Universal primers that amplify RNA from all three flavivirus subgroups
Directory of Open Access Journals (Sweden)
Barnard Ross T
2008-01-01
Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Glennon, Kelsey L; Cron, Glynis V
2016-05-01
Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.
Prunier, Rachel; Latimer, Andrew
2010-01-01
Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].
Chen, Suiqing; Lu, Xiaolei; Wang, Lili
2011-05-01
To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.
Glennon, Kelsey L.; Cron, Glynis V.
2016-01-01
Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125
Directory of Open Access Journals (Sweden)
Dunn Sade N
2008-06-01
Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.
Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin
2013-01-01
Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin
2003-06-01
Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.
Directory of Open Access Journals (Sweden)
Wang Xiaowei
2008-12-01
Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev
2016-02-09
Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang
2014-10-21
Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Low-copy nuclear primers and ycf1 primers in Cactaceae.
Franck, Alan R; Cochrane, Bruce J; Garey, James R
2012-10-01
To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers
Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li
2017-01-01
Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424
Inter simple sequence repeats (ISSR) and random amplified ...
African Journals Online (AJOL)
21 of 30 random amplified polymorphic DNA (RAPD) primers produced 220 reproducible bands with average of 10.47 bands per primer and 80.12% of polymorphism. OPR02 primer showed the highest number of effective allele (Ne), Shannon index (I) and genetic diversity (H). Some of the cultivars had specific bands, ...
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions.
Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele
2008-08-29
Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Primer sets for cloning the human repertoire of T cell Receptor Variable regions
Directory of Open Access Journals (Sweden)
Santoro Claudio
2008-08-01
Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.
Directory of Open Access Journals (Sweden)
Andrés Alvarado
Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.
Detection of somaclonal variation by random amplified polymorphic ...
African Journals Online (AJOL)
Detection of somaclonal variation by random amplified polymorphic DNA analysis during micropropagation of Phalaenopsis bellina (Rchb.f.) Christenson. ... Among the primers used, P 16 produced the highest number of bands (29), while primer OPU 10 produced the lowest number (15). The range of similarity coefficient ...
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Application of randomly amplified polymorphic DNA (RAPD ...
African Journals Online (AJOL)
Jane
2011-10-10
Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...
Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.
Yofe, Ido; Schuldiner, Maya
2014-02-01
The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Christopher A Gulvik
Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Elsheikha, H M; Schott, H C; Mansfield, L S
2006-06-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.
PCR detection of a Maell polymorphism in the human major breakpoint cluster region (BCR)
Energy Technology Data Exchange (ETDEWEB)
McClure, J.S.; Litz, C.E. (Medical School, Minneapolis, MN (United States))
1991-09-25
Nested primer pairs flanking the second intron of the breakpoint cluster region were constructed from the published cDNA sequence. The outer primer pair 5{prime}BCR Exon 2 (5{prime}-GTT TCA GAA GCT TCT CCC TG-3{prime}) and 3{prime}BCR Exon 3 (5{prime}-ACT CTG CTT AAA TCC AGT GG-3{prime}), amplified a fragment of genomic DNA approximately 810 bp in length. The inner primer pair, 3{prime}BCR Exon 2(5{prime}-CGC TGA CCA TCA ATA AGG AA-3{prime}) and 5{prime}BCR Exon 3 (5{prime}-AGA AAC CCA TAG AGC CCC GG-3{prime}), amplified a fragment approximately 730 bp in length. Double stranded DNA amplified with the outer primer pair was subjected to asymmetric PCR using the inner primer pair. Sequencing reactions were performed using the Sequenase dideoxy sequencing kit with S{sup 35}-dATP. Sequences in homozygotes revealed either an A or a G 85 bp 5{prime} of the BCR BamHI site. Heterozygotes demonstrated both bands at the corresponding position.
Efficiency of random amplified polymorphic DNA (RAPD) and inter ...
African Journals Online (AJOL)
Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.
Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi
2016-01-01
Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153
Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi
2016-01-01
Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies.
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.
An iterative method for selecting degenerate multiplex PCR primers.
Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong
2007-01-01
Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.
Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie
2016-06-01
Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter
Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.
Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G
2013-09-01
New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples
Directory of Open Access Journals (Sweden)
Alexandre R. Zuntini
2013-08-01
Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.
SRAP analysis of M3 lotus mutants induced by Fe+ ion implantation
International Nuclear Information System (INIS)
Jia Yanyan; Deng Chuanliang; Gao Jun; Ren Yingxue; Wang Ningna; Gao Wujun; Lu Longdou; Zhang Tao; Li Pengfei
2011-01-01
To examine and determine the lotus mutants induced by the same Fe + ion implantation at the molecular level, the SRAP technique was used, and the non denatured polyacrylamide gel electrophoresis was undertaken to analyze the PCR products. At the optimized SRAP reaction condition, of the 121 primer pairs tested, 10 primer pairs could amplify stable and remarkable specific bands, with primer polymorphism of 8.26%. This 10 primer pairs amplified a total of 215 bands, 83 of which were polymorphic, and the percent of polymorphic bands was 38.6%. A total of 141 bands were amplified for the mutant 1, 22 of which were different from the control with the variation ratio of 15.6%. However, the variation ratios of mutant 2 to 6 were 16.4%, 17.1%, 16.9%, 18.2% and 20.5% respectively. The results indicated that Fe + ion implantation into the seeds of Baiyangdian red lotus could induce random genetic DNA variations. (authors)
Bansal, N S; McDonell, F
1997-01-01
The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...
Zhang, J; Zhang, L G
2014-02-14
Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.
Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P
2008-07-22
Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.
The Dynamics of Multiple Pair-Wise Collisions in a Chain for Designing Optimal Shock Amplifiers
Directory of Open Access Journals (Sweden)
Bryan Rodgers
2009-01-01
Full Text Available The major focus of this work is to examine the dynamics of velocity amplification through pair-wise collisions between multiple masses in a chain, in order to develop useful machines. For instance low-cost machines based on this principle could be used for detailed, very-high acceleration shock-testing of MEMS devices. A theoretical basis for determining the number and mass of intermediate stages in such a velocity amplifier, based on simple rigid body mechanics, is proposed. The influence of mass ratios and the coefficient of restitution on the optimisation of the system is identified and investigated. In particular, two cases are examined: in the first, the velocity of the final mass in the chain (that would have the object under test mounted on it is maximised by defining the ratio of adjacent masses according to a power law relationship; in the second, the energy transfer efficiency of the system is maximised by choosing the mass ratios such that all masses except the final mass come to rest following impact. Comparisons are drawn between both cases and the results are used in proposing design guidelines for optimal shock amplifiers. It is shown that for most practical systems, a shock amplifier with mass ratios based on a power law relationship is optimal and can easily yield velocity amplifications of a factor 5–8 times. A prototype shock testing machine that was made using above principles is briefly introduced.
Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae
Directory of Open Access Journals (Sweden)
Francesco Dal Grande
2013-03-01
Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Yang, Jiuru; Ma, Yu; OuYang, Yunlun; Liu, Chunyu; Zhang, Jiaxiao
2014-07-01
Fiber grating-pair is one of the efficient methods for gain stabilization of erbium doped fiber amplifier (EDFA) but with a gain-reduction of signals, especially in C-band. In order to overcome it, in this article, we establish a configuration of EDFA based uniform fiber grating-pair and conduct a comprehensive study on gain stabilization by varying the reflectivity, center wavelength and 3dB bandwidth of grating, and by varying the channel number and pump power. The numerical results show that under the optimal parameters of grating the gain stabilization at 1550nm is +/-0.044dB with high gain and large dynamic range.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic
Directory of Open Access Journals (Sweden)
Pamela E. Akin-Idowu
2016-01-01
Full Text Available Efficient utilization of plant genetic resources for nutrition and crop improvement requires systematic understanding of the important traits. Amaranthus species are distributed worldwide with an interesting diversity of landraces and cultivars whose leaves and seeds are consumed. Despite their potential to enhance food security and economic livelihoods, grain amaranth breeding to improve nutritional quality and adoption by farmers in sub-Saharan Africa is scanty. This study assessed the variation among 29 grain amaranth accessions using 27 phenotypic (10 morphological and 17 nutritional characters and 16 random amplified polymorphic DNA (RAPD primers. Multivariate analysis of phenotypic characters showed the first four principal components contributing 57.53% of observed variability, while cluster analysis yielded five groups at 87.5% similarity coefficient. RAPD primers generated a total of 193 amplicons with an average of 12.06 amplicons per primer, 81% of which were polymorphic. Genetic similarities based on Jaccard’s coefficient ranged from 0.61 to 0.88. The RAPD-based unweighted pair group method with arithmetic mean dendrogram grouped the accessions into nine clusters, with the same species clustering together. RAPD primers distinguished the accessions more effectively than phenotypic markers. Accessions in the different clusters as obtained can be exploited for heterotic gain in desired nutritional traits.
MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling
Directory of Open Access Journals (Sweden)
Kitchen James L
2012-11-01
Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.
Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G
2012-11-05
Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.
Genetic variability of Indian yaks using random amplified ...
African Journals Online (AJOL)
Only five primers (ILO 526, OPAV 15, ILO 1127, ILO 1065 and ILO 876) out of the ten primers tried produced consistant polymorphic fingerprints. Of the 76 fingerprints produced, 49 were present in all types, 21 were individual specific and 6 were polymorphic for different types. The pair wise comparison studied for different ...
Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.
2015-01-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers
Pair formation models for sexually transmitted infections: A primer
Directory of Open Access Journals (Sweden)
Mirjam Kretzschmar
2017-08-01
Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number
UniPrime2: a web service providing easier Universal Primer design.
Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C
2009-07-01
The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.
Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda
2006-01-01
Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.
Genotyping via Sequence Related Amplified Polymorphism Markers in Fusarium culmorum
Directory of Open Access Journals (Sweden)
Işıl Melis Zümrüt
2018-02-01
Full Text Available Fusarium culmorum is predominating causal agent of head blight (HB and root rot (RR in cereals worldwide. Since F. culmorum has a great level of genetic diversity and the parasexual stage is assumed for this phytopathogen, characterization of isolates from different regions is significant step in food safety and controlling the HB. In this study, it was aimed to characterize totally 37 F. culmorum isolates from Turkey via sequence related amplified polymorphism (SRAP marker based genotyping. MAT-1/MAT-2 type assay was also used in order to reveal intraspecific variation in F. culmorum. MAT-1 and MAT-2 specific primer pairs for mating assays resulted in 210 and 260 bp bands, respectively. 11 of isolates were belonged to MAT-1 type whereas 19 samples were of MAT-2. Remaining 7 samples yielded both amplicons. Totally 9 SRAP primer sets yielded amplicons from all isolates. Genetic similarity values were ranged from 39 to 94.7%. Total band number was 127 and PCR product sizes were in the range of 0.1-2.5 kb. Amplicon numbers for individuals were ranged from 1 to 16. According to data obtained from current study, SRAP based genotyping is powerful tool for supporting the data obtained from investigations including phenotypic and agro-ecological characteristics. Findings showed that SRAP-based markers could be useful in F. culmorum characterization.
Genus-Specific Primers for Study of Fusarium Communities in Field Samples
Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna
2015-01-01
Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387
Genetic diversity of Santalum album using random amplified ...
African Journals Online (AJOL)
In the present study Random Amplified Polymorphic DNA (RAPD) technique was used to accesses the genetic diversity among 30 accessions of S. album collected from different parts of South India. A total of 248 polymorphic amplicons were obtained from 30 primers. The value of Jaccard coefficient ranged from 0.66 to ...
Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae
Directory of Open Access Journals (Sweden)
Andrew L. Krohn
2013-07-01
Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.
International Nuclear Information System (INIS)
BIBI, S.; Khan, I.A.; Naqvi, M.H.; Siddiqui, M.A.; Yasmeen, S.; Seema, M.
2012-01-01
Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)
Pair formation models for sexually transmitted infections : A primer
Kretzschmar, MEE; Heijne, Janneke C M
For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward
Adlar, F. R.; Bela, B.
2017-08-01
To anticipate the potential use of anti-integrase drugs in Indonesia for treatment of HIV-1 infection, the development of a drug resistance genotyping assay for anti-integrase is crucial in identifying the genetic drug resistance profile of Indonesian HIV-1 strains. This experiment aimed to amplify a target region in the integrase gene of Indonesian HIV-1 subtypes CRF01_AE and B that contain genetic mutations known to confer resistance to anti-integrase drug. Eleven archived plasma samples from individuals living with HIV-1 were obtained from the Virology and Cancer Pathobiology Research Center for Health Service (VCPRC FKUI-RSCM) laboratory. One of the plasma samples contained HIV-1 subtype B, and the remaining plasma samples contained subtype CRF01_AE. The target regions for all samples were amplified through RT-PCR, with an annealing temperature of 55 °C, using the primer pair AE_POL 4086F and AE_POL 5232R that were designed by VCPRC FKUI-RSCM. The results of this experiment show that 18.2% (2/11) of the samples were successfully amplified using the one-step RT-PCR. While the primer pair was effective in amplifying the target region in the integrase gene sequence for subtype B (100%; 1/1), it had a low efficacy (10%, 1/10) for subtype CRF01_AE. In conclusion, the primer pair can be used to amplify the target region in Indonesian HIV-1 strain subtypes CRF01_AE and B. However, optimization of the PCR condition and an increased number of samples would help to determine an accurate representation of the efficacy of the primer pair.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Directory of Open Access Journals (Sweden)
Alex D. Twyford
2013-05-01
Full Text Available Premise of the study: Transcriptome sequence data were used to design microsatellite primers for two widespread Central American Begonia species, B. heracleifolia and B. nelumbiifolia, to investigate population structure and hybridization. Methods and Results: The transcriptome from vegetative meristem tissue from the related B. plebeja was mined for microsatellite loci, and 31 primer pairs amplified in the target species. Fifteen primer pairs were combined in two multiplex PCR reactions, which amplified an average of four alleles per locus. Conclusions: The markers developed will be a valuable genetic resource for medium-throughput genotyping of Central American species of Begonia sect. Gireoudia. A subset of these markers have perfect sequence matches to Asian B. venusta, and are promising for studies in other Begonia sections.
Detecção molecular de Hepatozoon canis e Babesia canis vogeli em cães domésticos de Cuiabá, Brasil
Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura
2011-01-01
The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co-infection of Babesia spp. and Hep...
Spolidorio,Mariana Granziera; Torres,Mariana de Medeiros; Campos,Wilma Neres da Silva; Melo,Andréia Lima Tomé; Igarashi,Michelle; Amude,Alexandre Mendes; Labruna,Marcelo Bahia; Aguiar,Daniel Moura
2011-01-01
The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co-infection of Babesia spp. and Hep...
Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S
2010-06-01
The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.
Directory of Open Access Journals (Sweden)
Joseph-Alexander Verreet
2011-01-01
Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.
Directory of Open Access Journals (Sweden)
M. Jorjandi
2014-08-01
Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
-Bio gene Soil DNA extraction kit (MP Biomedicals, Ohio, U.S.) according to the manufacturer’s instructions. DNA samples from the three stations were amplified using fungal-specific ITS1F/ITS4 [13], primer pair a, as well as universal ITS1/ITS4, primer...NTPs (0.2 mM each), primers (0.5 μM each), and 1 X PCR buffer (Roche, Switzerland.). Reaction mixture without template DNA was used as a negative control and sediments spiked with fungal DNA was used as a positive control. Amplified products were gel...
Gamper, H.A.; Leuchtmann, A.
2007-01-01
Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking
Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C
2015-12-02
Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.
Directory of Open Access Journals (Sweden)
Douglas de Almeida Pereira
2015-09-01
Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui
2015-01-01
Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun
2009-03-01
Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.
Polymerase chain reaction as a tool for developing stress protein probes
Energy Technology Data Exchange (ETDEWEB)
Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)
1994-08-01
Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo
2007-04-01
Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).
Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R
2013-06-06
Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.
PCR strategy for identification and differentiation of small pox and other orthopoxviruses.
Ropp, S L; Jin, Q; Knight, J C; Massung, R F; Esposito, J J
1995-08-01
Rapid identification and differentiation of orthopoxviruses by PCR were achieved with primers based on genome sequences encoding the hemagglutinin (HA) protein, an infected-cell membrane antigen that distinguishes orthopoxviruses from other poxvirus genera. The initial identification step used a primer pair of consensus sequences for amplifying an HA DNA fragment from the three known North American orthopoxviruses (raccoonpox, skunkpox, and volepox viruses), and a second pair for amplifying virtually the entire HA open reading frame of the Eurasian-African orthopoxviruses (variola, vaccinia, cowpox, monkeypox, camelpox, ectromelia, and gerbilpox viruses). RsaI digest electropherograms of the amplified DNAs of the former subgroup provided species differentiation, and TaqI digests differentiated the Eurasian-African orthopoxviruses, including vaccinia virus from the vaccinia virus subspecies buffalopox virus. Endonuclease HhaI digest patterns distinguished smallpox variola major viruses from alastrim variola minor viruses. For the Eurasian-African orthopoxviruses, a confirmatory step that used a set of higher-sequence-homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross-contaminated orthopoxvirus DNA samples; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity. Finally, a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species, which enabled production of a single DNA fragment of a particular size that indicated the specific species.
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita
2014-01-01
Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789
Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita
2014-11-01
Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.
Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R
2007-01-01
We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.
Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.
Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F
2003-07-01
ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.
International Nuclear Information System (INIS)
Zhan Fangfang; Zhou Xiaoming; Xing Da
2013-01-01
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental
Directory of Open Access Journals (Sweden)
Miyazawa Takayuki
2010-12-01
Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.
Caetano-Anollés, G; Gresshoff, P M
1996-06-01
DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Heng, Shuangping; Shi, Dianyi; Hu, Zhenhua; Huang, Tao; Li, Jinping; Liu, Liyan; Xia, Chunxiu; Yuan, Zhenzhen; Xu, Yuejin; Fu, Tingdong; Wan, Zhengjie
2015-09-01
A new non-heading Chinese cabbage CMS line M119A was characterized and specific molecular markers were developed to classify different CMS types. One new non-heading Chinese cabbage (Brassica rapa L.) cytoplasmic male sterile (CMS) line M119A was obtained by interspecific crosses between the recently discovered hau CMS line of Brassica juncea and B. rapa. Furthermore, the line was characterized and compared with other five isonuclear-alloplasmic CMS lines. The M119A line produced six stamens without pollen and only two stamen fused together in fewer flowers. Tissue section indicated that anther abortion in M119A may have occurred during differentiation of the archesporial cells without pollen sac. All the six CMS lines were grouped into three types based on the presence of three PCR fragments of 825, 465 and 772 bp amplified with different mitochondrial genes specific primers. The 825-bp fragment was amplified both in 09-10A and H201A using the specific primer pair P-orf224-atp6, and showed 100 % identity with the mitochondrial gene of pol CMS. The 465-bp fragment was amplified in 30A and 105A using the primer pair P-orf138 and shared 100 % identity with the mitochondrial gene of ogu CMS. The 772-bp fragment was amplified in M119A and H203A using the primer pair P-orf288 and showed 100 % identity with the mitochondrial gene of hau CMS. Therefore, these markers could efficiently distinguish different types of isonuclear-alloplasmic CMS lines of non-heading Chinese cabbage, which were useful for improving the efficiency of cross-breeding and heterosis utilization in cruciferous vegetables.
International Nuclear Information System (INIS)
R, Maria Lina; S, Dadang; Suhadi, F.
2000-01-01
To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR
Free-electron laser system with Raman amplifier outcoupling
Energy Technology Data Exchange (ETDEWEB)
Linford, G.J.
1988-05-03
A free-electron laser system is described comprising: a free-electron laser pump beam generator producing a high-power optical output beam in a vacuum environement; a Raman amplifier cell located in the path of the output beam from the pump beam generator; means for generating and introducing a Stokes seed beam into the Raman amplifier cell, a pair of gaseous windows through which the output beam enters and leaves the Raman amplifier cell, each window having a stream of gas moving continuously in a direction generally perpendicular to the beam; and a mirror positioned in the path of the output beam from the Raman amplifier, the mirror functioning to reflect and further direct the output beam, but not the unwanted spectral components.
Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S
Energy Technology Data Exchange (ETDEWEB)
Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)
2013-01-25
Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection
Development and Testing of New Gene-Homologous EST-SSRs for Eucalyptus gomphocephala (Myrtaceae
Directory of Open Access Journals (Sweden)
Donna Bradbury
2013-07-01
Full Text Available Premise of the study: New microsatellite (simple sequence repeat [SSR] primers were developed from Eucalyptus expressed sequence tags (ESTs and optimized for genetic studies of the southwestern Australian tree E. gomphocephala, which is severely impacted by tree health decline and habitat fragmentation. Methods and Results: A total of 133 gene-homologous EST-SSR primer pairs were designed for Eucalyptus, and 44 were screened in E. gomphocephala. Of these, 17 produced reliable amplification products and 11 were polymorphic. Between two and 13 alleles were observed per locus, and observed heterozygosities ranged from 0.172 to 0.867. All 17 EST-SSRs that amplified E. gomphocephala cross-amplified to at least one of E. marginata, E. camaldulensis, and E. victrix. Conclusions: This set of EST-SSR primer pairs will be valuable tools for future population genetic studies of E. gomphocephala and other eucalypts, particularly for studying gene-linked variation and informing seed-sourcing strategies for ecological restoration.
Wang, Hongxia; Walla, James A; Zhong, Shaobin; Huang, Danqiong; Dai, Wenhao
2012-11-01
Chokecherry (Prunus virginiana L.) (2n = 4x = 32) is a unique Prunus species for both genetics and disease-resistance research due to its tetraploid nature and X-disease resistance. However, no genetic and genomic information on chokecherry is available. A partial chokecherry genome was sequenced using Roche 454 sequencing technology. A total of 145,094 reads covering 4.8 Mbp of the chokecherry genome were generated and 15,113 contigs were assembled, of which 11,675 contigs were larger than 100 bp in size. A total of 481 SSR loci were identified from 234 (out of 11,675) contigs and 246 polymerase chain reaction (PCR) primer pairs were designed. Of 246 primers, 212 (86.2 %) effectively produced amplification from the genomic DNA of chokecherry. All 212 amplifiable chokecherry primers were used to amplify genomic DNA from 11 other rosaceous species (sour cherry, sweet cherry, black cherry, peach, apricot, plum, apple, crabapple, pear, juneberry, and raspberry). Thus, chokecherry SSR primers can be transferable across Prunus species and other rosaceous species. An average of 63.2 and 58.7 % of amplifiable chokecherry primers amplified DNA from cherry and other Prunus species, respectively, while 47.2 % of amplifiable chokecherry primers amplified DNA from other rosaceous species. Using random genome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no sequence information available. Sequence information and confirmed transferability of the identified chokecherry SSRs among species will be valuable for genetic research in Prunus and other rosaceous species. Key message A total of 246 SSR primers were identified from chokecherry genome sequences. Of which, 212 were confirmed amplifiable both in chokecherry and other 11 other rosaceous species.
