WorldWideScience

Sample records for primer pairs amplifying

  1. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  2. Pair formation models for sexually transmitted infections : A primer

    NARCIS (Netherlands)

    Kretzschmar, MEE; Heijne, Janneke C M

    For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward

  3. Pair formation models for sexually transmitted infections: A primer

    Directory of Open Access Journals (Sweden)

    Mirjam Kretzschmar

    2017-08-01

    Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number

  4. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  5. The Dynamics of Multiple Pair-Wise Collisions in a Chain for Designing Optimal Shock Amplifiers

    Directory of Open Access Journals (Sweden)

    Bryan Rodgers

    2009-01-01

    Full Text Available The major focus of this work is to examine the dynamics of velocity amplification through pair-wise collisions between multiple masses in a chain, in order to develop useful machines. For instance low-cost machines based on this principle could be used for detailed, very-high acceleration shock-testing of MEMS devices. A theoretical basis for determining the number and mass of intermediate stages in such a velocity amplifier, based on simple rigid body mechanics, is proposed. The influence of mass ratios and the coefficient of restitution on the optimisation of the system is identified and investigated. In particular, two cases are examined: in the first, the velocity of the final mass in the chain (that would have the object under test mounted on it is maximised by defining the ratio of adjacent masses according to a power law relationship; in the second, the energy transfer efficiency of the system is maximised by choosing the mass ratios such that all masses except the final mass come to rest following impact. Comparisons are drawn between both cases and the results are used in proposing design guidelines for optimal shock amplifiers. It is shown that for most practical systems, a shock amplifier with mass ratios based on a power law relationship is optimal and can easily yield velocity amplifications of a factor 5–8 times. A prototype shock testing machine that was made using above principles is briefly introduced.

  6. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  7. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  8. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  9. Closely spaced mirror pair for reshaping and homogenizing pump beams in laser amplifiers

    International Nuclear Information System (INIS)

    Bass, I.L.

    1992-12-01

    Channeling a laser beam by multiple reflections between two closely-spaced, parallel or nearly parallel mirrors, serves to reshape and homogenize the beam at the output gap between the mirrors. Application of this device to improve the spatial overlap of a copper laser pump beam with the signal beam in a dye laser amplifier is described. This technique has been applied to the AVLIS program at the Lawrence Livermore National Laboratory

  10. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  11. An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Directory of Open Access Journals (Sweden)

    Miyazawa Takayuki

    2010-12-01

    Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.

  12. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  13. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  14. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  15. A comprehensive study on gain stabilization of Er-doped fiber amplifier in C-band with uniform fiber Bragg grating-pair

    Science.gov (United States)

    Yang, Jiuru; Ma, Yu; OuYang, Yunlun; Liu, Chunyu; Zhang, Jiaxiao

    2014-07-01

    Fiber grating-pair is one of the efficient methods for gain stabilization of erbium doped fiber amplifier (EDFA) but with a gain-reduction of signals, especially in C-band. In order to overcome it, in this article, we establish a configuration of EDFA based uniform fiber grating-pair and conduct a comprehensive study on gain stabilization by varying the reflectivity, center wavelength and 3dB bandwidth of grating, and by varying the channel number and pump power. The numerical results show that under the optimal parameters of grating the gain stabilization at 1550nm is +/-0.044dB with high gain and large dynamic range.

  16. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  18. A newly constructed primer pair for the PCR amplification, cloning and sequencing of the flagellin (flaA) gene from isolatesof urease-negative Campylobacter lari.

    Science.gov (United States)

    Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo

    2005-08-01

    A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.

  19. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  20. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  1. Single, but not multiple pairings of sucrose and corticosterone enhance memory for sucrose drinking and amplify remote reward relativity effects

    NARCIS (Netherlands)

    Pecoraro, Norman; Gomez, Francisca; La Fleur, Susanne; Roy, Monica; Dallman, Mary F.

    2005-01-01

    This study tested whether pre-training pairings of ingestion of a 32% sucrose solution and injection(s) of corticosterone (B) would enhance later ingestion in the absence of B, and whether these effects would carry over into later contrast-like effects when animals were subsequently shifted to 4%

  2. Design and implementation of sigma delta modulators (ΣΔm) for class D audio amplifiers using differential pairs

    CERN Document Server

    Pereira, Nuno

    2015-01-01

    This book focuses on the design of a 3rd Order CT-ΣΔM where the integrator stages of the filter are implemented with Bipolar-Junction Transistors (BJT) differential pairs. These circuits are fully analyzed and the design method is carefully explained. The design method is validated through experimental measurements of several prototype circuits.

  3. Acute effects of nicotine amplify accumbal neural responses during nicotine-taking behavior and nicotine-paired environmental cues.

    Directory of Open Access Journals (Sweden)

    Karine Guillem

    Full Text Available Nicotine self-administration (SA is maintained by several variables, including the reinforcing properties of nicotine-paired cues and the nicotine-induced amplification of those cue properties. The nucleus accumbens (NAc is implicated in mediating the influence of these variables, though the underlying neurophysiological mechanisms are not yet understood. In the present study, Long-Evans rats were trained to self-administer nicotine. During SA sessions each press of a lever was followed by an intravenous infusion of nicotine (30 µg/kg paired with a combined light-tone cue. Extracellular recordings of single-neuron activity showed that 20% of neurons exhibited a phasic change in firing during the nicotine-directed operant, the light-tone cue, or both. The phasic change in firing for 98% of neurons was an increase. Sixty-two percent of NAc neurons additionally or alternatively showed a sustained decrease in average firing during the SA session relative to a presession baseline period. These session decreases in firing were significantly less prevalent in a group of neurons that were activated during either the operant or the cue than in a group of neurons that were nonresponsive during those events (referred to as task-activated and task-nonactivated neurons, respectively. Moreover, the session decrease in firing was dose-dependent for only the task-nonactivated neurons. The data of the present investigation provide supportive correlational evidence for two hypotheses: (1 excitatory neurophysiological mechanisms mediate the NAc role in cue-maintenance of nicotine SA, and (2 a differential nicotine-induced inhibition of task-activated and task-nonactivated neurons mediates the NAc role in nicotine-induced amplification of cue effects on nicotine SA.

  4. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  5. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  6. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  7. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  8. Fiber Amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten

    2017-01-01

    The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....

  9. Assessing the germplasm of Laminaria (phaeophyceae) with random amplified polymorphic DNA (RAPD) method

    Science.gov (United States)

    He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin

    2003-06-01

    Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.

  10. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  11. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  12. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  13. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  14. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  15. Application of randomly amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Jane

    2011-10-10

    Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...

  16. Genetic analysis of 430 Chinese Cynodon dactylon accessions using sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang

    2014-10-21

    Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.

  17. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  18. Operation amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2008-01-01

    To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a differential amplifier circuit 1;

  19. Inter simple sequence repeats (ISSR) and random amplified ...

    African Journals Online (AJOL)

    21 of 30 random amplified polymorphic DNA (RAPD) primers produced 220 reproducible bands with average of 10.47 bands per primer and 80.12% of polymorphism. OPR02 primer showed the highest number of effective allele (Ne), Shannon index (I) and genetic diversity (H). Some of the cultivars had specific bands, ...

  20. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  1. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  2. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  3. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  4. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  5. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  6. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.

    2018-01-01

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  7. An improved primer set and amplification protocol with increased specificity and sensitivity targeting the Symbiodinium ITS2 region

    KAUST Repository

    Hume, Benjamin C.C.

    2018-05-23

    The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.

  8. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  9. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  10. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, Saito; Nauta, Bram

    2011-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. SOLUTION: The operation amplifier comprises: a

  11. Operation Amplifier

    NARCIS (Netherlands)

    Tetsuya, S.; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an operation amplifier which improves power source voltage removal ratios while assuring phase compensation characteristics, and therefore can be realized with a small-scale circuit and low power consumption. ; SOLUTION: The operation amplifier comprises: a

  12. Operational amplifiers

    CERN Document Server

    Dostal, Jiri

    1993-01-01

    This book provides the reader with the practical knowledge necessary to select and use operational amplifier devices. It presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits.Provides the reader with practical knowledge necessary to select and use operational amplifier devices. Presents an extensive treatment of applications and a practically oriented, unified theory of operational circuits

  13. Amplifier Distortion

    Science.gov (United States)

    Keeports, David

    2006-12-01

    By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.

  14. De-MetaST-BLAST: a tool for the validation of degenerate primer sets and data mining of publicly available metagenomes.

    Directory of Open Access Journals (Sweden)

    Christopher A Gulvik

    Full Text Available Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies. Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI's BLAST (De-MetaST-BLAST, the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications.

  15. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  16. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  17. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  18. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  19. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  20. Amplified Policymaking

    Science.gov (United States)

    Prince, Katherine; Woempner, Carolyn

    2010-01-01

    This brief examines the policy implications of two drivers of change presented in the "2020 Forecast: Creating the Future of Learning"-- Pattern Recognition and Amplified Organization. These drivers point toward a series of cultural shifts and illuminate how we are developing new ways of organizing, constructing, and managing knowledge.…

  1. Detection of somaclonal variation by random amplified polymorphic ...

    African Journals Online (AJOL)

    Detection of somaclonal variation by random amplified polymorphic DNA analysis during micropropagation of Phalaenopsis bellina (Rchb.f.) Christenson. ... Among the primers used, P 16 produced the highest number of bands (29), while primer OPU 10 produced the lowest number (15). The range of similarity coefficient ...

  2. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  3. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  4. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  5. Genotyping via Sequence Related Amplified Polymorphism Markers in Fusarium culmorum

    Directory of Open Access Journals (Sweden)

    Işıl Melis Zümrüt

    2018-02-01

    Full Text Available Fusarium culmorum is predominating causal agent of head blight (HB and root rot (RR in cereals worldwide. Since F. culmorum has a great level of genetic diversity and the parasexual stage is assumed for this phytopathogen, characterization of isolates from different regions is significant step in food safety and controlling the HB. In this study, it was aimed to characterize totally 37 F. culmorum isolates from Turkey via sequence related amplified polymorphism (SRAP marker based genotyping. MAT-1/MAT-2 type assay was also used in order to reveal intraspecific variation in F. culmorum. MAT-1 and MAT-2 specific primer pairs for mating assays resulted in 210 and 260 bp bands, respectively. 11 of isolates were belonged to MAT-1 type whereas 19 samples were of MAT-2. Remaining 7 samples yielded both amplicons. Totally 9 SRAP primer sets yielded amplicons from all isolates. Genetic similarity values were ranged from 39 to 94.7%. Total band number was 127 and PCR product sizes were in the range of 0.1-2.5 kb. Amplicon numbers for individuals were ranged from 1 to 16. According to data obtained from current study, SRAP based genotyping is powerful tool for supporting the data obtained from investigations including phenotypic and agro-ecological characteristics. Findings showed that SRAP-based markers could be useful in F. culmorum characterization.

  6. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  7. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  8. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  9. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  10. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  11. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  12. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  13. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  14. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  15. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  16. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  17. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  18. Genetic variability of Indian yaks using random amplified ...

    African Journals Online (AJOL)

    Only five primers (ILO 526, OPAV 15, ILO 1127, ILO 1065 and ILO 876) out of the ten primers tried produced consistant polymorphic fingerprints. Of the 76 fingerprints produced, 49 were present in all types, 21 were individual specific and 6 were polymorphic for different types. The pair wise comparison studied for different ...

  19. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  20. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  1. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  2. Genomic relations among 31 species of Mammillaria haworth (Cactaceae) using random amplified polymorphic DNA.

    Science.gov (United States)

    Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda

    2006-01-01

    Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.

  3. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  4. Amplifier for nuclear spectrometry

    International Nuclear Information System (INIS)

    Suarez Canner, E.

    1996-01-01

    The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system

  5. Portable musical instrument amplifier

    Science.gov (United States)

    Christian, David E.

    1990-07-24

    The present invention relates to a musical instrument amplifier which is particularly useful for electric guitars. The amplifier has a rigid body for housing both the electronic system for amplifying and processing signals from the guitar and the system's power supply. An input plug connected to and projecting from the body is electrically coupled to the signal amplifying and processing system. When the plug is inserted into an output jack for an electric guitar, the body is rigidly carried by the guitar, and the guitar is operatively connected to the electrical amplifying and signal processing system without use of a loose interconnection cable. The amplifier is provided with an output jack, into which headphones are plugged to receive amplified signals from the guitar. By eliminating the conventional interconnection cable, the amplifier of the present invention can be used by musicians with increased flexibility and greater freedom of movement.

  6. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  7. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  8. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  9. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  10. Genetic diversity of Santalum album using random amplified ...

    African Journals Online (AJOL)

    In the present study Random Amplified Polymorphic DNA (RAPD) technique was used to accesses the genetic diversity among 30 accessions of S. album collected from different parts of South India. A total of 248 polymorphic amplicons were obtained from 30 primers. The value of Jaccard coefficient ranged from 0.66 to ...

  11. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  13. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  14. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  15. Characterization of Grain Amaranth (Amaranthus spp. Germplasm in South West Nigeria Using Morphological, Nutritional, and Random Amplified Polymorphic DNA (RAPD Analysis

    Directory of Open Access Journals (Sweden)

    Pamela E. Akin-Idowu

    2016-01-01

    Full Text Available Efficient utilization of plant genetic resources for nutrition and crop improvement requires systematic understanding of the important traits. Amaranthus species are distributed worldwide with an interesting diversity of landraces and cultivars whose leaves and seeds are consumed. Despite their potential to enhance food security and economic livelihoods, grain amaranth breeding to improve nutritional quality and adoption by farmers in sub-Saharan Africa is scanty. This study assessed the variation among 29 grain amaranth accessions using 27 phenotypic (10 morphological and 17 nutritional characters and 16 random amplified polymorphic DNA (RAPD primers. Multivariate analysis of phenotypic characters showed the first four principal components contributing 57.53% of observed variability, while cluster analysis yielded five groups at 87.5% similarity coefficient. RAPD primers generated a total of 193 amplicons with an average of 12.06 amplicons per primer, 81% of which were polymorphic. Genetic similarities based on Jaccard’s coefficient ranged from 0.61 to 0.88. The RAPD-based unweighted pair group method with arithmetic mean dendrogram grouped the accessions into nine clusters, with the same species clustering together. RAPD primers distinguished the accessions more effectively than phenotypic markers. Accessions in the different clusters as obtained can be exploited for heterotic gain in desired nutritional traits.

  16. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  17. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  18. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  19. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  20. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  1. SPS RF System Amplifier plant

    CERN Multimedia

    1977-01-01

    The picture shows a 2 MW, 200 MHz amplifier plant with feeder lines. The main RF-system of the SPS comprises four cavities: two of 20 m length and two of 16.5 m length. They are all installed in one long straight section (LSS 3). These cavities are of the travelling-wave type operating at a centre frequency of 200.2 MHz. They are wideband, filling time about 700 ns and untuned. The power amplifiers, using tetrodes are installed in a surface building 200 m from the cavities. Initially only two cavities were installed, a third cavity was installed in 1978 and a forth one in 1979. The number of power amplifiers was also increased: to the first 2 MW plant a second 2 MW plant was added and by end 1979 there were 8 500 kW units combined in pairs to feed each of the 4 cavities with up to about 1 MW RF power, resulting in a total accelerating voltage of about 8 MV. See also 7412016X, 7412017X, 7411048X.

  2. Oscillators and operational amplifiers

    OpenAIRE

    Lindberg, Erik

    2005-01-01

    A generalized approach to the design of oscillators using operational amplifiers as active elements is presented. A piecewise-linear model of the amplifier is used so that it make sense to investigate the eigenvalues of the Jacobian of the differential equations. The characteristic equation of the general circuit is derived. The dynamic nonlinear transfer characteristic of the amplifier is investigated. Examples of negative resistance oscillators are discussed.

  3. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  4. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  5. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  6. FLUIDIC AC AMPLIFIERS.

    Science.gov (United States)

    Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems

  7. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  8. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  10. Antares laser power amplifier

    International Nuclear Information System (INIS)

    Stine, R.D.; Ross, G.F.; Silvernail, C.

    1979-01-01

    The overall design of the Antares laser power amplifier is discussed. The power amplifier is the last stage of amplification in the 100-kJ Antares laser. In the power amplifier a single, cylindrical, grid-controlle, cold-cathode electron gun is surrounded by 12 large-aperture CO 2 electron-beam sustained laser discharge sectors. Each power amplifier will deliver 18 kJ and the six modules used in Antares will produce the required 100 kJ for delivery to the target. A large-scale interaction between optical, mechanical, and electrical disciplines is required to meet the design objectives. Significant component advances required by the power amplifier design are discussed

  11. Rapid detection of the H275Y oseltamivir resistance mutation in influenza A/H1N1 2009 by single base pair RT-PCR and high-resolution melting.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We aimed to design a real-time reverse-transcriptase-PCR (rRT-PCR, high-resolution melting (HRM assay to detect the H275Y mutation that confers oseltamivir resistance in influenza A/H1N1 2009 viruses.A novel strategy of amplifying a single base pair, the relevant SNP at position 823 of the neuraminidase gene, was chosen to maintain specificity of the assay. Wildtype and mutant virus were differentiated when using known reference samples of cell-cultured virus. However, when dilutions of these reference samples were assayed, amplification of non-specific primer-dimer was evident and affected the overall melting temperature (T(m of the amplified products. Due to primer-dimer appearance at >30 cycles we found that if the cycle threshold (C(T for a dilution was >30, the HRM assay did not consistently discriminate mutant from wildtype. Where the C(T was 32.98 would have an H275Y assay C(T>30. Analysis of the TaqMan C(T values for 609 consecutive clinical samples predicted that 207 (34% of the samples would result in an HRM assay C(T>30 and therefore not be amenable to the HRM assay.The use of single base pair PCR and HRM can be useful for specifically interrogating SNPs. When applied to H1N1 09, the constraints this placed on primer design resulted in amplification of primer-dimer products. The impact primer-dimer had on HRM curves was adjusted for by plotting T(m against C(T. Although less sensitive than TaqMan assays, the HRM assay can rapidly, and at low cost, screen samples with moderate viral concentrations.

