative run in conjunction with the Royal College of General Practitioners in south-west Uganda. USHAPE aims to disseminate positive messages about modern contraception in an attempt to dispel fears and misconceptions and address the high rate of unmet need. The aim was to determine the rate of unmet need for family planning among women of reproductive age in the population local of Kisiizi hospital and to use the successful USHAPE model to train health workers to address this need. 100 patients were screened in the outpatient department to determine the level of unmet need by asking 2 questions. Level 1 training aims enhance every staff member's knowledge, so that the responsibility for family planning is adopted by the whole institution. Level 2 trains clinicians to become full family planning providers, with the necessary communication, educational and practical skills. The screening for unmet need for contraception revealed that 51% have an unmet need, which is higher than the national average of 38%. Sixty-eight members of staff at Kisiizi trained to a basic level and a further 32 staff have been trained to Level 2 higher level. The USHAPE approach has begun to tackle some of the barriers to accessing family planning, but there are further areas which need development. Our cascade model of training, involves training Ugandan USHAPE trainers with the aim of future scale up and long-term development.

  9. Early initiation of night-time NIV in an outpatient setting: a randomized non-inferiority study in ALS patients.

    Science.gov (United States)

    Bertella, Enrica; Banfi, Paolo; Paneroni, Mara; Grilli, Silvia; Bianchi, Luca; Volpato, Eleonora; Vitacca, Michele

    2017-12-01

    In patients with amyotrophic lateral sclerosis (ALS), non-invasive ventilation (NIV) is usually initiated in an in-hospital regime. We investigated if NIV initiated in an outpatient setting can be as effective in terms of patients' acceptance/adherence. We also evaluated factors predicting NIV acceptance and adherence and disease progression. Prospective randomized study. Outpatient versus inpatient rehabilitation. ALS patients. ALS patients were randomized to two groups for NIV initiation: outpatients versus inpatients. At baseline (T0), end of NIV trial program (T1) and after 3 months from T1 (T2), respiratory function tests, blood gas analysis, and sleep study were performed. At T1, we assessed: NIV acceptance (>4 h/night), and dyspnea symptoms (day/night) by Visual analogue scale (VAS), staff and patients' experience (how difficult NIV was to accept, how difficult ventilator was to manage, satisfaction); at T2: NIV adherence (>120 h/month) and patients' experience. Fifty patients participated. There were no differences in acceptance failure (P=0.733) or adherence failure (P=0.529). At T1, outpatients had longer hours of nocturnal ventilation (PNIV acceptance/adherence failure. There were no between-group differences in progression of respiratory impairment, symptoms and sleep quality. Early outpatient initiation of NIV in ALS is as effective as inpatient initiation.

  10. Setting ART initiation targets in response to changing guidelines: The importance of addressing both steady-state and backlog.

    Science.gov (United States)

    Martin, Catherine; Naidoo, Nicolette P; Venter, W D Francois; Jaffer, Ambereen; Barker, Pierre M

    2014-05-12

    Target setting is useful in planning, assessing and improving antiretroviral treatment (ART) programmes. In the past 4 years, the ART initiation environment has been transformed due to the change in eligibility criteria (starting ART at a CD4+ count ART. To describe and illustrate the use of a target-setting model for estimating district-based targets in the era of an expanding ART programme and changing CD4+ count thresholds for ART initiation. Using previously described models and data for annual new HIV infections, we estimated both steady-state need for ART initiation and backlog in a North West Province district, accounting for the shift in eligibility. Comparison of actual v. targeted ART initiations was undertaken. The change in CD4+ count threshold adds a once-off group of newly eligible patients to the pool requiring ART - the backlog. The steady-state remains unchanged as it is determined by the annual rate of new HIV infections in previous years. The steady-state need for the district was 639 initiations/month, and the backlog was ~15,388 patients. After the shift in eligibility in September 2011, the steady-state target was exceeded over several months with some backlog addressed. Of the total backlog for this district, 72% remains to be cleared. South Africa has two pools of patients who need ART: the steady-state of HIV-infected patients entering the programme each year, determined by historical infection rates; and the backlog created by the shift in eligibility. The healthcare system needs to build long- term capacity to meet the steady-state need for ART and additional capacity to address the backlog.

  11. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  12. Building the field of population health intervention research: The development and use of an initial set of competencies.

    Science.gov (United States)

    Riley, Barbara; Harvey, Jean; Di Ruggiero, Erica; Potvin, Louise

    2015-01-01

    Population health intervention research (PHIR) is a relatively new research field that studies interventions that can improve health and health equity at a population level. Competencies are one way to give legitimacy and definition to a field. An initial set of PHIR competencies was developed with leadership from a multi-sector group in Canada. This paper describes the development process for these competencies and their possible uses. Methods to develop the competencies included key informant interviews; a targeted review of scientific and gray literature; a 2-round, online adapted Delphi study with a 24-member panel; and a focus group with 9 international PHIR experts. The resulting competencies consist of 25 items grouped into 6 categories. They include principles of good science applicable though not exclusive to PHIR, and more suitable for PHIR teams rather than individuals. This initial set of competencies, released in 2013, may be used to develop graduate student curriculum, recruit trainees and faculty to academic institutions, plan non-degree professional development, and develop job descriptions for PHIR-related research and professional positions. The competencies provide some initial guideposts for the field and will need to be adapted as the PHIR field matures and to meet unique needs of different jurisdictions.

  13. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  14. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  15. Effect of Initiation Time of Hydrostatic Pressure Shock on Chromosome Set Doubling of Tetraploidization in Turbot Scophthalmus maximus.

    Science.gov (United States)

    Zhu, Xiangping; Lin, Zhengmei; Wu, Zhihao; Li, Jiandong; You, Feng

    2017-10-01

    The objective of the study was to clarify the effects of initiation time on chromosome set doubling induced by hydrostatic pressure shock through nuclear phase fluorescent microscopy in turbot Scophthalmus maximus. The ratio of developmentally delayed embryo and chromosome counting was used to assess induction efficiency. For the embryos subjected to a pressure of 67.5 MPa for 6 min at prometaphase (A group), chromosomes recovered to the pre-treatment condition after 11-min recovering. The first nuclear division and cytokinesis proceeded normally. During the second cell cycle, chromosomes did not enter into metaphase after prometaphase, but spread around for about 13 min, then assembled together and formed a large nucleus without anaphase separation; the second nuclear division and cytokinesis was inhibited. The ratio of developmentally delayed embryo showed that the second mitosis of 78% A group embryo was inhibited. The result of chromosome counting showed that the tetraploidization rate of A group was 72%. For the embryos subjected to a pressure of 67.5 MPa for 6 min at anaphase (B group), chromosomes recovered to the pre-treatment condition after about 31-min recovering. Afterwards, one telophase nucleus formed without anaphase separation; the first nuclear division was inhibited. The time of the first cleavage furrow occurrence of B group embryos delayed 27 min compared with that of A group embryos. With the first cytokinesis proceeding normally, 81.3% B group embryos were at two-cell stage around the middle of the second cell cycle after treatment. Those embryos were one of the two blastomeres containing DNA and the other without DNA. The first nuclear division of those embryos was inhibited. During the third cell cycle after treatment, 65.2% of those abovementioned embryos were at four-cell stage, cytokinesis occurred in both blastomeres, and nuclear division only occurred in the blastomere containing DNA. Of those abovementioned embryos, 14.0% were at

  16. Incidence of WHO stage 3 and 4 conditions following initiation of anti-retroviral therapy in resource limited settings.

    Directory of Open Access Journals (Sweden)

    Andrea J Curtis

    Full Text Available OBJECTIVES: To determine the incidence of WHO clinical stage 3 and 4 conditions during early anti-retroviral therapy (ART in resource limited settings (RLS. DESIGN/SETTING: A descriptive analysis of routine program data collected prospectively from 25 Médecins Sans Frontières supported HIV treatment programs in eight countries between 2002 and 2010. SUBJECTS/PARTICIPANTS: 35,349 study participants with median follow-up on ART of 1.33 years (IQR 0.51-2.41. OUTCOME MEASURES: Incidence in 100 person-years of WHO stage 3 or 4 conditions during 5 periods after ART initiation. Diagnoses of conditions were made according to WHO criteria and relied upon clinical assessments supported by basic laboratory investigations. RESULTS: The incidence of any WHO clinical stage 3 or 4 condition over 3 years was 40.02 per 100 person-years (31.77 for stage 3 and 8.25 for stage 4. The incidence of stage 3 and 4 conditions fell by over 97% between months 0-3 and months 25-36 (77.81 to 2.40 for stage 3 and 28.70 to 0.64 for stage 4. During months 0-3 pulmonary tuberculosis was the most common condition diagnosed in adults (incidence 22.24 per 100 person-years and children aged 5-14 years (25.76 and oral candidiasis was the most common in children <5 years (25.79. Overall incidences were higher in Africa compared with Asia (43.98 versus 12.97 for stage 3 and 8.98 versus 7.05 for stage 4 conditions, p<0.001. Pulmonary tuberculosis, weight loss, oral and oesophageal candidiasis, chronic diarrhoea, HIV wasting syndrome and severe bacterial infections were more common in Africa. Extra-pulmonary tuberculosis, non-tuberculous mycobacterial infection, cryptococcosis, penicilliosis and toxoplasmosis were more common in Asia. CONCLUSIONS: The incidence of WHO stage 3 and 4 conditions during the early period after ART initiation in RLS is high, but greatly reduces over time. This is likely due to both the benefits of ART and deaths of the sickest patients occurring shortly

  17. 2017 European guideline for the screening, prevention and initial management of hepatitis B and C infections in sexual health settings.

    Science.gov (United States)

    Brook, Gary; Brockmeyer, Norbert; van de Laar, Thijs; Schellberg, Sven; Winter, Andrew J

    2018-01-01

    This guideline updates the 2010 European guideline for the management of hepatitis B and C virus infections. It is primarily intended to provide advice on testing, prevention and initial management of viral hepatitis B and C for clinicians working in sexual health clinical settings in European countries. The guideline is in a new question and answer format based on clinical situations, from which population/intervention/comparison/outcome questions were formulated. Updates cover areas such as epidemiology, point-of-care tests for hepatitis B, hepatitis C risk and 'chemsex', and HIV pre-exposure prophylaxis and hepatitis B. We have also included a short paragraph on hepatitis E noting there is no evidence for sexual transmission. The guideline has been prepared in accordance with the Europe protocol for production available at http://www.iusti.org/regions/europe/pdf/2017/ProtocolForProduction2017.pdf.

  18. Evaluation of Shear Strength of RC Beams with Multiple Interfaces Formed before Initial Setting Using 3D Printing Technology

    Directory of Open Access Journals (Sweden)

    Kyeongjin Kim

    2017-11-01

    Full Text Available With the recent development of 3D printing technology, concrete materials are sometimes used in 3D printing. Concrete structures based on 3D printing have been characterized to have the form of multiple layer build-up. Unlike general concrete structures, therefore, the 3D-printed concrete can be regarded as an orthotropic material. The material property of the 3D-printed concrete’s interface between layers is expected to be far different from that of general concrete bodies since there are no aggregate interlocks and weak chemical bonding. Such a difference finally affects the structural performance of concrete structures even though the interfaces are formed before initial setting of the concrete. The current study mainly reviewed the changes in fracture energy (toughness with respect to various environmental conditions of such interface. Changes in fracture energies of interfaces between concrete layers were measured using low-speed Crack Mouth Opening Displacement (CMOD closed loop concrete fracture test. The experimental results indicated reduction in fracture energy as well as tensile strengths. To improve the tensile strength of interfaces, the use of bridging materials is suggested. Since it was assumed that reduction in fracture energy could be a cause of shear strength, to evaluate the reduced structural performance of concrete structure constructed with multiple interfaces by 3D printing technology, the shear strength of RC beam by 3D printing technology was predicted and compared with that of plain RC beam. Based on the fracture energy measured in this study, Modified Compression Field Theory (MCFT theory-applied Vector 2 program was employed to predict the degree of reduction in shear strength without considering stirrups. Reduction factors were presented based on the obtained results to predict the reduction in shear strength due to interfaces before initial setting of the concrete.

  19. Ultrasound-guided Breast Biopsy in the Resource-limited Setting: An Initial Experience in Rural Uganda

    Directory of Open Access Journals (Sweden)

    Christopher R. Stark

    2017-06-01

    Full Text Available Purpose: To describe the methodology and initial experience behind creation of an ultrasoundguided percutaneous breast core biopsy program in rural Uganda. Methods and Materials: Imaging the World Africa (ITWA is the registered non-governmental organization division of Imaging the World (ITW, a not-for-profit organization whose primary aim is the integration of affordable high-quality ultrasound into rural health centers. In 2013, ITWA began the pilot phase of an IRB-approved breast care protocol at a rural health center in Uganda. As part of the protocol’s diagnostic arm, an ultrasound-guided percutaneous breast core biopsy training curriculum was implemented in tandem with creation of regionally supplied biopsy kits. Results: A surgeon at a rural regional referral hospital was successfully trained and certified to perform ultrasound-guided percutaneous breast core biopsies. Affordable and safe biopsy kits were created using locally available medical supplies with the cost of each kit totaling $10.62 USD. Conclusion: Successful implementation of an ultrasound-guided percutaneous breast core biopsy program in the resource-limited setting is possible and can be made sustainable through incorporation of local health care personnel and regionally supplied biopsy materials. Our hope is that ITWA’s initial experience in rural Uganda can serve as a model for similar programs in the future.

  20. An historical document analysis of the introduction of the Baby Friendly Hospital Initiative into the Australian setting.

    Science.gov (United States)

    Atchan, Marjorie; Davis, Deborah; Foureur, Maralyn

    2017-02-01

    Breastfeeding has many known benefits yet its support across Australian health systems was suboptimal throughout the 20th Century. The World Health Organization launched a global health promotion strategy to help create a 'breastfeeding culture'. Research on the programme has revealed multiple barriers since implementation. To analyse the sociopolitical challenges associated with implementing a global programme into a national setting via an examination of the influences on the early period of implementation of the Baby Friendly Hospital Initiative in Australia. A focused historical document analysis was attended as part of an instrumental case study. A purposeful sampling strategy obtained a comprehensive sample of public and private documents related to the introduction of the BFHI in Australia. Analysis was informed by a 'documents as commentary' approach to gain insight into individual and collective social practices not otherwise observable. Four major themes were identified: "a breastfeeding culture"; "resource implications"; "ambivalent support for breastfeeding and the BFHI" and "business versus advocacy". "A breastfeeding culture" included several subthemes. No tangible support for breastfeeding generally, or the Baby Friendly Hospital Initiative specifically, was identified. Australian policy did not follow international recommendations. There were no financial or policy incentives for BFHI implementation. Key stakeholders' decisions negatively impacted on the Baby Friendly Hospital Initiative at a crucial time in its implementation in Australia. The potential impact of the programme was not realised, representing a missed opportunity to establish and provide sustainable standardised breastfeeding support to Australian women and their families. Copyright © 2016 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  1. PPDS compas-primer

    International Nuclear Information System (INIS)

    Alekhin, S.I.; Bazeeva, V.V.; Grudtsin, S.N.

    1987-01-01

    Catalogue of IHEP data bases on particle physics (PPDS) and short guide for unexperienced user are presented. All data bases are under common data base management system and include bibliographic and factographic ones. Binary search and set of applied programs controlling input and formatting output make using of system easy and convenient. Basic programs are developed in FORTRAN

  2. A Primer of Existentialism.

    Science.gov (United States)

    Bigelow, Gordon E.

    1961-01-01

    Although no set of principles can apply uniformly to all existentialists, certain basic characteristics of existentialism are central to both the nonreligious writers like Sartre and Camus and the theistic existentialists like Kierkegaard, Maritain, Marcel, Tillich, Berdyaev, and Buber. These characteristics are (1) an insistence that human life…

  3. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  4. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  5. Blockchain: A Primer

    OpenAIRE

    Dwyer, Gerald P

    2016-01-01

    The Bitcoin blockchain is the primary innovation in Bitcoin that makes it practical. Blockchains have applications in many contexts other than cryptocurrencies. This note is an introduction to blockchains that requires no prior knowledge, including of Bitcoin. Blockchains are ledgers of transactions kept by a set of participants, none of which is accorded special status as the “correct one.” Instead, agreement is reached by a process of consensus. I show how this works for Bitcoin, discuss ap...

  6. Can traditional birth attendants be trained to accurately identify septic infants, initiate antibiotics, and refer in a rural African setting?

    Science.gov (United States)

    Gill, Christopher John; MacLeod, William B; Phiri-Mazala, Grace; Guerina, Nicholas G; Mirochnick, Mark; Knapp, Anna B; Hamer, Davidson H

    2014-08-01

    Neonatal sepsis is a major cause of neonatal mortality. In populations with limited access to health care, early identification of bacterial infections and initiation of antibiotics by community health workers (CHWs) could be lifesaving. It is unknown whether this strategy would be feasible using traditional birth attendants (TBAs), a cadre of CHWs who typically have limited training and educational backgrounds. We analyzed data from the intervention arm of a cluster-randomized trial involving TBAs in Lufwanyama District, Zambia, from June 2006 to November 2008. TBAs followed neonates for signs of potential infection through 28 days of life. If any of 16 criteria were met, TBAs administered oral amoxicillin and facilitated referral to a rural health center. Our analysis included 1,889 neonates with final vital status by day 28. TBAs conducted a median of 2 (interquartile range 2-6) home visits (51.4% in week 1 and 48.2% in weeks 2-4) and referred 208 neonates (11%) for suspected sepsis. Of referred neonates, 176/208 (84.6%) completed their referral. Among neonates given amoxicillin, 171/183 (93.4%) were referred; among referred neonates, 171/208 (82.2%) received amoxicillin. Referral and/or initiation of antibiotics were strongly associated with neonatal death (for referral, relative risk [RR] = 7.93, 95% confidence interval [CI] = 4.4-14.3; for amoxicillin administration, RR = 4.7, 95% CI = 2.4-8.7). Neonates clinically judged to be "extremely sick" by the referring TBA were at greatest risk of death (RR = 8.61, 95% CI = 4.0-18.5). The strategy of administering a first dose of antibiotics and referring based solely on the clinical evaluation of a TBA is feasible and could be effective in reducing neonatal mortality in remote rural settings.

  7. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  8. The calculus primer

    CERN Document Server

    Schaaf, William L

    2011-01-01

    Comprehensive but concise, this introduction to differential and integral calculus covers all the topics usually included in a first course. The straightforward development places less emphasis on mathematical rigor, and the informal manner of presentation sets students at ease. Many carefully worked-out examples illuminate the text, in addition to numerous diagrams, problems, and answers.Bearing the needs of beginners constantly in mind, the treatment covers all the basic concepts of calculus: functions, derivatives, differentiation of algebraic and transcendental functions, partial different

  9. Primer on radiation

    International Nuclear Information System (INIS)

    Rados, B.