Near quantum limited amplification from inelastic Cooper-pair tunneling
Hofheinz, Max; Jebari, Salha; Blanchet, Florian; Grimm, Alexander; Hazra, Dibyendu; Albert, Romain; Portier, Fabien
Josephson parametric amplifiers approach quantum-limited noise performance but require strong external microwave pump tones which make them more difficult to use than DC powered amplifiers: The pump tone can affect the device under test and requires expensive room-temperature equipment. Inelastic Cooper pair tunneling processes through a small DC voltage-biased Josephson junction, where a tunneling Cooper pair dissipates its energy 2 eV in the form of two photons are reminiscent of parametric down conversion. We show that these processes can be used to provide amplification near the quantum limit without external microwave pump tone. We explain the measured gain and noise based on the P (E) theory of inelastic Cooper pair tunneling and general fluctuation-dissipation relations.
Li, X Y; Xu, H X; Chen, J W
2014-04-29
Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.
VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI
Directory of Open Access Journals (Sweden)
Gun Gun Gumilar
2005-06-01
Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR
Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng
2015-03-01
DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Optical oscillator-amplifier laser configuration
International Nuclear Information System (INIS)
McAllister, G.L.
1975-01-01
A laser is described that has incorporated therein an oscillator formed by a pair of mirrors, at least one of the mirrors being positioned outside of the envelope. The mirrors are dimensioned and spaced from each other so that the resonator has a relatively low Fresnel number and is operated unstably. The entire surface of one of these mirrors is convex and diffracts a portion of the energy outside of the oscillator region. Also incorporated into the laser is an amplifier region defined by a separate pair of mirrors which receive the energy diffracted from the oscillator region. The second pair of mirrors form an optical system with a high Fresnel number. A filter, modulator or other control for the laser signal may be placed outside the laser envelope in the optical path of the oscillator
Fontaine, Emmanuelle; Coste, Sébastien; Poyat, Chrystelle; Klein, Céline; Lefort, Hugues; Leclerc, Thomas; Dubourdieu, Stéphane; Briche, Frédérique; Jost, Daniel; Maurin, Olga; Domanski, Laurent; Tourtier, Jean-Pierre
2014-01-01
The aim of this study was to evaluate the capacity of a traditional stethoscope versus an electronically amplified one (expected to reduce background and ambient noise) to assess heart and respiratory sounds during medical transport. It was a prospective, double-blinded, randomized performed study. One traditional stethoscope (Littmann Cardiology III; 3M, St Paul, MN) and 1 electronically amplified stethoscope (Littmann 3200, 3M) were used for our tests. Heart and lung auscultation during real medical evacuations aboard a medically configured Falcon 50 aircrafts were studied. The quality of auscultation was ranged using a numeric rating scale from 0 to 10 (0 corresponding to "I hear nothing" and 10 to "I hear perfectly"). Data collected were compared using a t-test for paired values. A total of 40 comparative evaluations were performed. For cardiac auscultation, the value of the rating scale was 4.53 ± 1.91 and 7.18 ± 1.88 for the traditional and amplified stethoscope, respectively (paired t-test: P auscultation was estimated at 3.1 ± 1.95 for a traditional stethoscope and 5.10 ± 2.13 for the amplified one (paired t-test: P < .0001). This study showed that practitioners would be better helped in hearing cardiac and respiratory sounds with an electronically amplified stethoscope than with a traditional one during air medical transport in a medically configured Falcon 50 aircraft. Copyright © 2014 Air Medical Journal Associates. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.
1991-01-01
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation
Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus
2015-01-01
Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Multiplex polymerase chain reaction (PCR) and fluorescence-based ...
African Journals Online (AJOL)
reading 7
2011-12-28
Dec 28, 2011 ... mitochondrial DNA and cytochrome b as an internal PCR control. The amplified species- ... more labour-saving than using each pair of species- specific primers separately for .... obtained from the NCBI nucleotide data bank.
1977-01-01
The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.
Li, Wenbin; Brlansky, Ronald H; Hartung, John S
2006-05-01
Herbaria are important resources for the study of the origins and dispersal of plant pathogens, particularly bacterial plant pathogens that incite local lesions in which large numbers of pathogen genomes are concentrated. Xanthomonas axonopodis pv. citri (Xac), the causal agent of citrus bacterial canker disease, is a notable example of such a pathogen. The appearance of novel strains of the pathogen in Florida and elsewhere make it increasingly important to understand the relationships among strains of this pathogen. USDA-ARS at Beltsville, Maryland maintains approximately 700 herbarium specimens with citrus canker disease lesions up to 90 years old, originally collected from all over the world, and so is an important resource for phytogeographic studies of this bacterium. Unfortunately, DNA in herbarium specimens is degraded and may contain high levels of inhibitors of PCR. In this study, we compared a total of 23 DNA isolation techniques in combination with 31 novel primer pairs in order to develop an efficient protocol for the analysis of Xac DNA in herbarium specimens. We identified the most reliable extraction method, identified in terms of successful amplification by our panel of 31 primer pairs. We also identified the most robust primer pairs, identified as successful in the largest number of extracts prepared by different methods. We amplified Xac genomic sequences up to 542 bp long from herbarium samples up to 89 years old. Primers varied in effectiveness, with some primer pairs amplifying Xac DNA from a 1/10,000 dilution of extract from a single lesion from a citrus canker herbarium specimen. Our methodology will be useful to identify pathogens and perform molecular analyses of bacterial and possibly fungal genomes from herbarium specimens.
Tetranucleotide microsatellite loci from the black bear (Ursus americanus)
Sanderlin, J.S.; Faircloth, B.C.; Shamblin, B.; Conroy, M.J.
2009-01-01
We describe primers and polymerase chain reaction conditions to amplify 21 tetranucleotide microsatellite DNA loci in black bears (Ursus americanus). We tested primers using individuals from two populations, one each in Georgia and Florida. Among individuals from Georgia (n = 29), primer pairs yielded an average of 2.9 alleles (range, one to four) and an average observed heterozygosity (HO) of 0.50 (range, 0.00 to 0.79). Among individuals from Florida (n = 19), primer pairs yielded an average of 5.7 alleles (range, one to 14) and an HO of 0.55 (range, 0.00 to 1.00). A comparison of previously developed markers with individuals from Georgia suggests that bear populations in Georgia and Florida have reduced allelic diversity relative to other populations. ?? 2008 The Authors.
The internal transcribed spacer rDNA specific markers for ...
African Journals Online (AJOL)
GREGORY
2010-09-13
Sep 13, 2010 ... amplified efficiently when paired with universal primer ITS4 in Z. piperitum, but not in Z. schinifolium. ..... generation of protein database search programs. ... Dillon SL, Lawrence PK, Henry RJ, Ross L, Price HJ, Johnston JS.
Directory of Open Access Journals (Sweden)
Morteza Shojaei Moghadam
2010-01-01
Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.
Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations
Directory of Open Access Journals (Sweden)
DiaS Edelberto S.
1998-01-01
Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes
Directory of Open Access Journals (Sweden)
Nomin Batnyam
2012-01-01
Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.
Sex identification of four penguin species using locus-specific PCR.
Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng
2013-01-01
Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.
Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija
1999-01-01
A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 33...
Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko
2016-02-01
The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zuiter Afnan
2012-08-01
Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
AFLP genetic polymorphism in wild barley (Hordeum spontaneum) populations in Israel
Turpeinen, T.; Vanhala, T.; Nevo, E.; Nissila, E.
2003-01-01
The genetic diversity produced by the amplified fragment length polymorphism (AFLP) method was studied in 94 genotypes of wild barley, Hordeum spontaneum (C. Koch) Thell., originating from ten ecologically and geographically different locations in Israel. Eight primer pairs produced 204 discernible
Guenni, K; Aouadi, M; Chatti, K; Salhi-Hannachi, A
2016-10-17
Sequence-related amplified polymorphism (SRAP) markers preferentially amplify open reading frames and were used to study the genetic diversity of Tunisian pistachio. In the present study, 43 Pistacia vera accessions were screened using seven SRAP primer pairs. A total of 78 markers was revealed (95.12%) with an average polymorphic information content of 0.850. The results suggest that there is strong genetic differentiation, which characterizes the local resources (G ST = 0.307). High gene flow (N m = 1.127) among groups was explained by the exchange of plant material among regions. Analysis of molecular variance revealed significant differences within groups and showed that 73.88% of the total genetic diversity occurred within groups, whereas the remaining 26.12% occurred among groups. Bayesian clustering and principal component analysis identified three pools, El Guettar, Pollenizers, and the rest of the pistachios belonging to the Gabès, Kasserine, and Sfax localities. Bayesian analysis revealed that El Guettar and male genotypes were assigned with more than 80% probability. The BayeScan method proposed that locus 59 (F13-R9) could be used in the development of sex-linked SCAR markers from SRAP since it is a commonly detected locus in comparisons involving the Pollenizers group. This is the first application of SRAP markers for the assessment of genetic diversity in Tunisian germplasm of P. vera. Such information will be useful to define conservation strategies and improvement programs for this species.
Directory of Open Access Journals (Sweden)
Alejandro Gonzalez-Martinez
2015-01-01
Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.
International Nuclear Information System (INIS)
Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.
2017-01-01
The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)
Development of Polymorphic Microsatellite Markers for Indian Tobacco, Lobelia inflata (Campanulaceae
Directory of Open Access Journals (Sweden)
P. William Hughes
2014-04-01
Full Text Available Premise of the study: Nuclear microsatellite markers were developed for Lobelia inflata (Campanulaceae, an obligately self-fertilizing plant species, for use in the study of temporal fluctuation in allele frequency and of the genetic structure within and among populations. Methods and Results: We developed 28 primer pairs for L. inflata, all of which amplify CT dinucleotide repeats. We evaluated amplification of these loci in 53 L. inflata individuals at three sites in eastern North America and found that 24 loci showed microsatellite polymorphism. We also found that 16 loci amplified successfully in L. cardinalis, and 11 amplified successfully in L. siphilitica. Conclusions: These primers will be useful for assessing allelic diversity within and among populations of L. inflata, and show potential for use in congeneric species.
Guo, Qi; Wang, Jin-Xing; Su, Li-Zhuo; Lv, Wei; Sun, Yu-Han; Li, Yun
2017-07-07
Black locust ( Robinia pseudoacacia L. of the family Fabaceae) is an ecologically and economically important deciduous tree. However, few genomic resources are available for this forest species, and few effective expressed sequence tag-derived simple sequence repeat (EST-SSR) markers have been developed to date. In this study, paired-end sequencing was used to sequence transcriptomes of R. pseudoacacia by the Illumina HiSeq TM2000 platform, and EST-SSR loci were identified by de novo assembly. Furthermore, a total of 1697 primer pairs were successfully designed, from which 286 primers met the selection screening criteria; 94 pairs were randomly selected and tested for validation using polymerase chain reaction amplification. Forty-five primers were verified as polymorphic, with clear bands. The polymorphism information content values were 0.033-0.765, the number of alleles per locus ranged from 2 to 10, and the observed and expected heterozygosities were 0.000-0.931 and 0.035-0.810, respectively, indicating a high level of informativeness. Subsequently, 45 polymorphic EST-SSR loci were tested for amplification efficiency, using the verified primers, in an additional nine species of Leguminosae, 23 loci were amplified in more than three species, of which two loci were amplified successfully in all species. These EST-SSR markers provide a valuable tool for investigating the genetic diversity and population structure of R . pseudoacacia , constructing a DNA fingerprint database, performing quantitative trait locus mapping, and preserving genetic information.
Genetic diversity of sesame (sesamum indicum L.) germplasm from Pakistan using RAPD markers
Energy Technology Data Exchange (ETDEWEB)
Akbar, F; Rabbani, M A; Masood, M S; Shinwari, Z.K., E-mail: shinwari@qau.edu.p
2011-08-15
Genetic diversity among 20 sesame (Sesamum indicum L.) accessions was examined at DNA level by means of random amplified polymorphic DNA (RAPD) analysis. Ten primers used produced a total of 93 RAPD fragments, of which 70 (75%) were polymorphic. Each primer generated 5 to 17 amplified fragments with an average of 9.3 bands per primer. Based on pair-wise comparisons of RAPD amplification products, Nei and Li's similarity coefficients were computed to assess the associations among the accessions. Pair-wise similarity indices varied from 0.65 to 0.91. A UPGMA cluster analysis based on these genetic similarities located most of the accessions far apart from one another, showing a high level of polymorphism. Genetically, all the genotypes were classified into two major groups and six subgroups or clusters. A single accession (22243) was relatively distinct from rest of the accessions and created independent cluster. In conclusion, even with the use of a limited set of primers, RAPD technique revealed a high level of genetic variation among sesame accessions collected from diverse ecologies of Pakistan. This high level of genetic diversity among the genotypes suggested that RAPD technique is valuable for sesame systematic, and can be helpful for the upholding of germplasm banks and the competent choice of parents in breeding programs. (author)
SSR Analysis of Genetic Diversity Among 192 Diploid Potato Cultivars
Directory of Open Access Journals (Sweden)
Xiaoyan Song
2016-05-01
Full Text Available In potato breeding, it is difficult to improve the traits of interest at the tetraploid level due to the tetrasomic inheritance. A promising alternative is diploid breeding. Thus it is necessary to assess the genetic diversity of diploid potato germplasm for efficient exploration and deployment of desirable traits. In this study, we used SSR markers to evaluate the genetic diversity of diploid potato cultivars. To screen polymorphic SSR markers, 55 pairs of SSR primers were employed to amplify 39 cultivars with relatively distant genetic relationships. Among them, 12 SSR markers with high polymorphism located at 12 chromosomes were chosen to evaluate the genetic diversity of 192 diploid potato cultivars. The primers produced 6 to 18 bands with an average of 8.2 bands per primer. In total, 98 bands were amplified from 192 cultivars, and 97 of them were polymorphic. Cluster analysis using UPGMA showed the genetic relationships of all accessions tested: 186 of the 192 accessions could be distinguished by only 12 pairs of SSR primers, and the 192 diploid cultivars were divided into 11 groups, and 83.3% constituted the first group. Clustering results showed relatively low genetic diversity among 192 diploid cultivars, with closer relationship at the molecular level. The results can provide molecular basis for diploid potato breeding.
Genetic diversity of sesame (sesamum indicum L.) germplasm from Pakistan using RAPD markers
International Nuclear Information System (INIS)
Akbar, F; Rabbani, M.A.; Masood, M.S.; Shinwari, Z.K.
2011-01-01
Genetic diversity among 20 sesame (Sesamum indicum L.) accessions was examined at DNA level by means of random amplified polymorphic DNA (RAPD) analysis. Ten primers used produced a total of 93 RAPD fragments, of which 70 (75%) were polymorphic. Each primer generated 5 to 17 amplified fragments with an average of 9.3 bands per primer. Based on pair-wise comparisons of RAPD amplification products, Nei and Li's similarity coefficients were computed to assess the associations among the accessions. Pair-wise similarity indices varied from 0.65 to 0.91. A UPGMA cluster analysis based on these genetic similarities located most of the accessions far apart from one another, showing a high level of polymorphism. Genetically, all the genotypes were classified into two major groups and six subgroups or clusters. A single accession (22243) was relatively distinct from rest of the accessions and created independent cluster. In conclusion, even with the use of a limited set of primers, RAPD technique revealed a high level of genetic variation among sesame accessions collected from diverse ecologies of Pakistan. This high level of genetic diversity among the genotypes suggested that RAPD technique is valuable for sesame systematic, and can be helpful for the upholding of germplasm banks and the competent choice of parents in breeding programs. (author)
Spolidorio, Mariana Granziera; Torres, Mariana de Medeiros; Campos, Wilma Neres da Silva; Melo, Andréia Lima Tomé; Igarashi, Michelle; Amude, Alexandre Mendes; Labruna, Marcelo Bahia; Aguiar, Daniel Moura
2011-01-01
The objective of this study was to report for the first time infection by Hepatozoon spp. and Babesia spp. in 10 dogs from the city of Cuiabá, State of Mato Grosso, central-western Brazil. A pair of primers that amplifies a 574 bp fragment of the 18S rRNA of Hepatozoon spp., and a pair of primers that amplifies a 551 bp fragment of the gene 18S rRNA for Babesia spp. were used. Six dogs were positive for Babesia spp., and 9 were positive for Hepatozoon spp. Co‑infection of Babesia spp. and Hepatozoon spp. was seen in 5 dogs. Sequenced samples revealed 100% identity with B. canis vogeli, and H. canis. This is the first molecular detection of H. canis in domestic dogs from Cuiabá. Additionally, it is described for the first time the presence of B. canis vogeli circulating among dogs in Cuiabá.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W
2009-04-01
The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Optimal control of a high-frequency class-D amplifier
DEFF Research Database (Denmark)
Dahl, Nicolai J.; Iversen, Niels Elkjær; Knott, Arnold
2018-01-01
Control loops have been used with switch-mode audio amplifiers to improve the sound quality of the amplifier. Because these amplifiers use a high-frequency modulation, precautions in the controller design must be taken. Further, the quality factor of the output filter can have a great impact...... on the controller's capabilities to suppress noise and track the audio signal. In this paper design methods for modern control are presented. The control method proves to easily overcome the challenge of designing a good performing controller when the output filter has a high quality factor. The results show...... that the controller is able to produce a clear improvement in the Total Harmonic Distortion with up to a 30 times improvement compared to open-loop with a clear reduction in the noise. This places the audio quality on pair with current solutions....
Polyacid macromolecule primers
Sugama, Toshifumi.
1989-12-26
Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.
Quantification of microcystin-producing microcystis in freshwater ...
African Journals Online (AJOL)
Total Microcystis spp (microcystinproducing and non-producing strains) were quantified in the three selected study areas with the determination of the copy numbers of the phycocyanin (PC) operon. Microcystin-producing gene copy numbers were quantified using specific primer pair, amplifying the mcyB gene. Microcystis ...
Directory of Open Access Journals (Sweden)
Irum Gul
2016-01-01
Full Text Available Background: With the increase in demand of herbal medicines, adulteration in these drugs is also gaining momentum and remains an indispensable problem in domestic and export markets. Correct identification is the first step toward assuring quality, safety, and efficacy of indigenous herbal medicines. Materials and Methods: In this study, sequence characterized amplified region (SCAR markers were developed to discriminate Ruta graveolens from its adulterant Euphorbia dracunculoides. Random amplified polymorphic DNA (RAPD was performed and subsequently converted into SCAR markers. Results: After performing RAPD, SCAR primers were designed from the selected unique RAPD amplicons of the genuine drug as well as its adulterant. These primers produced 670 bp and 750 bp SCAR markers with genomic DNA sample of R. graveolens and E. dracunculoides, respectively. Conclusion: Development of these markers will help in the quality control of herbal drugs and monitoring widespread adulteration of these drugs by pharmaceutical industries and government agencies.
AFLP analysis of rice transformed with maize DNA by particle beam
International Nuclear Information System (INIS)
Ji Shengdong; Chen Peng; Wang Jiachuan; Yuan Zhao; Yue Chunhui; Wang Zhifeng
2009-01-01
Many stable heritable rice lines were obtained via five years agricultural selection, which were derived from rice (oryza stative Japonica) Yujing-6 transgened with large fraction DNA of Zhengdan-14 (zea mays L.) by particle beam method. 18 pairs optimum selective primers were got by screening from 64 pairs AFLP selective primers via experiment on two mutant lines, which could amplify many DNA fingerprints and also could amplify polymorphic bands and target bands, both in this two mutant lines. Then the two mutant lines and two controls were analyzed with AFLP, the results showed that many polymorphic bands (such as novel bands, target bands, missing bands) were found in mutant lines. The discrepancy in DNA level indicated that rice, transgened with large fraction DNA of Zhengdan-14 by particle beam, might be inserted maize DNA and inherited steadily in some degree. It also indicated that it was possible to cultivate novel rice variety transformed with wide DNA by particle beam. (authors)
Stability investigation for InP DHBT mm‐wave power amplifier
DEFF Research Database (Denmark)
Yan, Lei; Johansen, Tom Keinicke; Kammersgaard, Jacob
2013-01-01
microwave integrated circuit power amplifier. Experimental results from a redesigned power amplifier with improved stability are presented to confirm that the previously detected oscillation loop is removed using odd‐mode stabilization resistors with the correct choice of values and locations. © 2012 Wiley......In this article, we discuss stability issues for mm‐wave monolithic integrated power amplifiers using InP double heterojunction bipolar transistor (DHBT) technology targeting E‐band applications at 71–76 GHz and 81–86 GHz. Different stability detection methods based on the classical two‐port K......‐Δs pair, linear three‐port graphical analysis, system identifications, circuit modal analysis, and normalized determinant function are all reviewed. The corresponding techniques are employed to predict the occurrence of instability at 15 GHz observed during measurements on a fabricated monolithic...
PHUSER (Primer Help for USER): a novel tool for USER fusion primer design
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads
2011-01-01
containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...
DEFF Research Database (Denmark)
Rottwitt, Karsten
2017-01-01
The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....
γ-rays from pair recombination in a travelling wave structure
International Nuclear Information System (INIS)
Bertolotti, M.; Sibilla, C.