  12. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  13. Auto-Zero Differential Amplifier

    Science.gov (United States)

    Quilligan, Gerard T. (Inventor); Aslam, Shahid (Inventor)

    2017-01-01

    An autozero amplifier may include a window comparator network to monitor an output offset of a differential amplifier. The autozero amplifier may also include an integrator to receive a signal from a latched window comparator network, and send an adjustment signal back to the differential amplifier to reduce an offset of the differential amplifier.

  14. Relatedness of Indian flax genotypes (Linum usitatissimum L.): an inter-simple sequence repeat (ISSR) primer assay.

    Science.gov (United States)

    Rajwade, Ashwini V; Arora, Ritu S; Kadoo, Narendra Y; Harsulkar, Abhay M; Ghorpade, Prakash B; Gupta, Vidya S

    2010-06-01

    The objective of this study was to analyze the genetic relationships, using PCR-based ISSR markers, among 70 Indian flax (Linum usitatissimum L.) genotypes actively utilized in flax breeding programs. Twelve ISSR primers were used for the analysis yielding 136 loci, of which 87 were polymorphic. The average number of amplified loci and the average number of polymorphic loci per primer were 11.3 and 7.25, respectively, while the percent loci polymorphism ranged from 11.1 to 81.8 with an average of 63.9 across all the genotypes. The range of polymorphism information content scores was 0.03-0.49, with an average of 0.18. A dendrogram was generated based on the similarity matrix by the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), wherein the flax genotypes were grouped in five clusters. The Jaccard's similarity coefficient among the genotypes ranged from 0.60 to 0.97. When the omega-3 alpha linolenic acid (ALA) contents of the individual genotypes were correlated with the clusters in the dendrogram, the high ALA containing genotypes were grouped in two clusters. This study identified SLS 50, Ayogi, and Sheetal to be the most diverse genotypes and suggested their use in breeding programs and for developing mapping populations.

  15. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  16. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  17. Noise in Optical Amplifiers

    DEFF Research Database (Denmark)

    Jeppesen, Palle

    1997-01-01

    Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived.......Noise in optical amplifiers is discussed on the basis of photons and electromagntic fields. Formulas for quantum noise from spontaneous emission, signal-spontaneous beat noise and spontaneous-spontaneous beat noise are derived....

  18. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  19. Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers

    Science.gov (United States)

    Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

    2016-01-01

    Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153

  20. Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers.

    Science.gov (United States)

    Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

    2016-01-01

    Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies.

  1. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  2. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  5. Electrospun amplified fiber optics.

    Science.gov (United States)

    Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario

    2015-03-11

    All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.

  6. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  7. Fast pulse amplifier

    International Nuclear Information System (INIS)

    Lepetit, J.; Poussier, E.

    1984-01-01

    This amplifier comprises an inverter transformer, the primary circuit of which receives a pulse and the secondary circuit of which is connected to several amplifying elements in parallel. The inverter transformer is made of coaxial cable segments winded around a magnetic torus; the cable cores connected in series constitute the primary circuit and the braiding of cables, connected in parallel, are the secondary circuit. The transformer comprises, besides, delay lines in series with each braiding of the secondary circuit, these ones are such that pulses issued from each braiding arrive together to the secondary circuit connectors. This invention applies, noticeably in the case of a high voltage amplifier, to the control of deflection blocks of particles used in medicine or in particle accelerators [fr

  8. Fast logarithmic amplifier

    International Nuclear Information System (INIS)

    Tai, I.; Hasegawa, K.

    1975-01-01

    This paper reports on the improvement of frequency characteristics of a logarithmic amplifier with a Paterson transdiode connection. The improvement of the response speed has been achieved by using a phase compensation technique. Small signal response analyses of the logging circuit revealed the effects of a series resistor Rsub(p) and a parallel capacitance Csub(p) on the response of the circuit. The improvement of the frequency characteristics are remarkable at higher current levels. These facts were proved by the practical logarithmic amplifier. (auth.)

  9. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  10. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  11. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  12. Optical oscillator-amplifier laser configuration

    International Nuclear Information System (INIS)

    McAllister, G.L.

    1975-01-01

    A laser is described that has incorporated therein an oscillator formed by a pair of mirrors, at least one of the mirrors being positioned outside of the envelope. The mirrors are dimensioned and spaced from each other so that the resonator has a relatively low Fresnel number and is operated unstably. The entire surface of one of these mirrors is convex and diffracts a portion of the energy outside of the oscillator region. Also incorporated into the laser is an amplifier region defined by a separate pair of mirrors which receive the energy diffracted from the oscillator region. The second pair of mirrors form an optical system with a high Fresnel number. A filter, modulator or other control for the laser signal may be placed outside the laser envelope in the optical path of the oscillator

  13. Molecular Diversity of Antagonistic Streptomyces spp. against Botrytis allii, the agent of onion gray mold using Random Amplified Polymorphic DNA (RAPD Markers

    Directory of Open Access Journals (Sweden)

    M. Jorjandi

    2014-08-01

    Full Text Available As an aim in sustainable agriculture, biological control of plant diseases has received intensive attention mainly as a response to public concern about the use of chemical fungicides in the environment. Soil Actinomycetes particularly Streptomyces spp. enhance soil fertility and have antagonistic activity against wide range of plant pathogens. To investigate for biocontrol means against the pathogen, 30 isolates of Actinomycetes have been isolated from agricultural soils of Kerman province of Iran and assayed for antagonistic activity against Botrytis allii, the agent of onion gray mold. RAPD DNA analysis has been used to determine the relatedness of active and non-active isolates based on their RAPD-PCR fingerprints. PCR amplifiable DNA samples have been isolated using the CTAB method and amplified fragments have been obtained from 5 random 10-mer primers. Different DNA fingerprinting patterns have been obtained for all of the isolates. Electrophoretic and cluster analysis of the amplification products has revealed incidence of polymorphism among the isolates. A total of 138 bands, ranging in size from 150-2800 bp, have been amplified from primers which 63.7% of the observed bands have been polymorphic. Genetic distances among different varieties have been analyzed with a UPGMA (Unweighted pair-group method, arithmetic average-derived dendrogram. Resulting dendrogram has showed from 0.65 to 0.91 similarities among varieties and divided the isolates into five major groups. Isolates which haven’t had any antagonistic activity against B. allii have been separated into a group and other isolates classified into four groups. The results indicate that RAPD is an efficient method for discriminating and studying genetic diversity of Streptomyces isolates.

  14. Analysis of genetic diversity of Tunisian pistachio (Pistacia vera L.) using sequence-related amplified polymorphism (SRAP) markers.

    Science.gov (United States)

    Guenni, K; Aouadi, M; Chatti, K; Salhi-Hannachi, A

    2016-10-17

    Sequence-related amplified polymorphism (SRAP) markers preferentially amplify open reading frames and were used to study the genetic diversity of Tunisian pistachio. In the present study, 43 Pistacia vera accessions were screened using seven SRAP primer pairs. A total of 78 markers was revealed (95.12%) with an average polymorphic information content of 0.850. The results suggest that there is strong genetic differentiation, which characterizes the local resources (G ST = 0.307). High gene flow (N m = 1.127) among groups was explained by the exchange of plant material among regions. Analysis of molecular variance revealed significant differences within groups and showed that 73.88% of the total genetic diversity occurred within groups, whereas the remaining 26.12% occurred among groups. Bayesian clustering and principal component analysis identified three pools, El Guettar, Pollenizers, and the rest of the pistachios belonging to the Gabès, Kasserine, and Sfax localities. Bayesian analysis revealed that El Guettar and male genotypes were assigned with more than 80% probability. The BayeScan method proposed that locus 59 (F13-R9) could be used in the development of sex-linked SCAR markers from SRAP since it is a commonly detected locus in comparisons involving the Pollenizers group. This is the first application of SRAP markers for the assessment of genetic diversity in Tunisian germplasm of P. vera. Such information will be useful to define conservation strategies and improvement programs for this species.

  15. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  16. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  17. Amplifying genetic logic gates.

    Science.gov (United States)

    Bonnet, Jerome; Yin, Peter; Ortiz, Monica E; Subsoontorn, Pakpoom; Endy, Drew

    2013-05-03

    Organisms must process information encoded via developmental and environmental signals to survive and reproduce. Researchers have also engineered synthetic genetic logic to realize simpler, independent control of biological processes. We developed a three-terminal device architecture, termed the transcriptor, that uses bacteriophage serine integrases to control the flow of RNA polymerase along DNA. Integrase-mediated inversion or deletion of DNA encoding transcription terminators or a promoter modulates transcription rates. We realized permanent amplifying AND, NAND, OR, XOR, NOR, and XNOR gates actuated across common control signal ranges and sequential logic supporting autonomous cell-cell communication of DNA encoding distinct logic-gate states. The single-layer digital logic architecture developed here enables engineering of amplifying logic gates to control transcription rates within and across diverse organisms.

  18. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  19. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  20. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  1. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  2. Flashlamp excited fluid laser amplified

    International Nuclear Information System (INIS)

    1976-01-01

    The patent describes a laser amplifier with chambers for containing and amplifying an intensifier medium. It serves the need for a large impulse repetition rate and high intensities as required e.g. for laser isotope separation

  3. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  4. Improved-Bandwidth Transimpedance Amplifier

    Science.gov (United States)

    Chapsky, Jacob

    2009-01-01

    The widest available operational amplifier, with the best voltage and current noise characteristics, is considered for transimpedance amplifier (TIA) applications where wide bandwidth is required to handle fast rising input signals (as for time-of-flight measurement cases). The added amplifier inside the TIA feedback loop can be configured to have slightly lower voltage gain than the bandwidth reduction factor.

  5. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  6. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  7. Simplified design of IC amplifiers

    CERN Document Server

    Lenk, John

    1996-01-01

    Simplified Design of IC Amplifiers has something for everyone involved in electronics. No matter what skill level, this book shows how to design and experiment with IC amplifiers. For experimenters, students, and serious hobbyists, this book provides sufficient information to design and build IC amplifier circuits from 'scratch'. For working engineers who design amplifier circuits or select IC amplifiers, the book provides a variety of circuit configurations to make designing easier.Provides basics for all phases of practical design.Covers the most popular forms for amplif

  8. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  9. Wideband amplifier design

    CERN Document Server

    Hollister, Allen L

    2007-01-01

    In this book, the theory needed to understand wideband amplifier design using the simplest models possible will be developed. This theory will be used to develop algebraic equations that describe particular circuits used in high frequency design so that the reader develops a ""gut level"" understanding of the process and circuit. SPICE and Genesys simulations will be performed to show the accuracy of the algebraic models. By looking at differences between the algebraic equations and the simulations, new algebraic models will be developed that include parameters originally left out of the model

  10. Building valve amplifiers

    CERN Document Server

    Jones, Morgan

    2013-01-01

    Building Valve Amplifiers is a unique hands-on guide for anyone working with tube audio equipment--as an electronics hobbyist, audiophile or audio engineer. This 2nd Edition builds on the success of the first with technology and technique revisions throughout and, significantly, a major new self-build project, worked through step-by-step, which puts into practice the principles and techniques introduced throughout the book. Particular attention has been paid to answering questions commonly asked by newcomers to the world of the valve, whether audio enthusiasts tackling their first build or

  11. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  12. Superconducting digital logic amplifier

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper describes a superconducting digital logic amplifier for interfacing between a Josephson junction logic circuit having output current and a higher voltage semiconductor circuit input. The amplifier comprising: an input terminal for connection to a; an output terminal for connection to a semiconductor circuit input; an input, lower critical current, Josephson junction having first and second terminals; a first series string of at least three lower critical current Josephson junctions. The first series string being connected to the first terminal of the input Josephson junction such that the first series string is in series with the input Josephson junction to provide a series combination. The input terminal being connected to the first terminal of the input Josephson junction, and with the critical current of the lower critical current Josephson junctions of the input Josephson junction and the first series Josephson junctions being less than the output current of the low voltage Josephson junction circuit; a second series string of at least four higher critical current Josephson junctions. The second string being connected in parallel with the series combination to provide parallel strings having an upper common connection and a lower common connection. The lower common connection being connected to the second terminal of the input Josephson junction and the upper common connection being connected to the output terminal; and a pulsed DC current source connected the parallel strings at the upper common connection. The DC current source having a current at least equal to the critical current of the higher critical current Josephson junctions

  13. Cascade energy amplifier

    International Nuclear Information System (INIS)

    Barzilov, A.P.; Gulevich, A.V.; Kukharchuk, O.F.

    2000-01-01

    The technical problem of long-life fission product and minor actinide incineration and production of plutonium fuel in the prospective nuclear systems will arise at significant scales of nuclear power industry development. Subcritical nuclear reactors driven by extemal neutron sources (energy amplifiers) are considered as incinerators of toxicity of complete nuclear industry. In the frames of this concept, the subcritical reactor part consisting of two coupled blanket regions (inner fast neutron spectrum core and outer thermal core) driven by extemal neutron source is discussed. Two types of source are studied: spallation target and 14-MeV fusion bum of micropellets. Liquid metal Pb-Bi is considered as target material and coolant of inner fast core. Thermal core is a heavy-water subcritical reactor of the Candu-type. The fast core is protected from thermal neutrons influence with the boron shield. All reactor technologies used in this concept are tested during years of operation and commercially available. Thus, the cascade energy amplifiers have a set of advantages in comparison with traditional concepts: in energy production, in transmutation efficiency, and in economics. (authors)

  14. A Primer on Macroprudential Policy

    Science.gov (United States)

    Poutineau, Jean-Christophe; Vermandel, Gauthier

    2015-01-01

    This article introduces macroprudential policy using a static New Keynesian Macroeconomics model with financial frictions. The authors analyze two related questions: First, they show how the procyclicality of financial factors, captured by the financial accelerator, amplifies the transmission of supply and demand shocks and impacts the intuition…

  15. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  16. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  17. Free-electron laser system with Raman amplifier outcoupling

    Energy Technology Data Exchange (ETDEWEB)

    Linford, G.J.

    1988-05-03

    A free-electron laser system is described comprising: a free-electron laser pump beam generator producing a high-power optical output beam in a vacuum environement; a Raman amplifier cell located in the path of the output beam from the pump beam generator; means for generating and introducing a Stokes seed beam into the Raman amplifier cell, a pair of gaseous windows through which the output beam enters and leaves the Raman amplifier cell, each window having a stream of gas moving continuously in a direction generally perpendicular to the beam; and a mirror positioned in the path of the output beam from the Raman amplifier, the mirror functioning to reflect and further direct the output beam, but not the unwanted spectral components.

  18. 454-Pyrosequencing analysis of bacterial communities from autotrophic nitrogen removal bioreactors utilizing universal primers : Effect of annealing temperature

    NARCIS (Netherlands)

    Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S

  19. Nanoscale electromechanical parametric amplifier

    Science.gov (United States)

    Aleman, Benjamin Jose; Zettl, Alexander

    2016-09-20

    This disclosure provides systems, methods, and apparatus related to a parametric amplifier. In one aspect, a device includes an electron source electrode, a counter electrode, and a pumping electrode. The electron source electrode may include a conductive base and a flexible conductor. The flexible conductor may have a first end and a second end, with the second end of the flexible conductor being coupled to the conductive base. A cross-sectional dimension of the flexible conductor may be less than about 100 nanometers. The counter electrode may be disposed proximate the first end of the flexible conductor and spaced a first distance from the first end of the flexible conductor. The pumping electrode may be disposed proximate a length of the flexible conductor and spaced a second distance from the flexible conductor.

  20. Linear pulse amplifier

    International Nuclear Information System (INIS)

    Tjutju, R.L.

    1977-01-01

    Pulse amplifier is standard significant part of spectrometer. Apart from other type of amplification, it's a combination of amplification and pulse shaping. Because of its special purpose the device should fulfill the following : High resolution is desired to gain a high yield comparable to its actual state of condition. High signal to noise is desired to nhν resolution. High linearity to facilitate calibration. A good overload recovery, in order to the device will capable of analizing a low energy radiation which appear joinly on the high energy fields. Other expections of the device are its economical and practical use its extentive application. For that reason it's built on a standard NIM principle. Taking also into account the above mentioned considerations. High quality component parts are used throughout, while its availability in the domestic market is secured. (author)

  1. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  2. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  3. Modeling of semiconductor optical amplifiers

    DEFF Research Database (Denmark)

    Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther

    We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....

  4. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  5. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  6. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  7. CERN: Energy amplifier

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Even under the heavy burden of responsibility as CERN's Director General from 1989-3 the fertile mind of Carlo Rubbia the scientist was never still. A long-time Rubbia 'hobby' has been the search for new sources of nuclear energy, exploiting knowledge and skills from high energy physics. An initial objective was to adopt heavy ion techniques to induce controlled thermonuclear fusion, but in 1994 this quest changed direction. Putting the problems of thermonuclear fusion aside, Rubbia began to explore an alternative route to energy production through controlled nuclear fission. The idea is to use a particle accelerator producing neutrons by spallation (interaction of particles with a target) to feed a fuel/moderator assembly where the neutrons multiply by fission chain reactions. If the energy liberated becomes substantially greater than that needed to drive the accelerator, the process has a net gain and becomes selfsupporting. Hence the name ''Energy Amplifier'' (EA). Similar systems for energy production or for nuclear waste incineration have been proposed at Los Alamos and in Japan and Russia, but appear to require the prior development of innovative linear accelerators. For Rubbia's Amplifier, the requisite accelerator is a reasonable extrapolation of an existing cyclotron such that at the Swiss Paul Scherrer Institute. Moreover, the EA would require fuel rods very similar to those of conventional reactors, rather than demand-ing new technology using liquid fuel loops (molten salts) with on-line separation of radioactive products. Unlike a reactor, the EA's fission reaction is not self-sustaining: it is sub-critical and needs a continuous supply of neutrons from the accelerator. This makes Chernobyl-type meltdowns unlikely: if the accelerator stops, the reaction stops too. Another major advantage is that the old dream of using thorium as a fuel is now made possible. Thorium is not itself fissile, but under neutron

  8. Millimeter-wave power amplifiers

    CERN Document Server

    du Preez, Jaco

    2017-01-01

    This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.