    1979-01-01

    Sources of anthropogenic radiation and their relative risk are discussed. Natural radiation accounts for more than half the exposure most U.S. citizens receive; the average citizen is exposed to about 100 mrem/yr. Medical and dental X-rays and radioactive material used to diagnose and treat illness account for 90% of all anthropogenic exposure. The remaining 10% comes from nuclear weapons testing, nuclear power plants, industrial uses of radioactive materials, and minute emissions from consumer products, such as color television sets. Occupationally exposed workers face greater risks from radiation. Means of calculating health risks are explained. Mechanisms of biological damage from ionizing radiation are outlined

  10. Identity Management A Primer

    CERN Document Server

    Sharoni, Ilan; Williamson, Graham; Yip, David

    2009-01-01

    In an age in which the boundaries between the real and the virtual are becoming increasingly blurred, this timely guide teaches both the key issues of identity management as well as appropriate strategies and preventative measures for ensuring personal safety in the virtual world. In a corporate setting, it is essential to identify and control the way in which the organization deals with customers, suppliers, employees, and other users who may interact with the information systems of the company. Providing strategies for overcoming this task in real-world terms as well as questions that assist

  11. Atmospheric bromoform at Cape Point, South Africa: an initial fixed-point data set on the African continent

    Directory of Open Access Journals (Sweden)

    B. Kuyper

    2018-04-01

    Full Text Available Bromoform mixing ratios in marine air were measured at Cape Point Global Atmospheric Watch Station, South Africa. This represents the first such bromoform data set recorded at this location. Manual daily measurements were made during a month-long field campaign (austral spring 2011 using a gas chromatograph-electron capture detector (GC-ECD with a custom-built front end thermal desorption trap. The measured concentrations ranged between 4.4 and 64.6 (± 22.2 % ppt with a mean of 24.8 ± 14.8 ppt. The highest mixing ratios recorded here occurred at, or shortly after, low tide. The diurnal cycle exhibited a morning and evening maximum with lower concentrations throughout the rest of the day. Initial analysis of the data presented indicates that the local kelp beds were the dominant source of the bromoform reported. A concentration-weighted trajectory analysis of the bromoform measurements suggests that two offshore source areas may exist. These source areas appear to be centred on the Agulhas retroflection and extend from St Helena Bay to the southwest.

  12. Atmospheric bromoform at Cape Point, South Africa: an initial fixed-point data set on the African continent

    Science.gov (United States)

    Kuyper, Brett; Palmer, Carl J.; Labuschagne, Casper; Reason, Chris J. C.

    2018-04-01

    Bromoform mixing ratios in marine air were measured at Cape Point Global Atmospheric Watch Station, South Africa. This represents the first such bromoform data set recorded at this location. Manual daily measurements were made during a month-long field campaign (austral spring 2011) using a gas chromatograph-electron capture detector (GC-ECD) with a custom-built front end thermal desorption trap. The measured concentrations ranged between 4.4 and 64.6 (± 22.2 %) ppt with a mean of 24.8 ± 14.8 ppt. The highest mixing ratios recorded here occurred at, or shortly after, low tide. The diurnal cycle exhibited a morning and evening maximum with lower concentrations throughout the rest of the day. Initial analysis of the data presented indicates that the local kelp beds were the dominant source of the bromoform reported. A concentration-weighted trajectory analysis of the bromoform measurements suggests that two offshore source areas may exist. These source areas appear to be centred on the Agulhas retroflection and extend from St Helena Bay to the southwest.

  13. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  14. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  15. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  16. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  17. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  18. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  19. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  20. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  1. Regenerative medicine primer.

    Science.gov (United States)

    Terzic, Andre; Nelson, Timothy J

    2013-07-01

    The pandemic of chronic diseases, compounded by the scarcity of usable donor organs, mandates radical innovation to address the growing unmet needs of individuals and populations. Beyond life-extending measures that are often the last available option, regenerative strategies offer transformative solutions in treating degenerative conditions. By leveraging newfound knowledge of the intimate processes fundamental to organogenesis and healing, the emerging regenerative armamentarium aims to boost the aptitude of human tissues for self-renewal. Regenerative technologies strive to promote, augment, and reestablish native repair processes, restituting organ structure and function. Multimodal regenerative approaches incorporate transplant of healthy tissues into damaged environments, prompt the body to enact a regenerative response in damaged tissues, and use tissue engineering to manufacture new tissue. Stem cells and their products have a unique aptitude to form specialized tissues and promote repair signaling, providing active ingredients of regenerative regimens. Concomitantly, advances in materials science and biotechnology have unlocked additional prospects for growing tissue grafts and engineering organs. Translation of regenerative principles into practice is feasible and safe in the clinical setting. Regenerative medicine and surgery are, thus, poised to transit from proof-of-principle studies toward clinical validation and, ultimately, standardization, paving the way for next-generation individualized management algorithms. Copyright © 2013 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  2. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  3. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  4. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  5. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  6. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  7. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  8. Mobile Landing Platform with Core Capability Set (MLP w/CCS): Combined Initial Operational Test and Evaluation and Live Fire Test and Evaluation Report

    Science.gov (United States)

    2015-07-01

    SUBTITLE Mobile Landing Platform with Core Capability Set (MLP w/CCS) Combined Initial Operational Test and Evaluation ( IOT &E) and Live Fire Test and...based on data from a series of integrated test events, a dedicated end-to-end Initial Operational Test and Evaluation ( IOT &E), and two Marine Corps...Internally Transportable Vehicles (ITVs).   ii the LMSR to anchor within a few miles of the shore. Using MLP (CCS), the equipment is transported ashore

  9. Time asymmetric spacetimes near null and spatial infinity: II. Expansions of developments of initial data sets with non-smooth conformal metrics

    International Nuclear Information System (INIS)

    Kroon, Juan Antonio Valiente

    2005-01-01

    This paper uses the conformal Einstein equations and the conformal representation of spatial infinity introduced by Friedrich to analyse the behaviour of the gravitational field near null and spatial infinity for the development of initial data which are, in principle, non-conformally flat and time asymmetric. The paper is the continuation of the investigation started in Class. Quantum Grav. 21 (2004) 5457-92, where only conformally flat initial data sets were considered. For the purposes of this investigation, the conformal metric of the initial hypersurface is assumed to have a very particular type of non-smoothness at infinity in order to allow for the presence of non-Schwarzschildean stationary initial data sets in the class under study. The calculation of asymptotic expansions of the development of these initial data sets reveals-as in the conformally flat case-the existence of a hierarchy of obstructions to the smoothness of null infinity which are expressible in terms of the initial data. This allows for the possibility of having spacetimes where future and past null infinity have different degrees of smoothness. A conjecture regarding the general structure of the hierarchy of obstructions is presented

  10. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  11. Good analytical practice: statistics and handling data in biomedical science. A primer and directions for authors. Part 1: Introduction. Data within and between one or two sets of individuals.

    Science.gov (United States)

    Blann, A D; Nation, B R

    2008-01-01

    The biomedical scientist is bombarded on a daily basis by information, almost all of which refers to the health status of an individual or groups of individuals. This review is the first of a two-part article written to explain some of the issues related to the presentation and analysis of data. The first part focuses on types of data and how to present and analyse data from an individual or from one or two groups of persons. The second part will examine data from three or more sets of persons, what methods are available to allow this analysis (i.e., statistical software packages), and will conclude with a statement on appropriate descriptors of data, their analyses, and presentation for authors considering submission of their data to this journal.

  12. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  13. How does additional diagnostic testing influence the initial diagnosis in patients with cognitive complaints in a memory clinic setting?

    Science.gov (United States)

    Meijs, Anouk P; Claassen, Jurgen A H R; Rikkert, Marcel G M Olde; Schalk, Bianca W M; Meulenbroek, Olga; Kessels, Roy P C; Melis, René J F

    2015-01-01

    patients suspected of dementia frequently undergo additional diagnostic testing (e.g. brain imaging or neuropsychological assessment) after standard clinical assessment at a memory clinic. This study investigates the use of additional testing in an academic outpatient memory clinic and how it influences the initial diagnosis. the initial diagnosis after standard clinical assessment (history, laboratory tests, cognitive screening and physical and neurological examination) and the final diagnosis after additional testing of 752 memory clinic patients were collected. We specifically registered if, and what type of, additional testing was requested. additional testing was performed in 518 patients (69%), 67% of whom underwent magnetic resonance imaging, 45% had neuropsychological assessment, 14% had cerebrospinal fluid analysis and 49% had (combinations of) other tests. This led to a modification of the initial diagnosis in 17% of the patients. The frequency of change was highest in patients with an initial non-Alzheimer's disease (AD) dementia diagnosis (54%, compared with 11 and 14% in patients with AD and 'no dementia'; P testing 44% was diagnosed with AD, 9% with non-AD dementia and 47% with 'no dementia'. additional testing should especially be considered in non-AD patients. In the large group of patients with an initial AD or 'no dementia' diagnosis, additional tests have little diagnostic impact and may perhaps be used with more restraint. © The Author 2014. Published by Oxford University Press on behalf of the British Geriatrics Society. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  15. Association Between Student Loan Debt on Graduation, Demographic Characteristics and Initial Choice of Practice Setting of Pharmacists

    Directory of Open Access Journals (Sweden)

    Akeem A. Yusuf

    2011-01-01

    Full Text Available Objectives: (1 To examine trends in level of student loan indebtedness for groups of pharmacists that were first licensed between 1980 and 2006; (2 To examine if demographic variables are associated with level of student loan indebtedness; (3 To examine the association between student loan debt and choice of practice setting while controlling for demographic variables. Methods: Data for this study were collected from a national random sample of 3,000 pharmacists using a self administered survey. Descriptive statistics were used to examine trends in level of indebtedness. The relationships between level of indebtedness, demographic variables and practice setting choice were examined using Chi-square statistics. Multinomial logistic regression was used to determine the independent association of student loan debt and choice of practice setting while controlling for demographic variables. Results: The proportion of licensed pharmacists reporting student loan debt after graduation, and the mean amount of debt incurred increased between 1980 and 2006. Non-white pharmacists incurred debt at a higher proportion compared to white, and they also incurred significantly higher levels of debt. A lower level of indebtedness was associated with choosing independent practice over chain practice. Conclusions: Student loan indebtedness has been increasing over time, especially for non-white pharmacy students. Future research should be done to examine other factors that might influence student debt load, work contributions and choice of practice settings. The affordability of pharmacy education for students of color and how salaries may or may not help off-set these costs also should be examined closely.   Type: Original Research

  16. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  17. Working together: a joint initiative between academics and clinicians to prepare undergraduate nursing students to work in mental health settings.

    Science.gov (United States)

    Curtis, Janette

    2007-08-01

    There is ongoing concern among mental health professionals regarding the recruitment of newly graduated nurses to this specialist nursing area. Many reasons for the problem have been identified, including the perceived inadequate preparation by the tertiary sector, students' prejudices and anxieties about mental illness, a perceived lack of support while undertaking clinical placement, and the quality of the clinical placement itself. This paper describes a collaborative response to these issues undertaken in the Illawarra region of New South Wales, Australia. The implementation of preclinical undergraduate workshops using problem-based learning and role plays were undertaken. Mental health nursing scenarios were developed in association with experienced clinicians to introduce core concepts in a supportive learning environment. Quantitative and qualitative evaluation data were collected immediately following the workshop and again after the students returned to the university following a mental health clinical placement. A further survey of one cohort was undertaken 12 months after initial state registration and the beginning of a career in mental health nursing. Results showed that both students' and clinicians' attitudes to the workshops were consistently positive and indicated that the workshops were beneficial in preparing students for their clinical placement. Importantly, since the implementation of the workshops and other collaborative initiatives, an increasing number of newly graduated nurses from the region are choosing to work in mental health.

  18. Initial validation of the prekindergarten Classroom Observation Tool and goal setting system for data-based coaching.

    Science.gov (United States)

    Crawford, April D; Zucker, Tricia A; Williams, Jeffrey M; Bhavsar, Vibhuti; Landry, Susan H

    2013-12-01

    Although coaching is a popular approach for enhancing the quality of Tier 1 instruction, limited research has addressed observational measures specifically designed to focus coaching on evidence-based practices. This study explains the development of the prekindergarten (pre-k) Classroom Observation Tool (COT) designed for use in a data-based coaching model. We examined psychometric characteristics of the COT and explored how coaches and teachers used the COT goal-setting system. The study included 193 coaches working with 3,909 pre-k teachers in a statewide professional development program. Classrooms served 3 and 4 year olds (n = 56,390) enrolled mostly in Title I, Head Start, and other need-based pre-k programs. Coaches used the COT during a 2-hr observation at the beginning of the academic year. Teachers collected progress-monitoring data on children's language, literacy, and math outcomes three times during the year. Results indicated a theoretically supported eight-factor structure of the COT across language, literacy, and math instructional domains. Overall interrater reliability among coaches was good (.75). Although correlations with an established teacher observation measure were small, significant positive relations between COT scores and children's literacy outcomes indicate promising predictive validity. Patterns of goal-setting behaviors indicate teachers and coaches set an average of 43.17 goals during the academic year, and coaches reported that 80.62% of goals were met. Both coaches and teachers reported the COT was a helpful measure for enhancing quality of Tier 1 instruction. Limitations of the current study and implications for research and data-based coaching efforts are discussed. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  19. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  20. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  1. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  2. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  3. Provider Initiated Testing and Counseling (PITC for HIV in resource-limited clinical settings: important questions unanswered

    Directory of Open Access Journals (Sweden)

    Peter Twyman

    2009-09-01

    Full Text Available Testing is the gateway to HIV care and support services, and efforts to broaden treatment must include a proactive and inclusive approach to testing. Provider Initiated Testing and Counseling (PITC for HIV utilizes the opportunity afforded by the clinical encounter for the care provider to make a clinical recommendation that the patient have a voluntary HIV test. It is hoped that by broadening testing by such strategies as PITC more patients may be identified and linked to treatment and support. However, there exist multiple challenges and questions regarding the provision of routine HIV testing and counseling in clinical facilities. In order to support further PITC efforts and scale up of current testing programs, a research agenda that addresses the ethical, social and operational components of PITC programming in health facilities, is critically needed to further guide its expansion.

  4. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  5. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    2014-08-18

    Aug 18, 2014 ... the environmental quality of agroecosystems and are indeed considered as ..... five isopod species in standardized tests for pH preference. Eur. J. Soil. Biol. ... Zimmer M. and Topp W. 1997 Does food quality influence pop-.

  6. Provider Training to Screen and Initiate Evidence-Based Pediatric Obesity Treatment in Routine Practice Settings: A Randomized Pilot Trial.

    Science.gov (United States)

    Kolko, Rachel P; Kass, Andrea E; Hayes, Jacqueline F; Levine, Michele D; Garbutt, Jane M; Proctor, Enola K; Wilfley, Denise E

    This randomized pilot trial evaluated two training modalities for first-line, evidence-based pediatric obesity services (screening and goal setting) among nursing students. Participants (N = 63) were randomized to live interactive training or Web-facilitated self-study training. Pretraining, post-training, and 1-month follow-up assessments evaluated training feasibility, acceptability, and impact (knowledge and skill via simulation). Moderator (previous experience) and predictor (content engagement) analyses were conducted. Nearly all participants (98%) completed assessments. Both types of training were acceptable, with higher ratings for live training and participants with previous experience (ps pediatric obesity services. Copyright © 2016 National Association of Pediatric Nurse Practitioners. Published by Elsevier Inc. All rights reserved.

  7. Substantial differences in initiation of oral anticoagulant therapy and clinical outcome among non-valvular atrial fibrillation patients treated in inpatient and outpatient settings

    DEFF Research Database (Denmark)

    Mikkelsen, Anders Pretzmann; Hansen, Morten Lock; Olesen, Jonas Bjerring

    2016-01-01

    with a CHADS2 ≥ 2 was 42.1, 63.0, and 32.4%, respectively. Initiation of OAC therapy was only modestly influenced by CHADS2 and HAS-BLED scores, regardless of the healthcare setting. The rate of TE was 4.30 [95% confidence interval (CI) 4.21-4.40] per 100 person-years for inpatients, 2.28 (95% CI 2...

  8. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  9. Efficiency of the kidney disease outcomes quality initiative guidelines for preemptive vascular access in an academic setting.

    Science.gov (United States)

    Kimball, Traci A; Barz, Ken; Dimond, Kelly R; Edwards, James M; Nehler, Mark R

    2011-09-01

    The National Kidney Foundation-Kidney Diseases Outcomes Quality Initiative (KDOQI) for vascular access guidelines state that patients with late-stage chronic kidney disease (CKD) should undergo native arteriovenous fistula (AVF) creation at least 6 months before anticipated start of hemodialysis (HD) treatments to obviate the need for other vascular access types, such as grafts or central catheters. The objective of this study was to determine the incidence of HD, the functional patency, and associated morbidity of AVFs in patients with late-stage CKD placed according to KDOQI. Consecutive patients with late-stage CKD who underwent AVF creation using KDOQI guidelines for anatomy between January 2003 and December 2007 at two tertiary academic centers were retrospectively evaluated. Baseline demographics, AVF type, and clinical comorbidities were recorded. Patients were stratified into one of four groups (groups A-D) over the follow-up course based on two end points: patency of their AVF and whether or not they began HD. The ideal primary outcome was AVF maturation and use for HD (group A; cumulative functional patency). Other outcomes included AVF patency but no HD (group B), HD with AVF failure (group C), or no HD and AVF abandonment (ie, death, refused hemodialysis, kidney transplant, or fistula failure; group D). Secondary outcomes were time to first cannulation, complications, and secondary interventions. AVFs were created (46% forearm and 54% upper arm) in 150 patients with CKD (85% men, median age 63 years old). At a median follow-up of 10 months, 74 patients (49%) were receiving HD and of these, 48 patients (65%) were using their AVF (group A), whereas 26 patients (35%) were not due to fistula failure (group C). Thirty-four patients (23%) never initiated HD treatments, but had a viable AVF (group B), and 42 patients (28%) never initiated HD and abandoned their AVF (group D). Overall, AVF abandonment was 51%. Mean maturation time of all AVFs successfully

  10. Effects of Inoculum Amount, Initial pH, and Nicotine Load on the Set-Up of Bioaugmented System with Pseudomonas Sp. HF-1 to Treat Tobacco Wastewater

    Directory of Open Access Journals (Sweden)

    Kun Zhang

    2014-01-01

    Full Text Available This study evaluated and optimized the influence of inoculum amount, initial pH, and nicotine load on the construction of Pseudomonas sp. HF-1 bioaugmented system for tobacco wastewater treatment. The results demonstrated that the optimum condition for the set-up of strain HF-1 bioaugmented system was 1.10 mg/g (dry weight of strain HF-1/dry weight of activated sludge of inoculum amount, initial pH 7.0, and 250–1000 mg/L nicotine load. Higher than 1.10 mg/g could lead to noncolonization of strain HF-1 in activated sludge and failure of set-up of this bioaugmented system. Higher than pH 8.0 could restrain the colonization of strain HF-1 in activated sludge. Even though strain HF-1 colonizes in the activated sludge when pH was above 8.0, the removal of nicotine and total organic carbon (TOC was suppressed due to low activities of bacteria in the activated sludge. Nicotine load did not show inhibition effect on set-up of bioaugmented system, but the ability of TOC removal was restrained when the nicotine load was above 1000 mg/L. This work could offer vital parameters for the set-up of bioaugmented system to treat tobacco wastewater in engineering.