1978-01-01
To obtain stimulated annihilation of pairs, two photon beams arriving from opposite directions are made to impinge with a region where e - - e + pairs are interacting, thus stimulating their recombination. At the exit of the interaction region photons are amplified by a factor β. The change in photon density is studied as a function of the length of the interaction region. The pair density needed to have a given gain is calculated and results to be proportional to log β 2 /(1+β)
Directory of Open Access Journals (Sweden)
Md. Shariful Islam
2013-01-01
Full Text Available Genetic diversity and relationships among six rice genotypes were investigated using five random amplified polymorphic DNA (RAPD markers. A total of 69 alleles were amplified, of which 66 were polymorphic. The size of the amplified alleles was between 0.25 and 2.35 kbp. The number of polymorphic alleles detected with each primer ranged from 7 to 24 with an average of 13.2 per primer and the polymorphism information content (PIC values varied from 0.8672 to 0.9471. Pair-wise similarity estimated the range of 0.308 to 0.718 among all the genotypes and the highest genetic similarity was found between Maloti and BRRI dhan53. Cluster analysis using UPGMA (unweighted pair group method with arithmetic averages revealed three clusters at genetic similarity of 46%. A moderately drought tolerant landrace, Boalia, formed a single cluster and the remaining genotypes grouped into distinct clusters based on their relatedness. The results showed a high level of genetic diversity among studied genotypes and this information will assist in conservation as well as selection of parents during breeding programs for the development of drought tolerant rice varieties in near future.
Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.
2010-01-01
The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.
Zhu, Huaping; Liu, Zhigang; Lu, Maixin; Gao, Fengying; Ke, Xiaoli; Ma, Dongmei; Huang, Zhanghan; Cao, Jianmeng; Wang, Miao
2016-06-01
In this study, primer pairs of 15 microsatellite markers associated with sex determination of tilapia were selected and amplified in Wami tilapia, Oreochromis urolepis hornorum. While one marker, UNH168, on linkage group 3 (LG3) was associated (P tilapia chromosome pair (chromosome 1, equivalent to LG3). This sex-linked microsatellite marker could potentially be used for marker-assisted selection in tilapia breeding programmes to produce monosex male tilapia.
Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA
Energy Technology Data Exchange (ETDEWEB)
Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)
2012-08-01
The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.
Assessment of genetic diversity for some Iraqi date palms ( Phoenix ...
African Journals Online (AJOL)
Amplified fragment length polymorphisms (AFLP) were used to evaluate the genetic diversity between 18 date palm (Phoenix dactylifera L.) varieties (11 females and 7 males) collected from the center of Iraq. Six primer pairs were applied to detect polymorphism between varieties. A total of 83 polymorphic AFLP fragments ...
Directory of Open Access Journals (Sweden)
Akinori Kuzuya
2011-12-01
Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.
Sun, R X; Zhang, C H; Zheng, Y Q; Zong, Y C; Yu, X D; Huang, P
2016-05-06
Thirty-four Styphnolobium japonicum varieties were analyzed using sequence-related amplified polymorphism (SRAP) markers, to investigate genetic variation and test the effectiveness of SRAP markers in DNA fingerprint establishment. Twelve primer pairs were selected from 120 primer combinations for their reproducibility and high polymorphism. We found a total of 430 amplified fragments, of which 415 fragments were considered polymorphic with an average of 34.58 polymorphic fragments for each primer combination. The percentage of polymorphic fragments was 96.60%, and four primer pairs showed 100% polymorphism. Moreover, simple matched coefficients ranged between 0.68 and 0.89, with an average of 0.785, indicating that the genetic variation among varieties was relatively low. This could be because of the narrow genetic basis of the selected breeding material. Based on the similarity coefficient value of 0.76, the varieties were divided into four major groups. In addition, abundant and clear SRAP fingerprints were obtained and could be used to establish DNA fingerprints. In the DNA fingerprints, each variety had its unique pattern that could be easily distinguished from others. The results demonstrated that 34 varieties of S. japonicum had a relatively narrow genetic variation. Hence, a broadening of the genetic basis of breeding material is necessary. We conclude that establishment of DNA fingerprint is feasible by means of SRAP markers.
Directory of Open Access Journals (Sweden)
Cui Shang-jin
2010-05-01
Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Effect of oligonucleotide primers in determining viral variability within hosts
Directory of Open Access Journals (Sweden)
Moya Andrés
2004-12-01
Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Effect of oligonucleotide primers in determining viral variability within hosts.
Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando
2004-12-09
Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
In this study, primer pairs of 15 microsatellite markers associated with sex determination of tilapia were selected and amplified in Wami tilapia, Oreochromis urolepis hornorum. While one marker, UNH168, on linkage group 3 (LG3) was associated((P<0.001) with the phenotypic sex in the experimental population, nine ...
Characterization of Malaysian Trichoderma isolates using random amplified microsatellites (RAMS).
Siddiquee, Shafiquzzaman; Tan, Soon Guan; Yusuf, Umi Kalsom; Fatihah, Nur Hasan Nudin; Hasan, Md Mainul
2012-01-01
Trichoderma species are commercially applied as biocontrol agents against numerous plant pathogenic fungi due to their production of antifungal metabolites, competition for nutrients and space, and mycoparasitism. However, currently the identification of Trichoderma species from throughout the world based on micro-morphological descriptions is tedious and prone to error. The correct identification of Trichoderma species is important as several traits are species-specific. The Random Amplified Microsatellites (RAMS) analysis done using five primers in this study showed different degrees of the genetic similarity among 42 isolates of this genus. The genetic similarity values were found to be in the range of 12.50-85.11% based on a total of 76 bands scored in the Trichoderma isolates. Of these 76 bands, 96.05% were polymorphic, 3.95% were monomorphic and 16% were exclusive bands. Two bands (250 bp and 200 bp) produced by primer LR-5 and one band (250 bp) by primer P1A were present in all the Trichoderma isolates collected from healthy and infected oil palm plantation soils. Cluster analysis based on UPGMA of the RAMS marker data showed that T. harzianum, T. virens and T. longibrachiatum isolates were grouped into different clades and lineages. In this study we found that although T. aureoviride isolates were morphologically different when compared to T. harzianum isolates, the UPGMA cluster analysis showed that the majority isolates of T. aureoviride (seven from nine) were closely related to the isolates of T. harzianum.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Detection of Lymnaea columella infection by Fasciola hepatica through Multiplex-PCR
Directory of Open Access Journals (Sweden)
Kelly Grace Magalhães
2004-06-01
Full Text Available From complete mitochondrial DNA sequence of Fasciola hepatica available in Genbank, specific primers were designed for a conserved and repetitive region of this trematode. A pair of primers was used for diagnosis of infected Lymnaea columella by F. hepatica during the pre-patent period simultaneously with another pair of primers which amplified the internal transcribed spacer (ITS region of rDNA from L. columella in a single Multiplex-PCR. The amplification generated a ladder band profile specific for F. hepatica. This profile was observed in positive molluscs at different times of infection, including adult worms from the trematode. The Multiplex-PCR technique showed to be a fast and safe tool for fascioliasis diagnosis, enabling the detection of F. hepatica miracidia in L. columella during the pre-patent period and identification of transmission areas.
Directory of Open Access Journals (Sweden)
Yohan Pillon
2013-06-01
Full Text Available Premise of the study: Primers were developed to amplify 12 intron-less, low-copy nuclear genes in the Hawaiian genus Clermontia (Campanulaceae, a suspected tetraploid. Methods and Results: Data from a pooled 454 titanium run of the partial transcriptomes of seven Clermontia species were used to identify the loci of interest. Most loci were amplified and sequenced directly with success in a representative selection of lobeliads even though several of these loci turned out to be duplicated. Levels of variation were comparable to those observed in commonly used plastid and ribosomal markers. Conclusions: We found evidence of a genome duplication that likely predates the diversification of the Hawaiian lobeliads. Some genes nevertheless appear to be single-copy and should be useful for phylogenetic studies of Clermontia or the entire Lobelioideae subfamily.
32 species validation of a new Illumina paired-end approach for the development of microsatellites.
Directory of Open Access Journals (Sweden)
Stacey L Lance
Full Text Available Development and optimization of novel species-specific microsatellites, or simple sequence repeats (SSRs remains an important step for studies in ecology, evolution, and behavior. Numerous approaches exist for identifying new SSRs that vary widely in terms of both time and cost investments. A recent approach of using paired-end Illumina sequence data in conjunction with the bioinformatics pipeline, PAL_FINDER, has the potential to substantially reduce the cost and labor investment while also improving efficiency. However, it does not appear that the approach has been widely adopted, perhaps due to concerns over its broad applicability across taxa. Therefore, to validate the utility of the approach we developed SSRs for 32 species representing 30 families, 25 orders, 11 classes, and six phyla and optimized SSRs for 13 of the species. Overall the IPE method worked extremely well and we identified 1000s of SSRs for all species (mean = 128,485, with 17% of loci being potentially amplifiable loci, and 25% of these met our most stringent criteria designed to that avoid SSRs associated with repetitive elements. Approximately 61% of screened primers yielded strong amplification of a single locus.
Closely spaced mirror pair for reshaping and homogenizing pump beams in laser amplifiers
International Nuclear Information System (INIS)
Bass, I.L.
1992-12-01
Channeling a laser beam by multiple reflections between two closely-spaced, parallel or nearly parallel mirrors, serves to reshape and homogenize the beam at the output gap between the mirrors. Application of this device to improve the spatial overlap of a copper laser pump beam with the signal beam in a dye laser amplifier is described. This technique has been applied to the AVLIS program at the Lawrence Livermore National Laboratory
Directory of Open Access Journals (Sweden)
Fernando L. Mantelatto
Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.
Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P
1996-04-15
A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.
Al-Khalifah, Nasser S; Shanavaskhan, A E
2017-01-01
Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.
Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M
2010-03-01
The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.
Hong-yuan DUAN; Zhi-guo LIU; Shao-fu QIU; Bin HE; Hai ZHAO; Li-hua SONG; Hong ZHU; Qing DUAN
2011-01-01
Objective To provide a possible antigen for rapid serodiagnosis of leptospirosis,the present study focused on the activity of immune-reaction and cross-reaction between outer membrane protein LipL32 and multi-serogroup anti-pathogenic Leptospira antibodies.Methods Based on the given sequence of LipL32 gene of Leptospira icterohaemorrhagiae strain 56601,the primer pair was designed and the DNA fragment was amplified by PCR.The amplified product was inserted into vector pET-28a-(c) to construct...
A high-flux entanglement source based on a doubly resonant optical parametric amplifier
International Nuclear Information System (INIS)
Kuklewicz, Christopher E; Keskiner, Eser; Wong, Franco N C; Shapiro, Jeffrey H
2002-01-01
A 532 nm pumped type-II phase-matched, doubly resonant KTP optical parametric amplifier (OPA) was operated near frequency degeneracy to yield an inferred downconverted photon pair production rate of 1.7x10 6 s -1 at a pump power of 100 μW. The OPA output consisted of three components: narrowband doubly resonant mode pairs; narrowband singly resonant mode pairs for which either the signal or idler was resonant with the cavity and broadband nonresonant mode pairs. Under frequency-degenerate operation, the broadband nonresonant mode pairs were polarization triplet states. We observed quantum interference between the orthogonally polarized photons of the triplet states when they were analysed with a polarizer set at 45 deg. relative to the OPA's output polarizations, leading to reduced coincidence counts
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.
Directory of Open Access Journals (Sweden)
Ana Cruz Morillo Coronado
2015-01-01
Full Text Available The Inchi or Cacay (Caryodendron orinocense Karsten is one of the most promising species of the Amazon and Orinoco Colombian. The main product of Cacay are its almonds, from extracted oil cosmetic, phytotherapeutic and food applications, also has a high content of antioxidants such as Omega 3, 6 and 9 and vitamins like A and E. There are no studies on the molecular characterization of this plant genetic resource; therefore the objective of this research was to characterize the genetic diversity using Random Amplified Microsatellite markers (RAMs. The similarity analysis to 0.50 formed four groups according to geographical location, being materials from Putumayo, Cacayal 19, Pauna and Castilla lowest similarity. Estimated heterozygosity values were 0.16 and 0.28 for the primers CGA and GT, respectively. The percentage of polymorphic loci ranged from 55% for the primer CGA and 90% for the GT. The average Fst value for the 27 materials studied was 0.35, showing the space-temporal dynamics of materials Caryodendron tend toward genetic differentiation, due to their own evolutionary processes and domestication incidence.
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...
Directory of Open Access Journals (Sweden)
Agus Eko Prasetyo
2017-09-01
Full Text Available Coconut is a major commodity in Derawan island as source of additional income for the farmers. Research was conducted to detect and identify phytoplasmas associated with coconut wilt disease in Derawan island. Coconut wilt disease was indicated by the typical symptoms, i.e. leaf yellowing, shorten of coconut sheaths and leaves, necrosis and collapse of old leaves, and also nut fall. The presence of phytoplasmas in phloem tissues of coconut stem was observed using fluorescence and electron microscope. Identification of phytoplasmas was carried out by nested-PCR and sequencing of the 16S rRNA gene. DNA fragment of phytoplasma with the size of 1.25 kbp was successfully amplified using primer pairs P1/P7, followed by primer pairs R16F2n/R16R2. Sequence analysis of the amplified fragments showed that phytoplasma associated with coconut wilt disease in Derawan island belongs to 16SrII (witches broom phytoplasma and 16SrXI (ca. Phytoplasma oryzae groups.
Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.
Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D
2010-10-01
Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.
A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.
Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin
2005-06-01
Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu
2016-03-01
Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon.
Tetsuya, Saito; Nauta, Bram
2008-01-01
To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.
Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei
2015-07-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.
Assessment of fungal diversity in deep-sea sediments by multiple primer approach
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278
Directory of Open Access Journals (Sweden)
Ping-Shin Lee
Full Text Available Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp DNA mini-barcode could distinguish most mammal species (including separating dark taxa and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.
Keeports, David
2006-12-01
By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.
Directory of Open Access Journals (Sweden)
Daniel W. H. Robarts
2014-07-01
Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.
Felske, A; Akkermans, A D; De Vos, W M
1998-11-01
A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.
Using aflp to identify genetic relationships in cassia species from Thailand
International Nuclear Information System (INIS)
Sihanat, A.; Rungsihirunrat, K.; Chareonsap, P. P.; Ruangrungsi, N.
2017-01-01
Several species of Cassia are used in Thai folk medicine as a laxative and a treatment for skin infections. However, the taxonomy of the GenusCassia is quite complex and intriguing. Thus, the correct identification of the species of this genus is necessary for efficacy and safety. The phylogenetic relationships among the 16 species of Cassiagenus existing in Thailand were evaluated using Amplified Fragment Length Polymorphism (AFLP) technique. Combinations of 70 primers were screened and eleven primer combinations produced a total of 849 distinct and reproducible bands ranging from 60 to 100 bands with an average of 77.18 bands per primer combination. The genetic distances were calculated based on the AFLP bands that had been amplified using the eleven primer combinations. The similarity indices (SI) ranged from 0.25 to 0.78. The dendrogram was created using the Unweighted Pair Group Method of the Arithmetic Average (UPGMA) and the genotypes were divided into two major groups. The results indicate that the phylogenetic relationships are associated with the morphological characterization. In conclusion, an AFLP marker could be an efficient and reliable tool for the identification of a Cassia species. (author)
Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.
Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A
2014-07-02
We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.
Tynkkynen, S; Satokari, R; Saarela, M; Mattila-Sandholm, T; Saxelin, M
1999-09-01
A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 334, respectively, but did not give any signal with the recently revived species L. zeae, which contains the type strain ATCC 15820 and the strain ATCC 393, which was previously classified as L. casei. Our results are in accordance with the suggested new classification of the L. casei group. Altogether, 21 of the 24 strains studied were identified with the species-specific primers. In strain typing, PFGE was the most discriminatory method, revealing 17 genotypes for the 24 strains studied. Ribotyping and RAPD analysis yielded 15 and 12 genotypes, respectively.
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Entangled-Pair Transmission Improvement Using Distributed Phase-Sensitive Amplification
Directory of Open Access Journals (Sweden)
Anjali Agarwal
2014-12-01
Full Text Available We demonstrate the transmission of time-bin entangled photon pairs through a distributed optical phase-sensitive amplifier (OPSA. We utilize four-wave mixing at telecom wavelengths in a 5-km dispersion-shifted fiber OPSA operating in the low-gain limit. Measurements of two-photon interference curves show no statistically significant degradation in the fringe visibility at the output of the OPSA. In addition, coincidence counting rates are higher than direct passive transmission because of constructive interference between amplitudes of input photon pairs and those generated in the OPSA. Our results suggest that application of distributed phase-sensitive amplification to transmission of entangled photon pairs could be highly beneficial towards advancing the rate and scalability of future quantum communications systems.
30 CFR 56.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...
Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.
Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon
2015-10-01
Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.
Ludovic J. A. Capo-chichi; Wilson H. Faircloth; A. G. Williamson; Michael G. Patterson; James H. Miller; Edzard van Santen
2008-01-01
Nine sites of cogongrass were included in a study of genotypic dimity and spread dynamics at the point of introduction and its adjacent areas in the southern United States. Clones evaluated with two primer pairs yielded a total of 137 amplified fragment length polymorphism (AFLP) hi of which 102 (74.4%) were polymorphic. Genetic diversity was measured as the percentage...
Robarts, Daniel W. H.; Wolfe, Andrea D.
2014-01-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637
Robarts, Daniel W H; Wolfe, Andrea D
2014-07-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
Improving molecular tools for global surveillance of measles virus⋆
Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.
2017-01-01
Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666
Improving molecular tools for global surveillance of measles virus.
Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A
2013-09-01
The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.
KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz
International Nuclear Information System (INIS)
Bowman, Stephen M.
2008-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of
Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su
2012-01-01
The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1–10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy–Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni’s correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species. PMID:22837688
Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su
2012-01-01
The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1-10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni's correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species.
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Auto-Zero Differential Amplifier
Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)
2017-01-01
An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.
Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S
2016-09-01
Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.
Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S
2016-10-01
The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies
Biogeochemical and molecular signatures of anaerobic methane oxidation in a marine sediment.
Thomsen, T R; Finster, K; Ramsing, N B
2001-04-01
Anaerobic methane oxidation was investigated in 6-m-long cores of marine sediment from Aarhus Bay, Denmark. Measured concentration profiles for methane and sulfate, as well as in situ rates determined with isotope tracers, indicated that there was a narrow zone of anaerobic methane oxidation about 150 cm below the sediment surface. Methane could account for 52% of the electron donor requirement for the peak sulfate reduction rate detected in the sulfate-methane transition zone. Molecular signatures of organisms present in the transition zone were detected by using selective PCR primers for sulfate-reducing bacteria and for Archaea. One primer pair amplified the dissimilatory sulfite reductase (DSR) gene of sulfate-reducing bacteria, whereas another primer (ANME) was designed to amplify archaeal sequences found in a recent study of sediments from the Eel River Basin, as these bacteria have been suggested to be anaerobic methane oxidizers (K. U. Hinrichs, J. M. Hayes, S. P. Sylva, P. G. Brewer, and E. F. DeLong, Nature 398:802-805, 1999). Amplification with the primer pairs produced more amplificate of both target genes with samples from the sulfate-methane transition zone than with samples from the surrounding sediment. Phylogenetic analysis of the DSR gene sequences retrieved from the transition zone revealed that they all belonged to a novel deeply branching lineage of diverse DSR gene sequences not related to any previously described DSR gene sequence. In contrast, DSR gene sequences found in the top sediment were related to environmental sequences from other estuarine sediments and to sequences of members of the genera Desulfonema, Desulfococcus, and Desulfosarcina. Phylogenetic analysis of 16S rRNA sequences obtained with the primers targeting the archaeal group of possible anaerobic methane oxidizers revealed two clusters of ANME sequences, both of which were affiliated with sequences from the Eel River Basin.
STUDIES ON INDUCED HEPATOTOXICITY IN MALE ALBINO RATS (RATTUS NORVEGICUS)
International Nuclear Information System (INIS)
ABULYAZID, I.; ABBAS, O.A.; FAYEZ, V.
2008-01-01
Levanox, a hepato protective drug, and garlic powder have been considered as safe anti-oxidant agents. The present investigation refers to biochemical and molecular studies to evaluate the protective role of levanox and/or garlic powder toward CCl4-induced toxicity in adult male albino rats. CCl4 intoxication was attempted using a dose of 0.03 ml/kg of rat body weight.Pre-treatment with levanox (one capsule/ kg of rat body weight, each capsule contains 100 mg catechu, 7.5 mg dandelion, 75 mg termiric 2 % curcumin , 17.5 mg silymarin, 100 mg lecithin) was more effective than garlic powder (100mg/kg of rat body weight) in reducing CCl4-induced hepatotoxicity as revealed by its higher potency in reducing elevation of aspartate (AST) and alanine (ALT) aminotransferases in serum. Serum of control rats and those treated with levanox or garlic or CCl4 produced 13 types of proteins, differing in the molecular weight (MW) and densities, while those of levanox + garlic or garlic +CCl4 produced 14 bands differing in the MW and densities. The similarity index at the epigenetic level was also studied using the primers under study. The control sample produced one amplified DNA fragment with Rf of 0.73 and a molecular size (MS) of 67 base pair (bp) . Using the same primers, no amplified DNA fragment with the same MS was produced in the sample taken from levanox + garlic treated group.OPA-2 primer of sequence 5?- AGA TGC AGC C-3? produced one amplified DNA band with MS of 292 bp and Rf of 0.46 . However, the same primer produced one amplified DNA characteristic band with a molecular size of 363 bp and Rf of 0.43 in the sample of levanox + garlic group.In the control sample, OPA-4 primer of sequence 5? - ACG CAC AAC C-3? produced one amplified DNA band of MS of 299 bp and Rf of 0.43. The same primer produced one amplified characteristic DNA band with MS of 363 bp and Rf of 0.43 in the sample of levanox + garlic group.Dual treatment with levanox and garlic powder resulted in a
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Microsatellite association with seed protein content and flowering ...
African Journals Online (AJOL)
use
2011-12-12
Dec 12, 2011 ... 5'-AAA ATC GGG GAA GGA AAC C-3'. (AG). 186. 5'-GAA GGC AAA ATA CAT GGA GTC AC-3'. VM 71. 5'-TCG TGG CAG AGA ATC AAA GAC AC-3'. (AG). 225. 5'-TGG GTG GAG GCA AAA ACA AAA C-3'. (AAAG) amplified multiple bands and were not used for further analysis. One primer pair (SSR-6243) ...
Serber, Robert
2018-01-01
Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Portable musical instrument amplifier
Christian, David E.