  9. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  10. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  11. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  13. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  14. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  17. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  19. Small signal microwave amplifier design

    CERN Document Server

    Grosch, Theodore

    2000-01-01

    This book explains techniques and examples for designing stable amplifiers for high-frequency applications in which the signal is small and the amplifier circuit is linear. An in-depth discussion of linear network theory provides the foundation needed to develop actual designs. Examples throughout the book will show you how to apply the knowledge gained in each chapter leading to the complex design of low noise amplifiers. Many exercises at the end of each chapter will help students to practice their skills. The solutions to these design problems are available in an accompanying solutions book

  20. Final amplifier design and mercury

    International Nuclear Information System (INIS)

    Rose, E.A.; Hanson, D.E.

    1991-01-01

    The final amplifier for the Mercury KrF excimer facility is being designed. The design exercise involves extensive modeling to predict amplifier performance. Models of the pulsed-power system, including a Child-Langmuir diode with closure, electron-beam energy deposition, KrF laser kinetics, amplified spontaneous emission (ASE), a time-dependent laser extraction in the presence of ASE are presented as a design package. The design exercise indicates that the energy objective of Phase I -- 100 joules -- will be met

  1. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  2. Characterization of Malaysian Trichoderma isolates using random amplified microsatellites (RAMS).

    Science.gov (United States)

    Siddiquee, Shafiquzzaman; Tan, Soon Guan; Yusuf, Umi Kalsom; Fatihah, Nur Hasan Nudin; Hasan, Md Mainul

    2012-01-01

    Trichoderma species are commercially applied as biocontrol agents against numerous plant pathogenic fungi due to their production of antifungal metabolites, competition for nutrients and space, and mycoparasitism. However, currently the identification of Trichoderma species from throughout the world based on micro-morphological descriptions is tedious and prone to error. The correct identification of Trichoderma species is important as several traits are species-specific. The Random Amplified Microsatellites (RAMS) analysis done using five primers in this study showed different degrees of the genetic similarity among 42 isolates of this genus. The genetic similarity values were found to be in the range of 12.50-85.11% based on a total of 76 bands scored in the Trichoderma isolates. Of these 76 bands, 96.05% were polymorphic, 3.95% were monomorphic and 16% were exclusive bands. Two bands (250 bp and 200 bp) produced by primer LR-5 and one band (250 bp) by primer P1A were present in all the Trichoderma isolates collected from healthy and infected oil palm plantation soils. Cluster analysis based on UPGMA of the RAMS marker data showed that T. harzianum, T. virens and T. longibrachiatum isolates were grouped into different clades and lineages. In this study we found that although T. aureoviride isolates were morphologically different when compared to T. harzianum isolates, the UPGMA cluster analysis showed that the majority isolates of T. aureoviride (seven from nine) were closely related to the isolates of T. harzianum.

  3. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  4. New Packaging for Amplifier Slabs

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Thorsness, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Suratwala, T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Steele, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Rogowski, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-03-18

    The following memo provides a discussion and detailed procedure for a new finished amplifier slab shipping and storage container. The new package is designed to maintain an environment of <5% RH to minimize weathering.

  5. Operational amplifiers theory and design

    CERN Document Server

    Huijsing, Johan

    2017-01-01

    This proven textbook guides readers to a thorough understanding of the theory and design of operational amplifiers (OpAmps). The core of the book presents systematically the design of operational amplifiers, classifying them into a periodic system of nine main overall configurations, ranging from one gain stage up to four or more stages. This division enables circuit designers to recognize quickly, understand, and choose optimal configurations. Characterization of operational amplifiers is given by macro models and error matrices, together with measurement techniques for their parameters. Definitions are given for four types of operational amplifiers depending on the grounding of their input and output ports. Many famous designs are evaluated in depth, using a carefully structured approach enhanced by numerous figures. In order to reinforce the concepts introduced and facilitate self-evaluation of design skills, the author includes problems with detailed solutions, as well as simulation exercises. Provides te...

  6. TARC: Carlo Rubbia's Energy Amplifier

    CERN Multimedia

    Laurent Guiraud

    1997-01-01

    Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.

  7. Enhanced performance CCD output amplifier

    Science.gov (United States)

    Dunham, Mark E.; Morley, David W.

    1996-01-01

    A low-noise FET amplifier is connected to amplify output charge from a che coupled device (CCD). The FET has its gate connected to the CCD in common source configuration for receiving the output charge signal from the CCD and output an intermediate signal at a drain of the FET. An intermediate amplifier is connected to the drain of the FET for receiving the intermediate signal and outputting a low-noise signal functionally related to the output charge signal from the CCD. The amplifier is preferably connected as a virtual ground to the FET drain. The inherent shunt capacitance of the FET is selected to be at least equal to the sum of the remaining capacitances.

  8. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  9. A preliminary amplified fragment length polymorphism (AFLP) primers selection for spathoglottis species

    NARCIS (Netherlands)

    Ginibun, F.C.; Bhassu, S.; Khalid, N.; Arens, P.; Vosman, B.; Othman, R.Y.

    2015-01-01

    Spathoglottis is a native terrestrial orchid that attracting horticultural interest as a landscaping plant. Distinguishing orchid at species level based on morphological characteristics is unconvincing as some characteristic may sensitive to environmental. Therefore, molecular characterization

  10. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  11. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  12. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  13. Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains

    OpenAIRE

    Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija

    1999-01-01

    A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 33...

  14. Estimation of genetic variability among elite wheat genotypes using random amplified polymorphic DNA (RAPD) analysis

    International Nuclear Information System (INIS)

    BIBI, S.; Khan, I.A.; Naqvi, M.H.; Siddiqui, M.A.; Yasmeen, S.; Seema, M.

    2012-01-01

    Twenty four wheat varieties/lines were assessed through RAPD for genetic diversity. Of forty primers, thirteen were able to amplify the genomic DNA and yielded 269 polymorphic bands. The percentage of the polymorphic loci was 86.22%. Nei's genetic diversity (h) ranged from 0.248 to 0.393, with an average of 0.330. Shanon's index ranged from 0.382 to 0.567, with an average of 0.487. The proportion of genetic variation among the populations ( Ds) accounted for 28.58 % of the whole genetic diversity. The level of gene flow (Nm) was 1.25. Some specific RAPD bands were also identified, variety C-591, and QM-4531 contain a specific segment of 4.9 kbp. Whereas SARC-1 and PKV-1600 amplified a specific DNA segment with primer A-09. Marvi-2000 contains two specific segments of 3.2 kb and 200 bp amplified with primer B-07. Genetically most similar genotypes were C-591 and Pasban-90 (76%) and most dissimilar genotypes were Rawal-87 and Khirman (36.1%). On the basis of results, 24 wheat varieties under study could be divided into 'two' groups and five clusters 'A' to 'E. (author)

  15. Spectroscopic amplifier for pin diode

    International Nuclear Information System (INIS)

    Alonso M, M. S.; Hernandez D, V. M.; Vega C, H. R.

    2014-10-01

    The photodiode remains the basic choice for the photo-detection and is widely used in optical communications, medical diagnostics and field of corpuscular radiation. In detecting radiation it has been used for monitoring radon and its progeny and inexpensive spectrometric systems. The development of a spectroscopic amplifier for Pin diode is presented which has the following characteristics: canceler Pole-Zero (P/Z) with a time constant of 8 μs; constant gain of 57, suitable for the acquisition system; 4th integrator Gaussian order to waveform change of exponential input to semi-Gaussian output and finally a stage of baseline restorer which prevents Dc signal contribution to the next stage. The operational amplifier used is the TLE2074 of BiFET technology of Texas Instruments with 10 MHz bandwidth, 25 V/μs of slew rate and a noise floor of 17 nv/(Hz)1/2. The integrated circuit has 4 operational amplifiers and in is contained the total of spectroscopic amplifier that is the goal of electronic design. The results show like the exponential input signal is converted to semi-Gaussian, modifying only the amplitude according to the specifications in the design. The total system is formed by the detector, which is the Pin diode, a sensitive preamplifier to the load, the spectroscopic amplifier that is what is presented and finally a pulse height analyzer (Mca) which is where the spectrum is shown. (Author)

  16. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-12-28

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

  17. Novel Bacteriocinogenic Lactobacillus plantarum Strains and Their Differentiation by Sequence Analysis of 16S rDNA, 16S-23S and 23S-5S Intergenic Spacer Regions and Randomly Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Morteza Shojaei Moghadam

    2010-01-01

    Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.

  18. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  19. 32 species validation of a new Illumina paired-end approach for the development of microsatellites.

    Directory of Open Access Journals (Sweden)

    Stacey L Lance

    Full Text Available Development and optimization of novel species-specific microsatellites, or simple sequence repeats (SSRs remains an important step for studies in ecology, evolution, and behavior. Numerous approaches exist for identifying new SSRs that vary widely in terms of both time and cost investments. A recent approach of using paired-end Illumina sequence data in conjunction with the bioinformatics pipeline, PAL_FINDER, has the potential to substantially reduce the cost and labor investment while also improving efficiency. However, it does not appear that the approach has been widely adopted, perhaps due to concerns over its broad applicability across taxa. Therefore, to validate the utility of the approach we developed SSRs for 32 species representing 30 families, 25 orders, 11 classes, and six phyla and optimized SSRs for 13 of the species. Overall the IPE method worked extremely well and we identified 1000s of SSRs for all species (mean = 128,485, with 17% of loci being potentially amplifiable loci, and 25% of these met our most stringent criteria designed to that avoid SSRs associated with repetitive elements. Approximately 61% of screened primers yielded strong amplification of a single locus.

  20. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  1. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  2. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  3. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  4. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  7. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  8. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Dielectric waveguide amplifiers and lasers

    NARCIS (Netherlands)

    Pollnau, Markus

    The performance of semiconductor amplifiers and lasers has made them the preferred choice for optical gain on a micro-chip. In the past few years, we have demonstrated that also rare-earth-ion-doped dielectric waveguides show remarkable performance, ranging from a small-signal gain per unit length

  11. Identification, genetic localization, and allelic diversity of selectively amplified microsatellite polymorphic loci in lettuce and wild relatives (Lactuca spp.).

    Science.gov (United States)

    Witsenboer, H; Michelmore, R W; Vogel, J

    1997-12-01

    Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.

  12. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  13. Evaluation of genetic diversity in Chinese kale (Brassica oleracea L. var. alboglabra Bailey) by using rapid amplified polymorphic DNA and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, J; Zhang, L G

    2014-02-14

    Chinese kale is an original Chinese vegetable of the Cruciferae family. To select suitable parents for hybrid breeding, we thoroughly analyzed the genetic diversity of Chinese kale. Random amplified polymorphic DNA (RAPD) and sequence-related amplified polymorphism (SRAP) molecular markers were used to evaluate the genetic diversity across 21 Chinese kale accessions from AVRDC and Guangzhou in China. A total of 104 bands were detected by 11 RAPD primers, of which 66 (63.5%) were polymorphic, and 229 polymorphic bands (68.4%) were observed in 335 bands amplified by 17 SRAP primer combinations. The dendrogram showed the grouping of the 21 accessions into 4 main clusters based on RAPD data, and into 6 clusters based on SRAP and combined data (RAPD + SRAP). The clustering of accessions based on SRAP data was consistent with petal colors. The Mantel test indicated a poor fit for the RAPD and SRAP data (r = 0.16). These results have an important implication for Chinese kale germplasm characterization and improvement.

  14. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  15. Enzyme Treatment-Free and Ligation-Independent Cloning Using Caged Primers in Polymerase Chain Reactions

    Directory of Open Access Journals (Sweden)

    Akinori Kuzuya

    2011-12-01

    Full Text Available A new simple scheme for constructing recombinant vectors that does not require any restriction enzyme, ligase, or any other special enzyme treatment has been developed. By using caged primers in PCR, unnatural sticky-ends of any sequence, which are sufficiently long for ligation-independent cloning (LIC, are directly prepared on the product after a brief UVA irradiation. Target genes and vectors amplified by this light-assisted cohesive-ending (LACE PCR join together in the desired arrangement in a simple mixture of them, tightly enough to be repaired and ligated in competent cells.

  16. CMOS Current-mode Operational Amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1992-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-range ±700¿A) and a (theoretically) unlimited slew-rate. The amplifier is realized in a standard CMOS 2......A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  17. A CMOS current-mode operational amplifier

    DEFF Research Database (Denmark)

    Kaulberg, Thomas

    1993-01-01

    current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain-bandwidth product of 3 MHz, an offset current of 0.8 μA (signal range ±700 μA), and a (theoretically) unlimited slew rate. The amplifier is realized in a standard CMOS 2......A fully differential-input, differential-output, current-mode operational amplifier (COA) is described. The amplifier utilizes three second-generation current conveyors (CCIIs) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced...

  18. Amplified spontaneous emissions in a high-gain laser amplifier

    International Nuclear Information System (INIS)

    Osada, Hidenori; Gamo, Hideya.

    1978-01-01

    The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)

  19. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  20. Direct coupled amplifiers using field effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, E P [Control and Instrumentation Division, Atomic Energy Establishment, Winfrith, Dorchester, Dorset (United Kingdom)

    1964-03-15

    The concept of the uni-polar field effect transistor (P.E.T.) was known before the invention of the bi-polar transistor but it is only recently that they have been made commercially. Being produced as yet only in small quantities, their price imposes a restriction on use to circuits where their peculiar properties can be exploited to the full. One such application is described here where the combination of low voltage drift and relatively low input leakage current are necessarily used together. One of the instruments used to control nuclear reactors has a logarithmic response to the mean output current from a polarised ionisation chamber. The logarithmic signal is then differentiated electrically, the result being displayed on a meter calibrated to show the reactor divergence or doubling time. If displayed in doubling time the scale is calibrated reciprocally. Because of the wide range obtained in the logarithmic section and the limited supply voltage, an output of 1 volt per decade change in ionisation current is used. Differentiating this gives a current of 1.5 x 10{sup -8} A for p.s.D. (20 sec. doubling time) in the differentiating amplifier. To overcome some of the problems of noise due to statistical variations in input current, the circuit design necessitates a resistive path to ground at the amplifier input of 20 M.ohms. A schematic diagram is shown. 1. It is evident that a zero drift of 1% can be caused by a leakage current of 1.5 x 10{sup -10} A or an offset voltage of 3 mV at the amplifier input. Although the presently used electrometer valve is satisfactory from the point of view of grid current, there have been sudden changes in grid to grid voltage (the valve is a double triode) of up to 10 m.V. It has been found that a pair of F.E.T's. can be used to replace the electrometer valve so long as care is taken in correct balance of the two devices. An investigation has been made into the characteristics of some fourteen devices to see whether those with

  1. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  2. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  3. Single conversion stage amplifier - SICAM

    Energy Technology Data Exchange (ETDEWEB)

    Ljusev, P.

    2005-12-15

    This Ph.D. thesis presents a thorough analysis of the so called SICAM - SIngle Converter stage AMplifier approach to building direct energy conversion audio power amplifiers. The mainstream approach for building isolated audio power amplifiers today consists of isolated DC power supply and Class D amplifier, which essentially represents a two stage solution, where each of the components can be viewed as separate and independent part. The proposed SICAM solution strives for direct energy conversion from the mains to the audio output, by dedicating the operation of the components one to another and integrating their functions, so that the final audio power amplifier represents a single-stage topology with higher efficiency, lower volume, less board space, lower component count and subsequently lower cost. The SICAM approach is both applicable to non-isolated and isolated audio power amplifiers, but the problems encountered in these two cases are different. Non-isolated SICAM solutions are intended for both AC mains-connected and battery-powered devices. In non-isolated mains-connected SICAMs the main idea is to simplify the power supply or even provide integrated power factor correction (PFC) functions, while still maintaining low component stress and good audio performance by generally decreasing the input voltage level to the Class D audio power amplifier. On the other hand, non-isolated battery-powered SICAMs have to cope with the ever changing battery voltage and provide output voltage levels which are both lower and higher than the battery voltage, while still being simple and single-stage energy conversion solutions. In isolated SICAMs the isolation transformer adjusts the voltage level on the secondary side to the desired level, so the main challenges here are decreasing the size of the magnetic core and reducing the number and size of bulky reactive components as much as possible. The main focus of this thesis is directed towards the isolated SICAMs and

  4. Analog circuit design designing high performance amplifiers

    CERN Document Server

    Feucht, Dennis

    2010-01-01

    The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.

  5. Higher order mode optical fiber Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Friis, Søren Michael Mørk; Usuga Castaneda, Mario A.

    2016-01-01

    We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations.......We review higher order mode Raman amplifiers and discuss recent theoretical as well as experimental results including system demonstrations....

  6. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  7. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  8. Challenges in higher order mode Raman amplifiers

    DEFF Research Database (Denmark)

    Rottwitt, Karsten; Nielsen, Kristian; Friis, Søren Michael Mørk

    2015-01-01

    A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed......A higher order Raman amplifier model that take random mode coupling into account ispresented. Mode dependent gain and signal power fluctuations at the output of the higher order modeRaman amplifier are discussed...

  9. European Research on THz Vacuum Amplifiers

    DEFF Research Database (Denmark)

    Brunetti, F.; Cojocarua, C.-S.; de Rossi, A.

    2010-01-01

    The OPTHER (OPtically Driven TeraHertz AmplifiERs) project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within this project is a consolidation of efforts at the international level from the main players...... of the European research, academy and industry in vacuum electronics. This paper describes the status of the project and progress towards the THz amplifier realization....

  10. Integrated amplifying circuit with MOS transistors

    Energy Technology Data Exchange (ETDEWEB)

    Baylac, B; Merckel, G; Meunier, P

    1974-01-25

    The invention relates to a feedback-pass-band amplifier with MOS-transistors. The differential stage of conventional amplifiers is changed into an adding state, whereas the differential amplification stages are changed into amplifier inverter stages. All MOS transistors used in that amplifier are of similar configuration and are interdigitized, whereby the operating speed dispersion is reduced. This can be applied to obtaining a measurement channel for proportional chambers.

  11. NASA developments in solid state power amplifiers

    Science.gov (United States)

    Leonard, Regis F.

    1990-01-01

    Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.