  11. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  12. Initial Experience with "Honoring Choices Wisconsin": Implementation of an Advance Care Planning Pilot in a Tertiary Care Setting.

    Science.gov (United States)

    Peltier, Wendy L; Gani, Faiz; Blissitt, Jennifer; Walczak, Katherine; Opper, Kristi; Derse, Arthur R; Johnston, Fabian M

    2017-09-01

    Although previous research on advance care planning (ACP) has associated ACP with improved quality of care at the end of life, the appropriate use of ACP remains limited. To evaluate the impact of a pilot program using the "Honoring Choices Wisconsin" (HCW) model for ACP in a tertiary care setting, and to understand barriers to system-wide implementation. Retrospective review of prospectively collected data. Patients who received medical or surgical oncology care at Froedtert and the Medical College of Wisconsin. Patient demographics, disease characteristics, patient satisfaction, and clinical outcomes. Data from 69 patients who died following the implementation of the HCW program were reviewed; 24 patients were enrolled in the HCW program while 45 were not. Patients enrolled in HCW were proportionally less likely to be admitted to the ICU (12.5% vs. 17.8%) and were more likely to be "do not resuscitate" (87.5% vs. 80.0%), as well as have a completed ACP (83.3% vs. 79.1%). Furthermore, admission to a hospice was also higher among patients who were enrolled in the HCW program (79.2% vs. 25.6%), with patients enrolled in HCW more likely to die in hospice (70.8% vs. 53.3%). The HCW program was favorably viewed by patients, patient caregivers, and healthcare providers. Implementation of a facilitator-based ACP care model was associated with fewer ICU admissions, and a higher use of hospice care. System-level changes are required to overcome barriers to ACP that limit patients from receiving end-of-life care in accordance with their preferences.

  13. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  14. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  15. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. The influence of contextual factors on healthcare quality improvement initiatives: what works, for whom and in what setting? Protocol for a realist review.

    Science.gov (United States)

    Coles, Emma; Wells, Mary; Maxwell, Margaret; Harris, Fiona M; Anderson, Julie; Gray, Nicola M; Milner, Gill; MacGillivray, Stephen

    2017-08-23

    Context shapes the effectiveness of knowledge implementation and influences health improvement. Successful healthcare quality improvement (QI) initiatives frequently fail to transfer to different settings, with local contextual factors often cited as the cause. Understanding and overcoming contextual barriers is therefore crucial to implementing effective improvement; yet context is still poorly understood. There is a paucity of information on the mechanisms underlying how and why QI projects succeed or fail in given settings. A realist review of empirical studies of healthcare QI initiatives will be undertaken to examine the influence and impact of contextual factors on quality improvement in healthcare settings and explore whether QI initiatives can work in all contexts. The review will explore which contextual factors are important, and how, why, when and for whom they are important, within varied settings. The dynamic nature of context and change over time will be explored by examining which aspects of context impact at key points in the improvement trajectory. The review will also consider the influence of context on improvement outcomes (provider- and patient-level), spread and sustainability. The review process will follow five iterative steps: (1) clarify scope, (2) search for evidence, (3) appraise primary studies and extract data, (4) synthesise evidence and draw conclusions and (5) disseminate findings. The reviewers will consult with experts and stakeholders in the early stages to focus the review and develop a programme theory consisting of explanatory 'context-mechanism-outcome' configurations. Searches for primary evidence will be conducted iteratively. Data will be extracted and tested against the programme theory. A review advisory group will oversee the review process. Review findings will follow RAMESES guidelines and will be disseminated via a report, presentations and peer-reviewed publications. The review will update and consolidate evidence

  17. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  18. Improved diagnostic accuracy of Alzheimer's disease by combining regional cortical thickness and default mode network functional connectivity: Validated in the Alzheimer's disease neuroimaging initiative set

    International Nuclear Information System (INIS)

    Park, Ji Eun; Park, Bum Woo; Kim, Sang Joon; Kim, Ho Sung; Choi, Choong Gon; Jung, Seung Jung; Oh, Joo Young; Shim, Woo Hyun; Lee, Jae Hong; Roh, Jee Hoon

    2017-01-01

    To identify potential imaging biomarkers of Alzheimer's disease by combining brain cortical thickness (CThk) and functional connectivity and to validate this model's diagnostic accuracy in a validation set. Data from 98 subjects was retrospectively reviewed, including a study set (n = 63) and a validation set from the Alzheimer's Disease Neuroimaging Initiative (n = 35). From each subject, data for CThk and functional connectivity of the default mode network was extracted from structural T1-weighted and resting-state functional magnetic resonance imaging. Cortical regions with significant differences between patients and healthy controls in the correlation of CThk and functional connectivity were identified in the study set. The diagnostic accuracy of functional connectivity measures combined with CThk in the identified regions was evaluated against that in the medial temporal lobes using the validation set and application of a support vector machine. Group-wise differences in the correlation of CThk and default mode network functional connectivity were identified in the superior temporal (p < 0.001) and supramarginal gyrus (p = 0.007) of the left cerebral hemisphere. Default mode network functional connectivity combined with the CThk of those two regions were more accurate than that combined with the CThk of both medial temporal lobes (91.7% vs. 75%). Combining functional information with CThk of the superior temporal and supramarginal gyri in the left cerebral hemisphere improves diagnostic accuracy, making it a potential imaging biomarker for Alzheimer's disease

  19. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  20. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  1. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  2. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  3. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  4. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  5. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  6. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  7. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  8. Setting priorities for zinc-related health research to reduce children's disease burden worldwide: an application of the Child Health and Nutrition Research Initiative's research priority-setting method.

    Science.gov (United States)

    Brown, Kenneth H; Hess, Sonja Y; Boy, Erick; Gibson, Rosalind S; Horton, Susan; Osendarp, Saskia J; Sempertegui, Fernando; Shrimpton, Roger; Rudan, Igor

    2009-03-01

    To make the best use of limited resources for supporting health-related research to reduce child mortality, it is necessary to apply a suitable method to rank competing research options. The Child Health and Nutrition Research Initiative (CHNRI) developed a new methodology for setting health research priorities. To broaden experience with this priority-setting technique, we applied the method to rank possible research priorities concerning the control of Zn deficiency. Although Zn deficiency is not generally recognized as a direct cause of child mortality, recent research indicates that it predisposes children to an increased incidence and severity of several of the major direct causes of morbidity and mortality. Leading experts in the field of Zn research in child health were identified and invited to participate in a technical working group (TWG) to establish research priorities. The individuals were chosen to represent a wide range of expertise in Zn nutrition. The seven TWG members submitted a total of ninety research options, which were then consolidated into a final list of thirty-one research options categorized by the type of resulting intervention. The identified priorities were dominated by research investment options targeting Zn supplementation, and were followed by research on Zn fortification, general aspects of Zn nutrition, dietary modification and other new interventions. In general, research options that aim to improve the efficiency of an already existing intervention strategy received higher priority scores. Challenges identified during the implementation of the methodology and suggestions to modify the priority-setting procedures are discussed.

  9. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  10. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  11. The challenges and opportunities of conducting a clinical trial in a low resource setting: The case of the Cameroon mobile phone SMS (CAMPS trial, an investigator initiated trial

    Directory of Open Access Journals (Sweden)

    Ongolo-Zogo Pierre

    2011-06-01

    Full Text Available Abstract Conducting clinical trials in developing countries often presents significant ethical, organisational, cultural and infrastructural challenges to researchers, pharmaceutical companies, sponsors and regulatory bodies. Globally, these regions are under-represented in research, yet this population stands to gain more from research in these settings as the burdens on health are greater than those in developed resourceful countries. However, developing countries also offer an attractive setting for clinical trials because they often have larger treatment naive populations with higher incidence rates of disease and more advanced stages. These factors can present a reduction in costs and time required to recruit patients. So, balance needs to be found where research can be encouraged and supported in order to bring maximum public health benefits to these communities. The difficulties with such trials arise from problems with obtaining valid informed consent, ethical compensation mechanisms for extremely poor populations, poor health infrastructure and considerable socio-economic and cultural divides. Ethical concerns with trials in developing countries have received attention, even though many other non-ethical issues may arise. Local investigator initiated trials also face a variety of difficulties that have not been adequately reported in literature. This paper uses the example of the Cameroon Mobile Phone SMS trial to describe in detail, the specific difficulties encountered in an investigator-initiated trial in a developing country. It highlights administrative, ethical, financial and staff related issues, proposes solutions and gives a list of additional documentation to ease the organisational process.

  12. The challenges and opportunities of conducting a clinical trial in a low resource setting: the case of the Cameroon mobile phone SMS (CAMPS) trial, an investigator initiated trial.

    Science.gov (United States)

    Mbuagbaw, Lawrence; Thabane, Lehana; Ongolo-Zogo, Pierre; Lang, Trudie

    2011-06-09

    Conducting clinical trials in developing countries often presents significant ethical, organisational, cultural and infrastructural challenges to researchers, pharmaceutical companies, sponsors and regulatory bodies. Globally, these regions are under-represented in research, yet this population stands to gain more from research in these settings as the burdens on health are greater than those in developed resourceful countries. However, developing countries also offer an attractive setting for clinical trials because they often have larger treatment naive populations with higher incidence rates of disease and more advanced stages. These factors can present a reduction in costs and time required to recruit patients. So, balance needs to be found where research can be encouraged and supported in order to bring maximum public health benefits to these communities. The difficulties with such trials arise from problems with obtaining valid informed consent, ethical compensation mechanisms for extremely poor populations, poor health infrastructure and considerable socio-economic and cultural divides. Ethical concerns with trials in developing countries have received attention, even though many other non-ethical issues may arise. Local investigator initiated trials also face a variety of difficulties that have not been adequately reported in literature. This paper uses the example of the Cameroon Mobile Phone SMS trial to describe in detail, the specific difficulties encountered in an investigator-initiated trial in a developing country. It highlights administrative, ethical, financial and staff related issues, proposes solutions and gives a list of additional documentation to ease the organisational process.

  13. The accuracy of SST retrievals from AATSR: An initial assessment through geophysical validation against in situ radiometers, buoys and other SST data sets

    Science.gov (United States)

    Corlett, G. K.; Barton, I. J.; Donlon, C. J.; Edwards, M. C.; Good, S. A.; Horrocks, L. A.; Llewellyn-Jones, D. T.; Merchant, C. J.; Minnett, P. J.; Nightingale, T. J.; Noyes, E. J.; O'Carroll, A. G.; Remedios, J. J.; Robinson, I. S.; Saunders, R. W.; Watts, J. G.

    The Advanced Along-Track Scanning Radiometer (AATSR) was launched on Envisat in March 2002. The AATSR instrument is designed to retrieve precise and accurate global sea surface temperature (SST) that, combined with the large data set collected from its predecessors, ATSR and ATSR-2, will provide a long term record of SST data that is greater than 15 years. This record can be used for independent monitoring and detection of climate change. The AATSR validation programme has successfully completed its initial phase. The programme involves validation of the AATSR derived SST values using in situ radiometers, in situ buoys and global SST fields from other data sets. The results of the initial programme presented here will demonstrate that the AATSR instrument is currently close to meeting its scientific objectives of determining global SST to an accuracy of 0.3 K (one sigma). For night time data, the analysis gives a warm bias of between +0.04 K (0.28 K) for buoys to +0.06 K (0.20 K) for radiometers, with slightly higher errors observed for day time data, showing warm biases of between +0.02 (0.39 K) for buoys to +0.11 K (0.33 K) for radiometers. They show that the ATSR series of instruments continues to be the world leader in delivering accurate space-based observations of SST, which is a key climate parameter.

  14. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  15. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  16. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  17. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  18. Effect of exposure to evening light on sleep initiation in the elderly: a longitudinal analysis for repeated measurements in home settings.

    Science.gov (United States)

    Obayashi, Kenji; Saeki, Keigo; Iwamoto, Junko; Okamoto, Nozomi; Tomioka, Kimiko; Nezu, Satoko; Ikada, Yoshito; Kurumatani, Norio

    2014-05-01

    Epidemiologic data have demonstrated associations of sleep-onset insomnia with a variety of diseases, including depression, dementia, diabetes and cardiovascular diseases. Sleep initiation is controlled by the suprachiasmatic nucleus of the hypothalamus and endogenous melatonin, both of which are influenced by environmental light. Exposure to evening light is hypothesized to cause circadian phase delay and melatonin suppression before bedtime, resulting in circadian misalignment and sleep-onset insomnia; however, whether exposure to evening light disturbs sleep initiation in home settings remains unclear. In this longitudinal analysis of 192 elderly individuals (mean age: 69.9 years), we measured evening light exposure and sleep-onset latency for 4 days using a wrist actigraph incorporating a light meter and an accelerometer. Mixed-effect linear regression analysis for repeated measurements was used to evaluate the effect of evening light exposure on subsequent sleep-onset latency. The median intensity of evening light exposure and the median sleep-onset latency were 27.3 lux (interquartile range, 17.9-43.4) and 17 min (interquartile range, 7-33), respectively. Univariate models showed significant associations between sleep-onset latency and age, gender, daytime physical activity, in-bed time, day length and average intensity of evening and nighttime light exposures. In a multivariate model, log-transformed average intensity of evening light exposure was significantly associated with log-transformed sleep-onset latency independent of the former potential confounding factors (regression coefficient, 0.133; 95% CI, 0.020-0.247; p = 0.021). Day length and nighttime light exposure were also significantly associated with log-transformed sleep-onset latency (p = 0.001 and p < 0.001, respectively). In conclusion, exposure to evening light in home setting prolongs subsequent sleep-onset latency in the elderly.

  19. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  20. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  1. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  2. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  3. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  4. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  5. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  6. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  7. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  8. A systematic review of structured versus non-structured breastfeeding programmes to support the initiation and duration of exclusive breastfeeding in acute and primary healthcare settings.

    Science.gov (United States)

    Beake, Sarah; Pellowe, Carol; Dykes, Fiona; Schmied, Virginia; Bick, Debra

    2011-01-01

    Background: Breastfeeding has many important health benefits for the woman and her baby. Despite evidence of benefit from a large number of well conducted studies, breastfeeding uptake and the duration of exclusive breastfeeding remain low in many countries. In order to improve breastfeeding rates, policy and guidelines at global, individual country level and in local healthcare settings have recommended that structured programmes to support breastfeeding should be introduced. The objective of this review was to consider the evidence of outcomes of structured compared with non-structured breastfeeding programmes in acute maternity care settings to support initiation and duration of exclusive breastfeeding. The definition of structured programme used included a multi-faceted or single intervention approach to support breastfeeding; definition of non-structured included support offered within standard care. The review considered quantitative and qualitative studies which addressed outcomes following the introduction of a structured programme in acute healthcare settings to support breastfeeding compared with no programme. The primary outcomes of interest were uptake of breastfeeding and duration of exclusive breastfeeding (only breast milk, including milk expressed). Studies which only considered community based interventions were not included. A search of the literature published between 1992 and 2010 was conducted, which followed a four step process. After a limited search of MEDLINE and CINAHL to identify key words contained in the title or abstract and index terms to describe relevant interventions, a second extensive search was undertaken using identified key words and index terms. The third step included a search of reference lists and bibliographies of relevant articles and the fourth step included a search of grey and unpublished literature and national databasesMethodological quality: Methodological quality was assessed using checklists developed by the

  9. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  10. Change in Vitamin D Levels Occurs Early after Antiretroviral Therapy Initiation and Depends on Treatment Regimen in Resource-Limited Settings

    Science.gov (United States)

    Havers, Fiona P.; Detrick, Barbara; Cardoso, Sandra W.; Berendes, Sima; Lama, Javier R.; Sugandhavesa, Patcharaphan; Mwelase, Noluthando H.; Campbell, Thomas B.; Gupta, Amita

    2014-01-01

    Study Background Vitamin D has wide-ranging effects on the immune system, and studies suggest that low serum vitamin D levels are associated with worse clinical outcomes in HIV. Recent studies have identified an interaction between antiretrovirals used to treat HIV and reduced serum vitamin D levels, but these studies have been done in North American and European populations. Methods Using a prospective cohort study design nested in a multinational clinical trial, we examined the effect of three combination antiretroviral (cART) regimens on serum vitamin D levels in 270 cART-naïve, HIV-infected adults in nine diverse countries, (Brazil, Haiti, Peru, Thailand, India, Malawi, South Africa, Zimbabwe and the United States). We evaluated the change between baseline serum vitamin D levels and vitamin D levels 24 and 48 weeks after cART initiation. Results Serum vitamin D levels decreased significantly from baseline to 24 weeks among those randomized to efavirenz/lamivudine/zidovudine (mean change: −7.94 [95% Confidence Interval (CI) −10.42, −5.54] ng/ml) and efavirenz/emtricitabine/tenofovir-DF (mean change: −6.66 [95% CI −9.40, −3.92] ng/ml) when compared to those randomized to atazanavir/emtricitabine/didanosine-EC (mean change: −2.29 [95% CI –4.83, 0.25] ng/ml). Vitamin D levels did not change significantly between week 24 and 48. Other factors that significantly affected serum vitamin D change included country (p<0.001), season (p<0.001) and baseline vitamin D level (p<0.001). Conclusion Efavirenz-containing cART regimens adversely affected vitamin D levels in patients from economically, geographically and racially diverse resource-limited settings. This effect was most pronounced early after cART initiation. Research is needed to define the role of Vitamin D supplementation in HIV care. PMID:24752177

  11. "helix Nebula - the Science Cloud", a European Science Driven Cross-Domain Initiative Implemented in via AN Active Ppp Set-Up

    Science.gov (United States)

    Lengert, W.; Mondon, E.; Bégin, M. E.; Ferrer, M.; Vallois, F.; DelaMar, J.