1990-07-24
The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M; Lovmand, J
1997-01-01
, but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....
Nanotechnology: A Policy Primer
2013-06-24
savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Goodwin, Stephen B; van der Lee, Theo A J; Cavaletto, Jessica R; Te Lintel Hekkert, Bas; Crane, Charles F; Kema, Gert H J
2007-05-01
A database of 30,137 EST sequences from Mycosphaerella graminicola, the septoria tritici blotch fungus of wheat, was scanned with a custom software pipeline for di- and trinucleotide units repeated tandemly six or more times. The bioinformatics analysis identified 109 putative SSR loci, and for 99 of them, flanking primers were developed successfully and tested for amplification and polymorphism by PCR on five field isolates of diverse origin, including the parents of the standard M. graminicola mapping population. Seventy-seven of the 99 primer pairs generated an easily scored banding pattern and 51 were polymorphic, with up to four alleles per locus, among the isolates tested. Among these 51 loci, 23 were polymorphic between the parents of the mapping population. Twenty-one of these as well as two previously published microsatellite loci were positioned on the existing genetic linkage map of M. graminicola on 13 of the 24 linkage groups. Most (66%) of the primer pairs also amplified bands in the closely related barley pathogen Septoria passerinii, but only six were polymorphic among four isolates tested. A subset of the primer pairs also revealed polymorphisms when tested with DNA from the related banana black leaf streak (Black Sigatoka) pathogen, M. fijiensis. The EST database provided an excellent source of new, highly polymorphic microsatellite markers that can be multiplexed for high-throughput genetic analyses of M. graminicola and related species.
Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M
2010-11-09
The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.
Development and validation of genic-SSR markers in sesame by RNA-seq.
Zhang, Haiyang; Wei, Libin; Miao, Hongmei; Zhang, Tide; Wang, Cuiying
2012-07-16
Sesame (Sesamum indicum L.) is one of the most important oil crops; however, a lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of samples from different sesame growth and developmental stages, and mining of genic-SSR markers to identify valuable markers for sesame molecular genetics research. In this study, 75 bp and 100 bp paired-end RNA-seq was used to sequence 24 cDNA libraries, and 42,566 uni-transcripts were assembled from more than 260 million filtered reads. The total length of uni-transcript sequences was 47.99 Mb, and 7,324 SSRs (SSRs ≥15 bp) and 4,440 SSRs (SSRs ≥18 bp) were identified. On average, there was one genic-SSR per 6.55 kb (SSRs ≥15 bp) or 10.81 kb (SSRs ≥18 bp). Among perfect SSRs (≥18 bp), di-nucleotide motifs (48.01%) were the most abundant, followed by tri- (20.96%), hexa- (25.37%), penta- (2.97%), tetra- (2.12%), and mono-nucleotides (0.57%). The top four motif repeats were (AG/CT)n [1,268 (34.51%)], (CA/TG)n [281 (7.65%)], (AT/AT)n [215 (5.85%)], and (GAA/TTC)n [131 (3.57%)]. A total of 2,164 SSR primer pairs were identified in the 4,440 SSR-containing sequences (≥18 bp), and 300 SSR primer pairs were randomly chosen for validation. These SSR markers were amplified and validated in 25 sesame accessions (24 cultivated accessions, one wild species). 276 (92.0%) primer pairs yielded PCR amplification products in 24 cultivars. Thirty two primer pairs (11.59%) exhibited polymorphisms. Moreover, 203 primer pairs (67.67%) yielded PCR amplicons in the wild accession and 167 (60.51%) were polymorphic between species. A UPGMA dendrogram based on genetic similarity coefficients showed that the correlation between genotype and geographical source was low and that the genetic basis of sesame in China is narrow, as previously reported. The 32 polymorphic primer pairs were validated using an F2 mapping population; 18 primer pairs exhibited polymorphisms between the parents, and 14
Readout ASIC of pair-monitor for international linear collider
International Nuclear Information System (INIS)
Sato, Yutaro; Ikeda, Hirokazu; Ito, Kazutoshi; Miyamoto, Akiya; Nagamine, Tadashi; Sasaki, Rei; Takubo, Yosuke; Tauchi, Toshiaki; Yamamoto, Hitoshi
2010-01-01
The pair-monitor is a beam profile monitor at the interaction point of the international linear collider. A prototype of the readout ASIC for the pair-monitor has been designed and tested. Since the pair-monitor uses the hit distribution of electrons and positrons generated by the beam-crossing to measure the beam profile, the readout ASIC is designed to count the number of hits. In a prototype ASIC, 36 readout cells were implemented by TSMC 0.25-μm CMOS process. Each readout cell is equipped with an amplifier, comparator, 8-bit counter and 16 count-registers. By the operation test, all the ASIC component were confirmed to work correctly. As the next step, we develop the prototype ASIC with the silicon on insulator technology. It is produced with OKI 0.2-μm FD-SOI CMOS process.
Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu
2018-03-15
The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.
Tetsuya, Saito; Nauta, Bram
2011-01-01
PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a
Tetsuya, S.; Nauta, Bram
2007-01-01
PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a
MPprimer: a program for reliable multiplex PCR primer design
Directory of Open Access Journals (Sweden)
Wang Xiaolei
2010-03-01
Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.
International Nuclear Information System (INIS)
Flude, J.W.; Nicholas, J.R.
1991-04-01
This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs
Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.
Pegels, N; González, I; Fernández, S; García, T; Martín, R
2012-01-01
A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.
Directory of Open Access Journals (Sweden)
Santos Carlos A.F.
2002-01-01
Full Text Available Amplified fragment length polymorphism (AFLP is a fast and reliable tool to generate a large number of DNA markers. In two unrelated F2 populations of carrot (Daucus carota L., Brasilia x HCM and B493 x QAL (wild carrot, it was hypothesized that DNA 1 digested with the same restriction endonuclease enzymes and amplified with the same primer combination and 2 sharing the same position in polyacrylamide gels should be conserved sequences. To test this hypothesis AFLP fragments from polyacrylamide gels were eluted, reamplified, separated in agarose gels, purified, cloned and sequenced. Among thirty-one paired fragments from each F2 population, twenty-six had identity greater than 91% and five presented identity of 24% to 44%. Among the twenty-six conserved AFLPs only one mapped to different linkage groups in the two populations while four of the five less-conserved bands mapped to different linkage groups. Of eight SCAR (sequence characterized amplified regions primers tested, one conserved AFLP resulted in co-dominant markers in both populations. Screening among 14 carrot inbreds or cultivars with three AFLP-SCAR primers revealed clear and polymorphic PCR products, with similar molecular sizes on agarose gels. The development of co-dominant markers based on conserved AFLP fragments will be useful to detect seed mixtures among hybrids, to improve and to merge linkage maps and to study diversity and phylogenetic relationships.
Monteiro, E R; Strioto, D K; Meirelles, A C S; Mangolin, C A; Machado, M F P S
2015-12-15
Amplified fragment length polymorphism (AFLP) analysis was used to evaluate DNA polymorphism in Pilosocereus gounellei with the aim of differentiating samples grown in different Brazilian semiarid regions. Seven primer pairs were used to amplify 703 AFLP markers, of which 700 (99.21%) markers were polymorphic. The percentage of polymorphic markers ranged from 95.3% for the primer combination E-AAG/M-CTT to 100% for E-ACC/M-CAT, E-ACC/M-CAA, E-AGC/M-CAG, E-ACT/M-CTA, and E-AGG/M-CTG. The largest number of informative markers (126) was detected using the primer combination E-AAC/M-CTA. Polymorphism of the amplified DNA fragments ranged from 72.55% (in sample from Piauí State) to 82.79% (in samples from Rio Grande Norte State), with an average of 75.39%. Despite the high genetic diversity of AFLP markers in xiquexique, analysis using the STRUCTURE software identified relatively homogeneous clusters of xiquexique from the same location, indicating a differentiation at the molecular level, among the plant samples from different regions of the Caatinga biome. The AFLP methodology identified genetically homogeneous and contrasting plants, as well as plants from different regions with common DNA markers. Seeds from such plants can be used for further propagation of plants for establishment of biodiversity conservation units and restoration of degraded areas of the Caatinga biome.
Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters
DEFF Research Database (Denmark)
Wang, Z.; Durhuus, T.; Mikkelsen, Benny
1994-01-01
A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....
Energy Technology Data Exchange (ETDEWEB)
Ni, Chun Chun
2009-11-16
Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Directory of Open Access Journals (Sweden)
Alex Galanis
2015-10-01
Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Energy Technology Data Exchange (ETDEWEB)
Ruano, G.; Ruddle, F.H.; Kidd, K.K. (Yale Univ., New Haven, CT (United States)); Gray, M.R. (Tufts Univ., Boston, MA (United States)); Miki, Tetsuro (Osaka Univ. (Japan)); Ferguson-Smith, A.C. (Inst. of Animal Physiology and Genetics Research, Cambridge (United Kingdom))
1990-03-11
The human homeo box cluster 2 (HOX2) contains genes coding for DNA binding proteins involved in developmental control and is highly conserved between mouse and man. The authors have applied in concert the Polymerase Chain Reaction (PCR) and Denaturing Gradient Electrophoresis (DGE) to amplify defined primate HOX2 segments and to detect sequence differences among them. They have sequenced a PstI fragment 4 kb upstream from HOX 2.2 and synthesized primers delimiting both halves of 630 bp segment within it PCR on various unrelated humans and SC-PCR on chimpanzee, gorilla, orangutan and gibbon yielded products of the same length for each primer pair.
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo
2005-08-01
A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.
Directory of Open Access Journals (Sweden)
Jung-Ha Kang
2012-06-01
Full Text Available The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62% produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1–10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy–Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni’s correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species.
International Nuclear Information System (INIS)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-01-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Directory of Open Access Journals (Sweden)
Esther Lantero
2017-07-01
Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control
Energy Technology Data Exchange (ETDEWEB)
Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.
2017-07-01
Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
International Nuclear Information System (INIS)
Stine, R.D.; Ross, G.F.; Silvernail, C.
1979-01-01
The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed
Amplification factor variable amplifier
Akitsugu, Oshita; Nauta, Bram
2007-01-01
PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and
Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R
2015-12-28
The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.
High-speed measurement of firearm primer blast waves
Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy
2012-01-01
This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...
Amplification factor variable amplifier
Akitsugu, Oshita; Nauta, Bram
2010-01-01
PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can
Directory of Open Access Journals (Sweden)
Camara Mark D
2008-05-01
Full Text Available Abstract Background Since it was first described in the mid-1990s, quantitative real time PCR (Q-PCR has been widely used in many fields of biomedical research and molecular diagnostics. This method is routinely used to validate whole transcriptome analyses such as DNA microarrays, suppressive subtractive hybridization (SSH or differential display techniques such as cDNA-AFLP (Amplification Fragment Length Polymorphism. Despite efforts to optimize the methodology, misleading results are still possible, even when standard optimization approaches are followed. Results As part of a larger project aimed at elucidating transcriptome-level responses of Pacific oysters (Crassostrea gigas to various environmental stressors, we used microarrays and cDNA-AFLP to identify Expressed Sequence Tag (EST fragments that are differentially expressed in response to bacterial challenge in two heat shock tolerant and two heat shock sensitive full-sib oyster families. We then designed primers for these differentially expressed ESTs in order to validate the results using Q-PCR. For two of these ESTs we tested fourteen primer pairs each and using standard optimization methods (i.e. melt-curve analysis to ensure amplification of a single product, determined that of the fourteen primer pairs tested, six and nine pairs respectively amplified a single product and were thus acceptable for further testing. However, when we used these primers, we obtained different statistical outcomes among primer pairs, raising unexpected but serious questions about their reliability. We hypothesize that as a consequence of high levels of sequence polymorphism in Pacific oysters, Q-PCR amplification is sub-optimal in some individuals because sequence variants in priming sites results in poor primer binding and amplification in some individuals. This issue is similar to the high frequency of null alleles observed for microsatellite markers in Pacific oysters. Conclusion This study highlights
Yu, J; Wang, Y; Ru, M; Peng, L; Liang, Z S
2015-07-03
Eucommia ulmoides Oliver, the only extant species of Eucommiaceae, is a second-category state-protected endangered plant in China. Evaluation of genetic diversity among some intraspecific hybrid populations of E. ulmoides Oliver is vital for breeding programs and further conservation of this rare species. We studied the genetic diversity of 130 accessions from 13 E. ulmoides intraspecific hybrid populations using inter-simple sequence related (ISSR) and sequence-related amplified polymorphism (SRAP) markers. Of the 100 ISSR primers and 100 SRAP primer combinations screened, eight ISSRs and eight SRAPs were used to evaluate the level of polymorphism and discriminating capacity. A total number of 65 bands were amplified using eight ISSR primers, in which 50 bands (76.9%) were polymorphic, with an average of 8.1 polymorphic fragments per primer. Alternatively, another 244 bands were observed using eight SRAP primer combinations, and 163 (66.8%) of them were polymorphic, with an average of 30.5 polymorphic fragments per primer. The unweighted pair-group method (UPGMA) analysis showed that these 13 populations could be classified into three groups by the ISSR marker and two groups by the SRAP marker. Principal coordinate analysis using SRAP was completely identical to the UPGMA-based clustering, although this was partly confirmed by the results of UPGMA cluster analysis using the ISSR marker. This study provides insights into the genetic background of E. ulmoides intraspecific hybrids. The progenies of the variations "Huazhong-3", "big fruit", "Yanci", and "smooth bark" present high genetic diversity and offer great potential for E. ulmoides breeding and conservation.
Directory of Open Access Journals (Sweden)
Hafiz Muhammad Ashraf
2016-10-01
Full Text Available Background: Keeping in view the havoc situation of dengue fever in Pakistan, the current study was designed to demonstrate the genetic variations, gene flow and rate of migration from Lahore and Faisalabad.Methods: The larvae were collected from both natural and artificial breeding places from each collection site. The adult mosquitoes were collected by means of sweep net and battery-operated aspirator. DNA extraction was performed using TNE buffer method. Ten GeneLink-A series RAPD primers were used for PCR amplification and the data was analyzed through POPGENE.Results: The number of amplification products produced per primer varied from 8-12, ranging from 200 to 2000 bp with an average of 10.0 bands per primer. The percentage of polymorphic loci amplified by each primer varied from 22.5 to 51%. The UPGMA dendrogram demonstrates two distinct groups from Faisalabad and Lahore populations. The genetic diversity ranged from 0.260 in Faisalabad to 0.294 in Lahore with a total heterozygosity of 0.379. The GST value for nine populations within Lahore was 0.131 (Nm= 3.317, whereas for nine populations in Faisalabad GST value was 0.117 (Nm= 3.773. The overall genetic variation among eighteen populations showed GST= 0.341 and Nm= 1.966.Conclusion: The genetic relatedness and Nm value show that Ae. aegypti populations exhibit intra-population gene flow both in Faisalabad and Lahore. Although, both cities show a distinct pattern of genetic structure; however, few areas from both the cities show genetic similarity. The gene flow and the genetic relatedness in few populations of Lahore and Faisalabad cities need further investigation.
Ashraf, Hafiz Muhammad; Zahoor, Muhammad Kashif; Nasir, Shabab; Majeed, Humara Naz; Zahoor, Sarwat
2016-12-01
Keeping in view the havoc situation of dengue fever in Pakistan, the current study was designed to demonstrate the genetic variations, gene flow and rate of migration from Lahore and Faisalabad. The larvae were collected from both natural and artificial breeding places from each collection site. The adult mosquitoes were collected by means of sweep net and battery-operated aspirator. DNA extraction was performed using TNE buffer method. Ten GeneLink-A series RAPD primers were used for PCR amplification and the data was analyzed through POPGENE. The number of amplification products produced per primer varied from 8-12, ranging from 200 to 2000 bp with an average of 10.0 bands per primer. The percentage of polymorphic loci amplified by each primer varied from 22.5 to 51%. The UPGMA dendrogram demonstrates two distinct groups from Faisalabad and Lahore populations. The genetic diversity ranged from 0.260 in Faisalabad to 0.294 in Lahore with a total heterozygosity of 0.379. The G ST value for nine populations within Lahore was 0.131 (Nm= 3.317), whereas for nine populations in Faisalabad G ST value was 0.117 (Nm= 3.773). The overall genetic variation among eighteen populations showed G ST = 0.341 and Nm= 1.966. The genetic relatedness and Nm value show that Ae . aegypti populations exhibit intra-population gene flow both in Faisalabad and Lahore. Although, both cities show a distinct pattern of genetic structure; however, few areas from both the cities show genetic similarity. The gene flow and the genetic relatedness in few populations of Lahore and Faisalabad cities need further investigation.
Directory of Open Access Journals (Sweden)
Can-Xing Duan
Full Text Available BACKGROUND: The adzuki bean weevil, Callosobruchus chinensis L., is one of the most destructive pests of stored legume seeds such as mungbean, cowpea, and adzuki bean, which usually cause considerable loss in the quantity and quality of stored seeds during transportation and storage. However, a lack of genetic information of this pest results in a series of genetic questions remain largely unknown, including population genetic structure, kinship, biotype abundance, and so on. Co-dominant microsatellite markers offer a great resolving power to determine these events. Here, we report rapid microsatellite isolation from C. chinensis via high-throughput sequencing. PRINCIPAL FINDINGS: In this study, 94,560,852 quality-filtered and trimmed reads were obtained for the assembly of genome using Illumina paired-end sequencing technology. In total, the genome with total length of 497,124,785 bp, comprising 403,113 high quality contigs was generated with de novo assembly. More than 6800 SSR loci were detected and a suit of 6303 primer pair sequences were designed and 500 of them were randomly selected for validation. Of these, 196 pair of primers, i.e. 39.2%, produced reproducible amplicons that were polymorphic among 8 C. chinensis genotypes collected from different geographical regions. Twenty out of 196 polymorphic SSR markers were used to analyze the genetic diversity of 18 C. chinensis populations. The results showed the twenty SSR loci were highly polymorphic among these populations. CONCLUSIONS: This study presents a first report of genome sequencing and de novo assembly for C. chinensis and demonstrates the feasibility of generating a large scale of sequence information and SSR loci isolation by Illumina paired-end sequencing. Our results provide a valuable resource for C. chinensis research. These novel markers are valuable for future genetic mapping, trait association, genetic structure and kinship among C. chinensis.
Directory of Open Access Journals (Sweden)
Qiang Fan
2013-11-01
Full Text Available Premise of the study: Firmiana consists of 12–16 species, many of which are narrow endemics. Expressed sequence tag (EST–simple sequence repeat (SSR markers were developed and characterized for size polymorphism in four Firmiana species. Methods and Results: A total of 102 EST-SSR primer pairs were designed based on the transcriptome sequences of F. danxiaensis; these were then characterized in four Firmiana species—F. danxiaensis, F. kwangsiensis, F. hainanensis, and F. simplex. In these four species, 17 primer pairs were successfully amplified, and 14 were polymorphic in at least one species. The number of alleles ranged from one to 13, and the observed and expected heterozygosities ranged from 0 to 1 and 0 to 0.925, respectively. The lowest level of polymorphism was observed in F. danxiaensis. Conclusions: These polymorphic EST-SSR markers are valuable for conservation genetics studies in the endangered Firmiana species.
CMOS Current-mode Operational Amplifier
DEFF Research Database (Denmark)
Kaulberg, Thomas
1992-01-01
current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...
Hexavalent Chromium IV-Free Primer Development
Alldredge, Michael J.; Buck, Amy L.
2015-01-01
Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.
Directory of Open Access Journals (Sweden)
FIGUEIREDO Luiz Tadeu Moraes
1997-01-01
Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination
Dostal, Jiri
1993-01-01
This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits
DEFF Research Database (Denmark)
Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard
2005-01-01
Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....
Multiplexing Short Primers for Viral Family PCR
Energy Technology Data Exchange (ETDEWEB)
Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W
2008-06-26
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.
International Nuclear Information System (INIS)
Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh
2013-01-01
To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)
KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input
International Nuclear Information System (INIS)
Busch, R.D.
2003-01-01
The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a
International Nuclear Information System (INIS)
Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet
2004-01-01
The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)
Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y
2014-04-08
The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.
Primer on spontaneous heating and pyrophoricity
Energy Technology Data Exchange (ETDEWEB)
1994-12-01
This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.
30 CFR 57.6304 - Primer protection.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...
CMOS Current-mode Operational Amplifier
Kaulberg, Thomas
1992-01-01
A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...
International Nuclear Information System (INIS)
Liu Wan; Yang, Y.S.; Li, P.J.; Zhou, Q.X.; Xie, L.J.; Han, Y.P.
2009-01-01
Impact assessment of contaminants in soil is an important issue in environmental quality study and remediation of contaminated land. A random amplified polymorphic DNA (RAPD) 'fingerprinting' technique was exhibited to detect genotoxin-induced DNA damage of plants from heavy metal contaminated soil. This study compared the effects occurring at molecular and population levels in barley seedlings exposed to cadmium (Cd) contamination in soil. Results indicate that reduction of root growth and increase of total soluble protein level in the root tips of barley seedlings occurred with the ascending Cd concentrations. For the RAPD analyses, nine 10-base pair (bp) random RAPD primers (decamers) with 60-70% GC content were found to produce unique polymorphic band patterns and subsequently were used to produce a total of 129 RAPD fragments of 144-2639 base pair in molecular size in the root tips of control seedlings. Results produced from nine primers indicate that the changes occurring in RAPD profiles of the root tips following Cd treatment included alterations in band intensity as well as gain or loss of bands compared with the control seedlings. New amplified fragments at molecular size from approximately 154 to 2245 bp appeared almost for 10, 20 and 40 mg L -1 Cd with 9 primers (one-four new polymerase chain reaction, (PCR) products), and the number of missing bands enhanced with the increasing Cd concentration for nine primers. These results suggest that genomic template stability reflecting changes in RAPD profiles were significantly affected and it compared favourably with the traditional indices such as growth and soluble protein level at the above Cd concentrations. The DNA polymorphisms detected by RAPD can be applied as a suitable biomarker assay for detection of the genotoxic effects of Cd stress in soil on plants. As a tool in risk assessment the RAPD assay can be used in characterisation of Cd hazard in soil
DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.
Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan
2015-09-01
Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.
Directory of Open Access Journals (Sweden)
Hirokazu Takahashi
Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.