  12. A pulse amplifier for nuclear instrumentation

    International Nuclear Information System (INIS)

    Martin, D.; Cliff, P.

    1987-01-01

    A Class-A 1 Watt amplifier has been designed and optimized for nanosecond pulses. Spanning .01MHz to 1300Mhz, signal gain is 26dB with gain flatness of 1dB. The amplifier drive +- 10 volts across 500 with 350ps risetime. Each amplifier is housed in a 2-wide NIM

  13. Remote Acquisition Amplifier For 50-Ohm Cable

    Science.gov (United States)

    Amador, Jose J.

    1995-01-01

    Buffer-amplifier unit designed to drive 50-Ohm cables up to 100 ft. (30 m) long, compensating for attenuation in cables and enabling remote operation of oscilloscopes. Variable resistor provides for adjustment of gain of amplifier, such that overall gain from input terminals of amplifier to output end of cable set to unity.

  14. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  15. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  16. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  17. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  18. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  19. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  20. Near quantum limited amplification from inelastic Cooper-pair tunneling

    Science.gov (United States)

    Hofheinz, Max; Jebari, Salha; Blanchet, Florian; Grimm, Alexander; Hazra, Dibyendu; Albert, Romain; Portier, Fabien

    Josephson parametric amplifiers approach quantum-limited noise performance but require strong external microwave pump tones which make them more difficult to use than DC powered amplifiers: The pump tone can affect the device under test and requires expensive room-temperature equipment. Inelastic Cooper pair tunneling processes through a small DC voltage-biased Josephson junction, where a tunneling Cooper pair dissipates its energy 2 eV in the form of two photons are reminiscent of parametric down conversion. We show that these processes can be used to provide amplification near the quantum limit without external microwave pump tone. We explain the measured gain and noise based on the P (E) theory of inelastic Cooper pair tunneling and general fluctuation-dissipation relations.

  1. using random amplified polymorphic DNA (RAPD)

    African Journals Online (AJOL)

    To study the pattern of genetic diversity in 45 genotypes of common bean, 19 RAPD primers were used. Of 253 bands produced, 236 bands (94.22%) were polymorphic in which maximum number (20 polymorphic bands) were observed in the profiles of the primer OPB-07. Highest PIC value (0.79) was observed for the ...

  2. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2003-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. The amplifier is constructed in a fully differential topology to maximize noise rejection. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved....... A continuous-time current-steering offset-compensation technique is utilized in order to minimize the noise contribution and to minimize dynamic impact on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0...

  3. Semiconductor quantum-dot lasers and amplifiers

    DEFF Research Database (Denmark)

    Hvam, Jørn Märcher; Borri, Paola; Ledentsov, N. N.

    2002-01-01

    -power surface emitting VCSELs. We investigated the ultrafast dynamics of quantum-dot semiconductor optical amplifiers. The dephasing time at room temperature of the ground-state transition in semiconductor quantum dots is around 250 fs in an unbiased amplifier, decreasing to below 50 fs when the amplifier...... is biased to positive net gain. We have further measured gain recovery times in quantum dot amplifiers that are significantly lower than in bulk and quantum-well semiconductor optical amplifiers. This is promising for future demonstration of quantum dot devices with high modulation bandwidth...

  4. CMOS Current-mode Operational Amplifier

    OpenAIRE

    Kaulberg, Thomas

    1992-01-01

    A fully differential-input differential-output current-mode operational amplifier (COA) is described. The amplifier utilizes three second generation current-conveyors (CCII) as the basic building blocks. It can be configured to provide either a constant gain-bandwidth product in a fully balanced current-mode feedback amplifier or a constant bandwidth in a transimpedance feedback amplifier. The amplifier is found to have a gain bandwidth product of 8 MHz, an offset current of 0.8 ¿A (signal-r...

  5. NIF/LMJ prototype amplifier mechanical design

    International Nuclear Information System (INIS)

    Horvath, J.

    1996-10-01

    Amplifier prototypes for the National Ignition Facility and the Laser Megajoule will be tested at Lawrence Livermore National Laboratory. The prototype amplifier, which is an ensemble of modules from LLNL and Centre d'Etudes de Limeil-Valenton, is cassette-based with bottom access for maintenance. A sealed maintenance transfer vehicle which moves optical cassettes between the amplifier and the assembly cleanroom, and a vacuum gripper which holds laser slabs during cassette assembly will also be tested. The prototype amplifier will be used to verify amplifier optical performance, thermal recovery time, and cleanliness of mechanical operations

  6. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  7. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  8. HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS

    International Nuclear Information System (INIS)

    2005-01-01

    Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department

  9. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  10. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  11. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  12. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  13. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  14. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  15. In-flight auscultation during medical air evacuation: comparison between traditional and amplified stethoscopes.

    Science.gov (United States)

    Fontaine, Emmanuelle; Coste, Sébastien; Poyat, Chrystelle; Klein, Céline; Lefort, Hugues; Leclerc, Thomas; Dubourdieu, Stéphane; Briche, Frédérique; Jost, Daniel; Maurin, Olga; Domanski, Laurent; Tourtier, Jean-Pierre

    2014-01-01

    The aim of this study was to evaluate the capacity of a traditional stethoscope versus an electronically amplified one (expected to reduce background and ambient noise) to assess heart and respiratory sounds during medical transport. It was a prospective, double-blinded, randomized performed study. One traditional stethoscope (Littmann Cardiology III; 3M, St Paul, MN) and 1 electronically amplified stethoscope (Littmann 3200, 3M) were used for our tests. Heart and lung auscultation during real medical evacuations aboard a medically configured Falcon 50 aircrafts were studied. The quality of auscultation was ranged using a numeric rating scale from 0 to 10 (0 corresponding to "I hear nothing" and 10 to "I hear perfectly"). Data collected were compared using a t-test for paired values. A total of 40 comparative evaluations were performed. For cardiac auscultation, the value of the rating scale was 4.53 ± 1.91 and 7.18 ± 1.88 for the traditional and amplified stethoscope, respectively (paired t-test: P auscultation was estimated at 3.1 ± 1.95 for a traditional stethoscope and 5.10 ± 2.13 for the amplified one (paired t-test: P < .0001). This study showed that practitioners would be better helped in hearing cardiac and respiratory sounds with an electronically amplified stethoscope than with a traditional one during air medical transport in a medically configured Falcon 50 aircraft. Copyright © 2014 Air Medical Journal Associates. Published by Elsevier Inc. All rights reserved.

  16. Assessing genetic divergence in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism markers.

    Science.gov (United States)

    Zhang, F; Ge, Y Y; Wang, W Y; Shen, X L; Yu, X Y

    2012-12-03

    Conventional hybridization and selection techniques have aided the development of new ornamental crop cultivars. However, little information is available on the genetic divergence of bromeliad hybrids. In the present study, we investigated the genetic variability in interspecific hybrids of Aechmea gomosepala and A. recurvata var. recurvata using inflorescence characteristics and sequence-related amplified polymorphism (SRAP) markers. The morphological analysis showed that the putative hybrids were intermediate between both parental species with respect to inflorescence characteristics. The 16 SRAP primer combinations yield 265 bands, among which 154 (57.72%) were polymorphic. The genetic similarity was an average of 0.59 and ranged from 0.21 to 0.87, indicating moderate genetic divergence among the hybrids. The unweighted pair group method with arithmetic average (UPGMA)-based cluster analysis distinguished the hybrids from their parents with a genetic distance coefficient of 0.54. The cophenetic correlation was 0.93, indicating a good fit between the dendrogram and the original distance matrix. The two-dimensional plot from the principal coordinate analysis showed that the hybrids were intermediately dispersed between both parents, corresponding to the results of the UPGMA cluster and the morphological analysis. These results suggest that SRAP markers could help to identify breeders, characterize F(1) hybrids of bromeliads at an early stage, and expedite genetic improvement of bromeliad cultivars.

  17. Audio power amplifier design handbook

    CERN Document Server

    Self, Douglas

    2013-01-01

    This book is essential for audio power amplifier designers and engineers for one simple reason...it enables you as a professional to develop reliable, high-performance circuits. The Author Douglas Self covers the major issues of distortion and linearity, power supplies, overload, DC-protection and reactive loading. He also tackles unusual forms of compensation and distortion produced by capacitors and fuses. This completely updated fifth edition includes four NEW chapters including one on The XD Principle, invented by the author, and used by Cambridge Audio. Cro

  18. Cathode-follower power amplifier

    International Nuclear Information System (INIS)

    Giordano, S.; Puglisi, M.

    1983-01-01

    In circular accelerators and particularly in storage rings it is essential that the total impedance, as seen by the beam, be kept below some critical value. A model of the accelerating system was built using a single-ended cathode-follower amplifier driving a ferrite-loaded cavity. The system operated at 234.5 kHz with a peak output voltage of +-10 kV on the gap. The dynamic output impedance, as measured on the gap, was < 15 ohms

  19. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  20. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  1. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  2. Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data.

    Science.gov (United States)

    Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R; Wang, Xiaolu

    2016-03-01

    Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon.

  3. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  4. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  5. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  6. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  7. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  8. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  9. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  10. Random amplified polymorphic DNA (RAPD analysis of Lutzomyia longipalpis laboratory populations

    Directory of Open Access Journals (Sweden)

    DiaS Edelberto S.

    1998-01-01

    Full Text Available The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica. The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.

  11. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  12. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  13. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  14. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  15. A system for biasing a differential amplifier

    International Nuclear Information System (INIS)

    Barbier, Daniel; Ittel, J.M.; Poujois, Robert

    1975-01-01

    This invention concerns a system for biasing a differential amplifier. It particularly applies to the integrated differential amplifiers designed with MOS field effect transistors. Variations in the technological parameters may well cause the amplifying transistors to work outside their usual operational area, in other words outside the linear part of the transfer characteristic. To ensure that these transistors function correctly, it is necessary that the value of the voltage difference at the output be equally null. To do this and to centre on the so called 'rest' point of the amplifier transfer charateristic, the condition will be set that the output potentials of each amplifier transistor should have a zero value or a constant value as sum. With this in view, the bias on the source (generally a transistor powered by its grid bias voltage) supplying current to the two amplifying transistors fitted in parallel, is permanently adjusted in a suitable manner [fr

  16. Enhanced Gain in Photonic Crystal Amplifiers

    DEFF Research Database (Denmark)

    Ek, Sara; Semenova, Elizaveta; Hansen, Per Lunnemann

    2012-01-01

    We experimentally demonstrate enhanced gain in the slow-light regime of quantum well photonic crystal amplifiers. A strong gain enhancement is observed with the increase of the group refractive index, due to light slow-down. The slow light enhancement is shown in a amplified spontaneous emission....... These results are promising for short and efficient semiconductor optical amplifiers. This effect will also benefit other devices, such as mode locked lasers....

  17. Very broad bandwidth klystron amplifiers

    Science.gov (United States)

    Faillon, G.; Egloff, G.; Farvet, C.

    Large surveillance radars use transmitters at peak power levels of around one MW and average levels of a few kW, and possibly several tens of kW, in S band, or even C band. In general, the amplification stage of these transmitters is a microwave power tube, frequently a klystron. Although designers often turn to klystrons because of their good peak and average power capabilities, they still see them as narrow band amplifiers, undoubtedly because of their resonant cavities which, at first sight, would seem highly selective. But, with the progress of recent years, it has now become quite feasible to use these tubes in installations requiring bandwidths in excess of 10 - 12 percent, and even 15 percent, at 1 MW peak for example, in S-band.

  18. Hydraulically amplified PZT mems actuator

    Science.gov (United States)

    Miles, Robin R.

    2004-11-02

    A hydraulically amplified microelectromechanical systems actuator. A piece of piezoelectric material or stacked piezo bimorph is bonded or deposited as a thin film. The piece is operatively connected to a primary membrane. A reservoir is operatively connected to the primary membrane. The reservoir contains a fluid. A membrane is operatively connected to the reservoir. In operation, energizing the piezoelectric material causing the piezoelectric material to bow. Bowing of the piezoelectric material causes movement of the primary membrane. Movement of the primary membrane results in a force in being transmitted to the liquid in the reservoir. The force in the liquid causes movement of the membrane. Movement of the membrane results in an operating actuator.

  19. Transverse pumped laser amplifier architecture

    Science.gov (United States)

    Bayramian, Andrew James; Manes, Kenneth; Deri, Robert; Erlandson, Al; Caird, John; Spaeth, Mary

    2013-07-09

    An optical gain architecture includes a pump source and a pump aperture. The architecture also includes a gain region including a gain element operable to amplify light at a laser wavelength. The gain region is characterized by a first side intersecting an optical path, a second side opposing the first side, a third side adjacent the first and second sides, and a fourth side opposing the third side. The architecture further includes a dichroic section disposed between the pump aperture and the first side of the gain region. The dichroic section is characterized by low reflectance at a pump wavelength and high reflectance at the laser wavelength. The architecture additionally includes a first cladding section proximate to the third side of the gain region and a second cladding section proximate to the fourth side of the gain region.

  20. γ-rays from pair recombination in a travelling wave structure

    International Nuclear Information System (INIS)

    Bertolotti, M.; Sibilla, C.

    1978-01-01

    To obtain stimulated annihilation of pairs, two photon beams arriving from opposite directions are made to impinge with a region where e - - e + pairs are interacting, thus stimulating their recombination. At the exit of the interaction region photons are amplified by a factor β. The change in photon density is studied as a function of the length of the interaction region. The pair density needed to have a given gain is calculated and results to be proportional to log β 2 /(1+β)

  1. Design of an 1800nm Raman amplifier

    DEFF Research Database (Denmark)

    Svane, Ask Sebastian; Rottwitt, Karsten

    2013-01-01

    We present the experimental results for a Raman amplifier that operates at 1810 nm and is pumped by a Raman fiber laser at 1680 nm. Both the pump laser and the Raman amplifier is polarization maintaining. A challenge when scaling Raman amplifiers to longer wavelengths is the increase...... in transmission loss, but also the reduction in the Raman gain coefficient as the amplifier wavelength is increased. Both polarization components of the Raman gain is characterized, initially for linearly co-polarized signal and pump, subsequently linearly polarized orthogonal signal and pump. The noise...

  2. Reflection amplifiers in self-regulated learning

    NARCIS (Netherlands)

    Verpoorten, Dominique

    2012-01-01

    Verpoorten, D. (2012). Reflection amplifiers in self-regulated learning. Doctoral thesis. November, 9, 2012, Heerlen, The Netherlands: Open Universiteit (CELSTEC). Datawyse / Universitaire Pers Maastricht.

  3. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  4. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  5. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  6. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  7. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  8. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    Directory of Open Access Journals (Sweden)

    Alejandro Gonzalez-Martinez

    2015-01-01

    Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  9. Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters

    DEFF Research Database (Denmark)

    Wang, Z.; Durhuus, T.; Mikkelsen, Benny

    1994-01-01

    A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....

  10. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  11. Self-pulsation in Raman fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, Martin Erland Vestergaard; Ott, Johan Raunkjær; Rottwitt, Karsten

    2009-01-01

    Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated.......Dynamic behavior caused by Brillouin scattering in Raman fiber amplifiers is studied. Modes of self-pulsation steady state oscillations are found. Their dependence on amplification scheme is demonstrated....

  12. Pulse amplifier with high 'common mode rejection'

    International Nuclear Information System (INIS)

    Ijlst, P.

    1987-01-01

    The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)

  13. BROADBAND TRAVELLING WAVE SEMICONDUCTOR OPTICAL AMPLIFIER

    DEFF Research Database (Denmark)

    2010-01-01

    Broadband travelling wave semiconductor optical amplifier (100, 200, 300, 400, 800) for amplification of light, wherein the amplifier (100, 200, 300, 400, 800) comprises a waveguide region (101, 201, 301, 401, 801) for providing confinement of the light in transverse directions and adapted...

  14. Bevalac injector final stage RF amplifier upgrades

    International Nuclear Information System (INIS)

    Howard, D.; Calvert, J.; Dwinell, R.; Lax, J.; Lindner, A.; Richter, R.; Ridgeway, W.

    1991-01-01

    With the assistance of the DOE In-house Energy Management Program, the Bevalac injector final stage RF amplifier systems have been successfully upgraded to reduce energy consumption and operating costs. This recently completed project removed the energy-inefficient plate voltage modulator circuits that were used in conjunction with the final stage RF amplifiers. Construction, design, and operating parameters are described in detail

  15. Method for reducing snap in magnetic amplifiers

    Science.gov (United States)

    Fischer, R. L. E.; Word, J. L.

    1968-01-01

    Method of reducing snap in magnetic amplifiers uses a degenerative feedback circuit consisting of a resistor and a separate winding on a magnetic core. The feedback circuit extends amplifier range by allowing it to be used at lower values of output current.

  16. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  17. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  18. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. A fluidic/pneumatic interface amplifier

    Science.gov (United States)

    Limbert, D. E.; Kegel, T. M.

    The development of a low cost, reliable, linear pressure amplifier to interface Laminar Proportional Amplifiers (LPA) to pneumatic controllers is presented. The amplifier consists of an LPA input stage and an output stage consisting of a venturi in series with a bellows nozzle valve. The LPA output drives the bellows nozzle valve thereby altering the flowrate through the venturi. The pressure within the venturi throat region, which is the amplifier output, changes with the flowrate. Non-linear characteristics, due to supersonic flow within the venturi, are altered through the use of feedback to the LPA input. A computer based model, to aid in optimizing the amplifier design, is developed. This model incorporates the effects of shock waves and boundary layers within the venturi. Good correspondence between the model and an experimental prototype is shown.

  20. Amplified OTDR Systems for Multipoint Corrosion Monitoring

    Science.gov (United States)

    Nascimento, Jehan F.; Silva, Marcionilo J.; Coêlho, Isnaldo J. S.; Cipriano, Eliel; Martins-Filho, Joaquim F.