    2015-12-01

    Helix Nebula, a European science cross-domain initiative building on an active PPP, is aiming to implement the concept of an open science commons[1] while using a cloud hybrid model[2] as the proposed implementation solution. This approach allows leveraging and merging of complementary data intensive Earth Science disciplines (e.g. instrumentation[3] and modeling), without introducing significant changes in the contributors' operational set-up. Considering the seamless integration with life-science (e.g. EMBL), scientific exploitation of meteorological, climate, and Earth Observation data and models open an enormous potential for new big data science. The work of Helix Nebula has shown that is it feasible to interoperate publicly funded infrastructures, such as EGI [5] and GEANT [6], with commercial cloud services. Such hybrid systems are in the interest of the existing users of publicly funded infrastructures and funding agencies because they will provide "freedom and choice" over the type of computing resources to be consumed and the manner in which they can be obtained. But to offer such freedom and choice across a spectrum of suppliers, various issues such as intellectual property, legal responsibility, service quality agreements and related issues need to be addressed. Finding solutions to these issues is one of the goals of the Helix Nebula initiative. [1] http://www.egi.eu/news-and-media/publications/OpenScienceCommons_v3.pdf [2] http://www.helix-nebula.eu/events/towards-the-european-open-science-cloud [3] e.g. https://sentinel.esa.int/web/sentinel/sentinel-data-access [5] http://www.egi.eu/ [6] http://www.geant.net/

  12. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  13. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  14. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  15. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  16. Piezoelectrically Initiated Pyrotechnic Igniter

    Science.gov (United States)

    Quince, Asia; Dutton, Maureen; Hicks, Robert; Burnham, Karen

    2013-01-01

    This innovation consists of a pyrotechnic initiator and piezoelectric initiation system. The device will be capable of being initiated mechanically; resisting initiation by EMF, RF, and EMI (electromagnetic field, radio frequency, and electromagnetic interference, respectively); and initiating in water environments and space environments. Current devices of this nature are initiated by the mechanical action of a firing pin against a primer. Primers historically are prone to failure. These failures are commonly known as misfires or hang-fires. In many cases, the primer shows the dent where the firing pin struck the primer, but the primer failed to fire. In devices such as "T" handles, which are commonly used to initiate the blowout of canopies, loss of function of the device may result in loss of crew. In devices such as flares or smoke generators, failure can result in failure to spot a downed pilot. The piezoelectrically initiated ignition system consists of a pyrotechnic device that plugs into a mechanical system (activator), which on activation, generates a high-voltage spark. The activator, when released, will strike a stack of electrically linked piezo crystals, generating a high-voltage, low-amperage current that is then conducted to the pyro-initiator. Within the initiator, an electrode releases a spark that passes through a pyrotechnic first-fire mixture, causing it to combust. The combustion of the first-fire initiates a primary pyrotechnic or explosive powder. If used in a "T" handle, the primary would ramp the speed of burn up to the speed of sound, generating a shock wave that would cause a high explosive to go "high order." In a flare or smoke generator, the secondary would produce the heat necessary to ignite the pyrotechnic mixture. The piezo activator subsystem is redundant in that a second stack of crystals would be struck at the same time with the same activation force, doubling the probability of a first strike spark generation. If the first

  17. Renal impairment in HIV-infected patients initiating tenofovir-containing antiretroviral therapy regimens in a Primary Healthcare Setting in South Africa.

    Science.gov (United States)

    Kamkuemah, Monika; Kaplan, Richard; Bekker, Linda-Gail; Little, Francesca; Myer, Landon

    2015-04-01

    Long-term use of tenofovir disoproxil fumarate is associated with declines in glomerular function and chronic kidney disease in HIV-infected patients. We aimed to assess the prevalence and incidence of renal impairment in a primary care setting in sub-Saharan Africa. We analysed data from 1092 HIV-infected patients initiating tenofovir at a primary care clinic in Cape Town, South Africa. Renal function was assessed for the first 12 months on ART by estimating glomerular filtration rate (eGFR) calculated using the Cockroft-Gault equation categorised into normal, mild, moderate and severe reduction in renal function based on values >90, 60-89, 30-59 and <30 ml/min/1.73 m(2) , respectively. Associations were assessed using logistic regression, and average GFR trajectory over time was modelled using linear mixed-effects models. The cohort consisted of 62% women; median age was 34 years (IQR 29; 41 years). The majority had normal renal function pre-ART (79%), 19% had mildly reduced GFR, and 2% had moderate renal impairment. Older age, more advanced WHO stage and anaemia were independently associated with prevalent renal impairment. On average, estimated glomerular function improved over the first year on tenofovir [1.10 ml/min/1.73 m(2) average increase over 12 months (95% CI: 0.80; 1.40)]. Male gender, anaemia and immunosuppression (WHO Stage III/IV and CD4 cell counts <100 cells/mm(3) ) were associated with lower average eGFR levels over time. Overall, 3% developed eGFR <50 ml/min/1.73 m(2) during this period. Serum creatinine tests conducted before 4 months on ART had low predictive value for predicting change in eGFR after a year on ART. Generally, renal function improved in HIV-infected adults initiating ART in this primary healthcare setting during the first year on ART. While monitoring of renal function is recommended in the first 4 months on ART, renal impairment appears uncommon during the first 12 months of tenofovir-containing ART in primary

  18. The development of the Older Persons and Informal Caregivers Survey Minimum DataSet (TOPICS-MDS): a large-scale data sharing initiative.

    Science.gov (United States)

    Lutomski, Jennifer E; Baars, Maria A E; Schalk, Bianca W M; Boter, Han; Buurman, Bianca M; den Elzen, Wendy P J; Jansen, Aaltje P D; Kempen, Gertrudis I J M; Steunenberg, Bas; Steyerberg, Ewout W; Olde Rikkert, Marcel G M; Melis, René J F

    2013-01-01

    In 2008, the Ministry of Health, Welfare and Sport commissioned the National Care for the Elderly Programme. While numerous research projects in older persons' health care were to be conducted under this national agenda, the Programme further advocated the development of The Older Persons and Informal Caregivers Survey Minimum DataSet (TOPICS-MDS) which would be integrated into all funded research protocols. In this context, we describe TOPICS data sharing initiative (www.topics-mds.eu). A working group drafted TOPICS-MDS prototype, which was subsequently approved by a multidisciplinary panel. Using instruments validated for older populations, information was collected on demographics, morbidity, quality of life, functional limitations, mental health, social functioning and health service utilisation. For informal caregivers, information was collected on demographics, hours of informal care and quality of life (including subjective care-related burden). Between 2010 and 2013, a total of 41 research projects contributed data to TOPICS-MDS, resulting in preliminary data available for 32,310 older persons and 3,940 informal caregivers. The majority of studies sampled were from primary care settings and inclusion criteria differed across studies. TOPICS-MDS is a public data repository which contains essential data to better understand health challenges experienced by older persons and informal caregivers. Such findings are relevant for countries where increasing health-related expenditure has necessitated the evaluation of contemporary health care delivery. Although open sharing of data can be difficult to achieve in practice, proactively addressing issues of data protection, conflicting data analysis requests and funding limitations during TOPICS-MDS developmental phase has fostered a data sharing culture. To date, TOPICS-MDS has been successfully incorporated into 41 research projects, thus supporting the feasibility of constructing a large (>30,000 observations

  19. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  20. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  1. Current procedural terminology; a primer.

    Science.gov (United States)

    Hirsch, Joshua A; Leslie-Mazwi, Thabele M; Nicola, Gregory N; Barr, Robert M; Bello, Jacqueline A; Donovan, William D; Tu, Raymond; Alson, Mark D; Manchikanti, Laxmaiah

    2015-04-01

    In 1966, The American Medical Association (AMA) working with multiple major medical specialty societies developed an iterative coding system for describing medical procedures and services using uniform language, the Current Procedural Terminology (CPT) system. The current code set, CPT IV, forms the basis of reporting most of the services performed by healthcare providers, physicians and non-physicians as well as facilities allowing effective, reliable communication among physician and other providers, third parties and patients. This coding system and its maintenance has evolved significantly since its inception, and now goes well beyond its readily perceived role in reimbursement. Additional roles include administrative management, tracking new and investigational procedures, and evolving aspects of 'pay for performance'. The system also allows for local, regional and national utilization comparisons for medical education and research. Neurointerventional specialists use CPT category I codes regularly--for example, 36,215 for first-order cerebrovascular angiography, 36,216 for second-order vessels, and 37,184 for acute stroke treatment by mechanical means. Additionally, physicians add relevant modifiers to the CPT codes, such as '-26' to indicate 'professional charge only,' or '-59' to indicate a distinct procedural service performed on the same day. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  2. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  3. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  4. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  5. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  6. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  7. Efficacy and Safety of Three Antiretroviral Regimens for Initial Treatment of HIV-1: A Randomized Clinical Trial in Diverse Multinational Settings

    Science.gov (United States)

    Campbell, Thomas B.; Smeaton, Laura M.; Kumarasamy, N.; Flanigan, Timothy; Klingman, Karin L.; Firnhaber, Cynthia; Grinsztejn, Beatriz; Hosseinipour, Mina C.; Kumwenda, Johnstone; Lalloo, Umesh; Riviere, Cynthia; Sanchez, Jorge; Melo, Marineide; Supparatpinyo, Khuanchai; Tripathy, Srikanth; Martinez, Ana I.; Nair, Apsara; Walawander, Ann; Moran, Laura; Chen, Yun; Snowden, Wendy; Rooney, James F.; Uy, Jonathan; Schooley, Robert T.; De Gruttola, Victor; Hakim, James Gita; Swann, Edith; Barnett, Ronald L.; Brizz, Barbara; Delph, Yvette; Gettinger, Nikki; Mitsuyasu, Ronald T.; Eshleman, Susan; Safren, Steven; Fiscus, Susan A.; Andrade, Adriana; Haas, David W.; Amod, Farida; Berthaud, Vladimir; Bollinger, Robert C.; Bryson, Yvonne; Celentano, David; Chilongozi, David; Cohen, Myron; Collier, Ann C.; Currier, Judith Silverstein; Cu-Uvin, Susan; Eron, Joseph; Flexner, Charles; Gallant, Joel E.; Gulick, Roy M.; Hammer, Scott M.; Hoffman, Irving; Kazembe, Peter; Kumwenda, Newton; Lama, Javier R.; Lawrence, Jody; Maponga, Chiedza; Martinson, Francis; Mayer, Kenneth; Nielsen, Karin; Pendame, Richard B.; Ramratnam, Bharat; Sanne, Ian; Severe, Patrice; Sirisanthana, Thira; Solomon, Suniti; Tabet, Steve; Taha, Taha; van der Horst, Charles; Wanke, Christine; Gormley, Joan; Marcus, Cheryl J.; Putnam, Beverly; Loeliger, Edde; Pappa, Keith A.; Webb, Nancy; Shugarts, David L.; Winters, Mark A.; Descallar, Renard S.; Steele, Joseph; Wulfsohn, Michael; Said, Farideh; Chen, Yue; Martin, John C; Bischofberger, Norbert; Cheng, Andrew; Jaffe, Howard; Sharma, Jabin; Poongulali, S.; Cardoso, Sandra Wagner; Faria, Deise Lucia; Berendes, Sima; Burke, Kelly; Mngqibisa, Rosie; Kanyama, Cecelia; Kayoyo, Virginia; Samaneka, Wadzanai P.; Chisada, Anthony; Faesen, Sharla; Chariyalertsak, Suwat; Santos, Breno; Lira, Rita Alves; Joglekar, Anjali A.; Rosa, Alberto La; Infante, Rosa; Jain, Mamta; Petersen, Tianna; Godbole, Sheela; Dhayarkar, Sampada; Feinberg, Judith; Baer, Jenifer; Pollard, Richard B.; Asmuth, David; Gangakhedkar, Raman R; Gaikwad, Asmita; Ray, M. Graham; Basler, Cathi; Para, Michael F.; Watson, Kathy J.; Taiwo, Babafemi; McGregor, Donna; Balfour, Henry H.; Mullan, Beth; Kim, Ge-Youl; Klebert, Michael K.; Cox, Gary Matthew; Silberman, Martha; Mildvan, Donna; Revuelta, Manuel; Tashima, Karen T.; Patterson, Helen; Geiseler, P. Jan; Santos, Bartolo; Daar, Eric S; Lopez, Ruben; Frarey, Laurie; Currin, David; Haas, David H.; Bailey, Vicki L.; Tebas, Pablo; Zifchak, Larisa; Noel-Connor, Jolene; Torres, Madeline; Sha, Beverly E.; Fritsche, Janice M.; Cespedes, Michelle; Forcht, Janet; O'Brien, William A.; Mogridge, Cheryl; Hurley, Christine; Corales, Roberto; Palmer, Maria; Adams, Mary; Luque, Amneris; Lopez-Detres, Luis; Stroberg, Todd

    2012-01-01

    Background Antiretroviral regimens with simplified dosing and better safety are needed to maximize the efficiency of antiretroviral delivery in resource-limited settings. We investigated the efficacy and safety of antiretroviral regimens with once-daily compared to twice-daily dosing in diverse areas of the world. Methods and Findings 1,571 HIV-1-infected persons (47% women) from nine countries in four continents were assigned with equal probability to open-label antiretroviral therapy with efavirenz plus lamivudine-zidovudine (EFV+3TC-ZDV), atazanavir plus didanosine-EC plus emtricitabine (ATV+DDI+FTC), or efavirenz plus emtricitabine-tenofovir-disoproxil fumarate (DF) (EFV+FTC-TDF). ATV+DDI+FTC and EFV+FTC-TDF were hypothesized to be non-inferior to EFV+3TC-ZDV if the upper one-sided 95% confidence bound for the hazard ratio (HR) was ≤1.35 when 30% of participants had treatment failure. An independent monitoring board recommended stopping study follow-up prior to accumulation of 472 treatment failures. Comparing EFV+FTC-TDF to EFV+3TC-ZDV, during a median 184 wk of follow-up there were 95 treatment failures (18%) among 526 participants versus 98 failures among 519 participants (19%; HR 0.95, 95% CI 0.72–1.27; p = 0.74). Safety endpoints occurred in 243 (46%) participants assigned to EFV+FTC-TDF versus 313 (60%) assigned to EFV+3TC-ZDV (HR 0.64, CI 0.54–0.76; p<0.001) and there was a significant interaction between sex and regimen safety (HR 0.50, CI 0.39–0.64 for women; HR 0.79, CI 0.62–1.00 for men; p = 0.01). Comparing ATV+DDI+FTC to EFV+3TC-ZDV, during a median follow-up of 81 wk there were 108 failures (21%) among 526 participants assigned to ATV+DDI+FTC and 76 (15%) among 519 participants assigned to EFV+3TC-ZDV (HR 1.51, CI 1.12–2.04; p = 0.007). Conclusion EFV+FTC-TDF had similar high efficacy compared to EFV+3TC-ZDV in this trial population, recruited in diverse multinational settings. Superior safety, especially in HIV-1-infected

  8. Efficacy and safety of three antiretroviral regimens for initial treatment of HIV-1: a randomized clinical trial in diverse multinational settings.

    Directory of Open Access Journals (Sweden)

    Thomas B Campbell

    Full Text Available Antiretroviral regimens with simplified dosing and better safety are needed to maximize the efficiency of antiretroviral delivery in resource-limited settings. We investigated the efficacy and safety of antiretroviral regimens with once-daily compared to twice-daily dosing in diverse areas of the world.1,571 HIV-1-infected persons (47% women from nine countries in four continents were assigned with equal probability to open-label antiretroviral therapy with efavirenz plus lamivudine-zidovudine (EFV+3TC-ZDV, atazanavir plus didanosine-EC plus emtricitabine (ATV+DDI+FTC, or efavirenz plus emtricitabine-tenofovir-disoproxil fumarate (DF (EFV+FTC-TDF. ATV+DDI+FTC and EFV+FTC-TDF were hypothesized to be non-inferior to EFV+3TC-ZDV if the upper one-sided 95% confidence bound for the hazard ratio (HR was ≤1.35 when 30% of participants had treatment failure. An independent monitoring board recommended stopping study follow-up prior to accumulation of 472 treatment failures. Comparing EFV+FTC-TDF to EFV+3TC-ZDV, during a median 184 wk of follow-up there were 95 treatment failures (18% among 526 participants versus 98 failures among 519 participants (19%; HR 0.95, 95% CI 0.72-1.27; p = 0.74. Safety endpoints occurred in 243 (46% participants assigned to EFV+FTC-TDF versus 313 (60% assigned to EFV+3TC-ZDV (HR 0.64, CI 0.54-0.76; p<0.001 and there was a significant interaction between sex and regimen safety (HR 0.50, CI 0.39-0.64 for women; HR 0.79, CI 0.62-1.00 for men; p = 0.01. Comparing ATV+DDI+FTC to EFV+3TC-ZDV, during a median follow-up of 81 wk there were 108 failures (21% among 526 participants assigned to ATV+DDI+FTC and 76 (15% among 519 participants assigned to EFV+3TC-ZDV (HR 1.51, CI 1.12-2.04; p = 0.007.EFV+FTC-TDF had similar high efficacy compared to EFV+3TC-ZDV in this trial population, recruited in diverse multinational settings. Superior safety, especially in HIV-1-infected women, and once-daily dosing of EFV+FTC-TDF are

  9. Initializing numerical weather prediction models with satellite-derived surface soil moisture: Data assimilation experiments with ECMWF's Integrated Forecast System and the TMI soil moisture data set

    Science.gov (United States)

    Drusch, M.

    2007-02-01

    Satellite-derived surface soil moisture data sets are readily available and have been used successfully in hydrological applications. In many operational numerical weather prediction systems the initial soil moisture conditions are analyzed from the modeled background and 2 m temperature and relative humidity. This approach has proven its efficiency to improve surface latent and sensible heat fluxes and consequently the forecast on large geographical domains. However, since soil moisture is not always related to screen level variables, model errors and uncertainties in the forcing data can accumulate in root zone soil moisture. Remotely sensed surface soil moisture is directly linked to the model's uppermost soil layer and therefore is a stronger constraint for the soil moisture analysis. For this study, three data assimilation experiments with the Integrated Forecast System (IFS) of the European Centre for Medium-Range Weather Forecasts (ECMWF) have been performed for the 2-month period of June and July 2002: a control run based on the operational soil moisture analysis, an open loop run with freely evolving soil moisture, and an experimental run incorporating TMI (TRMM Microwave Imager) derived soil moisture over the southern United States. In this experimental run the satellite-derived soil moisture product is introduced through a nudging scheme using 6-hourly increments. Apart from the soil moisture analysis, the system setup reflects the operational forecast configuration including the atmospheric 4D-Var analysis. Soil moisture analyzed in the nudging experiment is the most accurate estimate when compared against in situ observations from the Oklahoma Mesonet. The corresponding forecast for 2 m temperature and relative humidity is almost as accurate as in the control experiment. Furthermore, it is shown that the soil moisture analysis influences local weather parameters including the planetary boundary layer height and cloud coverage.