Simplified design of IC amplifiers
Lenk, John
1996-01-01
Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif
Directory of Open Access Journals (Sweden)
Jeremie B. Fant
2013-06-01
Full Text Available Premise of the study: Microsatellite primers were developed in the hemiparasitic perennial forb Castilleja sessiliflora to investigate patterns of gene flow and genetic diversity within and among populations. Methods and Results: Twelve polymorphic loci were identified in C. sessiliflora and tested on three populations (32 individuals each sampled across the range of the species. The loci amplified di- and trinucleotide repeats with 3–14 alleles per locus. To assess cross-amplification, primer pairs were also tested on 24 additional Castilleja species that represent the morphological and geographic diversity of the genus. We provide reports of their effectiveness in all 25 taxa. Conclusions: These results indicate the utility of these primers in C. sessiliflora for future studies of genetic structure and gene flow, as well as their widespread applicability in other members of the diverse and complex genus Castilleja.
Genetic diversity and gene differentiation among ten species of Zingiberaceae from Eastern India.
Mohanty, Sujata; Panda, Manoj Kumar; Acharya, Laxmikanta; Nayak, Sanghamitra
2014-08-01
In the present study, genetic fingerprints of ten species of Zingiberaceae from eastern India were developed using PCR-based markers. 19 RAPD (Rapid Amplified polymorphic DNA), 8 ISSR (Inter Simple Sequence Repeats) and 8 SSR (Simple Sequence Repeats) primers were used to elucidate genetic diversity important for utilization, management and conservation. These primers produced 789 loci, out of which 773 loci were polymorphic (including 220 unique loci) and 16 monomorphic loci. Highest number of bands amplified (263) in Curcuma caesia whereas lowest (209) in Zingiber cassumunar. Though all the markers discriminated the species effectively, analysis of combined data of all markers resulted in better distinction of individual species. Highest number of loci was amplified with SSR primers with resolving power in a range of 17.4-39. Dendrogram based on three molecular data using unweighted pair group method with arithmetic mean classified all the species into two clusters. Mantle matrix correspondence test revealed high matrix correlation in all the cases. Correlation values for RAPD, ISSR and SSR were 0.797, 0.84 and 0.8, respectively, with combined data. In both the genera wild and cultivated species were completely separated from each other at genomic level. It also revealed distinct genetic identity between species of Curcuma and Zingiber. High genetic diversity documented in the present study provides a baseline data for optimization of conservation and breeding programme of the studied zingiberacious species.
Hu, Kun; Liu, Jinwen; Chen, Jia; Huang, Yong; Zhao, Shulin; Tian, Jianniao; Zhang, Guohai
2013-04-15
An amplified graphene oxide (GO) based fluorescence aptasensor based on target-triggered aptamer hairpin switch and strand-displacement polymerization recycling is developed for bioassays. The dye-labeled single-strand DNA (aptamer hairpin) was adsorbed on the surface of GO, which result in the fluorescence quenching of dye, and exhibiting minimal background fluorescence. Upon the target, primer and polymerase, the stem of the aptamer hairpin was opened, and binds with the primer to triggers the circular target strand-displacement polymerization reaction, which produces huge amounts of duplex helixes DNA and lead to strong fluorescence emission due to shielding of nucelobases within its double-helix structure. During the polymerization reaction, the primer was extended, and target was displaced. And the displaced target recognizes and hybridizes with another hairpin probe, triggering the next round of polymerization reaction, and the circle process induces fluorescence signal amplification for the detection of analyte. To test the feasibility of the aptasensor systems, interferon-gamma (IFN-γ) was employed as a model analyte. A detection limit as low as 1.5 fM is obtained based on the GO aptasensor with a linear range of three orders of magnitude. The present method was successfully applied for the detection of IFN-γ in human plasma. Copyright © 2012 Elsevier B.V. All rights reserved.
Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A
2004-09-01
Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
A Fully Reconfigurable Low-Noise Biopotential Sensing Amplifier With 1.96 Noise Efficiency Factor.
Tzu-Yun Wang; Min-Rui Lai; Twigg, Christopher M; Sheng-Yu Peng
2014-06-01
A fully reconfigurable biopotential sensing amplifier utilizing floating-gate transistors is presented in this paper. By using the complementary differential pairs along with the current reuse technique, the theoretical limit for the noise efficiency factor of the proposed amplifier is below 1.5. Without consuming any extra power, floating-gate transistors are employed to program the low-frequency cutoff corner of the amplifier and to implement the common-mode feedback. A concept proving prototype chip was designed and fabricated in a 0.35 μm CMOS process occupying 0.17 mm (2) silicon area. With a supply voltage of 2.5 V, the measured midband gain is 40.7 dB and the measured input-referred noise is 2.8 μVrms. The chip was tested under several configurations with the amplifier bandwidth being programmed to 100 Hz, 1 kHz , and 10 kHz. The measured noise efficiency factors in these bandwidth settings are 1.96, 2.01, and 2.25, respectively, which are among the best numbers reported to date. The measured common-mode rejection and the supply rejection are above 70 dB . When the bandwidth is configured to be 10 kHz, the dynamic range measured at 1 kHz is 60 dB with total harmonic distortion less than 0.1%. The proposed amplifier is also demonstrated by recording electromyography (EMG), electrocardiography (ECG), electrooculography (EOG), and electroencephalography (EEG) signals from human bodies.
Improved-Bandwidth Transimpedance Amplifier
Chapsky, Jacob
2009-01-01
The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.
Solar energetic particles a modern primer on understanding sources, acceleration and propagation
Reames, Donald V
2017-01-01
This concise primer introduces the non-specialist reader to the physics of solar energetic particles (SEP) and systematically reviews the evidence for the two main mechanisms which lead to the so-called impulsive and gradual SEP events. More specifically, the timing of the onsets, the longitude distributions, the high-energy spectral shapes, the correlations with other solar phenomena (e.g. coronal mass ejections), as well as the all-important elemental and isotopic abundances of SEPs are investigated. Impulsive SEP events are related to magnetic reconnection in solar flares and jets. The concept of shock acceleration by scattering on self-amplified Alfvén waves is introduced, as is the evidence of reacceleration of impulsive-SEP material in the seed population accessed by the shocks in gradual events. The text then develops processes of transport of ions out to an observer. Finally, a new technique to determine the source plasma temperature in both impulsive and gradual events is demonstrated. Last but not ...
Millimeter-wave power amplifiers
du Preez, Jaco
2017-01-01
This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
International Nuclear Information System (INIS)
Wang Tiegu; Huang Qunce; Feng Weisen
2007-01-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Wang, Tiegu; Huang, Qunce; Feng, Weisen
2007-10-01
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam
Energy Technology Data Exchange (ETDEWEB)
Tiegu, Wang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Qunce, Huang [Henan Provincial Key Laboratory of Ion Beam Bio-Engineering, Zhengzhou University, Zhengzhou 450052 (China); Weisen, Feng [Luoyang Institute of Agricultural Science, Luoyang 471022 (China)
2007-10-15
Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.
A low power and low distortion rail-to-rail input/output amplifier using constant current technique
International Nuclear Information System (INIS)
Liu Yan; Zhao Yiqiang; Zhang Shilin; Zhao Hongliang
2011-01-01
A rail-to-rail amplifier with constant transconductance, intended for audio processing, is presented. The constant transconductance is obtained by a constant current technique based on the input differential pairs operating in the weak inversion region. MOSFETs working in the weak inversion region have the advantages of low power and low distortion. The proposed rail-to-rail amplifier, fabricated in a standard 0.35 μm CMOS process, occupies a core die area of 75 x 183 μm 2 . Measured results show that the maximum power consumption is 85.37 μW with a supply voltage of 3.3 V and the total harmonic distortion level is 1.2% at 2 kHz. (semiconductor integrated circuits)
Oscillators and operational amplifiers
Lindberg, Erik
2005-01-01
A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.
Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems
Energy Technology Data Exchange (ETDEWEB)
Koptev, M Yu; Anashkina, E A; Lipatov, D S; Andrianov, A V; Muravyev, S V; Kim, A V [Lobachevsky State University of Nizhny Novgorod, Nizhny Novgorod (Russian Federation); Bobkov, K K; Likhachev, M E; Levchenko, A E; Aleshkina, S S; Semjonov, S L; Denisov, A N; Bubnov, M M [Fiber Optics Research Center, Russian Academy of Sciences, Moscow (Russian Federation); Laptev, A Yu; Gur' yanov, A N [G.G.Devyatykh Institute of Chemistry of High-Purity Substances, Russian Academy of Sciences, Nizhnii Novgorod (Russian Federation)
2015-05-31
We report a new ytterbium-doped active tapered fibre used in the output amplifier stage of a fibre laser system for the generation of megawatt peak power ultrashort pulses in the microjoule energy range. The tapered fibre is single-mode at its input end (core and cladding diameters of 10 and 80 μm) and multimode at its output end (diameters of 45 and 430 μm), but ultrashort pulses are amplified in a quasi-single-mode regime. Using a hybrid Er/Yb fibre system comprising an erbium master oscillator and amplifier at a wavelength near 1.5 μm, a nonlinear wavelength converter to the 1 μm range and a three-stage ytterbium-doped fibre amplifier, we obtained pulses of 1 μJ energy and 7 ps duration, which were then compressed by a grating-pair dispersion compressor with 60% efficiency to a 130 fs duration, approaching the transform-limited pulse duration. The present experimental data agree well with numerical simulation results for pulse amplification in the threestage amplifier. (extreme light fields and their applications)
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Directory of Open Access Journals (Sweden)
Samaneh ZIBADOOST
2016-04-01
Full Text Available During field surveys in 2013 and 2014, about 14 weed plants showing phytoplasma diseases symptoms including yellowing and witches’broom were collected and tested by polymerase chain reaction (PCR using universal primers for 16SrRNA starting by primer pairs P1/P7 in first round PCR followed by primer pair R16F2n/R16R2 in nested PCR. The detected phytoplasmas were characterized and differentiated through sequence analysis of PCR-amplified rDNA and virtual restriction fragment length polymorphism (RFLP. The phytoplasmas detected in symptomatic horseweed (Erigeron canadensis L., common madder (Rubia tinctorum L., Johnson grass (Sorghum halepense [L.] Pers. and Sophora root (Sophora alopecuroides L. were identified as members of the clover proliferation group (16SrVI group by construction of phylogenetic trees. Further analysis by virtual RFLP classified the phytoplasmas of Erigeron canadensis L. and Sorghum halepense L. in subgroup 16SrVI-A and phytoplasmas of Rubia tinctorum L. and Sophora alpecuriodes L. in subgroup 16SrVI-D. This is the first report on the occurrence of phytoplasma diseases of weeds in west Azarbaijan, Iran.
Bioinformatic tools and guideline for PCR primer design | Abd ...
African Journals Online (AJOL)
Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...
竹内,準一; 黒杭,祐太; 田中,陵暉
2013-01-01
Internal colonizers of bacteria were isolated from gut after partial surface sterilization using UV irradiation and the subsequent dispersal treatment. Genomic DNA extraction from each isolate was performed with a FTA TM card (Whatman, UK), and then PCR-amplified, targeting 16S rDNA fragments with universal primer pairs. The PCR products were purified and then sequenced to identify a series of bacterial strains collected during this study. Most of the gut floras were members of the Aeromonas ...
Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.
2012-01-01
Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...
International Nuclear Information System (INIS)
Atoui, A.; Mathieu, F.; Lebrihi, A.
2007-01-01
Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RL O TAF/Ac12RL O TAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)
Development and characterization of genomic microsatellite markers in Prosopis cineraria
Directory of Open Access Journals (Sweden)
Shashi Shekhar Anand
2017-06-01
Full Text Available Characterization of genetic diversity is a must for exploring the genetic resources for plant development and improvement. Prosopis cineraria is ecologically imperative species known for its innumerable biological benefits. Since there is a lack of genetic resources for the species, so it is crucial to unravel the population dynamics which will be very effective in plant improvement and conservation strategies. Of the 41 genomic microsatellite markers designed from (AGn enriched library, 24 were subsequently employed for characterization on 30 genotypes of Indian arid region. A total of 93 alleles with an average 3.875 could be amplified by tested primer pairs. The average observed and expected heterozygosity was 0.5139 and 0.5786, respectively with 23 primer pairs showing significant deviations from Hardy-Weinberg equilibrium. Polymorphic information content average to 0.5102 and the overall polymorphism level was found to be 93.27%. STRUCTURE analysis and DARwin exhibited the presence of 4 clusters among 30 genotypes.
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
Medium Caliber Lead-Free Electric Primer. Version 2
2012-09-01
2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in
Zhang, F; Ge, Y Y; Wang, W Y; Shen, X L; Yu, X Y
2012-12-03
Conventional hybridization and selection techniques have aided the development of new ornamental crop cultivars. However, little information is available on the genetic divergence of bromeliad hybrids. In the present study, we investigated the genetic variability in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism (SRAP) markers. The morphological analysis showed that the putative hybrids were intermediate between both parental species with respect to inflorescence characteristics. The 16 SRAP primer combinations yield 265 bands, among which 154 (57.72%) were polymorphic. The genetic similarity was an average of 0.59 and ranged from 0.21 to 0.87, indicating moderate genetic divergence among the hybrids. The unweighted pair group method with arithmetic average (UPGMA)-based cluster analysis distinguished the hybrids from their parents with a genetic distance coefficient of 0.54. The cophenetic correlation was 0.93, indicating a good fit between the dendrogram and the original distance matrix. The two-dimensional plot from the principal coordinate analysis showed that the hybrids were intermediately dispersed between both parents, corresponding to the results of the UPGMA cluster and the morphological analysis. These results suggest that SRAP markers could help to identify breeders, characterize F(1) hybrids of bromeliads at an early stage, and expedite genetic improvement of bromeliad cultivars.
Directory of Open Access Journals (Sweden)
Saroj K. Dangi
2014-10-01
Full Text Available Aim: The present study was aimed at polymerase chain reaction (PCR amplification and cloning of NAD-dependent betahydroxybutyryl coenzyme A dehydrogenase (BHBD gene of Clostridium chauvoei. Materials and Methods: C. chauvoei was cultured and confirmed by 16-23S rDNA spacer region primers. The primers for nad-bhbd gene of C. chauvoei were designed to aid in cloning into pRham-N-His SUMO-Kan vector, and nad-bhbd gene was amplified by PCR. The amplified nad-bhbd gene was purified and cloned into pRham-N-His SUMO-Kan expression vector. The recombinant plasmid was transformed into E. cloni 10 G cells and the clone was confirmed by colony PCR using the pRham-SUMO-NAD-For and pRham-SUMO-NAD-Rev primers and also by sequencing. Results: PCR amplification of nad-bhbd gene yielded a product length of 844 base pairs which was cloned into pRham-NHis SUMO-Kan vector followed by transformation into E. cloni 10G chemically competent cells. The recombinant clones were characterized by colony PCR, sequencing, followed by basic local alignment search tool (BLAST analysis to confirm the insert. Conclusions: Immunogenic protein NAD- dependent BHBD of C. chauvoei was cloned and the recombinant clones were confirmed by colony PCR and sequencing analysis.
Detection and Molecular Characterization of Grapevine Virus A in Jordan
Directory of Open Access Journals (Sweden)
G. Anfoka
2004-12-01
Full Text Available In a study on grapevines in Jordan conducted between 2002 and 2003, grapevine virus A (GVA was detected in all areas where grapevines were planted. DAS-ELISA analysis of samples from symptomatic trees found that 16.1% of samples were infected with GVA. Using a GVA- specific primer pair (H587/C995, a portion of the coat protein gene of the virus was amplified by IC-RT-PCR and RT-PCR, using leaf extracts and RNA extracted from infected grapevines respectively. After cloning and sequencing the coat protein gene of the Jordanian isolate of GVA (GVA-Jo, the sequence of the amplified product was compared with sequences of other GVA isolates from different countries.
Directory of Open Access Journals (Sweden)
Li Xuerui
2012-11-01
Full Text Available Abstract Background Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. Methods We developed a primer pair based on the tuf gene (encoding elongation factor sequence to identify 56 Gram-positive cocci isolates. Results The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Conclusion Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.
A CMOS current-mode operational amplifier
DEFF Research Database (Denmark)
Kaulberg, Thomas
1993-01-01
current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...
Directory of Open Access Journals (Sweden)
reni heryani
2017-12-01
Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami menstruasi dengan nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Modeling of semiconductor optical amplifiers
DEFF Research Database (Denmark)
Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther
We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible
NASA developments in solid state power amplifiers
Leonard, Regis F.
1990-01-01
Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.
Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays
DEFF Research Database (Denmark)
Nielsen, Henrik Bjørn; Knudsen, Steen
2002-01-01
PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....
Value for money assessment for public-private partnerships : a primer.
2015-01-01
This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.
HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS
International Nuclear Information System (INIS)
2005-01-01
Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department
Godet , Sylvain; Tournier , Éric; Llopis , Olivier; Cathelin , Andreia; Juyon , Julien
2009-01-01
4 pages; International audience; The design and realization of an ultra-low noise operational amplifier is presented. Its applications are integrated low-frequency noise measurements in electronic devices and on-chip phase-noise measurement circuit. This paper discusses the SiGe:C BiCMOS 0.25 µm design improvements used for low noise applications. The proposed three-stage operational amplifier uses parallel bipolar transistor connection as input differential pair for low noise behavior. This ...
Directory of Open Access Journals (Sweden)
Dolores González
2012-12-01
Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m
Electrospun amplified fiber optics.
Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario
2015-03-11
All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.
Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel
2011-01-01
A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014
Cha, Thye San; Anne-Marie, Kaben; Chuah, Tse Seng
2014-02-01
Eleusine indica is one of the most common weed species found in agricultural land worldwide. Although herbicide-glyphosate provides good control of the weed, its frequent uses has led to abundant reported cases of resistance. Hence, the development of genetic markers for quick detection of glyphosate-resistance in E. indica population is imperative for the control and management of the weed. In this study, a total of 14 specific random amplified polymorphic DNA (RAPD) markers were identified and two of the markers, namely S4R727 and S26R6976 were further sequence characterized. Sequence alignment revealed that marker S4R727 showing a 12-bp nucleotides deletion in resistant biotypes, while marker S26R6976 contained a 167-bp nucleotides insertion in the resistant biotypes. Based on these sequence differences, three pairs of new sequence characterized amplified region (SCAR) primers were developed. The specificity of these primer pairs were further validated with genomic DNA extracted from ten individual plants of one glyphosate-susceptible and five glyphosate-resistant (R2, R4, R6, R8 and R11) populations. The resulting RAPD-SCAR markers provided the basis for assessing genetic diversity between glyphosate-susceptible and -resistant E. indica biotypes, as well for the identification of genetic locus link to glyphosate-resistance event in the species.
Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN
Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger
2016-01-01
Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Luo, C; Zhang, F; Zhang, Q L; Guo, D Y; Luo, Z R
2013-01-09
We developed and characterized expressed sequence tags (ESTs)-simple sequence repeats (SSRs) and targeted region amplified polymorphism (TRAP) markers to examine genetic relationships in the persimmon genus Diospyros gene pool. In total, we characterized 14 EST-SSR primer pairs and 36 TRAP primer combinations, which were amplified across 20 germplasms of 4 species in the genus Diospyros. We used various genetic parameters, including effective multiplex ratio (EMR), diversity index (DI), and marker index (MI), to test the utility of these markers. TRAP markers gave higher EMR (24.85) but lower DI (0.33), compared to EST-SSRs (EMR = 3.65, DI = 0.34). TRAP gave a very high MI (8.08), which was about 8 times than the MI of EST-SSR (1.25). These markers were utilized for phylogenetic inference of 20 genotypes of Diospyros kaki Thunb. and allied species, with a result that all kaki genotypes clustered closely and 3 allied species formed an independent group. These markers could be further exploited for large-scale genetic relationship inference.
Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François
2010-02-01
QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.
Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.
Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José
2018-04-01
Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.
Wang, Jian-Sheng; He, Jun-Hu; Chen, Hua-Rui; Chen, Ye-Yuan; Qiao, Fei
2017-12-01
Inter simple sequence repeat (ISSR) and simple sequence repeat (SSR) markers were used to assess the genetic diversity of 36 pineapple accessions that were introduced from 10 countries/regions. Thirteen ISSR primers amplified 96 bands, of which 91 (93.65%) were polymorphic, whereas 20 SSR primers amplified 73 bands, of which 70 (96.50%) were polymorphic. Nei's gene diversity (h = 0.28), Shannon's information index (I = 0.43), and polymorphism information content (PIC = 0.29) generated using the SSR primers were higher than that with ISSR primers (h = 0.23, I = 0.37, PIC = 0.24), thereby suggesting that the SSR system is more efficient than the ISSR system in assessing genetic diversity in various pineapple accessions. Mean genetic similarities were 0.74, 0.61, and 0.69, as determined using ISSR, SSR, and combined ISSR/SSR, respectively. These results suggest that the genetic diversity among pineapple accessions is very high. We clustered the 36 pineapple accessions into three or five groups on the basis of the phylogenetic trees constructed based on the results of ISSR, SSR, and combined ISSR/SSR analyses using the unweighted pair-group with arithmetic averaging (UPGMA) method. The results of principal components analysis (PCA) also supported the UPGMA clustering. These results will be useful not only for the scientific conservation and management of pineapple germplasm but also for the improvement of the current pineapple breeding strategies.
International Nuclear Information System (INIS)
Lepetit, J.; Poussier, E.
1984-01-01
This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr
A fluidic/pneumatic interface amplifier
Limbert, D. E.; Kegel, T. M.
The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.
Directory of Open Access Journals (Sweden)
KUSUMADEWI SRI YULITA
2011-07-01
Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.
Amplifier for nuclear spectrometry
International Nuclear Information System (INIS)
Suarez Canner, E.