    2012-01-01

    We present two configurations of an amplified fiber-optic-based corrosion sensor using the optical time domain reflectometry (OTDR) technique as the interrogation method. The sensor system is multipoint, self-referenced, has no moving parts and can measure the corrosion rate several kilometers away from the OTDR equipment. The first OTDR monitoring system employs a remotely pumped in-line EDFA and it is used to evaluate the increase in system reach compared to a non-amplified configuration. The other amplified monitoring system uses an EDFA in booster configuration and we perform corrosion measurements and evaluations of system sensitivity to amplifier gain variations. Our experimental results obtained under controlled laboratory conditions show the advantages of the amplified system in terms of longer system reach with better spatial resolution, and also that the corrosion measurements obtained from our system are not sensitive to 3 dB gain variations. PMID:22737017

  1. An Implantable CMOS Amplifier for Nerve Signals

    DEFF Research Database (Denmark)

    Nielsen, Jannik Hammel; Lehmann, Torsten

    2001-01-01

    In this paper, a low noise high gain CMOS amplifier for minute nerve signals is presented. By using a mixture of weak- and strong inversion transistors, optimal noise suppression in the amplifier is achieved. A continuous-time offset-compensation technique is utilized in order to minimize impact...... on the amplifier input nodes. The method for signal recovery from noisy nerve signals is presented. A prototype amplifier is realized in a standard digital 0.5 μm CMOS single poly, n-well process. The prototype amplifier features a gain of 80 dB over a 3.6 kHz bandwidth, a CMRR of more than 87 dB and a PSRR...

  2. Bandwidth tunable amplifier for recording biopotential signals.

    Science.gov (United States)

    Hwang, Sungkil; Aninakwa, Kofi; Sonkusale, Sameer

    2010-01-01

    This paper presents a low noise, low power, bandwidth tunable amplifier for bio-potential signal recording applications. By employing depletion-mode pMOS transistor in diode configuration as a tunable sub pA current source to adjust the resistivity of MOS-Bipolar pseudo-resistor, the bandwidth is adjusted without any need for a separate band-pass filter stage. For high CMRR, PSRR and dynamic range, a fully differential structure is used in the design of the amplifier. The amplifier achieves a midband gain of 39.8dB with a tunable high-pass cutoff frequency ranging from 0.1Hz to 300Hz. The amplifier is fabricated in 0.18εm CMOS process and occupies 0.14mm(2) of chip area. A three electrode ECG measurement is performed using the proposed amplifier to show its feasibility for low power, compact wearable ECG monitoring application.

  3. Dual-range linearized transimpedance amplifier system

    Science.gov (United States)

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  4. Detection of Non-Amplified Genomic DNA

    CERN Document Server

    Corradini, Roberto

    2012-01-01

    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  5. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  6. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  7. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  8. Ultrafast disk lasers and amplifiers

    Science.gov (United States)

    Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha

    2012-03-01

    Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.

  9. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  10. A high-flux entanglement source based on a doubly resonant optical parametric amplifier

    International Nuclear Information System (INIS)

    Kuklewicz, Christopher E; Keskiner, Eser; Wong, Franco N C; Shapiro, Jeffrey H

    2002-01-01

    A 532 nm pumped type-II phase-matched, doubly resonant KTP optical parametric amplifier (OPA) was operated near frequency degeneracy to yield an inferred downconverted photon pair production rate of 1.7x10 6 s -1 at a pump power of 100 μW. The OPA output consisted of three components: narrowband doubly resonant mode pairs; narrowband singly resonant mode pairs for which either the signal or idler was resonant with the cavity and broadband nonresonant mode pairs. Under frequency-degenerate operation, the broadband nonresonant mode pairs were polarization triplet states. We observed quantum interference between the orthogonally polarized photons of the triplet states when they were analysed with a polarizer set at 45 deg. relative to the OPA's output polarizations, leading to reduced coincidence counts

  11. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  12. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  13. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  14. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  15. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  16. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.

    Science.gov (United States)

    Hirao, Ichiro; Kimoto, Michiko

    2012-01-01

    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  17. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  18. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  19. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  20. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  1. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  2. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  3. Primers for Low-Copy Nuclear Genes in the Hawaiian Endemic Clermontia (Campanulaceae and Cross-Amplification in Lobelioideae

    Directory of Open Access Journals (Sweden)

    Yohan Pillon

    2013-06-01

    Full Text Available Premise of the study: Primers were developed to amplify 12 intron-less, low-copy nuclear genes in the Hawaiian genus Clermontia (Campanulaceae, a suspected tetraploid. Methods and Results: Data from a pooled 454 titanium run of the partial transcriptomes of seven Clermontia species were used to identify the loci of interest. Most loci were amplified and sequenced directly with success in a representative selection of lobeliads even though several of these loci turned out to be duplicated. Levels of variation were comparable to those observed in commonly used plastid and ribosomal markers. Conclusions: We found evidence of a genome duplication that likely predates the diversification of the Hawaiian lobeliads. Some genes nevertheless appear to be single-copy and should be useful for phylogenetic studies of Clermontia or the entire Lobelioideae subfamily.

  4. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  5. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  6. Phase noise in RF and microwave amplifiers.

    Science.gov (United States)

    Boudot, Rodolphe; Rubiola, Enrico

    2012-12-01

    Understanding amplifier phase noise is a critical issue in many fields of engineering and physics, such as oscillators, frequency synthesis, telecommunication, radar, and spectroscopy; in the emerging domain of microwave photonics; and in exotic fields, such as radio astronomy, particle accelerators, etc. Focusing on the two main types of base noise in amplifiers, white and flicker, the power spectral density of the random phase φ(t) is Sφ(f) = b(0) + b(-1)/f. White phase noise results from adding white noise to the RF spectrum in the carrier region. For a given RF noise level, b(0) is proportional to the reciprocal of the carrier power P(0). By contrast, flicker results from a near-dc 1/f noise-present in all electronic devices-which modulates the carrier through some parametric effect in the semiconductor. Thus, b(-1) is a parameter of the amplifier, constant in a wide range of P(0). The consequences are the following: Connecting m equal amplifiers in parallel, b(-1) is 1/m times that of one device. Cascading m equal amplifiers, b(-1) is m times that of one amplifier. Recirculating the signal in an amplifier so that the gain increases by a power of m (a factor of m in decibels) as a result of positive feedback (regeneration), we find that b(-1) is m(2) times that of the amplifier alone. The feedforward amplifier exhibits extremely low b(-1) because the carrier is ideally nulled at the input of its internal error amplifier. Starting with an extensive review of the literature, this article introduces a system-oriented model which describes the phase flickering. Several amplifier architectures (cascaded, parallel, etc.) are analyzed systematically, deriving the phase noise from the general model. There follow numerous measurements of amplifiers using different technologies, including some old samples, and in a wide frequency range (HF to microwaves), which validate the theory. In turn, theory and results provide design guidelines and give suggestions for CAD and

  7. Simulations of longitudinally pumped dye laser amplifier

    International Nuclear Information System (INIS)

    Takehisa, Kiwamu; Takemori, Satoshi

    1995-01-01

    Simulations of a copper laser pumped dye laser amplifier and new designs of the longitudinally pumped dye laser amplifier are presented. The simulations take the consideration of the amplified spontaneous emission (ASE). The new designs utilize a center-hole reflector instead of a dichroic mirror. The simulation results indicate that the poor spatial overlap between the pump beam and the dye beam in the transverse pumping not only reduces the laser output power, but also generates ASE strongly. The results also indicate that the longitudinal pumping is as efficient as the transverse pumping. (author)

  8. A parallel input composite transimpedance amplifier

    Science.gov (United States)

    Kim, D. J.; Kim, C.

    2018-01-01

    A new approach to high performance current to voltage preamplifier design is presented. The design using multiple operational amplifiers (op-amps) has a parasitic capacitance compensation network and a composite amplifier topology for fast, precision, and low noise performance. The input stage consisting of a parallel linked JFET op-amps and a high-speed bipolar junction transistor (BJT) gain stage driving the output in the composite amplifier topology, cooperating with the capacitance compensation feedback network, ensures wide bandwidth stability in the presence of input capacitance above 40 nF. The design is ideal for any two-probe measurement, including high impedance transport and scanning tunneling microscopy measurements.

  9. Fundamentals of RF and microwave transistor amplifiers

    CERN Document Server

    Bahl, Inder J

    2009-01-01

    A Comprehensive and Up-to-Date Treatment of RF and Microwave Transistor Amplifiers This book provides state-of-the-art coverage of RF and microwave transistor amplifiers, including low-noise, narrowband, broadband, linear, high-power, high-efficiency, and high-voltage. Topics covered include modeling, analysis, design, packaging, and thermal and fabrication considerations. Through a unique integration of theory and practice, readers will learn to solve amplifier-related design problems ranging from matching networks to biasing and stability. More than 240 problems are included to help read

  10. Quantum electronics maser amplifiers and oscillators

    CERN Document Server

    Fain, V M; Sanders, J H

    2013-01-01

    Quantum Electronics, Volume 2: Maser Amplifiers and Oscillators deals with the experimental and theoretical aspects of maser amplifiers and oscillators which are based on the principles of quantum electronics. It shows how the concepts and equations used in quantum electronics follow from the basic principles of theoretical physics.Comprised of three chapters, this volume begins with a discussion on the elements of the theory of quantum oscillators and amplifiers working in the microwave region, along with the practical achievements in this field. Attention is paid to two-level paramagnetic ma

  11. Unconditionally stable microwave Si-IMPATT amplifiers

    International Nuclear Information System (INIS)

    Seddik, M.M.

    1986-07-01

    The purpose of this investigation has been the development of an improved understanding of the design and analysis of microwave reflection amplifiers employing the negative resistance property of the IMPATT devices. Unconditionally stable amplifier circuit using a Silicon IMPATT diode is designed. The problems associated with the design procedures and the stability criterion are discussed. A computer program is developed to perform the computations. The stable characteristics of a reflection-type Si-IMPATT amplifier, such as gain, frequency and bandwidth are examined. It was found that at large signal drive levels, 7 dB gain with bandwidth of 800 MHz at 22,5 mA was obtained. (author)

  12. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    Science.gov (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  13. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  14. Characterization and multiplexing of EST-SSR primers in Cynodon (Poaceae) species1.

    Science.gov (United States)

    Jewell, Margaret C; Frere, Celine H; Prentis, Peter J; Lambrides, Christopher J; Godwin, Ian D

    2010-10-01

    Cynodon species are multiple-use grasses that display varying levels of adaptation to biotic and abiotic stress. Previously identified EST-SSR primers were characterized and multiplexed to assess the level of genetic diversity present within a collection of almost 1200 Cynodon accessions from across Australia. • Two multiplex reactions were developed comprising a total of 16 EST-SSR markers. All SSR markers amplified across different Cynodon species and different levels of ploidy. The number of alleles ranged from one to eight per locus and the total number of alleles for the germplasm collection was 79. • The 16 markers show sufficient variation for the characterization of Cynodon core collections and analysis of population genetic diversity in Cynodon grasses.

  15. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  16. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine.

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard

    2012-11-01

    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  17. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine†

    Science.gov (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard

    2012-01-01

    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  18. Automatic error compensation in dc amplifiers

    International Nuclear Information System (INIS)

    Longden, L.L.

    1976-01-01

    When operational amplifiers are exposed to high levels of neutron fluence or total ionizing dose, significant changes may be observed in input voltages and currents. These changes may produce large errors at the output of direct-coupled amplifier stages. Therefore, the need exists for automatic compensation techniques. However, previously introduced techniques compensate only for errors in the main amplifier and neglect the errors induced by the compensating circuitry. In this paper, the techniques introduced compensate not only for errors in the main operational amplifier, but also for errors induced by the compensation circuitry. Included in the paper is a theoretical analysis of each compensation technique, along with advantages and disadvantages of each. Important design criteria and information necessary for proper selection of semiconductor switches will also be included. Introduced in this paper will be compensation circuitry for both resistive and capacitive feedback networks

  19. Stimulated Brillouin scattering threshold in fiber amplifiers

    International Nuclear Information System (INIS)

    Liang Liping; Chang Liping

    2011-01-01

    Based on the wave coupling theory and the evolution model of the critical pump power (or Brillouin threshold) for stimulated Brillouin scattering (SBS) in double-clad fiber amplifiers, the influence of signal bandwidth, fiber-core diameter and amplifier gain on SBS threshold is simulated theoretically. And experimental measurements of SBS are presented in ytterbium-doped double-clad fiber amplifiers with single-frequency hundred nanosecond pulse amplification. Under different input signal pulses, the forward amplified pulse distortion is observed when the pulse energy is up to 660 nJ and the peak power is up to 3.3 W in the pulse amplification with pulse duration of 200 ns and repetition rate of 1 Hz. And the backward SBS narrow pulse appears. The pulse peak power equals to SBS threshold. Good agreement is shown between the modeled and experimental data. (authors)

  20. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  1. Behavior of MOSFET Amplifier in Radiation Fields

    International Nuclear Information System (INIS)

    Sharshar, K.A.A.; Ashry, M.

    2000-01-01

    MOSFET type 2 N 3823 characteristics and its application as an amplifier are analyzed including the effects of gamma, electron beam 1.5 MeV 25 m A and neutron flux. The 1-V characteristics, transfer curve, and the frequency response of the amplifier, and the amplification factor(A v 0 are discussed with MOSFET circuit parameters. The drain current and the amplitude of the output signal decrease as the absorbed dose increases. The measured values of the amplified signal are attenuated by 30% and 6% after exposing the MOSFET to gamma radiation and electron beam at the same dose respectively. Also for exposure to 4x10 13 N/cm 3 neutrons decreased the measured value of the amplified signal by 73% of the initial values. The decrease in the gain of the MOSFET is due to the degradation of the transconductance. It is also noticed that percentage of the decrease depends on the type of radiation

  2. Quantum-Limited Directional Amplifiers with Optomechanics

    Science.gov (United States)

    Malz, Daniel; Tóth, László D.; Bernier, Nathan R.; Feofanov, Alexey K.; Kippenberg, Tobias J.; Nunnenkamp, Andreas

    2018-01-01

    Directional amplifiers are an important resource in quantum-information processing, as they protect sensitive quantum systems from excess noise. Here, we propose an implementation of phase-preserving and phase-sensitive directional amplifiers for microwave signals in an electromechanical setup comprising two microwave cavities and two mechanical resonators. We show that both can reach their respective quantum limits on added noise. In the reverse direction, they emit thermal noise stemming from the mechanical resonators; we discuss how this noise can be suppressed, a crucial aspect for technological applications. The isolation bandwidth in both is of the order of the mechanical linewidth divided by the amplitude gain. We derive the bandwidth and gain-bandwidth product for both and find that the phase-sensitive amplifier has an unlimited gain-bandwidth product. Our study represents an important step toward flexible, on-chip integrated nonreciprocal amplifiers of microwave signals.

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  4. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  6. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  7. Optimal control of a high-frequency class-D amplifier

    DEFF Research Database (Denmark)

    Dahl, Nicolai J.; Iversen, Niels Elkjær; Knott, Arnold

    2018-01-01

    Control loops have been used with switch-mode audio amplifiers to improve the sound quality of the amplifier. Because these amplifiers use a high-frequency modulation, precautions in the controller design must be taken. Further, the quality factor of the output filter can have a great impact...... on the controller's capabilities to suppress noise and track the audio signal. In this paper design methods for modern control are presented. The control method proves to easily overcome the challenge of designing a good performing controller when the output filter has a high quality factor. The results show...... that the controller is able to produce a clear improvement in the Total Harmonic Distortion with up to a 30 times improvement compared to open-loop with a clear reduction in the noise. This places the audio quality on pair with current solutions....

  8. Stability investigation for InP DHBT mm‐wave power amplifier

    DEFF Research Database (Denmark)

    Yan, Lei; Johansen, Tom Keinicke; Kammersgaard, Jacob

    2013-01-01

    microwave integrated circuit power amplifier. Experimental results from a redesigned power amplifier with improved stability are presented to confirm that the previously detected oscillation loop is removed using odd‐mode stabilization resistors with the correct choice of values and locations. © 2012 Wiley......In this article, we discuss stability issues for mm‐wave monolithic integrated power amplifiers using InP double heterojunction bipolar transistor (DHBT) technology targeting E‐band applications at 71–76 GHz and 81–86 GHz. Different stability detection methods based on the classical two‐port K......‐Δs pair, linear three‐port graphical analysis, system identifications, circuit modal analysis, and normalized determinant function are all reviewed. The corresponding techniques are employed to predict the occurrence of instability at 15 GHz observed during measurements on a fabricated monolithic...

  9. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  10. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  11. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.

    1993-01-01

    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  12. Manhattan equation for the operational amplifier

    OpenAIRE

    Mishonov, Todor M.; Danchev, Victor I.; Petkov, Emil G.; Gourev, Vassil N.; Dimitrova, Iglika M.; Varonov, Albert M.

    2018-01-01

    A differential equation relating the voltage at the output of an operational amplifier $U_0$ and the difference between the input voltages ($U_{+}$ and $U_{-}$) has been derived. The crossover frequency $f_0$ is a parameter in this operational amplifier master equation. The formulas derived as a consequence of this equation find applications in thousands of specifications for electronic devices but as far as we know, the equation has never been published. Actually, the master equation of oper...

  13. Distributed amplifier using Josephson vortex flow transistors

    International Nuclear Information System (INIS)

    McGinnis, D.P.; Beyer, J.B.; Nordman, J.E.

    1986-01-01

    A wide-band traveling wave amplifier using vortex flow transistors is proposed. A vortex flow transistor is a long Josephson junction used as a current controlled voltage source. The dual nature of this device to the field effect transistor is exploited. A circuit model of this device is proposed and a distributed amplifier utilizing 50 vortex flow transistors is predicted to have useful gain to 100 GHz

  14. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  15. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  16. Multiple excitation regenerative amplifier inertial confinement system

    International Nuclear Information System (INIS)

    George, V.E.; Haas, R.A.; Krupke, W.F.; Schlitt, L.G.