  10. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  11. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  12. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  13. Setting global research priorities for integrated community case management (iCCM: Results from a CHNRI (Child Health and Nutrition Research Initiative exercise

    Directory of Open Access Journals (Sweden)

    Kerri Wazny

    2014-11-01

    Full Text Available Aims: to systematically identify global research gaps and resource priorities for integrated community case management (iCCM. Methods: an iCCM Child Health and Nutrition Research Initiative (CHNRI Advisory Group, in collaboration with the Community Case Management Operational Research Group (CCM ORG identified experts to participate in a CHNRI research priority setting exercise. These experts generated and systematically ranked research questions for iCCM. Research questions were ranked using a “Research Priority Score” (RPS and the “Average Expert Agreement” (AEA was calculated for every question. Our groups of experts were comprised of both individuals working in Ministries of Health or Non Governmental Organizations (NGOs in low– and middle–income countries (LMICs and individuals working in high–income countries (HICs in academia or NGO headquarters. A Spearman's Rho was calculated to determine the correlation between the two groups' research questions' ranks. Results: The overall RPS ranged from 64.58 to 89.31, with a median score of 81.43. AEA scores ranged from 0.54 to 0.86. Research questions involving increasing the uptake of iCCM services, research questions concerning the motivation, retention, training and supervision of Community Health Workers (CHWs and concerning adding additional responsibilities including counselling for infant and young child feeding (IYCF and treatment of severe acute malnutrition (SAM ranked highly. There was weak to moderate, statistically significant, correlation between scores by representatives of high–income countries and those working in–country or regionally (Spearman's ρ = 0.35034, P < 0.01. Conclusions: Operational research to determine optimal training, supervision and modes of motivation and retention for the CHW is vital for improving iCCM, globally, as is research to motivate caregivers to take advantage of iCCM services. Experts working in–country or regionally in

  14. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  15. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  16. Timing of initiation of macronuclear DNA synthesis is set during the preceding cell cycle in Paramecium tetraurelia: analysis of the effects of abrupt changes in nutrient level

    International Nuclear Information System (INIS)

    Ching, A.S.L.; Berger, J.D.

    1986-01-01

    In many eukaryotic organisms, initiation of DNA synthesis is associated with a major control point within the cell cycle and reflects the commitment of the cell to the DNA replication-division portion of the cell cycle. In paramecium, the timing of DNA synthesis initiation is established prior to fission during the preceding cell cycle. DNA synthesis normally starts at 0.25 in the cell cycle. When dividing cells are subjected to abrupt nutrient shift-up by transfer from a chemostat culture to medium with excess food, or shift-down from a well-fed culture to exhausted medium, DNA synthesis initiation in the post-shift cell cycle occurs at 0.25 of the parental cell cycle and not at either 0.25 in the post-shift cell cycle or at 0.25 in the equilibrium cell cycle produced under the post-shift conditions. The long delay prior to initiation of DNA synthesis following nutritional shift-up is not a consequence of continued slow growth because the rate of protein synthesis increases rapidly to the normal level after shift-up. Analysis of the relation between increase in cell mass and initiation of DNA synthesis following nutritional shifts indicates that increase in cell mass, per se, is neither a necessary nor a sufficient condition for initiation of DNA synthesis, in spite of the strong association between accumulation of cell mass and initiation of DNA synthesis in cells growing under steady-state conditions

  17. Early sex work initiation independently elevates odds of HIV infection and police arrest among adult sex workers in a Canadian setting.

    Science.gov (United States)

    Goldenberg, Shira M; Chettiar, Jill; Simo, Annick; Silverman, Jay G; Strathdee, Steffanie A; Montaner, Julio S G; Shannon, Kate

    2014-01-01

    To explore factors associated with early sex work initiation and model the independent effect of early initiation on HIV infection and prostitution arrests among adult sex workers (SWs). Baseline data (2010-2011) were drawn from a cohort of SWs who exchanged sex for money within the last month and were recruited through time location sampling in Vancouver, Canada. Analyses were restricted to adults ≥18 years old. SWs completed a questionnaire and HIV/sexually transmitted infection testing. Using multivariate logistic regression, we identified associations with early sex work initiation (prostitution arrests among adult SWs. Of 508 SWs, 193 (38.0%) reported early sex work initiation, with 78.53% primarily street-involved SWs and 21.46% off-street SWs. HIV prevalence was 11.22%, which was 19.69% among early initiates. Early initiates were more likely to be Canadian born [adjusted odds ratio (AOR): 6.8, 95% confidence interval (CI): 2.42 to 19.02], inject drugs (AOR: 1.6, 95% CI: 1.0 to 2.5), and to have worked for a manager (AOR: 2.22, 95% CI: 1.3 to 3.6) or been coerced into sex work (AOR: 2.3, 95% CI: 1.14 to 4.44). Early initiation retained an independent effect on increased risk of HIV infection (AOR: 2.5, 95% CI: 1.3 to 3.2) and prostitution arrests (AOR: 2.0, 95% CI: 1.3 to 3.2). Adolescent sex work initiation is concentrated among marginalized, drug, and street-involved SWs. Early initiation holds an independent increased effect on HIV infection and criminalization of adult SWs. Findings suggest the need for evidence-based approaches to reduce harm among adult and youth SWs.

  18. Early sex work initiation independently elevates odds of HIV infection and police arrest among adult sex workers in a Canadian setting

    Science.gov (United States)

    GOLDENBERG, Shira M.; CHETTIAR, Jill; SIMO, Annick; SILVERMAN, Jay G.; STRATHDEE, Steffanie A.; MONTANER, Julio; SHANNON, Kate

    2014-01-01

    Objectives To explore factors associated with early sex work initiation, and model the independent effect of early initiation on HIV infection and prostitution arrests among adult sex workers (SWs). Design Baseline data (2010–2011) were drawn from a cohort of SWs who exchanged sex for money within the last month and were recruited through time-location sampling in Vancouver, Canada. Analyses were restricted to adults ≥18 years old. Methods SWs completed a questionnaire and HIV/STI testing. Using multivariate logistic regression, we identified associations with early sex work initiation (prostitution arrests among adult SWs. Results Of 508 SWs, 193 (38.0%) reported early sex work initiation, with 78.53% primarily street-involved SWs and 21.46% off-street SWs. HIV prevalence was 11.22%, which was 19.69% among early initiates. Early initiates were more likely to be Canadian-born (Adjusted Odds Ratio (AOR): 6.8, 95% Confidence Interval (CI): 2.42–19.02), inject drugs (AOR: 1.6, 95%CI: 1.0–2.5), and to have worked for a manager (AOR: 2.22, 95%CI: 1.3–3.6) or been coerced into sex work (AOR: 2.3, 95%CI: 1.14–4.44). Early initiation retained an independent effect on increased risk of HIV infection (AOR: 2.5, 95% CI: 1.3–3.2) and prostitution arrests (AOR: 2.0, 95%CI: 1.3–3.2). Conclusions Adolescent sex work initiation is concentrated among marginalized, drug and street-involved SWs. Early initiation holds an independent increased effect on HIV infection and criminalization of adult SWs. Findings suggest the need for evidence-based approaches to reduce harm among adult and youth SWs. PMID:23982660

  19. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  20. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  3. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  4. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  5. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  7. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  8. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  9. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  10. Development and Use of a Goal Setting/Attainment Process Designed To Measure a Teacher's Ability To Engage in Professional Growth and Leadership Initiatives.

    Science.gov (United States)

    Minix, Nancy; And Others

    The process used to evaluate progress in identifying the goals to be used in evaluating teacher performance under the Kentucky Career Ladder Program is described. The process pertains to two areas of teacher development: (1) professional growth and development, and (2) professional leadership and initiative. A total of 1,650 individuals were asked…

  11. Mortality associated with delays between clinic entry and ART initiation in resource-limited-settings: results of a transition-state model

    Science.gov (United States)

    HOFFMANN, Christopher J; LEWIS, James J; DOWDY, David W; FIELDING, Katherine L; GRANT, Alison D; MARTINSON, Neil A; CHURCHYARD, Gavin J; CHAISSON, Richard E

    2013-01-01

    Objective Estimate the mortality impact of delay in antiretroviral therapy (ART) initiation from the time of entry-into-care. Design A state-transition Markov process model. This technique allows for assessing mortality before and after ART initiation associated with delays in ART initiation among a general population of ART eligible patients without conducting a randomized trial. Methods We used patient-level data from three South African cohorts to determine transition probabilities for pre-ART CD4 count changes and pre-ART and on-ART mortality. For each parameter we generated probabilities and distributions for Monte Carlo simulations with one week cycles to estimate mortality 52 weeks from clinic entry. Results We estimated an increase in mortality from 11.0% to 14.7% (relative increase of 34%) with a 10 week delay in ART for patients entering care with our pre-ART cohort CD4 distribution. When we examined low CD4 ranges, the relative increase in mortality delays remained similar; however, the absolute increase in mortality rose. For example, among patients entering with CD4 count 50–99 cells/mm3, 12 month mortality increased from 13.3% with no delay compared to 17.0% with a 10 week delay and 22.9% with a 6 month delay. Conclusions Delays in ART initiation, common in routine HIV programs, can lead to important increases in mortality. Prompt ART initiation for patients entering clinical care and eligible for ART, especially those with lower CD4 counts, could be a relatively low cost approach with a potential marked impact on mortality. PMID:23392457

  12. Mortality associated with delays between clinic entry and ART initiation in resource-limited settings: results of a transition-state model.

    Science.gov (United States)

    Hoffmann, Christopher J; Lewis, James J; Dowdy, David W; Fielding, Katherine L; Grant, Alison D; Martinson, Neil A; Churchyard, Gavin J; Chaisson, Richard E

    2013-05-01

    To estimate the mortality impact of delay in antiretroviral therapy (ART) initiation from the time of entry into care. A state-transition Markov process model. This technique allows for assessing mortality before and after ART initiation associated with delays in ART initiation among a general population of ART-eligible patients without conducting a randomized trial. We used patient-level data from 3 South African cohorts to determine transition probabilities for pre-ART CD4 count changes and pre-ART and on-ART mortality. For each parameter, we generated probabilities and distributions for Monte Carlo simulations with 1-week cycles to estimate mortality 52 weeks from clinic entry. We estimated an increase in mortality from 11.0% to 14.7% (relative increase of 34%) with a 10-week delay in ART for patients entering care with our pre-ART cohort CD4 distribution. When we examined low CD4 ranges, the relative increase in mortality delays remained similar; however, the absolute increase in mortality rose. For example, among patients entering with CD4 count 50-99 cells per cubic millimeter, 12-month mortality increased from 13.3% with no delay compared with 17.0% with a 10-week delay and 22.9% with a 6-month delay. Delays in ART initiation, common in routine HIV programs, can lead to important increases in mortality. Prompt ART initiation for patients entering clinical care and eligible for ART, especially those with lower CD4 counts, could be a relatively low-cost approach with a potential marked impact on mortality.

  13. Decreased health care utilization and health care costs in the inpatient and emergency department setting following initiation of ketogenic diet in pediatric patients: The experience in Ontario, Canada.

    Science.gov (United States)

    Whiting, Sharon; Donner, Elizabeth; RamachandranNair, Rajesh; Grabowski, Jennifer; Jetté, Nathalie; Duque, Daniel Rodriguez

    2017-03-01

    To assess the change in inpatient and emergency department utilization and health care costs in children on the ketogenic diet for treatment of epilepsy. Data on children with epilepsy initiated on the ketogenic diet (KD) Jan 1, 2000 and Dec 31, 2010 at Ontario pediatric hospitals were linked to province wide inpatient, emergency department (ED) data at the Institute for Clinical Evaluative Sciences. ED and inpatient visits and costs for this cohort were compared for a maximum of 2 years (730days) prior to diet initiation and for a maximum of 2 years (730days) following diet initiation. KD patient were compared to matched group of children with epilepsy who did not receive the ketogenic diet (no KD). Children on the KD experienced a mean decrease in ED visits of 2.5 visits per person per year [95% CI (1.5-3.4)], and a mean decrease of 0.8 inpatient visits per person per year [95% CI (0.3-1.3)], following diet initiation. They had a mean decrease in ED costs of $630 [95% CI (249-1012)] per person per year and a median decrease in inpatient costs of $1059 [IQR: 7890; pdiet experienced a mean reduction of 2.1 ED visits per child per year [95% CI (1.0-3.2)] and a mean decrease of 0.6 [95% CI (0.1-1.1)] inpatient visits per child per year. Patients on the KD experienced a reduction of $442 [95% CI (34.4-850)] per child per year more in ED costs than the matched group. The ketogenic diet group had greater median decrease in inpatient costs per child per year than the matched group [pketogenic diet, experienced decreased ED and inpatient visits as well as costs following diet initiation in Ontario, Canada. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  15. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  16. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  17. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  18. Psychosocial factors associated with early initiation and frequency of antenatal care (ANC) visits in a rural and urban setting in South Africa: a cross-sectional survey.

    Science.gov (United States)

    Muhwava, Lorrein Shamiso; Morojele, Neo; London, Leslie

    2016-01-25

    Late booking and infrequent antenatal care (ANC) are common but avoidable patient-related risk factors for maternal deaths in South Africa. The aim of the study was to examine the association of psychosocial factors with early initiation of ANC and adequate frequency of attendance of ANC clinics among women in an urban and rural location in South Africa. Data from a 2006 cross-sectional household survey of 363 women from the rural Western Cape and 466 women from urban Gauteng provinces of South Africa for risk of alcohol-exposed pregnancy were analysed. We examined associations between psychosocial variables (self-esteem, cultural influences, religiosity, social capital, social support, pregnancy desire (wanted versus unwanted pregnancy), partner characteristics and mental health) and both early ANC first visit (before 16 weeks) and adequate frequency of ANC visits (4 or more visits) for respondents' last pregnancy. Overall prevalence among urban women of early ANC initiation was 46% and 84% for adequate ANC frequency. Overall prevalence among rural women of early ANC initiation was 45% and 78% for adequate ANC frequency. After adjusting for clustering, psychosocial factors associated with early ANC initiation in the urban site were being employed (OR 1.6; 95% CI 1.0-2.5) and wanted pregnancy (OR 1.8; 95% CI 1.1-3.0). For the rural site, early ANC initiation was significantly associated with being married (OR 1.93; 95% CI 1.0-3.6) but inversely associated with high religiosity (OR 0.5; 95% CI 0.3-0.8). Adequate frequency of ANC attendance in the rural site was associated with wanted pregnancy (OR 4.2; 95% CI 1.9-9.3) and the father of the child being present in the respondent's life (OR 3.0; 95% CI 1.0-9.0) but inversely associated with having a previous miscarriage (OR 0.4; 95% CI 0.2-0.8). There were no significant associations between adequate ANC attendance and the psychosocial factors in the urban site. The majority of women from both sites attended ANC

  19. Action Research in a Non-Profit Agency School Setting: Analyzing the Adoption of an Innovation after Initial Training and Coaching

    Science.gov (United States)

    Sandoval-Lucero, Elena; Maes, Johanna B.; Pappas, Georgia

    2013-01-01

    Action research is a method of organizational development and improvement often used in educational settings. This study implemented an action research process in an alternative school that serves students with significant special needs. The action research process was implemented by classroom teams who developed a research question, collected and…

  20. Effects of Functional Communication Training (FCT) on the Communicative, Self-Initiated Toileting Behavior for Students with Developmental Disabilities in a School Setting

    Science.gov (United States)

    Kim, Jinnie

    2012-01-01

    Far less is known about the effects of functional communication-based toileting interventions for students with developmental disabilities in a school setting. Furthermore, the currently available toileting interventions for students with disabilities include some undesirable procedures such as the use of punishment, unnatural clinic/university…

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  3. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  5. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  6. Initialized Fractional Calculus

    Science.gov (United States)

    Lorenzo, Carl F.; Hartley, Tom T.

    2000-01-01

    This paper demonstrates the need for a nonconstant initialization for the fractional calculus and establishes a basic definition set for the initialized fractional differintegral. This definition set allows the formalization of an initialized fractional calculus. Two basis calculi are considered; the Riemann-Liouville and the Grunwald fractional calculi. Two forms of initialization, terminal and side are developed.

  7. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  8. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  9. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  10. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  11. Model simulation studies to clarify the effect on saccadic eye movements of initial condition velocities set by the Vestibular Ocular Reflex (VOR)

    Science.gov (United States)

    Nam, M. H.; Winters, J. M.; Stark, L.

    1981-01-01

    Voluntary active head rotations produced vestibulo-ocular reflex eye movements (VOR) with the subject viewing a fixation target. When this target jumped, the size of the refixation saccades were a function of the ongoing initial velocity of the eye. Saccades made against the VOR were larger in magnitude. Simulation of a reciprocally innervated model eye movement provided results comparable to the experimental data. Most of the experimental effect appeared to be due to linear summation for saccades of 5 and 10 degree magnitude. For small saccades of 2.5 degrees, peripheral nonlinear interaction of state variables in the neuromuscular plant also played a role as proven by comparable behavior in the simulated model with known controller signals.

  12. A student-facilitated community-based support group initiative for Mental Health Care users in a Primary Health Care setting

    Directory of Open Access Journals (Sweden)

    Leana Meiring

    2017-12-01

    Methods: Qualitative research methods were applied. Data were collected using semistructured interviews and a collage-making and storytelling method. Thematic analysis highlighted the main themes representing the meaning the five participants ascribed to the group. Results: The findings suggest that the group offered the participants a sense of belonging and a means of social and emotional support. The group also created opportunity for learning, encouraged mental and physical mobilisation and stimulation, and served as an additional link to professional services. Conclusion: The findings suggest that student-facilitated support groups could offer a viable supplement for offering support to service users in PHC settings. The group assisted MHC users to cope with symptoms, social integration, and participating in meaningful activities as part of rehabilitation services.

  13. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  14. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  15. Re-establishing safer medical-circumcision-integrated initiation ceremonies for HIV prevention in a rural setting in Papua New Guinea. A multi-method acceptability study.