1996-01-01
The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system
Montes-Borrego, Miguel; Muñoz Ledesma, Francisco J; Jiménez-Díaz, Rafael M; Landa, Blanca B
2009-01-01
A sensitive nested-polymerase chain reaction (PCR) protocol was developed using either of two primer pairs that improves the in planta detection of Peronospora arborescens DNA. The new protocol represented an increase in sensitivity of 100- to 1,000-fold of detection of the oomycete in opium poppy tissue compared with the detection limit of single PCR using the same primer pairs. The new protocol allowed amplification of 5 to 0.5 fg of Peronospora arborescens DNA mixed with Papaver somniferum DNA. The protocol proved useful for amplifying Peronospora arborescens DNA from 96-year-old herbarium specimens of Papaver spp. and to demonstrate that asymptomatic, systemic infections by Peronospora arborescens can occur in wild Papaver spp. as well as in cultivated opium poppy. Also, the increase in sensitivity of the protocol made possible the detection of seedborne Peronospora arborescens in commercial opium poppy seed stocks in Spain with a high frequency, which poses a threat for pathogen spread. Direct sequencing of purified amplicons allowed alignment of a Peronospora arborescens internal transcribed spacer (ITS) ribosomal DNA (rDNA) sequence up to 730-bp long when combining the sequences obtained with the two primer sets. Maximum parsimony analysis of amplified Peronospora arborescens ITS rDNA sequences from specimens of Papaver dubium, P. hybridum, P. rhoeas, and P. somniferum from different countries indicated for the first time that a degree of host specificity may exist within populations of Peronospora arborescens. The reported protocol will be useful for epidemiological and biogeographical studies of downy mildew diseases as well as to unravel misclassification of Peronospora arborescens and Peronospora cristata, the reported causal agents of the opium poppy downy mildew disease.
Economics : pricing, demand, and economic efficiency : a primer.
2008-11-01
The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...
Antoniou, Grigoris; Harmelen, Frank van
2004-01-01
The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a
Singh, Gurpreet; Singh, Maninder Lal
2015-08-01
A new four wave mixing (FWM) model for an optical network with amplifiers and a comparative analysis among three proposed amplifiers placement techniques have been presented in this paper. The FWM model is validated with the experimental measured data. The novelty of this model is its uniqueness that on direct substitutions of network parameters like length, it works even for unequal inter amplifier separations. The novelty of the analysis done among three schemes is that it presents fair choice of amplifiers placement methods for varied total system length. The appropriateness of these three schemes has been analyzed on the basis of critical system length, critical number of amplifiers and critical bit error rate (10-9) in presence of four wave mixing (FWM) and amplified spontaneous emission noise (ASE). The implementation of analysis done has been given with the help of an example of a regenerative metropolitan area network (MAN). The results suggest that the decreasing fiber section scheme should be avoided for placements of amplifiers and schemes IUFS and EFS shows their importance interchangeably for different set of parameters.
Semiconductor quantum-dot lasers and amplifiers
DEFF Research Database (Denmark)
Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.
2002-01-01
-power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...
NIF/LMJ prototype amplifier mechanical design
International Nuclear Information System (INIS)
Horvath, J.
1996-10-01
Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations
Effects of ion pairs on the dynamics of erbium doped fiber laser in the inhomogeneous model
International Nuclear Information System (INIS)
Keyvaninia, Sh.; Karvar, M.; Bahrampour, A.
2006-01-01
In a high concentration erbium doped fiber, the erbium ions are so closed together that the ion pairs and clusters are formed. In such fiber amplifiers, the ion pairs and clusters acting as a saturable absorber are distributed along the fiber laser. The inhomogeneous rate equations for the laser modes in a high-concentration EDFA are written. The governing equations are an uncountable system of partial differential equations. For the first time we introduced an approximation method that the system of partial differential equations is converted to a finite system of ordinary differential equations. The effects of ion pairs concentration on erbium doped fiber are analyzed that is in good agreement whit the experimental result.
A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory
Guo, Jiarong
2017-04-01
A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).
Paulik, G. F.; Mayer, R. P.
2012-01-01
A differential amplifier composed of an emitter-coupled pair is useful as an example in lecture presentations and laboratory experiments in electronic circuit analysis courses. However, in an active circuit with zero input load V[subscript id], both laboratory measurements and PSPICE and LTspice simulation results for the output voltage…
International Nuclear Information System (INIS)
Horvath, J. A.
1998-01-01
Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Dan Arthur; Bruce Langhus; Jon Seekins
2005-05-25
During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of
Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M
2011-11-22
Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.
An Electronically Tunable Transconductance Amplifier for Use in Auditory Prostheses
Directory of Open Access Journals (Sweden)
FARAGO, P.
2015-11-01
Full Text Available Low-voltage and low-power trends in analog electronics enable novel features in modern bio-medical devices, such as extensive portability, autonomy and even battery-less operation. One specific example is the cochlear implant (CI, which emulates the physiology of hearing to produce auditory sensations via neural stimulation. Besides low-voltage and low-power operation, a key feature in modern CIs is wide-range programmability of the speech processing parameters. This paper proposes an operational transconductance amplifier (OTA for use in CIs, with wide-range electronic tuning of the transconductance value. The proposed OTA is developed around a cascade of two transconductor stages, making the transconductance dependent on the bias current ratio. A combination of linearization techniques: bulk input, parallel differential pairs and feedback, is used to achieve sufficient linear range for CI speech processing. Wide-range parameter tuning of the speech processing sections is illustrated on a variable gain amplifier, a bandpass Tow-Thomas biquad and an envelope detector. Finally, the complete CI speech processing chain is illustrated. The proposed OTA and its employment in CI analog speech processing are validated on a 350 nm CMOS process.
Quick spacecraft charging primer
International Nuclear Information System (INIS)
Larsen, Brian Arthur
2014-01-01
This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
European Research on THz Vacuum Amplifiers
DEFF Research Database (Denmark)
Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.
2010-01-01
The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....
Integrated amplifying circuit with MOS transistors
Energy Technology Data Exchange (ETDEWEB)
Baylac, B; Merckel, G; Meunier, P
1974-01-25
The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.
Climate Change, Health, and Communication: A Primer.
Chadwick, Amy E
2016-01-01
Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.
using random amplified polymorphic DNA (RAPD)
African Journals Online (AJOL)
To study the pattern of genetic diversity in 45 genotypes of common bean, 19 RAPD primers were used. Of 253 bands produced, 236 bands (94.22%) were polymorphic in which maximum number (20 polymorphic bands) were observed in the profiles of the primer OPB-07. Highest PIC value (0.79) was observed for the ...
Xu, Jing-Yuan; Zhu, Yan; Yi, Ze; Wu, Gang; Xie, Guo-Yong; Qin, Min-Jian
2018-01-01
"Wu zhu yu", which is obtained from the dried unripe fruits of Tetradium ruticarpum (A. Jussieu) T. G. Hartley, has been used as a traditional Chinese medicine for treatment of headaches, abdominal colic, and hypertension for thousands of years. The present study was designed to assess the molecular genetic diversity among 25 collected accessions of T. ruticarpum (Wu zhu yu in Chinese) from different areas of China, based on inter-primer binding site (iPBS) markers and inter-simple sequence repeat (ISSR) markers. Thirteen ISSR primers generated 151 amplification bands, of which 130 were polymorphic. Out of 165 bands that were amplified using 10 iPBS primers, 152 were polymorphic. The iPBS markers displayed a higher proportion of polymorphic loci (PPL = 92.5%) than the ISSR markers (PPL = 84.9%). The results showed that T. ruticarpum possessed high loci polymorphism and genetic differentiation occurred in this plant. The combined data of iPBS and ISSR markers scored on 25 accessions produced five clusters that approximately matched the geographic distribution of the species. The results indicated that both iPBS and ISSR markers were reliable and effective tools for analyzing the genetic diversity in T. ruticarpum. Copyright © 2018 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.
Marketing Information Products and Services : A Primer for ...
International Development Research Centre (IDRC) Digital Library (Canada)
Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...
International Nuclear Information System (INIS)
Fayyaz, L.; Farhatullah, A.; Iqbal, S.; Kanwal, M.; Nawaz, I.
2014-01-01
Genetic diversity and relationship of F2 segregating progenies of interspecific crosses between B. napus N-501/B. campestris C-118 were studied. A set of 90 genotypes (2 parental lines and their 88 F2 progenies) was characterized separately using 24 microsatellite or SSR markers to cover the diversity as broadly as possibly present in them. In initial screening only 12 out of 24 SSR primers combination amplified DNA fragments, while the remaining 12 SSR primers did not amplify DNA fragment therefore those 12 SSR molecular markers were not used for further analysis. The 12 SSR primer combinations generated a total of 33 alleles, of that 32 were polymorphic loci, whereas only one was monomorphic locus. Primers BRMS-19 and BRMS-40 were highly polymorphic producing 4 bands each. Primer Ra2-D04 was less polymorphic and it produced only one band. The proportion of polymorphic loci was 95.83% which indicates high genetic diversity among the progenies. The average number of polymorphic alleles per locus was 2.66. The PIC values ranged from 0.395 for primer Ra2-E03 to 0.726 for primer BRMS-019 with an average genetic diversity (PIC value) of 0.584 per locus. Seven primers showed PIC values above 0.5 (50%) indicating high genetic diversity in the studied plant materials. Pair-wise similarity indices among 90 genotypes ranged from 0.3 to 0.95. Dendrogram obtained through UPGMA clustering of F2 progenies depicted eight main groups using similarity coefficient of 0.70. The progenies could be similar to their parents if they have the same banding patterns as that of the parents and could be distinguished from each other by the combination of fragments which are repeatedly present in one progeny and absent in the other. Considerable genetic diversity has been found among the F2 segregating progenies and their parents using SSR markers thus, SSR analysis proved to be a useful tool. (author)
Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques
Acar, M.
2011-01-01
In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high
An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET
Energy Technology Data Exchange (ETDEWEB)
Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)
2011-01-15
Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.
Microsatellite primers for fungus-growing ants
DEFF Research Database (Denmark)
Villesen, Palle; Gertsch, P J; Boomsma, JJ
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Microsatellite Primers for Fungus-Growing Ants
DEFF Research Database (Denmark)
Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)
2002-01-01
We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....
Enhanced performance CCD output amplifier
Dunham, Mark E.; Morley, David W.
1996-01-01
A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.
Directory of Open Access Journals (Sweden)
Xiaolin Liao
2014-07-01
Full Text Available Half-smooth tongue sole (Cynoglossus semilaevis is one of the most important flatfish species for aquaculture in China. To produce a monosex population, we attempted to develop a marker-assisted sex control technique in this sexually size dimorphic fish. In this study, we identified a co-dominant sex-linked marker (i.e., CyseSLM by screening genomic microsatellites and further developed a novel molecular method for sex identification in the tongue sole. CyseSLM has a sequence similarity of 73%–75% with stickleback, medaka, Fugu and Tetraodon. At this locus, two alleles (i.e., A244 and A234 were amplified from 119 tongue sole individuals with primer pairs CyseSLM-F1 and CyseSLM-R. Allele A244 was present in all individuals, while allele A234 (female-associated allele, FAA was mostly present in females with exceptions in four male individuals. Compared with the sequence of A244, A234 has a 10-bp deletion and 28 SNPs. A specific primer (CyseSLM-F2 was then designed based on the A234 sequence, which amplified a 204 bp fragment in all females and four males with primer CyseSLM-R. A time-efficient multiplex PCR program was developed using primers CyseSLM-F2, CyseSLM-R and the newly designed primer CyseSLM-F3. The multiplex PCR products with co-dominant pattern could be detected by agarose gel electrophoresis, which accurately identified the genetic sex of the tongue sole. Therefore, we have developed a rapid and reliable method for sex identification in tongue sole with a newly identified sex-linked microsatellite marker.
Transmission characteristics of acoustic amplifier in thermoacoustic engine
International Nuclear Information System (INIS)
Sun Daming; Qiu Limin; Wang Bo; Xiao Yong
2008-01-01
Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier
Tymon, Anna M; Shah, Paresh A; Pell, Judith K
2004-04-01
Studies were performed to assess the genetic variation amongst isolates of the aphid-pathogenic fungus Pandora neoaphidis (syn. Erynia neoaphidis). 37 isolates were examined, from a range of pest and non-pest aphid species, as well as 21 from eight other entomophthoralean species. Universal primers were used to amplify the ITS rDNA regions and all of the species tested produced discrete ITS groups, with the exception of Conidiobolus spp. Neighbour-joining analysis of the ITS2 regions from P. neoaphidis, P. kondoiensis and Zoophthora radicans demonstrated that these three species formed distinct groups with sequence identities of 58-82% between the groups. An ITS size of ca 1,100 bp was diagnostic for P. neoaphidis, while ca 1,450 bp was characteristic of P. kondoiensis. ITS-RFLP analysis failed to yield intraspecific polymorphisms in any of the P. neoaphidis isolates screened, although it was useful in distinguishing between different entomophthoralean species. Some intraspecific variation in the ITS region was detected in a number of isolates of Z. radicans and Conidiobolus spp. We propose that two isolates previously identified as P. neoaphidis based on conidia morphology, are actually P. kondoiensis based on molecular studies. Sequencing analysis of the complete ITS region from P. neoaphidis and P. kondoiensis allowed species-specific primers to be developed for P. neoaphidis and P. kondoiensis. These were used to screen aphids infected in laboratory bioassays and from field-collected samples, without prior isolation of the fungus. The primers are useful tools for quantifying the epizootiology of P. neoaphidis in aphid populations, as well as assessing competitive interactions between these two species.
Reduced transposed flicker noise in microwave oscillators using gaas-based feedforward amplifiers.
Everard, Jeremy K A; Broomfield, Carl D
2007-06-01
Transposed flicker noise reduction and removal is demonstrated in 7.6 GHz microwave oscillators for offsets greater than 10 kHz. This is achieved by using a GaAs-based feedforward power amplifier as the oscillation-sustaining stage and incorporating a limiter and resonator elsewhere in the loop. 20 dB noise suppression is demonstrated at 12.5 kHz offset when the error correcting amplifier is switched on. Three oscillator pairs have been built. A transmission line feedback oscillator with a Qo of 180 and two sapphire-based, dielectric resonator oscillators (DROs) with a Qo of 44,500. The difference between the two DROs is a change in the limiter threshold power level of 10 dB. The phase noise rolls-off at (1/f)(2) for offsets greater than 10 kHz for the transmission line oscillator and is set by the thermal noise to within 0-1 dB of the theoretical minimum. The noise performance of the DROs is within 6-12 dB of the theory. Possible reasons for this discrepancy are presented.
Identification of apple cultivars on the basis of simple sequence repeat markers.
Liu, G S; Zhang, Y G; Tao, R; Fang, J G; Dai, H Y
2014-09-12
DNA markers are useful tools that play an important role in plant cultivar identification. They are usually based on polymerase chain reaction (PCR) and include simple sequence repeats (SSRs), inter-simple sequence repeats, and random amplified polymorphic DNA. However, DNA markers were not used effectively in the complete identification of plant cultivars because of the lack of known DNA fingerprints. Recently, a novel approach called the cultivar identification diagram (CID) strategy was developed to facilitate the use of DNA markers for separate plant individuals. The CID was designed whereby a polymorphic maker was generated from each PCR that directly allowed for cultivar sample separation at each step. Therefore, it could be used to identify cultivars and varieties easily with fewer primers. In this study, 60 apple cultivars, including a few main cultivars in fields and varieties from descendants (Fuji x Telamon) were examined. Of the 20 pairs of SSR primers screened, 8 pairs gave reproducible, polymorphic DNA amplification patterns. The banding patterns obtained from these 8 primers were used to construct a CID map. Each cultivar or variety in this study was distinguished from the others completely, indicating that this method can be used for efficient cultivar identification. The result contributed to studies on germplasm resources and the seedling industry in fruit trees.
Recombinogenic engineering of conjugative plasmids with fluorescent marker cassettes
DEFF Research Database (Denmark)
Reisner, A.; Molin, Søren; Zechner, E.L.
2002-01-01
An efficient approach for the insertion of fluorescent marker genes with sequence specificity into conjugative plasmids in Escherichia coli is described. For this purpose, homologous recombination of linear double-stranded targeting DNA was mediated by the bacteriophage lambda recombination...... resistance genes and fluorescent markers. The choice of 5' non-homologous extensions in primer pairs used for amplifying the marker cassettes determines the site specificity of the targeting DNA. This methodology is applicable to the modification of all plasmids that replicate in E coli and is not restricted...
Robinson, Mike J.F.; Warlow, Shelley M.; Berridge, Kent C.
2014-01-01
Choosing one reward above another is important for achieving adaptive life goals. Yet hijacked into excessive intensity in disorders such as addiction, single-minded pursuit becomes maladaptive. Here, we report that optogenetic channelrhodopsin stimulation of neurons in central nucleus of amygdala (CeA), paired with earning a particular sucrose reward in rats, amplified and narrowed incentive motivation to that single reward target. Therefore, CeA rats chose and intensely pursued only the las...
A physicists guide to The Los Alamos Primer
International Nuclear Information System (INIS)
Reed, B Cameron
2016-01-01
In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)
Citakovic, J; Nielsen, I. Riis; Nielsen, Jannik Hammel; Asbeck, P; Andreani, Pietro
2005-01-01
A two-stage amplifier, operational at 0.8V and drawing 7μA, has been integrated in a standard digital 0.18μm CMOS process. Rail-to-rail operations at the input are enabled by complementary transistor pairs with gm control. The efficient rail-to-rail output stage is biased in class AB. The measured DC gain of the amplifier is 75dB, and the unity-gain frequency is 870kHz with a 12pF, 100kΩload. Both input and output stage transistors are biased in weak inversion.
Directory of Open Access Journals (Sweden)
Palmieri Dario A
2007-02-01
Full Text Available Abstract Background The genus Arachis includes Arachis hypogaea (cultivated peanut and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species. Results Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci. Conclusion These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species.
Molecular differentiation of sheep and cattle isolates of Fasciola hepatica using RAPD-PCR
Directory of Open Access Journals (Sweden)
Khakpour, M.
2012-11-01
Full Text Available Understanding genetic structure and status of genetic variation of Fasciola hepatica isolates from different hosts, has important implications on epidemiology and effective control of fasciolosis. Random amplified polymorphic DNA (RAPD-PCR was used to study the genetic variation of F. hepatica in sheep and cattle. DNA was extracted from adult helminthes removed from livers of each infected animal in slaughterhouse at East-Azerbaijan province, North-West of Iran. DNA template amplified by the polymerase chain reaction, using three oligonucleotide decamers with arbitrary DNA sequences as primers. RAPD patterns showed the specific but different pattern DNA patterns for each primer. The intraspecific similarity coefficient within two isolates of F. hepatica was ranged between 69 to 100%. Present findings showed that the interspecific genetic distance was higher than intraspecific genetic distances (19-47% compares to 0-19%. Pair wise similarity matrices generated from each isolates-primer combination were totaled and the similarity coefficient between strains were calculated both manually (Nei and Li method and software analysis (Free-Tree-Freeware program. The inferred phylogenetic tree on the fingerprinting of these isolates clearly demonstrated the existence of population genetic diversity sub structuring within F. hepatica of sheep and cattle of Iran, raising interesting questions on the host specificity, epidemiology (e.g., zoonotic transmission and ecology of this fluke. RAPD-PCR is useful for both individual identification and epidemiological investigations in endemic regions.
Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk
2012-06-01
The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.
Identifikasi Molekuler Fitoplasma yang Berasosiasi dengan Tanaman Kaktus Hias Opuntia sp.
Directory of Open Access Journals (Sweden)
Ariny Prasetya
2017-11-01
Full Text Available Cactus species (Opuntia sp. is a popular ornamental succulent plant. Some ornamental cactus species in Indonesia showing proliferation and green mosaic pattern symptoms have been reported to be associated with phytoplasma infection. However, further molecular identification for accurate classification of the causal phytoplasma has not been done. This study aimed to diagnose phytoplasma associated with Opuntia sp. based on molecular methods involving PCR standard combined with nested-PCR, cloning and DNA sequencing. Standard PCR was carried out using P1/P7 primers followed by nested-PCR using R16F2n/R16R2 or fU5/rU3 primer pairs which amplify the 16S rRNA gene targets of 1.2 kb and 880 bp, respectively. Amplified fragment of nested-PCR using R16F2n/R16R2 primers was chosen to be cloned and sequenced for further identification and classification of phytoplasma. BLASTn analysis showed that the phytoplasma from Opuntia sp. was closely related to 16SrII group. Phylogenetic analysis and in silico RFLP indicated that phytoplasma strain infecting Opuntia sp. was a member of subgroup 16SrII-C (cactus witches’ broom phytoplasma. This is a newly report of cactus witches’ broom phytoplasma on Opuntia sp. in Indonesia.
Final amplifier design and mercury
International Nuclear Information System (INIS)
Rose, E.A.; Hanson, D.E.
1991-01-01
The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met
A pulse amplifier for nuclear instrumentation
International Nuclear Information System (INIS)
Martin, D.; Cliff, P.
1987-01-01
A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM
Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia
2001-01-01
Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...
Directory of Open Access Journals (Sweden)
Nao Nishida
Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.
An Implantable CMOS Amplifier for Nerve Signals
DEFF Research Database (Denmark)
Nielsen, Jannik Hammel; Lehmann, Torsten
2003-01-01
In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...
International Nuclear Information System (INIS)
Tai, I.; Hasegawa, K.
1975-01-01
This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)
Do we need primer for orthodontic bonding? A randomized controlled trial.
Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R
2015-04-01
To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown
Paired Expression Analysis of Tumor Cell Surface Antigens
Directory of Open Access Journals (Sweden)
Rimas J. Orentas
2017-08-01
Full Text Available Adoptive immunotherapy with antibody-based therapy or with T cells transduced to express chimeric antigen receptors (CARs is useful to the extent that the cell surface membrane protein being targeted is not expressed on normal tissues. The most successful CAR-based (anti-CD19 or antibody-based therapy (anti-CD20 in hematologic malignancies has the side effect of eliminating the normal B cell compartment. Targeting solid tumors may not provide a similar expendable marker. Beyond antibody to Her2/NEU and EGFR, very few antibody-based and no CAR-based therapies have seen broad clinical application for solid tumors. To expand the way in which the surfaceome of solid tumors can be analyzed, we created an algorithm that defines the pairwise relative overexpression of surface antigens. This enables the development of specific immunotherapies that require the expression of two discrete antigens on the surface of the tumor target. This dyad analysis was facilitated by employing the Hotelling’s T-squared test (Hotelling–Lawley multivariate analysis of variance for two independent variables in comparison to a third constant entity (i.e., gene expression levels in normal tissues. We also present a unique consensus scoring mechanism for identifying transcripts that encode cell surface proteins. The unique application of our bioinformatics processing pipeline and statistical tools allowed us to compare the expression of two membrane protein targets as a pair, and to propose a new strategy based on implementing immunotherapies that require both antigens to be expressed on the tumor cell surface to trigger therapeutic effector mechanisms. Specifically, we found that, for MYCN amplified neuroblastoma, pairwise expression of ACVR2B or anaplastic lymphoma kinase (ALK with GFRA3, GFRA2, Cadherin 24, or with one another provided the strongest hits. For MYCN, non-amplified stage 4 neuroblastoma, neurotrophic tyrosine kinase 1, or ALK paired with GFRA2, GFRA3, SSK
Primer on consumer marketing research : procedures, methods, and tools
1994-03-01
The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...