    1980-01-01

    The invention relates to apparatus and methods for producing high intensity laser radiation generation which is achieved through an optical amplifier-storage ring design. One or two synchronized, counterpropagating laser pulses are injected into a regenerative amplifier cavity and amplified by gain media which are pumped repetitively by electrical or optical means. The gain media excitation pulses are tailored to efficiently amplify the laser pulses during each transit. After the laser pulses have been amplified to the desired intensity level, they are either switched out of the cavity by some switch means, as for example an electro-optical device, for any well known laser end uses, or a target means may be injected into the regenerative amplifier cavity in such a way as to intercept simultaneously the counterpropagating laser pulses. One such well known end uses to which this invention is intended is for production of high density and temperature plasmas suitable for generating neutrons, ions and x-rays and for studying matter heated by high intensity laser radiation

  17. An Electronically Tunable Transconductance Amplifier for Use in Auditory Prostheses

    Directory of Open Access Journals (Sweden)

    FARAGO, P.

    2015-11-01

    Full Text Available Low-voltage and low-power trends in analog electronics enable novel features in modern bio-medical devices, such as extensive portability, autonomy and even battery-less operation. One specific example is the cochlear implant (CI, which emulates the physiology of hearing to produce auditory sensations via neural stimulation. Besides low-voltage and low-power operation, a key feature in modern CIs is wide-range programmability of the speech processing parameters. This paper proposes an operational transconductance amplifier (OTA for use in CIs, with wide-range electronic tuning of the transconductance value. The proposed OTA is developed around a cascade of two transconductor stages, making the transconductance dependent on the bias current ratio. A combination of linearization techniques: bulk input, parallel differential pairs and feedback, is used to achieve sufficient linear range for CI speech processing. Wide-range parameter tuning of the speech processing sections is illustrated on a variable gain amplifier, a bandpass Tow-Thomas biquad and an envelope detector. Finally, the complete CI speech processing chain is illustrated. The proposed OTA and its employment in CI analog speech processing are validated on a 350 nm CMOS process.

  18. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  19. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  20. Coulomb pair-creation

    International Nuclear Information System (INIS)

    Hrasko, P.; Foeldy, L.; Toth, A.

    1986-07-01

    Electron-positron pair production in strong Coulomb fields is outlined. It is shown that the singular behaviour of the adiabatic basis can be removed if solutions of the time dependent external field Dirac equation are used as a basis to expand the fermion field operator. This latter 'asymptotic basis' makes it possible to introduce Feynman-propagator. Applying the reduction technique, the computation of all of the basic quantities can be reduced to the solution of an integral equation. The positron spectrum for separable potential model with Lorentzian time dependence and for potential jump is analyzed in the pole approximation. (author)

  1. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    2001-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  2. Au pairs on Facebook

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2016-01-01

    Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...

  3. Development and detection efficiency of sequence characterized amplified region markers for authentication of medicinal plant Ruta graveolens and its adulterant Euphorbia dracunculoides

    Directory of Open Access Journals (Sweden)

    Irum Gul

    2016-01-01

    Full Text Available Background: With the increase in demand of herbal medicines, adulteration in these drugs is also gaining momentum and remains an indispensable problem in domestic and export markets. Correct identification is the first step toward assuring quality, safety, and efficacy of indigenous herbal medicines. Materials and Methods: In this study, sequence characterized amplified region (SCAR markers were developed to discriminate Ruta graveolens from its adulterant Euphorbia dracunculoides. Random amplified polymorphic DNA (RAPD was performed and subsequently converted into SCAR markers. Results: After performing RAPD, SCAR primers were designed from the selected unique RAPD amplicons of the genuine drug as well as its adulterant. These primers produced 670 bp and 750 bp SCAR markers with genomic DNA sample of R. graveolens and E. dracunculoides, respectively. Conclusion: Development of these markers will help in the quality control of herbal drugs and monitoring widespread adulteration of these drugs by pharmaceutical industries and government agencies.

  4. Characterization of specific random amplified polymorphic (RAPD ...

    African Journals Online (AJOL)

    toshiba

    2013-04-10

    Apr 10, 2013 ... GGG CCA CTG T. 8. 8. 0. 97. OPY-20. AGC CGT GGA A. 7. 7. 0. 98. OPZ-13. GAC TAA GCC C. 0. 0. 0 fingerprinting differentiation was combined with bulked segregant analysis (Michelmore, et al. 1991). A total of. 98 operon RAPD primers (Almaeda, USA) were used in the first step differential screening in ...

  5. Optogenetic Excitation of Central Amygdala Amplifies and Narrows Incentive Motivation to Pursue One Reward Above Another

    OpenAIRE

    Robinson, Mike J.F.; Warlow, Shelley M.; Berridge, Kent C.

    2014-01-01

    Choosing one reward above another is important for achieving adaptive life goals. Yet hijacked into excessive intensity in disorders such as addiction, single-minded pursuit becomes maladaptive. Here, we report that optogenetic channelrhodopsin stimulation of neurons in central nucleus of amygdala (CeA), paired with earning a particular sucrose reward in rats, amplified and narrowed incentive motivation to that single reward target. Therefore, CeA rats chose and intensely pursued only the las...

  6. Readout ASIC of pair-monitor for international linear collider

    International Nuclear Information System (INIS)

    Sato, Yutaro; Ikeda, Hirokazu; Ito, Kazutoshi; Miyamoto, Akiya; Nagamine, Tadashi; Sasaki, Rei; Takubo, Yosuke; Tauchi, Toshiaki; Yamamoto, Hitoshi

    2010-01-01

    The pair-monitor is a beam profile monitor at the interaction point of the international linear collider. A prototype of the readout ASIC for the pair-monitor has been designed and tested. Since the pair-monitor uses the hit distribution of electrons and positrons generated by the beam-crossing to measure the beam profile, the readout ASIC is designed to count the number of hits. In a prototype ASIC, 36 readout cells were implemented by TSMC 0.25-μm CMOS process. Each readout cell is equipped with an amplifier, comparator, 8-bit counter and 16 count-registers. By the operation test, all the ASIC component were confirmed to work correctly. As the next step, we develop the prototype ASIC with the silicon on insulator technology. It is produced with OKI 0.2-μm FD-SOI CMOS process.

  7. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  8. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  9. Assessing Intimacy: The Pair Inventory.

    Science.gov (United States)

    Schaefer, Mark T.; Olson, David H.

    1981-01-01

    Personal Assessment of Intimacy in Relationships (PAIR) provides systematic information in five types of intimacy: emotional, social, sexual, intellectual and recreational. PAIR can be used with couples in marital therapy and enrichment groups. (Author)

  10. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  11. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  12. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  13. QSO Pairs across Active Galaxies

    Indian Academy of Sciences (India)

    2016-01-27

    Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...

  14. Advances in high-power rf amplifiers

    International Nuclear Information System (INIS)

    Tallerico, P.J.

    1979-01-01

    Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems

  15. Transpermeance Amplifier Applied to Magnetic Bearings

    Directory of Open Access Journals (Sweden)

    Jossana Ferreira

    2017-02-01

    Full Text Available The most conventional approach of controlling magnetic forces in active magnetic bearings (AMBs is through current feedback amplifiers: transconductance. This enables the operation of the AMB to be understood in terms of a relatively simple current-based model as has been widely reported on in the literature. The alternative notion of using transpermeance amplifiers, which approximate the feedback of gap flux rather than current, has been in commercial use in some form for at least thirty years, however is only recently seeing more widespread acceptance as a commercial standard. This study explores how such alternative amplifiers should be modeled and then examines the differences in behavior between AMBs equipped with transconductance and transpermeance amplifiers. The focus of this study is on two aspects. The first is the influence of rotor displacement on AMB force, commonly modeled as a constant negative equivalent mechanical stiffness, and it is shown that either scheme actually leads to a finite bandwidth effect, but that this bandwidth is much lower when transpermeance is employed. The second aspect is the influence of eddy currents. Using a very simple model of eddy currents (a secondary short-circuited coil, it is demonstrated that transpermeance amplifiers can recover significant actuator bandwidth compared with transconductance, but at the cost of needing increased peak current headroom.

  16. Pairing in hadron structure

    International Nuclear Information System (INIS)

    Chela-Flores, J.

    1981-08-01

    A many-body approach to hadron structure is presented, in which we consider two parton species: spin-0 (b-partons), and spin-1/2 (f-partons). We extend a boson and a fermion pairing scheme for the b-, and f-partons respectively, into a Yang-Mills gauge theory. The main feature of this theory is that the gauge field is not identified with the usual gluon field variable in QCD. We study the confinement problem of the hadron constituents, and obtain, for low temperatures, partons that are confined by energy gaps. As the critical temperatures for the corresponding phase transitions are approached, the energy gap gradually disappears, and confinement is lost. The theory goes beyond the non-relativistic harmonic oscillator quark model, in the sense of giving physical reasons why a non-relativistic approximation is adequate in describing the internal dynamics of hadron structure. (author)

  17. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  18. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  19. Wideband Low Noise Amplifiers Exploiting Thermal Noise Cancellation

    NARCIS (Netherlands)

    Bruccoleri, F.; Klumperink, Eric A.M.; Nauta, Bram

    2005-01-01

    Low Noise Amplifiers (LNAs) are commonly used to amplify signals that are too weak for direct processing for example in radio or cable receivers. Traditionally, low noise amplifiers are implemented via tuned amplifiers, exploiting inductors and capacitors in resonating LC-circuits. This can render

  20. Solid-state disk amplifiers for fusion-laser systems

    Energy Technology Data Exchange (ETDEWEB)

    Martin, W.E.; Trenholme, J.B.; Linford, G.J.; Yarema, S.M.; Hurley, C.A.

    1981-09-01

    We review the design, performance, and operation of large-aperture (10 to 46 cm) solid-state disk amplifiers for use in laser systems. We present design data, prototype tests, simulations, and projections for conventional cylindrical pump-geometry amplifiers and rectangular pump-geometry disk amplifiers. The design of amplifiers for the Nova laser system is discussed.

  1. The design of high performance weak current integrated amplifier

    International Nuclear Information System (INIS)

    Chen Guojie; Cao Hui

    2005-01-01

    A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)

  2. Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques

    NARCIS (Netherlands)

    Acar, M.

    2011-01-01

    In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high

  3. Design considerations for RF power amplifiers demonstrated through a GSM/EDGE power amplifier module

    NARCIS (Netherlands)

    Baltus, P.G.M.; Bezooijen, van A.; Huijsing, J.H.; Steyaert, M.; Roermund, van A.H.M.

    2002-01-01

    This paper describes the design considerations for RF power amplifiers in general, including trends in systems, linearity and efficiency, the PA environment, implementation is sues and technology. As an example a triple-band (900/1800/1900MHz) dual mode (GSMIEdge) power amplifier module is described

  4. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  5. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  6. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  7. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  8. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  9. Wideband pulse amplifiers for the NECTAr chip

    Science.gov (United States)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J.-F.; Naumann, C. L.; Nayman, P.; Ribó, M.; Tavernet, J.-P.; Toussenel, F.; Vincent, P.; Vorobiov, S.

    2012-12-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  10. Wideband pulse amplifiers for the NECTAr chip

    International Nuclear Information System (INIS)

    Sanuy, A.; Delagnes, E.; Gascon, D.; Sieiro, X.; Bolmont, J.; Corona, P.; Feinstein, F.; Glicenstein, J-F.; Naumann, C.L.; Nayman, P.; Ribó, M.

    2012-01-01

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1–3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  11. Wideband pulse amplifiers for the NECTAr chip

    Energy Technology Data Exchange (ETDEWEB)

    Sanuy, A., E-mail: asanuy@ecm.ub.es [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Delagnes, E. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Gascon, D. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Sieiro, X. [Departament d' Electronica, Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); Bolmont, J.; Corona, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Feinstein, F. [LUPM, Universite Montpellier II and IN2P3/CNRS, CC072, bat. 13, place Eugene Bataillon, 34095 Montpellier (France); Glicenstein, J-F. [IRFU/DSM/CEA, CE-Saclay, Bat. 141 SEN Saclay, F-91191, Gif-sur-Yvette (France); Naumann, C.L.; Nayman, P. [LPNHE, Universite Paris VI and Universite Paris VII and IN2P3/CNRS, Barre 12-22, 1er etage, 4 place Jussieu, 75252 Paris (France); Ribo, M. [Dept. AM i Dept. ECM, Institut de Ciencies del Cosmos (ICC), Universitat de Barcelona. Marti i Franques 1, E08028, Barcelona (Spain); and others

    2012-12-11

    The NECTAr collaboration's FE option for the camera of the CTA is a 16 bits and 1-3 GS/s sampling chip based on analog memories including most of the readout functions. This works describes the input amplifiers of the NECTAr ASIC. A fully differential wideband amplifier, with voltage gain up to 20 V/V and a BW of 400 MHz. As it is impossible to design a fully differential OpAmp with an 8 GHz GBW product in a 0.35 CMOS technology, an alternative implementation based on HF linearized transconductors is explored. The output buffer is a class AB miller operational amplifier, with special non-linear current boost.

  12. An automated test facility for neutronic amplifiers

    International Nuclear Information System (INIS)

    Beattie, W.J.

    1997-01-01

    Neutronic amplifiers are used at the Chalk River Laboratory in applications such as neutron flux monitoring and reactor control systems. Routine preventive maintenance of control and safety systems included annual calibration and characterization of the neutronic amplifiers. An investigation into the traditional methods of annual routine maintenance of amplifiers concluded that frequency and phase response measurements in particular were labour intensive and subject to non-repeatable errors. A decision was made to upgrade testing methods and facilities by using programmable test equipment under the control of a computer. In order to verify the results of the routine measurements, expressions for the transfer functions were derived from the circuit diagrams. Frequency and phase responses were then calculated and plotted thus providing a bench-mark to which the test results can be compared. (author)

  13. A high-efficiency superconductor distributed amplifier

    Energy Technology Data Exchange (ETDEWEB)

    Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)

    2010-02-15

    A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)

  14. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  15. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  16. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  17. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  18. Noise figure of amplified dispersive Fourier transformation

    International Nuclear Information System (INIS)

    Goda, Keisuke; Jalali, Bahram

    2010-01-01

    Amplified dispersive Fourier transformation (ADFT) is a powerful tool for fast real-time spectroscopy as it overcomes the limitations of traditional optical spectrometers. ADFT maps the spectrum of an optical pulse into a temporal waveform using group-velocity dispersion and simultaneously amplifies it in the optical domain. It greatly simplifies spectroscopy by replacing the diffraction grating and detector array in the conventional spectrometer with a dispersive fiber and single-pixel photodetector, enabling ultrafast real-time spectroscopic measurements. Following our earlier work on the theory of ADFT, here we study the effect of noise on ADFT. We derive the noise figure of ADFT and discuss its dependence on various parameters.

  19. Predistortion of a Bidirectional Cuk Audio Amplifier

    DEFF Research Database (Denmark)

    Birch, Thomas Hagen; Nielsen, Dennis; Knott, Arnold

    2014-01-01

    Some non-linear amplifier topologies are capable of providing a larger voltage gain than one from a DC source, which could make them suitable for various applications. However, the non-linearities introduce a significant amount of harmonic distortion (THD). Some of this distortion could be reduced...... using predistortion. This paper suggests linearizing a nonlinear bidirectional Cuk audio amplifier using an analog predistortion approach. A prototype power stage was built and results show that a voltage gain of up to 9 dB and reduction in THD from 6% down to 3% was obtainable using this approach....

  20. Cryogenic transimpedance amplifier for micromechanical capacitive sensors.

    Science.gov (United States)

    Antonio, D; Pastoriza, H; Julián, P; Mandolesi, P

    2008-08-01

    We developed a cryogenic transimpedance amplifier that works at a broad range of temperatures, from room temperature down to 4 K. The device was realized with a standard complementary metal oxide semiconductor 1.5 mum process. Measurements of current-voltage characteristics, open-loop gain, input referred noise current, and power consumption are presented as a function of temperature. The transimpedance amplifier has been successfully applied to sense the motion of a polysilicon micromechanical oscillator at low temperatures. The whole device is intended to serve as a magnetometer for microscopic superconducting samples.

  1. Dynamic range meter for radiofrequency amplifiers

    Directory of Open Access Journals (Sweden)

    Drozd S. S.

    2009-04-01

    Full Text Available The new measurement setup having increased on 20…30 dB the own dynamic range in comparison with the standard circuit of the dynamic range meter is offered and the rated value of an error bringing by setup in the worst case does not exceed ± 2,8 dB. The measurement setup can be applied also to determinate levels of intermodulation components average power amplifiers and powerful amplifiers of a low-frequency at replacement of the quartz filter on meeting low-frequency the LC-filter and the spectrum analyzer.

  2. Optimization of a high efficiency FEL amplifier

    International Nuclear Information System (INIS)

    Schneidmiller, E.A.; Yurkov, M.V.

    2014-10-01

    The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.

  3. Operational amplifier circuits analysis and design

    CERN Document Server

    Nelson, J C C

    1995-01-01

    This book, a revised and updated version of the author's Basic Operational Amplifiers (Butterworths 1986), enables the non-specialist to make effective use of readily available integrated circuit operational amplifiers for a range of applications, including instrumentation, signal generation and processing.It is assumed the reader has a background in the basic techniques of circuit analysis, particularly the use of j notation for reactive circuits, with a corresponding level of mathematical ability. The underlying theory is explained with sufficient but not excessive, detail. A range of compu

  4. Cavity enhanced rephased amplified spontaneous emission

    International Nuclear Information System (INIS)

    A Williamson, Lewis; J Longdell, Jevon

    2014-01-01

    Amplified spontaneous emission is usually treated as an incoherent noise process. Recent theoretical and experimental work using rephasing optical pulses has shown that rephased amplified spontaneous emission (RASE) is a potential source of wide bandwidth time-delayed entanglement. Due to poor echo efficiency the plain RASE protocol does not in theory achieve perfect entanglement. Experiments done to date show a very small amount of entanglement at best. Here we show that RASE can, in principle, produce perfect multimode time-delayed two mode squeezing when the active medium is placed inside a Q-switched cavity. (paper)

  5. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  6. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  7. Hybrid amplifier for calorimetry with photodiode readout

    Energy Technology Data Exchange (ETDEWEB)

    Sushkov, V V

    1994-12-31

    A hybrid surface mounted amplifier for the photodiode readout of the EM calorimeter has been developed. The main technical characteristics of the design are presented. The design able to math readout constraints for a high luminosity collider experiment is discussed. 10 refs., 2 tabs., 8 figs.