    Directory of Open Access Journals (Sweden)

    Clement Morris Manineng

    Full Text Available Efforts to stem the spread of Human Immunodeficiency Virus (HIV in Papua New Guinea (PNG are hampered by multiple interrelated factors including limited health services, extreme diversities in culture and language and highly prevalent gender inequity, domestic violence and poverty. In the rural district of Yangoru-Saussia, a revival of previously ceased male initiation ceremonies (MICs is being considered for a comprehensive approach to HIV prevention. In this study, we explore the local acceptability of this undertaking including replacing traditional penile cutting practices with medical male circumcision (MMC.A multi-method study comprising three phases. Phase one, focus group discussions with male elders to explore locally appropriate approaches to HIV prevention; Phase two, interviews and a cross-sectional survey with community men and women to assess views on MICs that include MMC for HIV prevention; Phase three, interviews with cultural leaders and a cross sectional survey to assess the acceptability of replacing traditional penile bleeding with MMC.Cultural leaders expressed that re-establishing MICs was locally appropriate for HIV prevention given the focus on character building and cultural preservation. Most surveyed participants (81.5% supported re-establishing MICs and 92.2% supported adapting MICs with MMC. Changes to penile bleeding emerged as a contentious and contested issue given its cultural significance in symbolizing initiates' transition from childhood to adulthood. Participants were concerned about potential clash with modern education, introduced religious beliefs and limited government support in leadership and funding.Most people in this study in Yangoru-Saussia support re-establishing MICs and replacing traditional penile bleeding with MMC. This culturally-sensitive alignment of MMC (and HIV prevention with revived MICs responds to a national health priority in PNG and acts as an example of providing culturally

  16. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  17. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  18. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  19. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  20. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  1. Mid-Pliocene global climate simulation with MRI-CGCM2.3: set-up and initial results of PlioMIP Experiments 1 and 2

    Directory of Open Access Journals (Sweden)

    Y. Kamae

    2012-05-01

    Full Text Available The mid-Pliocene (3.3 to 3.0 million yr ago, a globally warm period before the Quaternary, is recently attracting attention as a new target for paleoclimate modelling and data-model synthesis. This paper reports set-ups and results of experiments proposed in Pliocene Model Intercomparison Project (PlioMIP using a global climate model, MRI-CGCM2.3. We conducted pre-industrial and mid-Pliocene runs by using the coupled atmosphere-ocean general circulation model (AOGCM and its atmospheric component (AGCM for the PlioMIP Experiments 2 and 1, respectively. In addition, we conducted two types of integrations in AOGCM simulation, with and without flux adjustments on sea surface. General characteristics of differences in the simulated mid-Pliocene climate relative to the pre-industrial in the three integrations are compared. In addition, patterns of predicted mid-Pliocene biomes resulting from the three climate simulations are compared in this study. Generally, difference of simulated surface climate between AGCM and AOGCM is larger than that between the two AOGCM runs, with and without flux adjustments. The simulated climate shows different pattern between AGCM and AOGCM particularly over low latitude oceans, subtropical land regions and high latitude oceans. The AOGCM simulations do not reproduce wetter environment in the subtropics relative to the present-day, which is suggested by terrestrial proxy data. The differences between the two types of AOGCM runs are small over the land, but evident over the ocean particularly in the North Atlantic and polar regions.

  2. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  3. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  4. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  5. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Characterisation of flattening filter free (FFF) beam properties for initial beam set-up and routine QA, independent of flattened beams

    Science.gov (United States)

    Paynter, D.; Weston, S. J.; Cosgrove, V. P.; Thwaites, D. I.

    2018-01-01

    Flattening filter free (FFF) beams have reached widespread use for clinical treatment deliveries. The usual methods for FFF beam characterisation for their quality assurance (QA) require the use of associated conventional flattened beams (cFF). Methods for QA of FFF without the need to use associated cFF beams are presented and evaluated against current methods for both FFF and cFF beams. Inflection point normalisation is evaluated against conventional methods for the determination of field size and penumbra for field sizes from 3 cm  ×  3 cm to 40 cm  ×  40cm at depths from dmax to 20 cm in water for matched and unmatched FFF beams and for cFF beams. A method for measuring symmetry in the cross plane direction is suggested and evaluated as FFF beams are insensitive to symmetry changes in this direction. Methods for characterising beam energy are evaluated and the impact of beam energy on profile shape compared to that of cFF beams. In-plane symmetry can be measured, as can cFF beams, using observed changes in profile, whereas cross-plane symmetry can be measured by acquiring profiles at collimator angles 0 and 180. Beam energy and ‘unflatness’ can be measured as with cFF beams from observed shifts in profile with changing beam energy. Normalising the inflection points of FFF beams to 55% results in an equivalent penumbra and field size measurement within 0.5 mm of conventional methods with the exception of 40 cm  ×  40 cm fields at a depth of 20 cm. New proposed methods are presented that make it possible to independently carry out set up and QA measurements on beam energy, flatness, symmetry and field size of an FFF beam without the need to reference to an equivalent flattened beam of the same energy. The methods proposed can also be used to carry out this QA for flattened beams, resulting in universal definitions and methods for MV beams. This is presented for beams produced by an Elekta linear accelerator, but is

  7. Roles and relationships between health professionals involved in insulin initiation for people with type 2 diabetes in the general practice setting: a qualitative study drawing on relational coordination theory.

    Science.gov (United States)

    Manski-Nankervis, Jo-Anne; Furler, John; Blackberry, Irene; Young, Doris; O'Neal, David; Patterson, Elizabeth

    2014-01-31

    The majority of care for people with type 2 diabetes occurs in general practice, however when insulin initiation is required it often does not occur in this setting or in a timely manner and this may have implications for the development of complications. Increased insulin initiation in general practice is an important goal given the increasing prevalence of type 2 diabetes and a relative shortage of specialists. Coordination between primary and secondary care, and between medical and nursing personnel, may be important in achieving this. Relational coordination theory identifies key concepts that underpin effective interprofessional work: communication which is problem solving, timely, accurate and frequent and relationships between professional roles which are characterized by shared goals, shared knowledge and mutual respect. This study explores roles and relationships between health professionals involved in insulin initiation in order to gain an understanding of factors which may impact on this task being carried out in the general practice setting. 21 general practitioners, practice nurses, diabetes nurse educators and physicians were purposively sampled to participate in a semi-structured interview. Transcripts of the interviews were analysed using framework analysis. There were four closely interlinked themes identified which impacted on how health professionals worked together to initiate people with type 2 diabetes on insulin: 1. Ambiguous roles; 2. Uncertain competency and capacity; 3. Varying relationships and communication; and 4. Developing trust and respect. This study has shown that insulin initiation is generally recognised as acceptable in general practice. The role of the DNE and practice nurse in this space and improved communication and relationships between health professionals across organisations and levels of care are factors which need to be addressed to support this clinical work. Relational coordination provides a useful framework for

  8. Improved diagnostic accuracy of Alzheimer's disease by combining regional cortical thickness and default mode network functional connectivity: Validated in the Alzheimer's disease neuroimaging initiative set

    Energy Technology Data Exchange (ETDEWEB)

    Park, Ji Eun; Park, Bum Woo; Kim, Sang Joon; Kim, Ho Sung; Choi, Choong Gon; Jung, Seung Jung; Oh, Joo Young; Shim, Woo Hyun [Dept. of Radiology and Research Institute of Radiology, University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of); Lee, Jae Hong; Roh, Jee Hoon [University of Ulsan College of Medicine, Asan Medical Center, Seoul (Korea, Republic of)

    2017-11-15

    To identify potential imaging biomarkers of Alzheimer's disease by combining brain cortical thickness (CThk) and functional connectivity and to validate this model's diagnostic accuracy in a validation set. Data from 98 subjects was retrospectively reviewed, including a study set (n = 63) and a validation set from the Alzheimer's Disease Neuroimaging Initiative (n = 35). From each subject, data for CThk and functional connectivity of the default mode network was extracted from structural T1-weighted and resting-state functional magnetic resonance imaging. Cortical regions with significant differences between patients and healthy controls in the correlation of CThk and functional connectivity were identified in the study set. The diagnostic accuracy of functional connectivity measures combined with CThk in the identified regions was evaluated against that in the medial temporal lobes using the validation set and application of a support vector machine. Group-wise differences in the correlation of CThk and default mode network functional connectivity were identified in the superior temporal (p < 0.001) and supramarginal gyrus (p = 0.007) of the left cerebral hemisphere. Default mode network functional connectivity combined with the CThk of those two regions were more accurate than that combined with the CThk of both medial temporal lobes (91.7% vs. 75%). Combining functional information with CThk of the superior temporal and supramarginal gyri in the left cerebral hemisphere improves diagnostic accuracy, making it a potential imaging biomarker for Alzheimer's disease.

  9. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  10. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  11. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  12. A Privatization Primer: Issues and Evidence

    National Research Council Canada - National Science Library

    Tighe, C

    1997-01-01

    .... This study identified specific ways to streamline the competition process required by 0MB Circular A-76, and initial findings of five outsourcing and competition case studies reported in earlier reports...

  13. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  15. Initial ventilator settings for critically ill patients

    OpenAIRE

    Kilickaya, Oguz; Gajic, Ognjen

    2013-01-01

    The lung-protective mechanical ventilation strategy has been standard practice for management of acute respiratory distress syndrome (ARDS) for more than a decade. Observational data, small randomized studies and two recent systematic reviews suggest that lung protective ventilation is both safe and potentially beneficial in patients who do not have ARDS at the onset of mechanical ventilation. Principles of lung-protective ventilation include: a) prevention of volutrauma (tidal volume 4 to 8 ...

  16. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  17. Gibberellin Application at Pre-Bloom in Grapevines Down-Regulates the Expressions of VvIAA9 and VvARF7, Negative Regulators of Fruit Set Initiation, during Parthenocarpic Fruit Development

    Science.gov (United States)

    Jung, Chan Jin; Hur, Youn Young; Yu, Hee-Ju; Noh, Jung-Ho; Park, Kyo-Sun; Lee, Hee Jae

    2014-01-01

    Fruit set is initiated only after fertilization and is tightly regulated primarily by gibberellins (GAs) and auxins. The application of either of these hormones induces parthenocarpy, fruit set without fertilization, but the molecular mechanism underlying this induction is poorly understood. In the present study, we have shown that the parthenocarpic fruits induced by GA application at pre-bloom result from the interaction of GA with auxin signaling. The transcriptional levels of the putative negative regulators of fruit set initiation, including Vitis auxin/indole-3-acetic acid transcription factor 9 (VvIAA9), Vitis auxin response factor 7 (VvARF7), and VvARF8 were monitored during inflorescence development in seeded diploid ‘Tamnara’ grapevines with or without GA application. Without GA application, VvIAA9, VvARF7, and VvARF8 were expressed at a relatively high level before full bloom, but decreased thereafter following pollination. After GA application at 14 days before full bloom (DBF); however, the expression levels of VvIAA9 and VvARF7 declined at 5 DBF prior to pollination. The effects of GA application on auxin levels or auxin signaling were also analyzed by monitoring the expression patterns of auxin biosynthesis genes and auxin-responsive genes with or without GA application. Transcription levels of the auxin biosynthesis genes Vitis anthranilate synthase β subunit (VvASB1-like), Vitis YUCCA2 (VvYUC2), and VvYUC6 were not significantly changed by GA application. However, the expressions of Vitis Gretchen Hagen3.2 (VvGH3.2) and VvGH3.3, auxin-responsive genes, were up-regulated from 2 DBF to full bloom with GA application. Furthermore, the Vitis GA signaling gene, VvDELLA was up-regulated by GA application during 12 DBF to 7 DBF, prior to down-regulation of VvIAA9 and VvARF7. These results suggest that VvIAA9 and VvARF7 are negative regulators of fruit set initiation in grapevines, and GA signaling is integrated with auxin signaling via VvDELLA during

  18. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  19. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  20. Investment Primer for Green Revolving Funds

    Science.gov (United States)

    Weisbord, Dano

    2012-01-01

    Developing return-oriented green revolving funds (GRFs) is a rapidly growing trend at colleges and universities. A green revolving fund (GRF) is a special account designated for investment in on-campus projects that improve energy efficiency or decrease material use. GRFs invest in a variety of cost-saving initiatives, resulting in significant…

  1. Bond strength of primer/cement systems to zirconia subjected to artificial aging.

    Science.gov (United States)

    Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

    2016-11-01

    Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (P<.05), except for CCP/PAN versus PAN with 24H (P=.741). SU/RU had the highest bond strength among the groups for all treatments (P<.05), except for CCP/PAN versus SU/RU with 30D/TC (P=.171). Among the nonprimed groups, only RU went through 30D/TC without premature debonding. With 24H and 30D, the failure modes in SU/RU and CCP/PAN were purely mixed, whereas those in the other groups were mainly adhesive, except for RU. The superiority of the initial bond strength in SU/RU may result from some functional components other than MDP. The presence of MDP in the cement did not appear to have a positive effect on long-term bond

  2. Influence of power density and primer application on polymerization of dual-cured resin cements monitored by ultrasonic measurement.

    Science.gov (United States)

    Takubo, Chikako; Yasuda, Genta; Murayama, Ryosuke; Ogura, Yukari; Tonegawa, Motoka; Kurokawa, Hiroyasu; Miyazaki, Masashi

    2010-08-01

    We used ultrasonic measurements to monitor the influence of power density and primer application on the polymerization reaction of dual-cured resin cements. The ultrasonic equipment comprised a pulser-receiver, transducers, and an oscilloscope. Resin cements were mixed and inserted into a transparent mould, and specimens were placed on the sample stage, onto which the primer, if used, was also applied. Power densities of 0 (no irradiation), 200, or 600 mW cm(-2) were used for curing. The transit time through the cement disk was divided by the specimen thickness to obtain the longitudinal sound velocity. When resin cements were light-irradiated, each curve displayed an initial plateau of approximately 1,500 m s(-1), which rapidly increased to a second plateau of 2,300-2,900 m s(-1). The rate of sound velocity increase was retarded when the cements were light-irradiated at lower power densities, and increased when the primer was applied. The polymerization behaviour of dual-cured resin cements was therefore shown to be affected by the power density of the curing unit and the application of self-etching primer. (c) 2010 The Authors. Journal compilation (c) 2010 Eur J Oral Sci.

  3. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  4. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  6. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  7. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  8. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  9. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  10. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  13. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  14. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  15. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  16. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  17. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  18. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  19. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Macroecology: A Primer for Biological Oceanography

    Science.gov (United States)

    Li, W. K. W.

    2016-02-01

    Macroecology is the study of ecological patterns discerned at a spatial, temporal, or organization scale higher than that at which the focal entities interact. Such patterns are statistical or emergent manifestations arising from the ensemble of component entities. Although macroecology is a neologism largely based in terrestrial and avian ecology, macroscopic patterns have long been recognised in biological oceanography. Familiar examples include Redfield elemental stoichiometry, Elton trophic pyramids, Sheldon biomass spectrum, and Margalef life-forms mandala. Macroecological regularities can often be found along various continua, such as along body size in power-law scaling or along habitat temperature in metabolic theory. Uniquely in oceanography, a partition of the world ocean continuum into Longhurst biogeochemical provinces provides a spatial organization well-suited for macroecological investigations. In this rational discrete approach, fundamental processes in physical and biological oceanography that differentiate a set of non-overlapping ocean regions also appear to shape the macroecological structure of phytoplankton communities.

  2. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  3. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  4. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    Science.gov (United States)

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  5. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  6. Light front field theory: an advanced primer

    International Nuclear Information System (INIS)

    Martinovic, L.

    2007-01-01

    We present an elementary introduction to quantum field theory formulated in terms of Dirac's light front variables. In addition to general principles and methods, a few more specific topics and approaches based on the author's work will be discussed. Most of the discussion deals with massive two-dimensional models formulated in a finite spatial volume starting with a detailed comparison between quantization of massive free fields in the usual field theory and the light front (LF) quantization. We discuss basic properties such as relativistic invariance and causality. After the LF treatment of the soluble Federbush model, a LF approach to spontaneous symmetry breaking is explained and a simple gauge theory - the massive Schwinger model in various gauges is studied. A LF version of bosonization and the massive Thirring model are also discussed. A special chapter is devoted to the method of discretized light cone quantization and its application to calculations of the properties of quantum solitons. The problem of LF zero modes is illustrated with the example of the two/dimensional Yukawa model. Hamiltonian perturbation theory in the LF formulation is derived and applied to a few simple processes to demonstrate its advantages. As a byproduct, it is shown that the LF theory cannot be obtained as a 'light-like' limit of the usual field theory quantized on a initial space-like surface. A simple LF formulation of the Higgs mechanism is then given Since our intention was to provide a treatment of the light front quantization accessible to postgradual students, an effort was made to discuss most of the topics pedagogically and number of technical details and derivations are contained in the appendices (Author)

  7. A U.S. Biodefense Strategy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Poulin, D

    2009-05-11

    The anthrax mailings that followed the attacks of September 11, 2001 highlighted the need for a comprehensive national strategy to prevent, prepare for, respond to, and mitigate the effects of biological attacks. The goal of U.S. biodefense strategy is to reduce the likelihood of a future biological event, improve overall U.S. public health security, and minimize the economic and social disruption of a biological incident. Presidential communications, federal legislation, and executive agency planning documents provide the foundation for this strategy. Central to current U.S. biodefense strategy is the 2004 Homeland Security Presidential Directive (HSPD) 10, Biodefense for the 21st Century, which states that ''the United States will use all means necessary to prevent, protect against, and mitigate biological weapons attacks perpetrated against our homeland and our global interests.'' HSPD-10 also sets forth four pillars of U.S. biodefense: {sm_bullet} Threat awareness includes timely, accurate, and relevant intelligence, threat assessment, and the anticipation of future threats. {sm_bullet} Prevention and protection involve continuing and expanding efforts to limit access to agents, technologies, and knowledge to certain groups and countries as well as protecting critical infrastructure from the effects of biological attacks. {sm_bullet} Surveillance and detection provide early warning or recognition of biological attacks to permit a timely response and mitigation of consequences as well as attribution. {sm_bullet} Response and recovery include pre-attack planning and preparedness, capabilities to treat casualties, risk communications, physical control measures, medical countermeasures, and decontamination capabilities.

  8. PENGOLAHAN PRIMER LIMBAH TEKSTIL DENGAN ELEKTROKOAGULASI

    Directory of Open Access Journals (Sweden)

    Lieke Riadi

    2014-12-01

    Full Text Available Limbah industri tekstil di area pinggir kota Surabaya mempunyai karakteristik perbandingan COD dan BOD = 5.57. Limbah jenis ini sulit untuk dibiodegradasi. Studi ini mempelajari tekonologi elektrokoagulasi untuk mengolah limbah tekstil dengan menurunkan intensitas warna, Total Suspended Solid (TSS dan Chemical Oxygen Demand (COD. Percobaan batch pada suhu kamar dilakukan untuk mempelajari pengaruh pH, jarak elektroda terhadap penurunan warna,TSS dan COD dan membandingkan biaya operasinya jika menggunakan pengolahan kimia.Effisiensi penurunan tertinggi untuk warna (91.96%,  TSS (49.17%, dan COD (29.67% terjadi pada pH awal 4.0 dan jarak elektroda 2 cm dengan  elektroda Al/Al. Waktu optimum penurunan intensitas warna dalah 10 menit. Laju penurunan COD adalah : -dC/dt = 0.0053 C +0.056 , dengan C adalah konsentrasi COD. Jumlah sludge yang dihasilkan daripengolahan elektrokoagulasi  3.4 % lebih kecil dibandingkan menggunakan bahan kimia. Biaya yang digunakan untuk pengolahan dengan elektrokoagulasi 52.35 % lebih murah dibandingkan jika menggunakan koagulasi dengan bahan kimia ( tawas. Kata kunci : elektrokoagulasi, penurunan warna, penurunan TSS, laju degradasi COD, imbah tekstil Abstract Waste water from textile industry which is located in one suburb of Surabaya city as characteristic which the ratio of COD to BOD was 5.57. This type of waste water is difficult to be biodegraded. This study investigated elektrokoagulasi technology to treat textile waste water by removing color, total suspended solid, and Chemical Oxygen Demand. Batch experiment at room temperature was carried out to study the effect of pH, electrode distance for color, TSS and COD removal. This study also tried to compare the operation cost between elektrokoagulasi and chemical processes. The best removal efficiencies by Al electrodes was 91.96 % for color, 49.17 % for TSS and 29.67 % for COD which were under initial pH 4.0 and electrodes distance 2 cm. The optimum operation

  9. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  10. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  11. Counting SET-free sets

    OpenAIRE

    Harman, Nate

    2016-01-01

    We consider the following counting problem related to the card game SET: How many $k$-element SET-free sets are there in an $n$-dimensional SET deck? Through a series of algebraic reformulations and reinterpretations, we show the answer to this question satisfies two polynomiality conditions.