International Nuclear Information System (INIS)
Liu Min; Li Jinguo; Wang Yalin; Zhang Zan; Xue Huai; Zhang Chunhua; Li Sherong
1999-01-01
The detection technology of peroxidase isoenzyme pattern and RAPD (Randomly Amplified Polymorphic DNA) analysis were used to space-flown sweet pepper variety of 87-2 carried by a recoverable satellite, and its correspondent ground control Longjiao-2. Determination of peroxidase isoenzyme revealed that the physiological activities of space-flown sweet pepper were significantly higher than those of its ground control. To detect the polymorphism of gene sequence and the difference in molecular level. 42 primers were used, among them, 38 primers amplified polymorphic products, and the amplified products from 5 primers of sweet pepper 87-2 differed from those of ground control
Flashlamp excited fluid laser amplified
International Nuclear Information System (INIS)
1976-01-01
The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation
Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module
Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.
2002-01-01
This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Directory of Open Access Journals (Sweden)
Aunyachulee Ganogpichayagrai
2016-01-01
Full Text Available Thai mango cultivars are classified into six groups plus one miscellaneous group according to germplasm database for mango. Characterization is important for conservation and the development of Thai mango cultivars. This study investigated macroscopic, microscopic leaf characteristics, and genetic relationship among 17 cultivars selected from six groups of mango in Thailand. Selected mango samples were obtained from three different locations in Thailand (n = 57. They were observed for their leaf and fruit macroscopic characteristics. Leaf measurement for the stomatal number, veinlet termination number, and palisade ratio was evaluated under a microscope attached with digital camera. DNA fingerprint was performed using CTAB extraction of DNA and inter-simple sequence repeat (ISSR amplification. Forty-five primers were screened; then, seven primers that amplified the reproducible band patterns were selected to amplified and generate dendrogram by Unweighted Pair-Group Method with Arithmetic Average. These selected 17 Thai mango cultivars had individually macroscopic characteristics based on fruits and leaves. For microscopic characteristics, the stomatal number, veinlet termination number, and palisade ratio were slightly differentiable. For genetic identification, 78 bands of 190-2660 bps were amplified, of which 82.05% were polymorphic. The genetic relationship among these cultivars was demonstrated and categorized into two main clusters. It was shown that ISSR markers could be useful for Thai mango cultivar identification.
Challenges in higher order mode Raman amplifiers
DEFF Research Database (Denmark)
Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk
2015-01-01
A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...
Criticality calculations with MCNP trademark: A primer
International Nuclear Information System (INIS)
Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.
1994-01-01
With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand
Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.
This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.
Small signal microwave amplifier design
Grosch, Theodore
2000-01-01
This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book
Directory of Open Access Journals (Sweden)
Devita Kusdianingrum
2014-10-01
Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog
Directory of Open Access Journals (Sweden)
hajar shayesteh
2018-02-01
Full Text Available Introduction Jujube (Zizyphus jujuba Mill. as a valuable medicinal plant and adapted to different climatic conditions is widespread in many parts of Iran. Nowadays, beside the export of its fruit, jujube is also used as an herbal medicine to treat the diseases, so it has a high economic value. Study on genetic diversity is the first step to identify and preservation of germplasm. It is also considered as the basic principles of plant breeding. DNA markers seem to be the best way in determination of the genetic diversity. Inter simple sequence repeats (ISSR markers are highly polymorphic and combine most benefits of Simple Sequence Repeats (SSRs and amplified fragment length polymorphism (AFLP to the generality of random amplified polymorphic DNA (RAPD. Materials and Methods In order to study of the genetic diversity among 31 ecotypes collected from eight Jujube-rich provinces, including South Khorasan, Razavi Khorasan, Mazandaran, Golestan, Qom, Isfahan, Lorestan and Fars. Genomic DNA was extracted by CTAB method and polymerase chain reaction (PCR was performed with 13 ISSR primers in which six most efficient primers were selected. Cluster analysis based on Dice similarity coefficient and Unweighed Pair Group Method with Arithmetic Mean (UPGMA was carried out and POPGENe.3.2 software was used to determine the similarity of populations with each other. Results and Discussion 84 loci were amplified and 70 of them (83% revealed a proper polymorphism with the size between 200 and 2000 base pair. The average number of amplified and polymorphic bands per primer was 14 and 11.6 respectively. Primers with di-nucleotide repeats produced more polymorphic bands than ones with tri-nucleotide repeats. It seems that this is due to a higher frequency of sequences containing di-nucleotide repeats in intergenic regions and higher possibility of mutation revealed in more diversity in comparison to gene coding regions. Anchored primers with 1 or 2 nucleotides at
Development of primers for sequencing the NSP1, NSP3, and VP6 genes of the group A porcine rotavirus
Directory of Open Access Journals (Sweden)
Fernanda Dornelas Florentino Silva
2014-02-01
Full Text Available Rotavirus is the causative pathogen of diarrhea in humans and in several animal species. Eight pairs of primers were developed and used for Sanger sequencing of the coding region of the NSP1, NSP3, and VP6 genes based on the conserved regions of the genome of the group A porcine rotavirus. Three samples previously screened as positive for group A rotaviruses were subjected to gene amplification and sequencing to characterize the pathogen. The information generated from this study is crucial for the understanding of the epidemiology of the disease.
DEFF Research Database (Denmark)
Jeppesen, Palle
1997-01-01
Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....
Amplified spontaneous emissions in a high-gain laser amplifier
International Nuclear Information System (INIS)
Osada, Hidenori; Gamo, Hideya.
1978-01-01
The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)
Dual-range linearized transimpedance amplifier system
Wessendorf, Kurt O.
2010-11-02
A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).
Detection of Non-Amplified Genomic DNA
Corradini, Roberto
2012-01-01
This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...
Is there a role for amplifiers in sexual selection?
Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio
2008-05-21
The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
An Implantable CMOS Amplifier for Nerve Signals
DEFF Research Database (Denmark)
Nielsen, Jannik Hammel; Lehmann, Torsten
2001-01-01
In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...
Operational amplifiers theory and design
Huijsing, Johan
2017-01-01
This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...
Directory of Open Access Journals (Sweden)
Yacenia Morillo C.
2014-12-01
Full Text Available Random amplified microsatellite (RAMs markers six were used to characterize 93 genotypes of cocoa in Tumaco (Colombia. Hundred twenty seven bands were generated. The number of polymorphic loci varied between 11 and 25 for the AG and TG primers, respectively. This study differentiated the 93 genotypes into six groups with a 0.53 similarity, 0.28 mean heterozygosity (He for the population, and 0.12±0.02 genetic differentiation coefficient or Fst. A significant level of genetic diversity was evident in the T. cacao genotypes. This resource would benefit selection programs of individual trees or plant breeding programs. The genotypes clustered in a large proportion in accordance with the collection zone. This characteristic was associated with collection zones and along the rivers in the municipality of Tumaco. The RAM technique proved to be a useful tool for the determination of genetic diversity in Theobroma species.
Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation
Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram
2005-01-01
Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render
Solid State Power Amplifier for 805 MegaHertz at the Los Alamos Neutron Science Center
International Nuclear Information System (INIS)
Davis, J.L.; Lyles, J.T.M.
1998-01-01
Particle accelerators for protons, electrons, and other ion species often use high-power vacuum tubes for RF amplification, due to the high RF power requirements to accelerate these particles with high beam currents. The final power amplifier stages driving large accelerators are unable to be converted to solid-state devices with the present technology. In some instances, radiation levels preclude the use of transistors near beamlines. Work is being done worldwide to replace the RF power stages under about ten kilowatts CW with transistor amplifiers, due to the lower maintenance costs and obsolescence of power tubes in these ranges. This is especially practical where the stages drive fifty Ohm impedance and are not located in high radiation zones. The authors are doing this at the Los Alamos Neutron Science Center (LANSCE) proton linear accelerator (linac) in New Mexico. They replaced a physically-large air-cooled UHF power amplifier using a tetrode electron tube with a compact water-cooled unit based on modular amplifier pallets developed at LANSCE. Each module uses eight push-pull bipolar power transistor pairs operated in class AB. Four pallets can easily provide up to 2,800 watts of continuous RF at 805 MHz. A radial splitter and combiner parallels the modules. This amplifier has proven to be completely reliable after over 10,000 hours of operation without failure. A second unit was constructed and installed for redundancy, and the old tetrode system was removed in 1998. The compact packaging for cooling, DC power, impedance matching, RF interconnection, and power combining met the electrical and mechanical requirements. CRT display of individual collector currents and RF levels is made possible with built-in samplers and a VXI data acquisition unit
Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings
DEFF Research Database (Denmark)
Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere
2014-01-01
, either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...
Soury, Hamza
2012-05-01
Recent measurements show that the spectrum is under-utilized by licensed users in wireless communication. Cognitive radio (CR) has been proposed as a suitable solution to manage the inefficient usage of the spectrum and increase coverage area of wireless networks. The concept is based on allowing a group of secondary users (SUs) to share the unused radio spectrum originally owned by the primary user (PUs). The operation of CR should not cause harmful interference to the PUs. In the other hand, relayed transmission increases the coverage and achievable capacity of communication systems and in particular in CR systems. In fact there are many types of cooperative communications, however the two main ones are decode-and-forward (DAF) and amplify-and-forward (AAF). Adaptive relaying scheme is a relaying technique by which the benefits of the amplifying or decode and forward techniques can be achieved by switching the forwarding technique according to the quality of the signal. In this dissertation, we investigate the power allocation for an adaptive relaying protocol (ARP) scheme in cognitive system by maximizing the end-to-end rate and searching the best carriers pairing distribution. The optimization problem is under the interference and power budget constraints. The simulation results confirm the efficiency of the proposed adaptive relaying protocol in comparison to other relaying techniques, and the consequence of the choice of the pairing strategy.
Phase noise in RF and microwave amplifiers.
Boudot, Rodolphe; Rubiola, Enrico
2012-12-01
Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and
A database of PCR primers for the chloroplast genomes of higher plants
Heinze, Berthold
2007-01-01
Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828
A database of PCR primers for the chloroplast genomes of higher plants
Directory of Open Access Journals (Sweden)
Heinze Berthold
2007-02-01
Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.
Enhanced Gain in Photonic Crystal Amplifiers
DEFF Research Database (Denmark)
Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann
2012-01-01
We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....
Xiao, Yongshuang; Ma, Daoyuan; Xu, Shihong; Liu, Qinghua; Wang, Yanfeng; Xiao, Zhizhong; Li, Jun
2016-05-01
Oplegnathus fasciatus (rock bream) is a commercial rocky reef fish species in East Asia that has been considered for aquaculture. We estimated the population genetic diversity and population structure of the species along the coastal waters of China using fluorescent-amplified fragment length polymorphisms technology. Using 53 individuals from three populations and four pairs of selective primers, we amplified 1 264 bands, 98.73% of which were polymorphic. The Zhoushan population showed the highest Nei's genetic diversity and Shannon genetic diversity. The results of analysis of molecular variance (AMOVA) showed that 59.55% of genetic variation existed among populations and 40.45% occurred within populations, which indicated that a significant population genetic structure existed in the species. The pairwise fixation index F st ranged from 0.20 to 0.63 and were significant after sequential Bonferroni correction. The topology of an unweighted pair group method with arithmetic mean tree showed two significant genealogical branches corresponding to the sampling locations of North and South China. The AMOVA and STRUCTURE analyses suggested that the O. fasciatus populations examined should comprise two stocks.
Enan, Mohamed Rizk; Palakkott, Abdul Rasheed; Ksiksi, Taoufik Saleh
2017-01-01
It is commonly difficult to extract and amplify DNA from herbarium samples as they are old and preserved using different compounds. In addition, such samples are subjected to the accumulation of intrinsically produced plant substances over long periods (up to hundreds of years). DNA extraction from desert flora may pause added difficulties as many contain high levels of secondary metabolites. Herbarium samples from the Biology Department (UAE University) plant collection and fresh plant samples, collected from around Al-Ain (UAE), were used in this study. The three barcode loci for the coding genes matK, rbcL and rpoC1-were amplified. Our results showed that T. terresteris , H. robustum , T. pentandrus and Z. qatarense were amplified using all three primers for both fresh and herbaium samples. Both fresh and herbarium samples of C. comosum , however, were not amplified at all, using the three primers. Herbarium samples from A. javanica , C. imbricatum , T. aucherana and Z. simplex were not amplified with any of the three primers. For fresh samples 90, 90 and 80% of the samples were amplified using matK, rbcL and rpoC1, respectively. In short, fresh samples were significantly better amplified than those from herbarium sources, using the three primers. Both fresh and herbarium samples from one species ( C. comosum ), however, were not successfully amplified. It is also concluded that the rbcL regions showed real potentials to distinguish the UAE species under investigation into the appropriate family and genus.
Directory of Open Access Journals (Sweden)
Puntipar Sonthiphand
Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library
A system for biasing a differential amplifier
International Nuclear Information System (INIS)
Barbier, Daniel; Ittel, J.M.; Poujois, Robert
1975-01-01
This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr
The ability of T2/B4 primers to detect Leishmania infantum among ...
African Journals Online (AJOL)
SERVER
2008-04-03
Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...
Solid-state disk amplifiers for fusion-laser systems
Energy Technology Data Exchange (ETDEWEB)
Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.
1981-09-01
We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.
International Nuclear Information System (INIS)
Naqvi, S.M.S.; Mahmood, T.
2005-01-01
Plants respond to a number of environmental stimuli by modulating expression of genes. One such family of genes is now known as germin/germin-like protein genes (Glps). In order to detect any Glp gene response in rice, a pair of degenerate primers was designed based on consensus region from Glp sequences in Genbank. Using these primers a DNA fragment of about 550 bp was obtained by PCR amplification from genomic template. This 550 bp DNA was used as probe in Northern analysis. These studies provided evidence pointing to differential response of Glp expression to salt stress. RNA obtained from the roots was used for synthesis of cDNA. This cDNA was amplifiable with sense primer (RGLP1) from above mentioned pair and oligo-(dt) yielding a fragment of approx. 800 bp. Restriction analysis revealed that the PCR product was heterogeneous. After establishing that 800 bp fragment was the desired product, it was cloned in pCRII-TOPO. Five clones were picked up and analyzed by restriction analysis and sequencing. Two different Glp cDNAs were represented by these partial clones. Remaining sequence of the 5' end for clone 4 and 16 was obtained by Rapid Amplification of cDNA ends (RACE). The resultant sequences have been submitted to Genbank as Oryza sativa Rice Germin-like Protein 1 and 2 (osRGLP1 and 2). When full length genes corresponding to these sequences were amplified from genomic templates, resulting fragments were nearly 150 by larger than cDNAs. Cloning of structural genes for osRGLP1 revealed presence of a 162 bp intron in the coding region near 3' end. Preliminary evidence shows that expression of both osRGLP1 and 2 is severely reduced during salt stress. Another approach to establish both osRGLP1 and 2 genes involvement in stress tolerance is to study the ability of their promotor regions to drive expression of some reporter gene during stress. Promotor regions of about 1100 bp has been amplified and cloned and has been confirmed by restriction analysis and nested
Multi-pass amplifier architecture for high power laser systems
Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C
2014-04-01
A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.
Using inter simple sequence repeat (ISSR) markers to study genetic ...
African Journals Online (AJOL)
This study shows that ISSR-PCR analysis is quick, reliable and produces sufficient polymorphisms for large-scale DNA fingerprinting purposes. The total of 111 bands of which 60 were polymorphic, (with 54.04%) was amplified by the six primers, an average of seven bands per primer. The total number of amplified ...
Figure 1. T. tor species. Figure 2. Long PCR products of ...
Indian Academy of Sciences (India)
Annam
Figure 2. Long PCR products of mitochondrial DNA from the fish T. tor. Lane 1, amplified product using L-12321-Leu and S-LA-16S-H primers. Lane 2, amplified product using H-12321 –Leu and S-LA-16S-L primers. Lane M, 1-Kb DNA ladder. 8 kb ...
Design of an 1800nm Raman amplifier
DEFF Research Database (Denmark)
Svane, Ask Sebastian; Rottwitt, Karsten
2013-01-01
We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...
Thao, Nguyen Thi Thanh; Ngoc, Nguyen Thi Kim; Tú, Phan Văn; Thúy, Trần Thi; Cardosa, Mary Jane; McMinn, Peter Charles; Phuektes, Patchara
2010-01-01
Human enterovirus 71 (HEV71) and coxsackievirus A16 (CVA16) are two major aetiological agents of hand, foot and mouth disease (HFMD) in children. Recently there have been several large outbreaks of HFMD in Vietnam and the Asia-Pacific region. In this study, a multiplex RT-PCR assay was developed in order to detect simultaneously HEV71, CVA16 and other human enteroviruses. Enterovirus detection was performed with a mixture of three pairs of oligonucleotide primers: one pair of published primers for amplifying all known enterovirus genomes and two new primer pairs specific for detection of the VP1 genes of HEV71 and CVA16. Enterovirus isolates, CVA16 and HEV71 strains identified previously from patients with HFMD were examined to evaluate the sensitivity and specificity of the multiplex RT-PCR assay. The assay was then applied to the direct detection of these viruses in clinical specimens obtained from HFMD cases identified at Children's Hospital Number 2, Ho Chi Minh City, Vietnam. The multiplex RT-PCR assay showed 100% specificity in screening for enteroviruses and in identifying HEV71 and CVA16. Similar results were obtained when using the multiplex RT-PCR assay to screen for enteroviruses and to identify HEV71 and CVA16 in clinical specimens obtained from HFMD cases identified at the hospital. This multiplex RT-PCR assay is a rapid, sensitive and specific assay for the diagnosis of HEV71 or CVA16 infection in cases of HFMD and is also potentially useful for molecular epidemiological investigations. PMID:20863857
Remote Acquisition Amplifier For 50-Ohm Cable
Amador, Jose J.
1995-01-01
Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.
Directory of Open Access Journals (Sweden)
Ni Luh Putu Indi Dharmayanti
2016-07-01
Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.
Design of a Percussion and Electric Primer Gun Firing Power Supply
2014-07-01
solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply
ANALYSIS OF STABILITY OF TRINUCLEOTIDE TTC MOTIFS IN COMMON FLAX PLANTED IN THE CHERNOBYL AREA
Directory of Open Access Journals (Sweden)
Veronika Lancíková
2015-02-01
Full Text Available Flax (Linum usitatissimum L. is one of the oldest domesticated plants — it was cultivated as early as in ancient Egypt and Samaria 10,000 years ago to serve as a source of fiber and oil, whence it later spread around the world. Compared with other plants, the flax genome consists of a high number of repetitive sequences, middle repetitive sequences and small repetitive sequences of nucleotides. The aim of the study was to analyze the stability of the existing trinucleotides motifs of microsatellite DNA of the flax genome (genotype Kyivskyi, growing in the Chernobyl conditions. The Chernobyl area is the most extensive “natural” laboratory suitable for the study of radiation effects. Over the last 20 years, the researches collected important knowledge about the effects of low and high radiation doses on the DNA isolated from the plant material growing on the remediated fields near Chernobyl and the plant material from fields contaminated by radioactive cesium 137Cs and strontium 90Sr. Using eight pairs of microsatellite primers, we successfully amplified the samples from the remediated fields. For each primer in the control samples and remediated samples, we detected 1 to 3 fragments per locus, each in size up to 120 to 250 base pairs. The applied microsatellite primers confirmed the monomorphic condition of microsatellite loci.
Aifat, N. R.; Yaakop, S.; Md-Zain, B. M.
2016-11-01
The IUCN Red List of Threatened Species has categorized Malaysian primates from being data deficient to critically endanger. Thus, ancient DNA analyses hold great potential to understand phylogeny, phylogeography and population history of extinct and extant species. Museum samples are one of the alternatives to provide important sources of biological materials for a large proportion of ancient DNA studies. In this study, a total of six museum skin samples from species Presbytis hosei (4 samples) and Presbytis frontata (2 samples), aged between 43 and 124 years old were extracted to obtain the DNA. Extraction was done by using QIAGEN QIAamp DNA Investigator Kit and the ability of this kit to extract museum skin samples was tested by amplification of partial Cyt b sequence using species-specific designed primer. Two primer pairs were designed specifically for P. hosei and P. frontata, respectively. These primer pairs proved to be efficient in amplifying 200bp of the targeted species in the optimized PCR conditions. The performance of the sequences were tested to determine genetic distance of genus Presbytis in Malaysia. From the analyses, P. hosei is closely related to P. chrysomelas and P. frontata with the value of 0.095 and 0.106, respectively. Cyt b gave a clear data in determining relationships among Bornean species. Thus, with the optimized condition, museum specimens can be used for molecular systematic studies of the Malaysian primates.
Directory of Open Access Journals (Sweden)
Weiguo Hou
2018-05-01
Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
Multiple excitation regenerative amplifier inertial confinement system
International Nuclear Information System (INIS)
George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.