  8. Amplifier Design for Proportional Ionization Chambers

    Energy Technology Data Exchange (ETDEWEB)

    Baker, W. H.

    1950-08-24

    This paper presents the requirements of a nuclear amplifier of short resolving time, designed to accept pulses of widely varying amplitudes. Data are given which show that a proportional ionization chamber loaded with a 1,000-ohm resistor develops pulses of 0.5 microsecond duration and several volts amplitude. Results indicate that seven basic requirements are imposed on the amplifier when counting soft beta and gamma radiation in the presence of alpha particles, without absorbers. It should, (1) have a fast recovery time, (2) have a relatively good low frequency response, (3) accept pulses of widely varying heights without developing spurious pulsed, (4) have a limiting output stage, (5) preserve the inherently short rise time of the chamber, (6) minimize pulse integration, and (7) have sufficient gain to detect the weak pulses well below the chamber voltage at which continuous discharge takes place. The results obtained with an amplifier which meets these requirements is described. A formula is derived which indicates that redesign of the proportional ionization chamber might eliminate the need for an amplifier. This may be possible if the radioactive particles are collimated parallel to the collecting electrode.

  9. Methylation sensitive amplified polymorphism (MSAP) reveals that ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... Key words: Salt stress, alkali stress, Gossypium hirsutum L., DNA methylation, methylation sensitive amplified polymorphism (MSAP). INTRODUCTION. DNA methylation is one of the key epigenetic mecha- nisms among eukaryotes that can modulate gene expression without the changes of DNA sequence.

  10. Enhanced timing channel for spectroscopy amplifiers

    Energy Technology Data Exchange (ETDEWEB)

    Ianakiev, K; Grigorov, N [Inst. for Nuclear Research and Nuclear Energy, Sofia (Bulgaria)

    1996-12-31

    Purpose of this paper is to analyze noise and timing performance of some methods of filtering in the fast channel. Implementation of RLC-filter into a semi-Gaussian amplifier allows to obtain the time resolution of 420 ns. 5 refs.

  11. Optimization of Pr3+:ZBLAN fiber amplifiers

    DEFF Research Database (Denmark)

    Pedersen, B.; Miniscalco, J. W.; Quimby, R. S.

    1992-01-01

    Experimental parameters have been measured and used in a quantitative model of Pr3+-doped fluorozirconate fiber amplifiers. The optimum cutoff wavelength was determined to be 800 nm and the gain for 400 mW of pump was found to increase from 12 to 34 dB if the NA was increased from 0.15 to 0...

  12. Reducing Switching Artifacts in Chopper Amplifiers

    NARCIS (Netherlands)

    Kusuda, Y.

    2018-01-01

    This thesis describes the theory, design, and implementation of chopper operational amplifiers (op-amps) in CMOS integrated circuits (ICs). The chopping technique periodically corrects DC errors of such op-amps, so that low 1/f noise and stable, microvolt-level offset can be achieved. However,

  13. High-Performance Operational and Instrumentation Amplifiers

    NARCIS (Netherlands)

    Shahi, B.

    2015-01-01

    This thesis describes techniques to reduce the offset error in precision instrumentation and operational amplifiers. The offset error which is considered a major error source associated with gain blocks, together with other errors are reviewed. Conventional and newer approaches to remove offset and

  14. SINGLE CONVERSION ISOLATED IMPEDANCE TRANSFORMATION AMPLIFIER

    DEFF Research Database (Denmark)

    2003-01-01

    The invention relates to a switch mode power amplifier. A first and a second change-over switch are inserted between a DC voltage supply and a primary side of an isolation transformer. Two secondary windings are connected to a power output terminal. A first and a second secondary side power switc...

  15. Feedback analysis of transimpedance operational amplifier circuits

    DEFF Research Database (Denmark)

    Bruun, Erik

    1993-01-01

    The transimpedance or current feedback operational amplifier (CFB op-amp) is reviewed and compared to a conventional voltage mode op-amp using an analysis emphasizing the basic feedback characteristics of the circuit. With this approach the paradox of the constant bandwidth obtained from CFB op...

  16. Random amplified polymorphic DNA based genetic characterization ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA based genetic characterization of four important species of Bamboo, found in Raigad district, Maharashtra State, India. ... Bambusoideae are differentiated from other members of the family by the presence of petiolate blades with parallel venation and stamens are three, four, six or more, ...

  17. Compensation techniques for operational amplifier bias current

    International Nuclear Information System (INIS)

    Silva, M.S.

    1981-01-01

    Two techniques are proposed for the compensation of the input current on operational amplifiers that can be used on inverting and non-inverting configurations. A qualitative analysis of temperature drift problems is made, and as a practical application, the construction of a voltage follower for high impedance measurements is presented. (Author) [pt

  18. Multi-pass amplifier architecture for high power laser systems

    Science.gov (United States)

    Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C

    2014-04-01

    A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.

  19. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  20. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  1. Transmission characteristics of acoustic amplifier in thermoacoustic engine

    International Nuclear Information System (INIS)

    Sun Daming; Qiu Limin; Wang Bo; Xiao Yong

    2008-01-01

    Thermoacoustic engines are promising in practical applications for the merits of simple configuration, reliable operation and environmentally friendly working gas. An acoustic amplifier can increase the output pressure amplitude of a thermoacoustic engine (TE) and improve the matching between the engine and its load. In order to make full use of an acoustic amplifier, the transmission characteristics are studied based on linear thermoacoustic theory. Computational and experimental results show that the amplifying ability of an acoustic amplifier is mainly determined by its geometry parameters and output resistance impedance. The amplifying ability of an acoustic amplifier with appropriate length and diameter reaches its maximum when the output resistance impedance is infinite. It is also shown that the acoustic amplifier consumes an amount of acoustic power when amplifying pressure amplitude and the acoustic power consumption increases with amplifying ratio. Furthermore, a novel cascade acoustic amplifier is proposed, which has a much stronger amplifying ability with reduced acoustic power consumption. In experiments, a two-stage cascade acoustic amplifier amplifies the pressure ratio from 1.177 to 1.62 and produces a pressure amplitude of 0.547 MPa with nitrogen of 2.20 MPa as working gas. Good agreements are obtained between the theoretical analysis and experimental results. This research is instructive for comprehensively understanding the mechanism and making full use of the acoustic amplifier

  2. Is there a role for amplifiers in sexual selection?

    Science.gov (United States)

    Gualla, Filippo; Cermelli, Paolo; Castellano, Sergio

    2008-05-21

    The amplifier hypothesis states that selection could favour the evolution of traits in signallers that improve the ability of receivers to extract honest information from other signals or cues. We provide a formal definition of amplifiers based on the receiver's mechanisms of signal perception and we present a game-theoretical model in which males advertise their quality and females use sequential-sampling tactics to choose among prospective mates. The main effect of an amplifier on the female mating strategy is to increase her mating threshold, making the female more selective as the effectiveness of the amplifier increases. The effects of the amplifier on male advertising strategy depends both on the context and on the types of the amplifier involved. We consider two different contexts for the evolution of amplifiers (when the effect of amplifiers is on signals and when it is on cues) and two types of amplifiers (the 'neutral amplifier', when it improves quality assessment without altering male attractiveness, and the 'attractive amplifier', when it improves both quality assessment and male attractiveness). The game-theoretical model provides two main results. First, neutral and attractive amplifiers represent, respectively, a conditional and an unconditional signalling strategy. In fact, at the equilibrium, neutral amplifiers are displayed only by males whose advertising level lays above the female acceptance threshold, whereas attractive amplifiers are displayed by all signalling males, independent of their quality. Second, amplifiers of signals increase the differences in advertising levels between amplifying and not-amplifying males, but they decrease the differences within each group, so that the system converges towards an 'all-or-nothing' signalling strategy. By applying concepts from information theory, we show that the increase in information transfer at the perception level due to the amplifier of signals is contrasted by a decrease in information

  3. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  4. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  5. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  6. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  7. Molecular characterization of 93 genotypes of cocoa (Theobroma cacao L. with random amplified microsatellites RAMs

    Directory of Open Access Journals (Sweden)

    Yacenia Morillo C.

    2014-12-01

    Full Text Available Random amplified microsatellite (RAMs markers six were used to characterize 93 genotypes of cocoa in Tumaco (Colombia. Hundred twenty seven bands were generated. The number of polymorphic loci varied between 11 and 25 for the AG and TG primers, respectively. This study differentiated the 93 genotypes into six groups with a 0.53 similarity, 0.28 mean heterozygosity (He for the population, and 0.12±0.02 genetic differentiation coefficient or Fst. A significant level of genetic diversity was evident in the T. cacao genotypes. This resource would benefit selection programs of individual trees or plant breeding programs. The genotypes clustered in a large proportion in accordance with the collection zone. This characteristic was associated with collection zones and along the rivers in the municipality of Tumaco. The RAM technique proved to be a useful tool for the determination of genetic diversity in Theobroma species.

  8. Molecular analysis of partial VP-2 gene amplified from rectal swab samples of diarrheic dogs in Pakistan confirms the circulation of canine parvovirus genetic variant CPV-2a and detects sequences of feline panleukopenia virus (FPV).

    Science.gov (United States)

    Ahmed, Nisar; Riaz, Adeel; Zubair, Zahra; Saqib, Muhammad; Ijaz, Sehrish; Nawaz-Ul-Rehman, Muhammad Shah; Al-Qahtani, Ahmed; Mubin, Muhammad

    2018-03-15

    The infection in dogs due to canine parvovirus (CPV), is a highly contagious one with high mortality rate. The present study was undertaken for a detailed genetic analysis of partial VP2 gene i.e., 630 bp isolated from rectal swab samples of infected domestic and stray dogs from all areas of district Faisalabad. Monitoring of viruses is important, as continuous prevalence of viral infection might be associated with emergence of new virulent strains. In the present study, 40 rectal swab samples were collected from diarrheic dogs from different areas of district Faisalabad, Pakistan, in 2014-15 and screened for the presence of CPV by immunochromatography. Most of these dogs were stray dogs showing symptoms of diarrhea. Viral DNA was isolated and partial VP2 gene was amplified using gene specific primer pair Hfor/Hrev through PCR. Amplified fragments were cloned in pTZ57R/T (Fermentas) and completely sequenced. Sequences were analyzed and assembled by the Lasergene DNA analysis package (v8; DNAStar Inc., Madison, WI, USA). The results with immunochromatography showed that 33/40 (82%) of dogs were positive for CPV. We were able to amplify a fragment of 630 bp from 25 samples. In 25 samples the sequences of CPV-2a were detected showing the amino acid substitution Ser297Ala and presence of amino acid (426-Asn) in partial VP2 protein. Interestingly the BLAST analysis showed the of feline panleukopenia virus (FPV) sequences in 3 samples which were already positive for new CPV-2a, with 99% sequence homology to other FPV sequences present in GenBank. Phylogenetic analysis showed clustering of partial CPV-VP-2 gene with viruses from China, India, Japan and Uruguay identifying a new variant, whereas the 3 FPV sequences showed immediate ancestral relationship with viruses from Portugal, South Africa and USA. Interesting observation was that CPV are clustering away from the commercial vaccine strains. In this work we provide a better understanding of CPV prevailing in Pakistan

  9. Differential InP HEMT MMIC Amplifiers Embedded in Waveguides

    Science.gov (United States)

    Kangaslahti, Pekka; Schlecht, Erich; Samoska, Lorene

    2009-01-01

    Monolithic microwave integrated-circuit (MMIC) amplifiers of a type now being developed for operation at frequencies of hundreds of gigahertz contain InP high-electron-mobility transistors (HEMTs) in a differential configuration. The differential configuration makes it possible to obtain gains greater than those of amplifiers having the single-ended configuration. To reduce losses associated with packaging, the MMIC chips are designed integrally with, and embedded in, waveguide packages, with the additional benefit that the packages are compact enough to fit into phased transmitting and/or receiving antenna arrays. Differential configurations (which are inherently balanced) have been used to extend the upper limits of operating frequencies of complementary metal oxide/semiconductor (CMOS) amplifiers to the microwave range but, until now, have not been applied in millimeter- wave amplifier circuits. Baluns have traditionally been used to transform from single-ended to balanced configurations, but baluns tend to be lossy. Instead of baluns, finlines are used to effect this transformation in the present line of development. Finlines have been used extensively to drive millimeter- wave mixers in balanced configurations. In the present extension of the finline balancing concept, finline transitions are integrated onto the affected MMICs (see figure). The differential configuration creates a virtual ground within each pair of InP HEMT gate fingers, eliminating the need for inductive vias to ground. Elimination of these vias greatly reduces parasitic components of current and the associated losses within an amplifier, thereby enabling more nearly complete utilization of the full performance of each transistor. The differential configuration offers the additional benefit of multiplying (relative to the single-ended configuration) the input and output impedances of each transistor by a factor of four, so that it is possible to use large transistors that would otherwise have

  10. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  11. Amplified spontaneous emission spectrum and gain characteristic of a two-electrode semiconductor optical amplifier

    International Nuclear Information System (INIS)

    Wang Hanchao; Huang Lirong; Shi Zhongwei

    2011-01-01

    A two-electrode multi-quantum-well semiconductor optical amplifier is designed and fabricated. The amplified spontaneous emission (ASE) spectrum and gain were measured and analyzed. It is shown that the ASE spectrum and gain characteristic are greatly influencedby the distribution of the injection current density. By changing the injection current density of two electrodes, the full width at half maximum, peak wavelength, peak power of the ASE spectrum and the gain characteristic can be easily controlled. (semiconductor devices)

  12. Assembly and maintenance of full scale NIF amplifiers in the amplifier module prototype laboratory (AMPLAB)

    International Nuclear Information System (INIS)

    Horvath, J. A.

    1998-01-01

    Mechanical assembly and maintenance of the prototype National Ignition Facility amplifiers in the Amplifier Module Prototype Laboratory (AMPLAB) at Lawrence Livermore National Laboratory requires specialized equipment designed to manipulate large and delicate amplifier components in a safe and clean manner. Observations made during the operation of this assembly and maintenance equipment in AMPLAB provide design guidance for similar tools being built for the National Ignition Facility. Fixtures used for amplifier frame installation, laser slab and flashlamp cassette assembly, transport, and installation, and in-situ blastshield exchange are presented. Examples include a vacuum slab gripper, slab handling clean crane, slab cassette assembly fixture, sealed transport vehicle for slab cassette movement between the cleanroom and amplifier, slab cassette transfer fixture between the cleanroom and transport vehicle, and equipment needed for frame assembly unit, blastshield, an d flashlamp cassette installation and removal. The use of these tools for amplifier assembly, system reconfiguration, reflector replacement, and recovery from an abnormal occurrence such as a flashlamp explosion is described. Observations are made on the design and operation of these tools and their contribution to the final design

  13. Kramers Pairs in configuration interaction

    DEFF Research Database (Denmark)

    Avery, John Scales; Avery, James Emil

    2003-01-01

    The theory of symmetry-preserving Kramers pair creation operators is reviewed and formulas for applying these operators to configuration interaction calculations are derived. A new and more general type of symmetry-preserving pair creation operator is proposed and shown to commute with the total ...

  14. Molecular characterization with random amplified microsatellites (RAMs of Inchi (Caryodendron orinocense K.

    Directory of Open Access Journals (Sweden)

    Ana Cruz Morillo Coronado

    2015-01-01

    Full Text Available The Inchi or Cacay (Caryodendron orinocense Karsten is one of the most promising species of the Amazon and Orinoco Colombian. The main product of Cacay are its almonds, from extracted oil cosmetic, phytotherapeutic and food applications, also has a high content of antioxidants such as Omega 3, 6 and 9 and vitamins like A and E. There are no studies on the molecular characterization of this plant genetic resource; therefore the objective of this research was to characterize the genetic diversity using Random Amplified Microsatellite markers (RAMs. The similarity analysis to 0.50 formed four groups according to geographical location, being materials from Putumayo, Cacayal 19, Pauna and Castilla lowest similarity. Estimated heterozygosity values were 0.16 and 0.28 for the primers CGA and GT, respectively. The percentage of polymorphic loci ranged from 55% for the primer CGA and 90% for the GT. The average Fst value for the 27 materials studied was 0.35, showing the space-temporal dynamics of materials Caryodendron tend toward genetic differentiation, due to their own evolutionary processes and domestication incidence.

  15. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  16. Optimization of random amplified polymorphic DNA techniques for use in genetic studies of Cuban triatominae Optimización de la técnica de ADN polimórfico amplificado al azar (RAPD para su utilización en la caracterización genética de triatomíneos cubanos

    Directory of Open Access Journals (Sweden)

    Jorge Fraga

    2005-10-01

    Full Text Available Random amplified polymorphic DNA (RAPD technique is a simple and reliable method to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of assay. In this study, we analyzed the effect of changing the concentration of primer, magnesium chloride, template DNA and Taq DNA polymerase with the objective of determining their optimum concentration for the standardization of RAPD technique for genetic studies of Cuban Triatominae. Reproducible amplification patterns were obtained using 5 pmoL of primer, 2.5 mM of MgCl2, 25 ng of template DNA and 2 U of Taq DNA polymerase in 25 µL of the reaction. A panel of five random primers was used to evaluate the genetic variability of T. flavida. Three of these (OPA-1, OPA-2 and OPA-4 generated reproducible and distinguishable fingerprinting patterns of Triatominae. Numerical analysis of 52 RAPD amplified bands generated for all five primers was carried out with unweighted pair group method analysis (UPGMA. Jaccard's Similarity Coefficient data were used to construct a dendrogram. Two groups could be distinguished by RAPD data and these groups coincided with geographic origin, i.e. the populations captured in areas from east and west of Guanahacabibes, Pinar del Río. T. flavida present low interpopulation variability that could result in greater susceptibility to pesticides in control programs. The RAPD protocol and the selected primers are useful for molecular characterization of Cuban Triatominae.La técnica de ADN polimórfico amplificado al azar (RAPD es un método simple para detectar el polimorfismo genético del ADN. Diferentes factores afectan los perfiles de amplificación lo que se manifiesta en la presencia de bandas falsas y en la reproducibilidad del ensayo. En nuestro trabajo analizamos los cambios de la concentración de cebador, ADN molde, cloruro de magnesio y de Taq ADN polimerasa con el objetivo de determinar su

  17. Property (RD) for Hecke Pairs

    International Nuclear Information System (INIS)

    Shirbisheh, Vahid

    2012-01-01

    As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.