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  15. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  16. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  17. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  18. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  19. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  20. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  1. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  2. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  3. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  4. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  5. Automatic sets and Delone sets

    International Nuclear Information System (INIS)

    Barbe, A; Haeseler, F von

    2004-01-01

    Automatic sets D part of Z m are characterized by having a finite number of decimations. They are equivalently generated by fixed points of certain substitution systems, or by certain finite automata. As examples, two-dimensional versions of the Thue-Morse, Baum-Sweet, Rudin-Shapiro and paperfolding sequences are presented. We give a necessary and sufficient condition for an automatic set D part of Z m to be a Delone set in R m . The result is then extended to automatic sets that are defined as fixed points of certain substitutions. The morphology of automatic sets is discussed by means of examples

  6. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  7. Biocompatibility of RealSeal, its primer and AH Plus implanted in subcutaneous connective tissue of rats

    Directory of Open Access Journals (Sweden)

    Fabiana Soares Grecca

    2011-02-01

    Full Text Available OBJECTIVE: This study tested rat connective tissue response to RealSeal, RealSeal primer or AH Plus after 7, 15, 30, 60 and 90 days of implantation. MATERIAL AND METHODS: Thirty Wistar rats had subcutaneous sockets created on their back and received four implants each of polyethylene tubes containing one of the materials tested according to the groups: AH (AH Plus Sealer; RS (RealSeal Sealer; RP (RealSeal Primer; CG (control group - empty tube. After histological processing, sections were analyzed to identify the presence of neutrophils, lymphocytes and plasma cells, eosinophils, macrophages and giant cells, as well as fibrous capsule and abscesses, by an examiner using light microscope. Kruskal-Wallis and multiple-comparisons test were used for statistical analysis. Significance level was set at 5%. RESULTS: Lymphoplasmacytic infiltrate scores significantly higher than those of the control group were observed at 14 and 60 days in AH group, and at 90 days in RS group (p<0.05. There were no differences in terms of presence of macrophages, giant cells, eosinophils, neutrophils or fibrosis. AH Plus group scored higher for abscesses at 7 days than after any other period (p=0.031. RP group scored higher for lymphoplasmacytic infiltrate at 14 days than at 90 days (p=0.04. CONCLUSION: The main contribution of this study was to demonstrate that issues involved with tissue tolerance of a Resilon-containing sealer, RealSeal Sealer, cannot be attributed to its primer content.

  8. Potasssium chloride as a nutrient seed primer to enhance salt‑tolerance in maize

    Directory of Open Access Journals (Sweden)

    Badar‑uz‑Zaman

    2012-08-01

    Full Text Available The objective of this work was to determine if KCl could be a useful nutrient primer for safe seed germination in maize crop under salt stress conditions. Seed priming was done using 50 mmol L‑1 of muriate of potash, and germination and seedling growth were evaluated after salt stress with NaCl up to 50 mmol L‑1. Another set of seeds was tested under the same salt stress conditions without priming. Under salinity stress, germination percentage, germination rate index, germination coefficient, and seedling vigor indexes were higher in primed seeds. In unprimed seeds, mean germination time increased, while the germination rate index and the fresh and dry matter mass decreased more sharply with salinity stress. The Na/K ratio was higher in unprimed seeds.

  9. HBA1C CONTROL AND COST-EFFECTIVENESS IN PATIENTS WITH TYPE 2 DIABETES MELLITUS INITIATED ON CANAGLIFLOZIN OR A GLUCAGON-LIKE PEPTIDE 1 RECEPTOR AGONIST IN A REAL-WORLD SETTING.

    Science.gov (United States)

    Wysham, Carol H; Pilon, Dominic; Ingham, Mike; Lafeuille, Marie-Hélène; Emond, Bruno; Kamstra, Rhiannon; Pfeifer, Michael; Lefebvre, Patrick

    2018-03-01

    To compare glycated hemoglobin (HbA1c) control and medication costs between patients with type 2 diabetes mellitus (T2DM) treated with canagliflozin 300 mg (CANA) or a glucagon-like peptide 1 receptor agonist (GLP-1 RA) in a real-world setting. Adults with T2DM newly initiated on CANA or a GLP-1 RA (index date) were identified from IQVIA ™ Real-World Data Electronic Medical Records U.S. database (March 29, 2012-April 30, 2016). Inverse probability of treatment weighting accounted for differences in baseline characteristics. HbA1c levels at 3-month intervals were compared using generalized estimating equations. Medication costs used wholesale acquisition costs. For both cohorts (CANA: n = 11,435; GLP-1 RA: n = 11,582), HbA1c levels decreased at 3 months postindex and remained lower through 30 months. Absolute changes in mean HbA1c from index to 3 months postindex for CANA and GLP-1 RA were -1.16% and -1.21% (patients with baseline HbA1c ≥7% [53 mmol/mol]); -1.54% and -1.51% (patients with baseline HbA1c ≥8% [64 mmol/mol]); and -2.13% and -1.99% (patients with baseline HbA1c ≥9% [75 mmol/mol]), respectively. Postindex, CANA patients with baseline HbA1c ≥7% had similar HbA1c levels at each interval versus GLP-1 RA patients, except 9 months (mean HbA1c, 7.75% [61 mmol/mol] vs. 7.86% [62 mmol/mol]; P = .0305). CANA patients with baseline HbA1c ≥8% and ≥9% had consistently lower HbA1c numerically versus GLP-1 RA patients and statistically lower HbA1c at 9 (baseline HbA1c ≥8% or ≥9%), 27, and 30 months (baseline HbA1c ≥9%). Continuous 12-month medication cost $3,326 less for CANA versus GLP-1 RA. This retrospective study demonstrated a similar evolution of HbA1c levels among CANA and GLP-1 RA patients in a real-world setting. Lower medication costs suggest CANA is economically dominant over GLP-1 RA (similar effectiveness, lower cost). AHA = antihyperglycemic agent BMI = body mass index CANA = canagliflozin 300 mg DCSI = diabetes complications severity

  10. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  11. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  12. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  13. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  14. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  15. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  16. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  17. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  18. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  19. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  20. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  1. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  2. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  3. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  4. Manufacturing Initiative

    Data.gov (United States)

    National Aeronautics and Space Administration — The Advanced Manufacturing Technologies (AMT) Project supports multiple activities within the Administration's National Manufacturing Initiative. A key component of...

  5. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  6. Small finger protein of avian and murine retroviruses has nucleic acid annealing activity and positions the replication primer tRNA onto genomic RNA.

    Science.gov (United States)

    Prats, A C; Sarih, L; Gabus, C; Litvak, S; Keith, G; Darlix, J L

    1988-06-01

    Retrovirus virions carry a diploid genome associated with a large number of small viral finger protein molecules which are required for encapsidation. Our present results show that finger protein p12 of Rous sarcoma virus (RSV) and p10 of murine leukaemia virus (MuLV) positions replication primer tRNA on the replication initiation site (PBS) at the 5' end of the RNA genome. An RSV mutant with a Val-Pro insertion in the finger motif of p12 is able to partially encapsidate genomic RNA but is not infectious because mutated p12 is incapable of positioning the replication primer, tRNATrp. Since all known replication competent retroviruses, and the plant virus CaMV, code for finger proteins analogous to RSV p12 or MuLV p10, the initial stage of reverse transcription in avian, mammalian and human retroviruses and in CaMV is probably controlled in an analogous way.

  7. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  8. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  10. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  11. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  12. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    Science.gov (United States)

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and

  13. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  14. Data Sets from Major NCI Initiaves

    Science.gov (United States)

    The NCI Data Catalog includes links to data collections produced by major NCI initiatives and other widely used data sets, including animal models, human tumor cell lines, epidemiology data sets, genomics data sets from TCGA, TARGET, COSMIC, GSK, NCI60.

  15. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  16. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  17. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  18. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  19. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  20. Unilateral initiatives

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    This paper reports on arms control which is generally thought of in terms of formal negotiations with an opponent, with the resulting agreements embodied in a treaty. This is not surprising, since arms control discussions between opponents are both important and politically visible. There are, however, strong reasons for countries to consider and frequently take unilateral initiatives. To do so is entirely consistent with the established major precepts of arms control which state that arms control is designed to reduce the risk of war, the costs of preparing for war, and the death and destruction if war should come. Unilateral initiatives on what weapons are purchased, which ones are eliminated and how forces are deployed can all relate to these objectives. There are two main categories of motives for unilateral initiatives in arms control. In one category, internal national objectives are the dominant, often sole, driving force; the initiative is undertaken for our own good

  1. Ports Initiative

    Science.gov (United States)

    EPA's Ports Initiative works in collaboration with the port industry, communities, and government to improve environmental performance and increase economic prosperity. This effort helps people near ports breath cleaner air and live better lives.

  2. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  3. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  4. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  5. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  6. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  7. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  8. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  9. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  10. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  11. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  12. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  13. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  14. Early diagnosis of HIV in children below 18 months using DNA PCR test--assessment of the effectiveness of PMTCT interventions and challenges in early initiation of ART in a resource-limited setting.

    Science.gov (United States)

    Gupta, Anil; Singh, Girraj; Kaushik, Pratap; Joshi, Bipin; Kalra, Kamlesh; Chakraborty, Sabyasachi

    2013-04-01

    This study was conducted to assess efficacy of the current Indian Prevention of Mother-to-Child Transmission (PMTCT) protocol in 217 HIV-exposed infants, and to assess challenges in the early initiation of antiretroviral treatment (ART) in 18 (8.3%) infants with HIV, as determined by the HIV-1 DNA polymerase chain reaction (PCR) test at ≥ 6 weeks to ART was initiated in 10 (55.6%) HIV-infected children at a mean ± standard deviation (SD) age of 10.45 ± 4.9 (range: 4-17.5) months; delay resulted in opportunistic infections in one-third of the children. A single-dose nevirapine PMTCT regimen should be replaced by a triple antiretroviral regimen; DBS DNA PCR-positive infants may be given ART, and simultaneously a whole blood specimen should be taken to determine whether ART should be continued.

  15. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  16. Mixed-Initiative Clustering

    Science.gov (United States)

    Huang, Yifen

    2010-01-01

    Mixed-initiative clustering is a task where a user and a machine work collaboratively to analyze a large set of documents. We hypothesize that a user and a machine can both learn better clustering models through enriched communication and interactive learning from each other. The first contribution or this thesis is providing a framework of…

  17. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  18. Initial Study

    DEFF Research Database (Denmark)

    Torp, Kristian

    2009-01-01

    increased. In the initial study presented here, the time it takes to pass an intersection is studied in details. Two major signal-controlled four-way intersections in the center of the city Aalborg are studied in details to estimate the congestion levels in these intersections, based on the time it takes...

  19. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  20. Viscosupplementation for Osteoarthritis: a Primer for Primary Care Physicians

    Science.gov (United States)

    2015-01-01

    Introduction Osteoarthritis (OA) constitutes a growing public health burden and the most common cause of disability in the United States. Non-pharmacologic modalities and conservative pharmacologic therapies are recommended for the initial treatment of OA, including acetaminophen, and topical and oral non-steroidal anti-inflammatory drugs. However, safety concerns continue to mount regarding the use of these treatments and none have been shown to impact disease progression. Viscosupplementation with injections of hyaluronans (HAs) are indicated when non-pharmacologic and simple analgesics have failed to relieve symptoms (e.g., pain, stiffness) associated with knee OA. This review evaluates literature focusing on the efficacy and/or safety of HA injections in treating OA of the knee and in other joints, including the hip, shoulder, and ankle. Methods Relevant literature on intra-articular (IA) HA injections as a treatment for OA pain in the knee and other joints was identified through PubMed database searches from inception until January 2013. Search terms included “hyaluronic acid” or “hylan”, and “osteoarthritis”. Discussion Current evidence indicates that HA injections are beneficial and safe for patients with OA of the knee. IA injections of HAs treat the symptoms of knee OA and may also have disease-modifying properties, potentially delaying progression of OA. Although traditionally reserved for second-line treatment, evidence suggests that HAs may have value as a first-line therapy in the treatment of knee OA as they have been shown to be more effective in earlier stages and grades of disease, more recently diagnosed OA, and in less severe radiographic OA. Conclusion For primary care physicians who treat and care for patients with OA of the knee, IA injection with HAs constitutes a safe and effective treatment that can be routinely administered in the office setting. PMID:24203348

  1. HIV-1 reverse transcription initiation: a potential target for novel antivirals?

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Berkhout, Ben

    2008-01-01

    Reverse transcription is an essential step in the retroviral life cycle, as it converts the genomic RNA into DNA. In this review, we describe recent developments concerning the initiation step of this complex, multi-step reaction. During initiation of reverse transcription, a cellular tRNA primer is

  2. The Yekaterinburg headache initiative

    DEFF Research Database (Denmark)

    Lebedeva, Elena R; Olesen, Jes; Osipova, Vera V

    2013-01-01

    for a demonstrational interventional project in Russia, undertaken within the Global Campaign against Headache. The initiative proposes three actions: 1) raise awareness of need for improvement; 2) design and implement a three-tier model (from primary care to a single highly specialized centre with academic affiliation......) for efficient and equitable delivery of headache-related health care; 3) develop a range of educational initiatives aimed at primary-care physicians, non-specialist neurologists, pharmacists and the general public to support the second action. RESULTS AND CONCLUSION: We set these proposals in a context...... of a health-care needs assessment, and as a model for all Russia. We present and discuss early progress of the initiative, justify the investment of resources required for implementation and call for the political support that full implementation requires. The more that the Yekaterinburg headache initiative...

  3. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  4. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  5. C-Reactive Protein (CRP), Interferon Gamma-Inducible Protein 10 (IP-10), and Lipopolysaccharide (LPS) Are Associated with Risk of Tuberculosis after Initiation of Antiretroviral Therapy in Resource-Limited Settings

    Science.gov (United States)

    Tenforde, Mark W.; Gupte, Nikhil; Dowdy, David W.; Asmuth, David M.; Balagopal, Ashwin; Pollard, Richard B.; Sugandhavesa, Patcharaphan; Lama, Javier R.; Pillay, Sandy; Cardoso, Sandra W.; Pawar, Jyoti; Santos, Breno; Riviere, Cynthia; Mwelase, Noluthando; Kanyama, Cecilia; Kumwenda, Johnstone; Hakim, James G.; Kumarasamy, Nagalingeswaran; Bollinger, Robert; Semba, Richard D.; Campbell, Thomas B.; Gupta, Amita

    2015-01-01

    Objective The association between pre-antiretroviral (ART) inflammation and immune activation and risk for incident tuberculosis (TB) after ART initiation among adults is uncertain. Design Nested case-control study (n = 332) within ACTG PEARLS trial of three ART regimens among 1571 HIV-infected, treatment-naïve adults in 9 countries. We compared cases (participants with incident TB diagnosed by 96 weeks) to a random sample of controls (participants who did not develop TB, stratified by country and treatment arm). Methods We measured pre-ART C-reactive protein (CRP), EndoCab IgM, ferritin, interferon gamma (IFN-γ), interleukin 6 (IL-6), interferon gamma-inducible protein 10 (IP-10), lipopolysaccharide (LPS), soluble CD14 (sCD14), tumor necrosis factor alpha (TNF-α), and CD4/DR+/38+ and CD8/DR+/38+ T cells. Markers were defined according to established cutoff definitions when available, 75th percentile of measured values when not, and detectable versus undetectable for LPS. Using logistic regression, we measured associations between biomarkers and incident TB, adjusting for age, sex, study site, treatment arm, baseline CD4 and log10 viral load. We assessed the discriminatory value of biomarkers using receiver operating characteristic (ROC) analysis. Results Seventy-seven persons (4.9%) developed incident TB during follow-up. Elevated baseline CRP (aOR 3.25, 95% CI: 1.55–6.81) and IP-10 (aOR 1.89, 95% CI: 1.05–3.39), detectable plasma LPS (aOR 2.39, 95% CI: 1.13–5.06), and the established TB risk factors anemia and hypoalbuminemia were independently associated with incident TB. In ROC analysis, CRP, albumin, and LPS improved discrimination only modestly for TB risk when added to baseline routine patient characteristics including CD4 count, body mass index, and prior TB. Conclusion Incident TB occurs commonly after ART initiation. Although associated with higher post-ART TB risk, baseline CRP, IP-10, and LPS add limited value to routine patient characteristics

  6. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  7. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  8. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  9. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  10. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  11. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  12. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  13. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  14. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  15. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  16. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  17. Quality assurance and quality control of geochemical data—A primer for the research scientist

    Science.gov (United States)

    Geboy, Nicholas J.; Engle, Mark A.

    2011-01-01

    Geochemistry is a constantly expanding science. More and more, scientists are employing geochemical tools to help answer questions about the Earth and earth system processes. Scientists may assume that the responsibility of examining and assessing the quality of the geochemical data they generate is not theirs but rather that of the analytical laboratories to which their samples have been submitted. This assumption may be partially based on knowledge about internal and external quality assurance and quality control (QA/QC) programs in which analytical laboratories typically participate. Or there may be a perceived lack of time or resources to adequately examine data quality. Regardless of the reason, the lack of QA/QC protocols can lead to the generation and publication of erroneous data. Because the interpretations drawn from the data are primary products to U.S. Geological Survey (USGS) stakeholders, the consequences of publishing erroneous results can be significant. The principal investigator of a scientific study ultimately is responsible for the quality and interpretation of the project's findings, and thus must also play a role in the understanding, implementation, and presentation of QA/QC information about the data. Although occasionally ignored, QA/QC protocols apply not only to procedures in the laboratory but also in the initial planning of a research study and throughout the life of the project. Many of the tenets of developing a sound QA/QC program or protocols also parallel the core concepts of developing a good study: What is the main objective of the study? Will the methods selected provide data of enough resolution to answer the hypothesis? How should samples be collected? Are there known or unknown artifacts or contamination sources in the sampling and analysis methods? Assessing data quality requires communication between the scientists responsible for designing the study and those collecting samples, analyzing samples, treating data, and

  18. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  19. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  20. NASA and ESA Collaboration on Hexavalent Chrome Alternatives - Pretreatments with Primers Screening Final Test Report

    Science.gov (United States)

    Rothgeb, Matthew J.; Kessel, Kurt R.