1980-01-01
The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation
Kulkarni, Tejaswini; Aikawa, Chihiro; Nozawa, Takashi; Murase, Kazunori; Maruyama, Fumito; Nakagawa, Ichiro
2016-10-11
Group A Streptococcus (GAS; Streptococcus pyogenes) causes a range of mild to severe infections in humans. It can also colonize healthy persons asymptomatically. Therefore, it is important to study GAS carriage in healthy populations, as carriage of it might lead to subsequent disease manifestation, clonal spread in the community, and/or diversification of the organism. Throat swab culture is the gold standard method for GAS detection. Advanced culture-independent methods provide rapid and efficient detection of microorganisms directly from clinical samples. We investigated the presence of GAS in throat swab samples from healthy adults in Japan using culture-dependent and culture-independent methods. Two throat swab samples were collected from 148 healthy volunteers. One was cultured on selective medium, while total DNA extracted from the other was polymerase chain reaction (PCR) amplified with two GAS-specific primer pairs: one was a newly designed 16S rRNA-specific primer pair, the other a previously described V-Na + -ATPase primer pair. Although only 5 (3.4 %) of the 148 samples were GAS-positive by the culture-dependent method, 146 (98.6 %) were positive for the presence of GAS DNA by the culture-independent method. To obtain serotype information by emm typing, we performed nested PCR using newly designed emm primers. We detected the four different emm types in 25 (16.9 %) samples, and these differed from the common emm types associated with GAS associated diseases in Japan. The different emm types detected in the healthy volunteers indicate that the presence of unique emm types might be associated with GAS carriage. Our results suggest that culture-independent methods should be considered for profiling GAS in the healthy hosts, with a view to obtaining better understanding of these organisms. The GAS-specific primers (16S rRNA and V-Na + -ATPase) used in this study can be used to estimate the maximum potential GAS carriage in people.
DEFF Research Database (Denmark)
Borri, P.; Langbein, W.; Hvam, Jørn Märcher
2001-01-01
The ultrafast gain dynamics in an electrically pumped InAs/InGaAs/GaAs quantum-dot amplifier are measured at room temperature with femtosecond resolution, and compared with results on an InGaAsP bulk amplifier. The role of spectral hole burning and carrier heating in the recovery of the gain...
Comparison of shear bond strength of orthodontic brackets using various zirconia primers.
Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju
2015-07-01
The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.
Bioinformatic tools for PCR Primer design
African Journals Online (AJOL)
ES
Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.
Canonico, Laura; Comitini, Francesca; Ciani, Maurizio
2015-05-04
Torulaspora delbrueckii yeast strains are being increasingly applied at the industrial level, such as in the winemaking process, and so their identification and characterisation require effective, fast, accurate, reproducible and reliable approaches. Therefore, the development of typing techniques that allow discrimination at the strain level will provide an essential tool for those working with T. delbrueckii strains. Here, 28 T. delbrueckii strains from various substrates were characterised using different PCR-fingerprinting molecular methods: random amplified polymorphic DNA with polymerase chain reaction (RAPD-PCR), minisatellites SED1, AGA1, DAN4 and the newly designed T. delbrueckii (Td)PIR, and microsatellites (GAC)5 and (GTG)5. The aim was to determine and compare the efficacies, reproducibilities and discriminating powers of these molecular methods. RAPD-PCR using the M13 primers and the newly designed TdPIR3 minisatellite primer pair provided discrimination of the greatest number of T. delbrueckii strains. TdPIR3 clustered the 28 strains into 16 different groups with an efficiency of 100%, while M13 clustered the strains into 17 different groups, although with a lower efficiency of 89%. Moreover, the TdPIR3 primers showed reproducible profiles when the stringency of the PCR protocol was varied, which highlighted the great robustness of this technique. In contrast, variation of the stringency of the M13 PCR protocol resulted in modification of the amplified profiles, which suggested low reproducibility of this technique. Copyright © 2015 Elsevier B.V. All rights reserved.
Detecting beef meatball contamination with polymerase chain reaction
Directory of Open Access Journals (Sweden)
Hoda A.
2017-10-01
Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
The OPTHER Project: Progress toward the THz Amplifier
DEFF Research Database (Denmark)
Paoloni, C; Brunetti, F; Di Carlo, A
2011-01-01
This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....
Differential InP HEMT MMIC Amplifiers Embedded in Waveguides
Kangaslahti, Pekka; Schlecht, Erich; Samoska, Lorene
2009-01-01
Monolithic microwave integrated-circuit (MMIC) amplifiers of a type now being developed for operation at frequencies of hundreds of gigahertz contain InP high-electron-mobility transistors (HEMTs) in a differential configuration. The differential configuration makes it possible to obtain gains greater than those of amplifiers having the single-ended configuration. To reduce losses associated with packaging, the MMIC chips are designed integrally with, and embedded in, waveguide packages, with the additional benefit that the packages are compact enough to fit into phased transmitting and/or receiving antenna arrays. Differential configurations (which are inherently balanced) have been used to extend the upper limits of operating frequencies of complementary metal oxide/semiconductor (CMOS) amplifiers to the microwave range but, until now, have not been applied in millimeter- wave amplifier circuits. Baluns have traditionally been used to transform from single-ended to balanced configurations, but baluns tend to be lossy. Instead of baluns, finlines are used to effect this transformation in the present line of development. Finlines have been used extensively to drive millimeter- wave mixers in balanced configurations. In the present extension of the finline balancing concept, finline transitions are integrated onto the affected MMICs (see figure). The differential configuration creates a virtual ground within each pair of InP HEMT gate fingers, eliminating the need for inductive vias to ground. Elimination of these vias greatly reduces parasitic components of current and the associated losses within an amplifier, thereby enabling more nearly complete utilization of the full performance of each transistor. The differential configuration offers the additional benefit of multiplying (relative to the single-ended configuration) the input and output impedances of each transistor by a factor of four, so that it is possible to use large transistors that would otherwise have
Spectroscopic amplifier for pin diode
International Nuclear Information System (INIS)
Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.
2014-10-01
The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Yetter, Carol J.
2009-01-01
This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…
DNA Extraction and Primer Selection
DEFF Research Database (Denmark)
Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads
Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...
International Nuclear Information System (INIS)
Moriyasu, K.
1981-01-01
A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)
Francisco, Flávio de O; Brito, Rute M; Arias, Maria C
2006-01-01
In the present study we compare genetic characteristics (allele diversity and observed heterozygosity) of microsatellite loci, from three stingless bee species (Plebeia remota Holmberg, Partamona mulata Moure In Camargo and Partamona helleri Friese), amplified by using heterospecific primers originally designed for Melipona bicolor Lepeletier and Scaptotrigona postica Latreille. We analyzed 360 individuals of P. remota from 72 nests, 58 individuals of R. mulata from 58 nests, and 47 individuals of P. helleri from 47 nests. The three species studied showed low level of polymorphism for the loci amplified with primers derived from M. bicolor. However, for the loci amplified with primers derived from S. postica, only P. remota presented low level of polymorphism.
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
Tools for Ultraspecific Probe/Primer Design
National Research Council Canada - National Science Library
Fofanov, Yurly
2006-01-01
.... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...
Diversity of internal structures in inhibited epoxy primers
Directory of Open Access Journals (Sweden)
Anthony E. Hughes
2015-10-01
Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.
Automatic error compensation in dc amplifiers
International Nuclear Information System (INIS)
Longden, L.L.
1976-01-01
When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks
Preparation and Characterization of Acrylic Primer for Concrete Substrate Application
Directory of Open Access Journals (Sweden)
El-Sayed Negim
2016-01-01
Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.
Quantum electronics maser amplifiers and oscillators
Fain, V M; Sanders, J H
2013-01-01
Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma
Class-E Amplifier Design Improvements for GSM Frequencies
Directory of Open Access Journals (Sweden)
Z. Nadir
2011-06-01
Full Text Available Efficient power amplifiers are essential in portable battery-operated systems such as mobile phones. Also, the power amplifier (PA is the most power-consuming building block in the transmitter of a portable system. This paper investigates how the efficiency of the power amplifier (which is beneficial for multiple applications in communcation sector can be improved by increasing the efficiency of switching mode class E power amplifiers for frequencies of 900 MHz and 1800 MHz. The paper tackles modeling, design improvements and verification through simulation for higher efficiencies. This is the continuation of previous work by the authors. These nonlinear power amplifiers can only amplify constant-envelope RF signals without introducing significant distortion. Mobile systems such as Advanced Mobile Phone System (AMPS and Global System for Mobile communications (GSM use modulation schemes which generate constant amplitude RF outputs in order to use efficient but nonlinear power amplifiers. Improvements in designs are suggested and higher efficiencies are achieved, to the tune of 67.1% (for 900 MHz and 67.0% (1800 MHz.
Bond strength of compomers to dentin using acidic primers.
Tate, W H; You, C; Powers, J M
1999-10-01
To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.
Amplified OTDR Systems for Multipoint Corrosion Monitoring
Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.
2012-01-01
We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017
Bandwidth tunable amplifier for recording biopotential signals.
Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer
2010-01-01
This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.
Identification of RAPD markers linked to pubescent trait in cassava ...
African Journals Online (AJOL)
Segments of the extracted DNAs were amplified under standard amplification conditions using Operon primer series A, B, and C making a total of 60 primers. Most primers produced monomorphic fragments. However, two primers, OPA 13 and. OPC 19 produced 798bp and 752 bp polymorphic fragments respectively.
Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael
2014-01-01
Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...
Shen, X L; Zhang, Y M; Xue, J Y; Li, M M; Lin, Y B; Sun, X Q; Hang, Y Y
2016-04-25
Non-heading Chinese cabbage [Brassica rapa var. chinensis (Linnaeus) Kitamura] is a popular vegetable and is also used as a medicinal plant in traditional Chinese medicine. Fragrant Bok Choy is a unique accession of non-heading Chinese cabbage and a product of geographic indication certified by the Ministry of Agriculture of China, which is noted for its rich aromatic flavor. However, transitional and overlapping morphological traits can make it difficult to distinguish this accession from other non-heading Chinese cabbages. This study aimed to develop a molecular method for efficient identification of Fragrant Bok Choy. Genetic diversity analysis, based on inter-simple sequence repeat molecular markers, was conducted for 11 non-heading Chinese cabbage accessions grown in the Yangtze River Delta region. Genetic similarity coefficients between the 11 accessions ranged from 0.5455 to 0.8961, and the genetic distance ranged from 0.0755 to 0.4475. Cluster analysis divided the 11 accessions into two major groups. The primer ISSR-840 amplified a fragment specific for Fragrant Bok Choy. A pair of specific sequence-characterized amplified region (SCAR) primers based on this fragment amplified a target band in Fragrant Bok Choy individuals, but no band was detected in individuals of other accessions. In conclusion, this study has developed an efficient strategy for authentication of Fragrant Bok Choy. The SCAR marker described here will facilitate the conservation and utilization of this unique non-heading Chinese cabbage germplasm resource.
DEFF Research Database (Denmark)
Citakovic, J; Nielsen, I. Riis; Nielsen, Jannik Hammel
2005-01-01
A two-stage amplifier, operational at 0.8V and drawing 7μA, has been integrated in a standard digital 0.18μm CMOS process. Rail-to-rail operations at the input are enabled by complementary transistor pairs with gm control. The efficient rail-to-rail output stage is biased in class AB. The measured...
Directory of Open Access Journals (Sweden)
Emma Suryati
2013-03-01
Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Directory of Open Access Journals (Sweden)
Gao Zhihong
2010-07-01
Full Text Available Abstract Background Expressed Sequence Tag (EST has been a cost-effective tool in molecular biology and represents an abundant valuable resource for genome annotation, gene expression, and comparative genomics in plants. Results In this study, we constructed a cDNA library of Prunus mume flower and fruit, sequenced 10,123 clones of the library, and obtained 8,656 expressed sequence tag (EST sequences with high quality. The ESTs were assembled into 4,473 unigenes composed of 1,492 contigs and 2,981 singletons and that have been deposited in NCBI (accession IDs: GW868575 - GW873047, among which 1,294 unique ESTs were with known or putative functions. Furthermore, we found 1,233 putative simple sequence repeats (SSRs in the P. mume unigene dataset. We randomly tested 42 pairs of PCR primers flanking potential SSRs, and 14 pairs were identified as true-to-type SSR loci and could amplify polymorphic bands from 20 individual plants of P. mume. We further used the 14 EST-SSR primer pairs to test the transferability on peach and plum. The result showed that nearly 89% of the primer pairs produced target PCR bands in the two species. A high level of marker polymorphism was observed in the plum species (65% and low in the peach (46%, and the clustering analysis of the three species indicated that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the Prunus species. Conclusions We have constructed the first cDNA library of P. mume flower and fruit, and our data provide sets of molecular biology resources for P. mume and other Prunus species. These resources will be useful for further study such as genome annotation, new gene discovery, gene functional analysis, molecular breeding, evolution and comparative genomics between Prunus species.
RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).
Zhao, Ya-E; Wu, Li-Ping
2012-06-01
For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.
BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER
DEFF Research Database (Denmark)
2010-01-01
Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...
A modular positive feedback-based gene amplifier
Directory of Open Access Journals (Sweden)
Bhalerao Kaustubh D
2010-02-01
Full Text Available Abstract Background Positive feedback is a common mechanism used in the regulation of many gene circuits as it can amplify the response to inducers and also generate binary outputs and hysteresis. In the context of electrical circuit design, positive feedback is often considered in the design of amplifiers. Similar approaches, therefore, may be used for the design of amplifiers in synthetic gene circuits with applications, for example, in cell-based sensors. Results We developed a modular positive feedback circuit that can function as a genetic signal amplifier, heightening the sensitivity to inducer signals as well as increasing maximum expression levels without the need for an external cofactor. The design utilizes a constitutively active, autoinducer-independent variant of the quorum-sensing regulator LuxR. We experimentally tested the ability of the positive feedback module to separately amplify the output of a one-component tetracycline sensor and a two-component aspartate sensor. In each case, the positive feedback module amplified the response to the respective inducers, both with regards to the dynamic range and sensitivity. Conclusions The advantage of our design is that the actual feedback mechanism depends only on a single gene and does not require any other modulation. Furthermore, this circuit can amplify any transcriptional signal, not just one encoded within the circuit or tuned by an external inducer. As our design is modular, it can potentially be used as a component in the design of more complex synthetic gene circuits.
40 CFR 63.745 - Standards: Primer and topcoat application operations.
2010-07-01
... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...
Realization of OFCC based Transimpedance Mode Instrumentation Amplifier
Directory of Open Access Journals (Sweden)
Neeta Pandey
2016-01-01
Full Text Available The paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three Operational Floating Current Conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematicThe paper presents an instrumentation amplifier suitable for amplifying the current source transducer signals. It provides a voltage output. It has a high gain, common mode rejection ratio and gain independent bandwidth. It uses three operational floating current conveyors (OFCCs and four resistors. The effect of nonidealities of OFCC on performance of proposed transimpedance instrumentation amplifier (TIA is also analyzed. The proposal has been verified through SPICE simulations using CMOS based schematic.
Quantum-Limited Directional Amplifiers with Optomechanics
Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas
2018-01-01
Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.
Kim, S A; Park, S H; Lee, S I; Ricke, S C
2017-12-01
The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in
Development and characterization of EST-SSR markers for Artocarpus hypargyreus (Moraceae).
Liu, Haijun; Tan, Weizheng; Sun, Hongbin; Liu, Yu; Meng, Kaikai; Liao, Wenbo
2016-12-01
Polymorphic microsatellite markers were developed for Artocarpus hypargyreus (Moraceae), a threatened species endemic to China, to investigate the genetic diversity and structure of the species. Based on the transcriptome data of A. hypargyreus , 63 primer pairs were preliminarily designed and tested, of which 34 were successfully amplified and 10 displayed clear polymorphisms across the 67 individuals from four populations of A. hypargyreus . The results showed the number of alleles per locus ranged from three to 10, and the observed heterozygosity and expected heterozygosity per locus varied from 0.000 to 0.706 and from 0.328 to 0.807, respectively. These microsatellite markers will be useful in exploring genetic diversity and structure of A. hypargyreus . Furthermore, most loci were successfully cross-amplified in A. nitidus and A. heterophyllus , indicating that they will be of great value for genetic study across this genus.
Occurrence and Distribution of Citrus tristeza virus (CTV in the Jordan Valley
Directory of Open Access Journals (Sweden)
G. Anfoka
2005-04-01
Full Text Available In a survey conducted in 2002 and 2003, Citrus tristeza virus (CTV was detected in the Jordan Valley. The direct tissue blot immunoassay (DTBIA indicated that 12.7 and 15.2% of samples tested in the central and northern Jordan Valley respectively were infected with CTV. Similar results showed that all citrus species grown in the Jordan Valley were susceptible to CTV. DAS-ELISA analysis of samples from a citrus orchard in the Dir Alla area with severe CTV symptoms indicated that 49% of samples were infected with CTV. Using a CTV specific primer pair (CTV1/CTV10, the coat protein gene of the virus was successfully amplified from leaf extracts obtained from CTVinfected trees by IC-RT-PCR. After cloning and sequencing the coat protein gene, the sequence of the amplified product was deposited in the GenBank.
High efficiency fourth-harmonic generation from nanosecond fiber master oscillator power amplifier
Mu, Xiaodong; Steinvurzel, Paul; Rose, Todd S.; Lotshaw, William T.; Beck, Steven M.; Clemmons, James H.
2016-03-01
We demonstrate high power, deep ultraviolet (DUV) conversion to 266 nm through frequency quadrupling of a nanosecond pulse width 1064 nm fiber master oscillator power amplifier (MOPA). The MOPA system uses an Yb-doped double-clad polarization-maintaining large mode area tapered fiber as the final gain stage to generate 0.5-mJ, 10 W, 1.7- ns single mode pulses at a repetition rate of 20 kHz with measured spectral bandwidth of 10.6 GHz (40 pm), and beam qualities of Mx 2=1.07 and My 2=1.03, respectively. Using LBO and BBO crystals for the second-harmonic generation (SHG) and fourth-harmonic generation (FHG), we have achieved 375 μJ (7.5 W) and 92.5 μJ (1.85 W) at wavelengths of 532 nm and 266 nm, respectively. To the best of our knowledge these are the highest narrowband infrared, green and UV pulse energies obtained to date from a fully spliced fiber amplifier. We also demonstrate high efficiency SHG and FHG with walk-off compensated (WOC) crystal pairs and tightly focused pump beam. An SHG efficiency of 75%, FHG efficiency of 47%, and an overall efficiency of 35% from 1064 nm to 266 nm are obtained.
Assessment of genetic diversity in Chinese eared pheasant using fluorescent-AFLP markers
DEFF Research Database (Denmark)
Li, Xiujuan; Zhu, Yaohong; Liu, Panqi
2010-01-01
on the list of the world’s threatened species. In this paper, 74 individuals from the four eared pheasant species were assessed for population genetic diversity by means of fluorescent-AFLP markers. A total of 429 AFLP peaks were amplified by 11 pairs of fluorescent EcoRI/TaqI primer combinations. Out of all...... using Jaccard’s similarity coefficients (SC) and the corresponding dendrogram. It was found that there was a moderate genetic distance between the four species (SC = 0.674–0.832). Brown eared pheasant was genetically closely related to blue eared pheasant (SC = 0.832), while white eared pheasant...
Directory of Open Access Journals (Sweden)
Stalis Norma Ethica
2013-12-01
Full Text Available As an initial attempt to reveal genetic information of Azospirillum sp. JG3 strain, which is still absence despite of the strains' ability in producing valued enzymes, two groups of conventional methods: lysis-enzyme and column-kit; and two rapid methods: thermal disruption and intact colony were evaluated. The aim is to determine the most practical method for obtaining high-grade PCR product using degenerate primers as part of routine-basis protocols for studying the molecular genetics of the Azospirillal bacteria. The evaluation includes the assessment of electrophoresis gel visualization, pellet appearance, preparation time, and PCR result of extracted genomic DNA from each method. Our results confirmed that the conventional methods were more superior to the rapid methods in generating genomic DNA isolates visible on electrophoresis gel. However, modification made in the previously developed DNA isolation protocol giving the simplest and most rapid method of all methods used in this study for extracting PCR-amplifiable DNA of Azospirillum sp. JG3. Intact bacterial cells (intact colony loaded on electrophoresis gel could present genomic DNA band, but could not be completely amplified by PCR without thermal treatment. It can also be inferred from our result that the 3 to 5-min heating in dH2O step is critical for the pre-treatment of colony PCR of Azospirillal cells.
Integrated wide-band low-background amplifiers
International Nuclear Information System (INIS)
Il'yushchenko, I.I.
1980-01-01
Ways of increasing stability and reproduction of characteristics of wide-band integral amplifiers that would to the least extent increase their background noises, are discussed. Considered are some certain flowsheets of integral wide-band amplifiers with low background noise of foreign production which differ from one another by construction of inlet cascades as well as by the applied feedback type. The principal flowsheets of the amplifiers and their main performances are presented. The analysis of the data obtained has revealed that microcircuits made of cascades with a common emitter and local combined feedback are most wide-band among all the considered microcircuits [ru
Helicobacter pylori cagA and vacA genotypes in Cuban and Venezuelan populations
Directory of Open Access Journals (Sweden)
Diana Ortiz-Princz
2010-05-01
Full Text Available The aim of this study was to determine the presence of Helicobacter pylori cytotoxin-associated gene (cagA/vacuolating cytotoxin gene (vacA among patients with chronic gastritis in Cuba and Venezuela. Gastric antrum biopsies were taken for culture, DNA extraction and PCR analysis. Amplification of vacA and cagA segments was performed using two regions of cagA: 349 bp were amplified with the F1/B1 primers and the remaining 335 bp were amplified with the B7629/B7628 primers. The VA1-F/VA1-R set of primers was used to amplify the 259-bp (s1 or 286-bp (s2 product and the VAG-R/VAG-F set of primers was used to amplify the 567-bp (m1 or 642-bp (m2 regions of vacA. cagA was detected in 87% of the antral samples from Cuban patients and 80.3% of those from Venezuelan patients. All possible combinations of vacA regions were found, with the exception of s2/m1. The predominant combination found in both countries was s1/m1. The percentage of cagA+ strains was increased by the use of a second set of primers and a greater number of strains was amplified with the B7629/B7628 primers in the Cuban patients (p = 0.0001. There was no significant difference between the presence of the allelic variants of vacA and cagA in both populations. The predominant genotype was cagA+/s1m1 in both countries. The results support the necessary investigation of isolates circulating among the human population in each region.
Advances in high-power rf amplifiers
International Nuclear Information System (INIS)
Tallerico, P.J.
1979-01-01
Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems
Class D audio amplifiers for high voltage capacitive transducers
DEFF Research Database (Denmark)
Nielsen, Dennis
of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.