    2015-01-01

    Hexavalent chromium (hex chrome or Cr(VI)) is a widely used element within applied coating systems because of its self-healing and corrosion-resistant properties. The replacement of hex chrome in the processing of aluminum for aviation and aerospace applications remains a goal of great significance. Aluminum is the major manufacturing material of structures and components in the space flight arena. The National Aeronautics and Space Administration (NASA) and the European Space Agency (ESA) are engaged in a collaborative effort to test and evaluate alternatives to hexavalent chromium containing corrosion coating systems. NASA and ESA share common risks related to material obsolescence associated with hexavalent chromium used in corrosion-resistant coatings. In the United States, Occupational Safety and Health Administration (OSHA) studies have concluded that hexavalent chromium is carcinogenic and poses significant risk to human health. On May 5, 2011, amendments to the Defense Federal Acquisition Regulation Supplement (DFARS) were issued in the Federal Register. Subpart 223.73 prohibits contracts from requiring hexavalent chromium in deliverables unless certain exceptions apply. Subpart 252.223-7008 provides the contract clause prohibiting contractors and subcontractors from using or delivering hexavalent chromium in a concentration greater than 0.1 percent by weight for all new contracts associated with supplies, maintenance and repair services, and construction materials. ESA faces its own increasingly stringent regulations within European directives such as Registration, Evaluation, Authorization and Restriction of Chemical (REACH) substances and the Restriction of Hazardous Substances Directive (RoHS) which have set a mid-2017 sunset date for hexavalent chromium. NASA and ESA continue to search for an alternative to hexavalent chromium in coatings applications that meet their performance requirements in corrosion protection, cost, operability, and health and

  1. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  2. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  3. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  4. Arthroscopic meniscectomy for degenerative meniscal tears reduces knee pain but is not cost-effective in a routine health care setting: a multi-center longitudinal observational study using data from the osteoarthritis initiative.

    Science.gov (United States)

    Rongen, J J; Govers, T M; Buma, P; Rovers, M M; Hannink, G

    2018-02-01

    It is disputed whether arthroscopic meniscectomy is an (cost-) effective treatment for degenerative meniscus tears in day-to-day clinical practice. The objective of this study was to assess the cost-effectiveness of arthroscopic meniscectomy in subjects with knee osteoarthritis, in routine clinical practice, while taking into account the increased risk for future knee replacement surgery. We compared cost-effectiveness of arthroscopic meniscectomy compared to no surgery. We used a state transition (Markov) simulation model to evaluate the cost-effectiveness of arthroscopic meniscectomy compared to no surgery in subjects with knee osteoarthritis (age range 45-79 years). Data used in the preparation of the current study were obtained from the Osteoarthritis Initiative (AOI) database. We applied a 9 years' time horizon (which is equal to the current OAI study follow up period), and evaluated cost-effectiveness from a societal perspective. The main outcome measure was the incremental cost-effectiveness ratio (Euros per quality adjusted life-year (QALY) gained). Arthroscopic meniscectomy was associated with 8.09 (SD ± 0.07) QALYs at a cost of € 21,345 (SD ± 841), whereas the no surgery was associated with 8.05 (SD ± 0.07) QALYs at a cost of € 16,284 (SD ± 855). For arthroscopic meniscectomy, the incremental cost per QALY gained was € 150,754. In day-to-day clinical practice, arthroscopic meniscectomy in subjects with knee osteoarthritis is associated with € 150,754 per QALY gained, which exceeds the generally accepted willingness to pay (WTP) (range € 20,000-€ 80,000). Copyright © 2017 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  5. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  6. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  7. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  8. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  9. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  10. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  11. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  12. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  13. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  14. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  15. Initial validation of the Argentinean Spanish version of the PedsQL™ 4.0 Generic Core Scales in children and adolescents with chronic diseases: acceptability and comprehensibility in low-income settings

    Directory of Open Access Journals (Sweden)

    Bauer Gabriela

    2008-08-01

    Full Text Available Abstract Background To validate the Argentinean Spanish version of the PedsQL™ 4.0 Generic Core Scales in Argentinean children and adolescents with chronic conditions and to assess the impact of socio-demographic characteristics on the instrument's comprehensibility and acceptability. Reliability, and known-groups, and convergent validity were tested. Methods Consecutive sample of 287 children with chronic conditions and 105 healthy children, ages 2–18, and their parents. Chronically ill children were: (1 attending outpatient clinics and (2 had one of the following diagnoses: stem cell transplant, chronic obstructive pulmonary disease, HIV/AIDS, cancer, end stage renal disease, complex congenital cardiopathy. Patients and adult proxies completed the PedsQL™ 4.0 and an overall health status assessment. Physicians were asked to rate degree of health status impairment. Results The PedsQL™ 4.0 was feasible (only 9 children, all 5 to 7 year-olds, could not complete the instrument, easy to administer, completed without, or with minimal, help by most children and parents, and required a brief administration time (average 5–6 minutes. People living below the poverty line and/or low literacy needed more help to complete the instrument. Cronbach Alpha's internal consistency values for the total and subscale scores exceeded 0.70 for self-reports of children over 8 years-old and parent-reports of children over 5 years of age. Reliability of proxy-reports of 2–4 year-olds was low but improved when school items were excluded. Internal consistency for 5–7 year-olds was low (α range = 0.28–0.76. Construct validity was good. Child self-report and parent proxy-report PedsQL™ 4.0 scores were moderately but significantly correlated (ρ = 0.39, p Conclusion Results suggest that the Argentinean Spanish PedsQL™ 4.0 is suitable for research purposes in the public health setting for children over 8 years old and parents of children over 5 years old

  16. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  17. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  18. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    Science.gov (United States)

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Openness initiative

    International Nuclear Information System (INIS)

    Duncan, S.S.

    1995-01-01

    Although antinuclear campaigns seem to be effective, public communication and education efforts on low-level radioactive waste have mixed results. Attempts at public information programs on low-level radioactive waste still focus on influencing public opinion. A question then is: open-quotes Is it preferable to have a program focus on public education that will empower individuals to make informed decisions rather than trying to influence them in their decisions?close quotes To address this question, a case study with both quantitative and qualitative data will be used. The Ohio Low-Level Radioactive Waste Education Program has a goal to provide people with information they want/need to make their own decisions. The program initiated its efforts by conducting a statewide survey to determine information needed by people and where they turned for that information. This presentation reports data from the survey and then explores the program development process in which programs were designed and presented using the information. Pre and post data from the programs reveal attitude and knowledge shifts

  20. Openness initiative

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, S.S. [Los Alamos National Lab., NM (United States)

    1995-12-31

    Although antinuclear campaigns seem to be effective, public communication and education efforts on low-level radioactive waste have mixed results. Attempts at public information programs on low-level radioactive waste still focus on influencing public opinion. A question then is: {open_quotes}Is it preferable to have a program focus on public education that will empower individuals to make informed decisions rather than trying to influence them in their decisions?{close_quotes} To address this question, a case study with both quantitative and qualitative data will be used. The Ohio Low-Level Radioactive Waste Education Program has a goal to provide people with information they want/need to make their own decisions. The program initiated its efforts by conducting a statewide survey to determine information needed by people and where they turned for that information. This presentation reports data from the survey and then explores the program development process in which programs were designed and presented using the information. Pre and post data from the programs reveal attitude and knowledge shifts.

  1. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  2. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  3. Initiative hard coal; Initiative Steinkohle

    Energy Technology Data Exchange (ETDEWEB)

    Leonhardt, J.

    2007-08-02

    In order to decrease the import dependence of hard coal in the European Union, the author has submitted suggestions to the director of conventional sources of energy (directorate general for energy and transport) of the European community, which found a positive resonance. These suggestions are summarized in an elaboration 'Initiative Hard Coal'. After clarifying the starting situation and defining the target the presupposition for a better use of hard coal deposits as raw material in the European Union are pointed out. On that basis concrete suggestions for measures are made. Apart from the conditions of the deposits it concerns thereby also new mining techniques and mining-economical developments, connected with tasks for the mining-machine industry. (orig.)

  4. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  5. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  6. Difference sets connecting algebra, combinatorics, and geometry

    CERN Document Server

    Moore, Emily H

    2013-01-01

    Difference sets belong both to group theory and to combinatorics. Studying them requires tools from geometry, number theory, and representation theory. This book lays a foundation for these topics, including a primer on representations and characters of finite groups. It makes the research literature on difference sets accessible to students who have studied linear algebra and abstract algebra, and it prepares them to do their own research. This text is suitable for an undergraduate capstone course, since it illuminates the many links among topics that the students have already studied. To this end, almost every chapter ends with a coda highlighting the main ideas and emphasizing mathematical connections. This book can also be used for self-study by anyone interested in these connections and concrete examples. An abundance of exercises, varying from straightforward to challenging, invites the reader to solve puzzles, construct proofs, and investigate problems--by hand or on a computer. Hints and solutions are...

  7. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  8. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  9. Cross-border migration and initiation of others into drug injecting in Tijuana, Mexico.

    Science.gov (United States)

    Rafful, Claudia; Melo, Jason; Medina-Mora, María Elena; Rangel, Gudelia; Sun, Xiaoying; Jain, Sonia; Werb, Dan

    2018-04-01

    Efforts to prevent injection drug use (IDU) are increasingly focusing on the role that people who inject drugs (PWID) play in facilitating the entry of others into this behaviour. This is particularly relevant in settings experiencing high levels of IDU, such as Mexico's northern border region, where cross-border migration, particularly through forced deportation, has been found to increase a range of health and social harms related to injecting. PWID enrolled in a prospective cohort study in Tijuana, Mexico, since 2011 were interviewed semi-annually, which solicited responses on their experiences initiating others into injecting. Univariate and multivariable logistic regression analyses were conducted at the Preventing Injection by Modifying Existing Responses (PRIMER) baseline, with the dependent variable defined as reporting ever initiating others into injection. The primary independent variable was lifetime deportation from the USA to Mexico. Among 532 participants, 14% (n = 76) reported initiating others into injecting, the majority of participants reporting initiating acquaintances (74%, n = 56). In multivariable analyses, initiating others into injecting was independently associated with reporting living in the USA for 1-5 years [adjusted odds ratio (AOR) = 2.42; 95% confidence interval (CI) 1.22-4.79, P = 0.01], and methamphetamine and heroin injection combined (AOR = 3.67; 95% CI 1.11-12.17, P = 0.03). Deportation was not independently associated with initiating others into injecting. The impact of migration needs to be considered within binational programming seeking to prevent the expansion of epidemics of injecting and HIV transmission among mobile populations residing in the Mexico-USA border region. © 2017 Australasian Professional Society on Alcohol and other Drugs.

  10. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    , suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...... site to allow correct second-strand transfer in reverse transcription. The system thereby selects for a reverse transcriptase-mediated recombination event in the 5' untranslated region. A panel of sequence differences between the recombination partners in this region has allowed mapping of the site...

  11. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))

    2012-03-15

    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  12. Social settings and addiction relapse.

    Science.gov (United States)

    Walton, M A; Reischl, T M; Ramanthan, C S

    1995-01-01

    Despite addiction theorists' acknowledgment of the impact of environmental factors on relapse, researchers have not adequately investigated these influences. Ninety-six substance users provided data regarding their perceived risk for relapse, exposure to substances, and involvement in reinforcing activities. These three setting attributes were assessed in their home, work, and community settings. Reuse was assessed 3 months later. When controlling for confounding variables, aspects of the home settings significantly distinguished abstainers from reusers; perceived risk for relapse was the strongest predictor of reuse. Exposure to substances and involvement in reinforcing activities were not robust reuse indicators. The work and community settings were not significant determinants of reuse. These findings offer some initial support for the utility of examining social settings to better understand addiction relapse and recovery. Identification of setting-based relapse determinants provides concrete targets for relapse prevention interventions.

  13. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  14. Primer Control System Cyber Security Framework and Technical Metrics

    Energy Technology Data Exchange (ETDEWEB)

    Wayne F. Boyer; Miles A. McQueen

    2008-05-01

    The Department of Homeland Security National Cyber Security Division supported development of a control system cyber security framework and a set of technical metrics to aid owner-operators in tracking control systems security. The framework defines seven relevant cyber security dimensions and provides the foundation for thinking about control system security. Based on the developed security framework, a set of ten technical metrics are recommended that allow control systems owner-operators to track improvements or degradations in their individual control systems security posture.

  15. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  16. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  17. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  18. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  19. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  1. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  2. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  3. Health initiatives conducted outside hospitals and other medical settings

    DEFF Research Database (Denmark)

    Mik-Meyer, Nanna

    2016-01-01

    The aim of this essay is to critically reflect on the concept of health. ‘Health’ refers not only to the absence of biomedical diseases and bodily and mental dysfunctionalities; today, the concept is also synonymous with wellness, happiness, and a good life. However, this broad definition of what......, believed to lead a lesser work life, family life, love life, etc....

  4. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  5. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  6. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  7. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  8. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  9. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  10. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  11. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  12. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  13. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  14. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  15. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  16. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  17. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Directory of Open Access Journals (Sweden)

    Zhiyuan Wu

    2014-01-01

    Full Text Available A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph- negative myeloproliferative neoplasms (MPNs. The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS, quantitative PCR (qPCR and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process.

  18. A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

    Science.gov (United States)

    Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

    2014-01-01

    A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

  19. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  20. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  1. iRODS Primer Integrated Rule-Oriented Data System

    CERN Document Server

    Rajasekar, Arcot

    2010-01-01

    Policy-based data management enables the creation of community-specific collections. Every collection is created for a purpose. The purpose defines the set of properties that will be associated with the collection. The properties are enforced by management policies that control the execution of procedures that are applied whenever data are ingested or accessed. The procedures generate state information that defines the outcome of enforcing the management policy. The state information can be queried to validate assessment criteria and verify that the required collection properties have been con

  2. IEP, IHP, and Section 504 Primer for New School Nurses.

    Science.gov (United States)

    Galemore, Cynthia A; Sheetz, Anne H

    2015-03-01

    Three types of documents and their frequently used acronyms play a vital role in ensuring that students with disabilities have the planning, services, and accommodations necessary to facilitate attendance and success in the school setting. Federal and state laws, as well as state nurse practice acts, govern the process and eligibility of students for these services. School nurses play a vital role in these processes, and new school nurses benefit from a comparison of the terms along with a historical explanation of the acronyms. © 2015 The Author(s).

  3. Titulación académica y posibilidades de acceso al primer empleo

    Directory of Open Access Journals (Sweden)

    ET. OTROS

    2009-11-01

    Full Text Available RESUMEN: El presente artículo realiza una revisión sobre el estado de la cuestión de la temática focalizada y recoge una investigación de carácter cualitativo. La técnica de recogida de información utilizada ha sido la entrevista. La investigación abordada versa sobre un estudio de caso, acerca de la titulación académica de los empleados de una empresa del sector del comercio en España y sus posibilidades de acceso al primer empleo.De la investigación se desprende que existe una estrecha relación entre la formación y el empleo llegando a convertirse en uno de los mayores condicionantes para la consecución y mantenimiento de éste. Los titulados medios y universitarios no encuentran dificultades para optar al primer empleo en el sector del comercio en España, debido a que todos presentan un nivel de estudios superior al solicitado para el trabajo que realizan en los primeros años de su vida laboral. A pesar de que el nivel de estudios no asegura la obtención del primer empleo coloca a las personas en una situación privilegiada para lograrlo, así la formación ofrece una predisposición para conseguirlo. Con todo, es recomendable desarrollar procedimientos para ofrecer una educación inicial más adaptada al contexto laboral de cada titulación académica que propicien un grado de exigencia coherente con la capacitación profesional.ABSTRACT: The present article is a review on the state of art of the topic starting from a qualitative approach. The technique Lised to collect data was the interview. This is a case study about the academic degrees of the employees of a company in the business sector in Spain and their possibilities of obtaining their first job.One conclusión is the cióse relationship between training and employment and how the former is one of the greatest conditioners in attaining and maintaining the latter. Persons with secondary diplomas and university degrees have no difficulties in gaining their first job

  4. Vacuum type D initial data

    Science.gov (United States)

    García-Parrado Gómez-Lobo, Alfonso

    2016-09-01

    A vacuum type D initial data set is a vacuum initial data set of the Einstein field equations whose data development contains a region where the space–time is of Petrov type D. In this paper we give a systematic characterisation of a vacuum type D initial data set. By systematic we mean that the only quantities involved are those appearing in the vacuum constraints, namely the first fundamental form (Riemannian metric) and the second fundamental form. Our characterisation is a set of conditions consisting of the vacuum constraints and some additional differential equations for the first and second fundamental forms These conditions can be regarded as a system of partial differential equations on a Riemannian manifold and the solutions of the system contain all possible regular vacuum type D initial data sets. As an application we particularise our conditions for the case of vacuum data whose data development is a subset of the Kerr solution. This has applications in the formulation of the nonlinear stability problem of the Kerr black hole.

  5. Initiation devices, initiation systems including initiation devices and related methods

    Energy Technology Data Exchange (ETDEWEB)

    Daniels, Michael A.; Condit, Reston A.; Rasmussen, Nikki; Wallace, Ronald S.

    2018-04-10

    Initiation devices may include at least one substrate, an initiation element positioned on a first side of the at least one substrate, and a spark gap electrically coupled to the initiation element and positioned on a second side of the at least one substrate. Initiation devices may include a plurality of substrates where at least one substrate of the plurality of substrates is electrically connected to at least one adjacent substrate of the plurality of substrates with at least one via extending through the at least one substrate. Initiation systems may include such initiation devices. Methods of igniting energetic materials include passing a current through a spark gap formed on at least one substrate of the initiation device, passing the current through at least one via formed through the at least one substrate, and passing the current through an explosive bridge wire of the initiation device.

  6. MELATONIN DAN MELATONIN RECEPTOR AGONIST SEBAGAI PENANGANAN INSOMNIA PRIMER KRONIS

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Ayu Maha Iswari

    2013-04-01

    Full Text Available Melatonin is a hormone that has an important role in the mechanism of sleep. Hypnotic effects of melatonin and melatonin receptor agonist are mediated via MT1 and MT2 receptors, especially in circadian rhythm pacemaker, suprachiasmatic nucleus, which is worked on the hypothalamic sleep switch. This mechanism is quite different with the GABAergic drugs such as benzodiazepine. Agonist melatonin triggers the initiation of sleep and normalize circadian rhythms so that makes it easier to maintain sleep. The main disadvantage of melatonin in helping sleep maintenance on primary insomnia is that the half life is very short. The solution to this problem is the use of prolonged-release melatonin and melatonin receptor agonist agents such as ramelteon. Melatoninergic agonist does not cause withdrawal effects, dependence, as well as cognitive and psychomotor disorders as often happens on the use of benzodiazepine.  

  7. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  8. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  9. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  10. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  11. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  12. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  13. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  14. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  15. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  16. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  17. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  18. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  19. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  20. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…