  18. Instability of vortex pair leapfrogging

    DEFF Research Database (Denmark)

    Tophøj, Laust; Aref, Hassan

    2013-01-01

    Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...

  19. Transport in coherently absorbing or amplifying media

    International Nuclear Information System (INIS)

    Sen, A.K.

    1995-11-01

    We study electronic transport in a one-dimensional ordered chain in the presence of either absorption or amplification at each site (the site-potential having an imaginary positive or negative part) within a single-band tightbinding Hamiltonian. The spectrum in either case for the isolated (closed) quantum system is found to become broader compared to the regular Bloch case where there is no absorption or amplification at any site. Interestingly for the transport through an infinitely long ordered chain (open quantum system), the reflectance saturates to a value greater (lesser) than unity in the amplifying (absorbing) case and the transmittance decays to zero in either case. This fact implies that the transmittance does not grow indefinitely even for an ordered, amplifying (active or lasing) medium and that it is not necessary to have any disorder or interaction induced confining mechanism on the transmitted wave, so as to achieve an amplification in the backscattered wave. (author). 8 refs, 2 figs

  20. Amplified music exposure carries risks to hearing.

    Science.gov (United States)

    da Silva, Valéria Gomes; de Oliveira, Carlos Augusto Costa Pires; Tauil, Pedro Luíz; de Castro Silva, Isabella Monteiro; Sampaio, André Luiz Lopes

    2017-02-01

    To investigate the association between changes in the outer hair cells and exposure to amplified music in a group of high-school students. In this retrospective, case-control study, 86 subjects underwent audiometry, immittance audiometry, and distortion-product otoacoustic emission tests. The subjects were questioned about their listening habits and divided into 2 groups: exposed and unexposed. Most of the subjects had reduced function in their outer hair cells, mainly beginning at 8 kHz. Among 60 subjects-30 cases and 30 controls-75% were considered exposed and 25% unexposed. The exposed subjects were 9.33 times more likely to have altered outer hair cells than the unexposed subjects were. Exposure to amplified music is associated with reduced function in the hair cells. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  1. Cryogenic cooling for high power laser amplifiers

    Directory of Open Access Journals (Sweden)

    Perin J.P.

    2013-11-01

    Full Text Available Using DPSSL (Diode Pumped Solid State Lasers as pumping technology, PW-class lasers with enhanced repetition rates are developed. Each of the Yb YAG amplifiers will be diode-pumped at a wavelength of 940 nm. This is a prerequisite for achieving high repetition rates (light amplification duration 1 millisecond and repetition rate 10 Hz. The efficiency of DPSSL is inversely proportional to the temperature, for this reason the slab amplifier have to be cooled at a temperature in the range of 100 K–170 K with a heat flux of 1 MW*m−2. This paper describes the thermo-mechanical analysis for the design of the amplification laser head, presents a preliminary proposal for the required cryogenic cooling system and finally outlines the gain of cryogenic operation for the efficiency of high pulsed laser.

  2. Spaceflight 2 um Tm Fiber MOPA Amplifier, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Fibertek proposes to design, develop, and test a spaceflight prototype 2051 nm thulium (Tm)-doped fiber amplifier (TDFA) optical master oscillator power amplifier...

  3. Conversion of the random amplified polymorphic DNA (RAPD ...

    African Journals Online (AJOL)

    Conversion of the random amplified polymorphic DNA (RAPD) marker UBC#116 linked to Fusarium crown and root rot resistance gene (Frl) into a co-dominant sequence characterized amplified region (SCAR) marker for marker-assisted selection of tomato.

  4. Development of primers for sequencing the NSP1, NSP3, and VP6 genes of the group A porcine rotavirus

    Directory of Open Access Journals (Sweden)

    Fernanda Dornelas Florentino Silva

    2014-02-01

    Full Text Available Rotavirus is the causative pathogen of diarrhea in humans and in several animal species. Eight pairs of primers were developed and used for Sanger sequencing of the coding region of the NSP1, NSP3, and VP6 genes based on the conserved regions of the genome of the group A porcine rotavirus. Three samples previously screened as positive for group A rotaviruses were subjected to gene amplification and sequencing to characterize the pathogen. The information generated from this study is crucial for the understanding of the epidemiology of the disease.

  5. Electrically Pumped Vertical-Cavity Amplifiers

    DEFF Research Database (Denmark)

    Greibe, Tine

    2007-01-01

    In this work, the design of electrically pumped vertical cavity semiconductor optical amplifiers (eVCAs) for use in a mode-locked external-cavity laser has been developed, investigated and analysed. Four different eVCAs, one top-emitting and three bottom emitting structures, have been designed...... and discussed. The thesis concludes with recommendations for further work towards the realisation of compact electrically pumped mode-locked vertical externalcavity surface emitting lasers....

  6. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Fast Electrocardiogram Amplifier Recovery after Defibrillation Shock

    Directory of Open Access Journals (Sweden)

    Ivan Dotsinsky

    2005-04-01

    Full Text Available A procedure for fast ECG amplifier recovery after defibrillation shocks was developed and simulated in the MATLAB environment. Exponentially decaying post-shock voltages have been recorded. Signals from the AHA database are taken and mixed with the recorded exponential disturbances. The algorithm applies moving averaging (comb filter on the compound input signal, thereby obtaining the samples of the disturbance. They are currently subtracted from the input signal. The results obtained show that its recovery is practically instantaneous.

  8. Ultra-low Voltage CMOS Cascode Amplifier

    OpenAIRE

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique.

  9. X-ray image amplifying tube

    International Nuclear Information System (INIS)

    1977-01-01

    The photo electrons from the picture on the fluorescent input screen are amplified by an electron optical system and produce an intensified image on the output screen. This can be photographed and shown on a TV screen. The effects of stray magnetic fields are reduced by covering the input screen with a grating made of strips of ferromagnetic material such as μ metal. (T.S.E.T.)

  10. Ultra-low Voltage CMOS Cascode Amplifier

    DEFF Research Database (Denmark)

    Lehmann, Torsten; Cassia, Marco

    2000-01-01

    In this paper, we design a folded cascode operational transconductance amplifier in a standard CMOS process, which has a measured 69 dB DC gain, a 2 MHz bandwidth and compatible input- and output voltage levels at a 1 V power supply. This is done by a novel Current Driven Bulk (CDB) technique......, which reduces the MOST threshold voltage by forcing a constant current though the transistor bulk terminal. We also look at limitations and improvements of this CDB technique....

  11. EFEKTIVITAS PEMBERIAN TERAPI MUSIK (MOZART DAN BACK EXERCISE TERHADAP PENURUNAN NYERI DYSMENORRHEA PRIMER

    Directory of Open Access Journals (Sweden)

    reni heryani

    2017-12-01

    Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

  12. Prototype disc amplifier for Iskra-6 facility

    International Nuclear Information System (INIS)

    Grigorovich, S.V.; Eroshenko, V.F.; Krotov, V.A.; Demidov, V.L.; Kalinin, N.V.; Kurunov, R.F.; Smirnov, V.G.; Fomin, V.M.

    2006-01-01

    Eight-channel disk amplifiers of the ISKRA-6 facility are made up of sections. An amplifier section consists of eight active elements (2*4) made of KGSS-0180/35-grade neodymium phosphate glass 400*690*40 mm in size located in frames at the Brewster angle. Twenty flash-lamps are arranged in one amplifier module. The flash-lamps have an inter electrode distance of 1600 mm, the tube is 40 mm in inner diameter. The results of numerical investigations into the dynamics of high-current pulse radiation discharge are presented. The investigations were carried out by the 1-dimensional RMHD-model. This model takes into account the transient processes in the electric circuit and the physical processes in the discharge plasma: ionization, Joule heating, thermal conductivity, radiation transfer and plasma motion caused by the non-uniformity of energy introduction into the discharge in case of a non-uniform initial ionization of gas in the pumping lamp. The experimental results of spectral measurements and light efficiency of the flash-lamps depending on specific power and value of energy contribution are presented

  13. Charge sensitive amplifies. The state of arts

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Kunishiro [Clear Pulse Co., Tokyo (Japan)

    1996-07-01

    In the radiation detectors, signals are essentially brought with charges produced by radiation, then it is naturally the best way to use a charge sensitive amplifier (CSA) system to extract those signals. The CSA is thought to be the best amplifier suitable to almost all the radiation detectors, if neglecting economical points of view. The CSA has been only applied to special fields like radiation detection because the concept of `charges` is not so universal against the concepts of `voltage` and `current`. The CSA, however, is low in noise and a high speed amplifier and may be applicable not only to radiation measurement but also piezoelectric devices and also bolometers. In this article, noise in the CSA, basic circuit on the CSA, concepts of `equivalent noise charge` (ENC), a method for the ENC, and importance of the `open-loop gain` in the CSA to achieve better performance of it and how to realize in a practical CSA were described. And, characteristics on a counting rate of the CSA, various circuit used in the CSA, and CSAs which are commercially available at present and special purpose CSAs were also introduced. (G.K.)

  14. Pump to signal noise transfer in parametric fiber amplifiers

    DEFF Research Database (Denmark)

    Lund-Hansen, Toke; Rottwitt, Karsten; Peucheret, Christophe

    2010-01-01

    Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal.......Fiber optic parametric amplifiers have been suggested due to their potential low spontaneous emission. However, by nature the parametric amplifier only work in a forward pumped configuration, which result in transfer of relative intensity noise in the pump to the signal....

  15. Noise and saturation properties of semiconductor quantum dot optical amplifiers

    DEFF Research Database (Denmark)

    Berg, Tommy Winther; Mørk, Jesper

    2002-01-01

    We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved.......We present a detailed theoretical analysis of quantum dot optical amplifiers. Due to the presence of a reservoir of wetting layer states, the saturation and noise properties differ markedly from bulk or QW amplifiers and may be significantly improved....

  16. The OPTHER Project: Progress toward the THz Amplifier

    DEFF Research Database (Denmark)

    Paoloni, C; Brunetti, F; Di Carlo, A

    2011-01-01

    This paper describes the status of the OPTHER (OPtically driven TeraHertz AmplifiERs) project and progress toward the THz amplifier realization. This project represents a considerable advancement in the field of high frequency amplification. The design and realization of a THz amplifier within...... this project is a consolidation of efforts at the international level from the leading scientific and industrial European organizations working with vacuum electronics....

  17. Differential transimpedance amplifier circuit for correlated differential amplification

    Science.gov (United States)

    Gresham, Christopher A [Albuquerque, NM; Denton, M Bonner [Tucson, AZ; Sperline, Roger P [Tucson, AZ

    2008-07-22

    A differential transimpedance amplifier circuit for correlated differential amplification. The amplifier circuit increase electronic signal-to-noise ratios in charge detection circuits designed for the detection of very small quantities of electrical charge and/or very weak electromagnetic waves. A differential, integrating capacitive transimpedance amplifier integrated circuit comprising capacitor feedback loops performs time-correlated subtraction of noise.

  18. Functional Blocks and Biquadratic ARC Filters using Transimpedance Amplifiers

    OpenAIRE

    R. Sarman; R. Prokop; T. Dostal

    1997-01-01

    The aims of the article are design and analysis of modern circuits including high performance functional blocks and biquadratic filters using transimpedance amplifiers. Here are given various types of these circuits, that works in classical voltage, current or hybrid mode. In this paper are also compared various possibilities of connection of single amplifier filters as for reduction of influence of transimpedance amplifier parasitic elements.

  19. The Dynamics of Semiconductor Optical Amplifiers – Modeling and Applications

    DEFF Research Database (Denmark)

    Mørk, Jesper; Nielsen, Mads Lønstrup; Berg, Tommy Winther

    2003-01-01

    The importance of semiconductor optical amplifiers is discussed. A semiconductor optical amplifier (SOA) is a semiconductor laser with anti-reflection coated facets that amplifies an injected light signal by means of stimulated emission. SOAs have a number of unique properties that open up...

  20. Deep Learning: A Primer for Radiologists.

    Science.gov (United States)

    Chartrand, Gabriel; Cheng, Phillip M; Vorontsov, Eugene; Drozdzal, Michal; Turcotte, Simon; Pal, Christopher J; Kadoury, Samuel; Tang, An

    2017-01-01

    Deep learning is a class of machine learning methods that are gaining success and attracting interest in many domains, including computer vision, speech recognition, natural language processing, and playing games. Deep learning methods produce a mapping from raw inputs to desired outputs (eg, image classes). Unlike traditional machine learning methods, which require hand-engineered feature extraction from inputs, deep learning methods learn these features directly from data. With the advent of large datasets and increased computing power, these methods can produce models with exceptional performance. These models are multilayer artificial neural networks, loosely inspired by biologic neural systems. Weighted connections between nodes (neurons) in the network are iteratively adjusted based on example pairs of inputs and target outputs by back-propagating a corrective error signal through the network. For computer vision tasks, convolutional neural networks (CNNs) have proven to be effective. Recently, several clinical applications of CNNs have been proposed and studied in radiology for classification, detection, and segmentation tasks. This article reviews the key concepts of deep learning for clinical radiologists, discusses technical requirements, describes emerging applications in clinical radiology, and outlines limitations and future directions in this field. Radiologists should become familiar with the principles and potential applications of deep learning in medical imaging. © RSNA, 2017.

  1. Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

    Directory of Open Access Journals (Sweden)

    KUSUMADEWI SRI YULITA

    2011-07-01

    Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

  2. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  3. A low-voltage sense amplifier with two-stage operational amplifier clamping for flash memory

    Science.gov (United States)

    Guo, Jiarong

    2017-04-01

    A low-voltage sense amplifier with reference current generator utilizing two-stage operational amplifier clamp structure for flash memory is presented in this paper, capable of operating with minimum supply voltage at 1 V. A new reference current generation circuit composed of a reference cell and a two-stage operational amplifier clamping the drain pole of the reference cell is used to generate the reference current, which avoids the threshold limitation caused by current mirror transistor in the traditional sense amplifier. A novel reference voltage generation circuit using dummy bit-line structure without pull-down current is also adopted, which not only improves the sense window enhancing read precision but also saves power consumption. The sense amplifier was implemented in a flash realized in 90 nm flash technology. Experimental results show the access time is 14.7 ns with power supply of 1.2 V and slow corner at 125 °C. Project supported by the National Natural Science Fundation of China (No. 61376028).

  4. Note: A high dynamic range, linear response transimpedance amplifier.

    Science.gov (United States)

    Eckel, S; Sushkov, A O; Lamoreaux, S K

    2012-02-01

    We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

  5. Characterization of a Common-Source Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeond, Todd C.; Ho, Pat D.

    2010-01-01

    This paper presents empirical data that was collected through experiments using a FeFET in the established common-source amplifier circuit. The unique behavior of the FeFET lends itself to interesting and useful operation in this widely used common-source amplifier. The paper examines the effect of using a ferroelectric transistor for the amplifier. It also examines the effects of varying load resistance, biasing, and input voltages on the output signal and gives several examples of the output of the amplifier for a given input. The difference between a commonsource amplifier using a ferroelectric transistor and that using a MOSFET is addressed.

  6. Characterization of a Common-Gate Amplifier Using Ferroelectric Transistors

    Science.gov (United States)

    Hunt, Mitchell; Sayyah, Rana; MacLeod, Todd C.; Ho, Fat D.

    2011-01-01

    In this paper, the empirical data collected through experiments performed using a FeFET in the common-gate amplifier circuit is presented. The FeFET common-gate amplifier was characterized by varying all parameters in the circuit, such as load resistance, biasing of the transistor, and input voltages. Due to the polarization of the ferroelectric layer, the particular behavior of the FeFET common-gate amplifier presents interesting results. Furthermore, the differences between a FeFET common-gate amplifier and a MOSFET common-gate amplifier are examined.

  7. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  8. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  9. Solid State Power Amplifier for 805 MegaHertz at the Los Alamos Neutron Science Center

    International Nuclear Information System (INIS)

    Davis, J.L.; Lyles, J.T.M.

    1998-01-01

    Particle accelerators for protons, electrons, and other ion species often use high-power vacuum tubes for RF amplification, due to the high RF power requirements to accelerate these particles with high beam currents. The final power amplifier stages driving large accelerators are unable to be converted to solid-state devices with the present technology. In some instances, radiation levels preclude the use of transistors near beamlines. Work is being done worldwide to replace the RF power stages under about ten kilowatts CW with transistor amplifiers, due to the lower maintenance costs and obsolescence of power tubes in these ranges. This is especially practical where the stages drive fifty Ohm impedance and are not located in high radiation zones. The authors are doing this at the Los Alamos Neutron Science Center (LANSCE) proton linear accelerator (linac) in New Mexico. They replaced a physically-large air-cooled UHF power amplifier using a tetrode electron tube with a compact water-cooled unit based on modular amplifier pallets developed at LANSCE. Each module uses eight push-pull bipolar power transistor pairs operated in class AB. Four pallets can easily provide up to 2,800 watts of continuous RF at 805 MHz. A radial splitter and combiner parallels the modules. This amplifier has proven to be completely reliable after over 10,000 hours of operation without failure. A second unit was constructed and installed for redundancy, and the old tetrode system was removed in 1998. The compact packaging for cooling, DC power, impedance matching, RF interconnection, and power combining met the electrical and mechanical requirements. CRT display of individual collector currents and RF levels is made possible with built-in samplers and a VXI data acquisition unit

  10. A Fully Reconfigurable Low-Noise Biopotential Sensing Amplifier With 1.96 Noise Efficiency Factor.

    Science.gov (United States)

    Tzu-Yun Wang; Min-Rui Lai; Twigg, Christopher M; Sheng-Yu Peng

    2014-06-01

    A fully reconfigurable biopotential sensing amplifier utilizing floating-gate transistors is presented in this paper. By using the complementary differential pairs along with the current reuse technique, the theoretical limit for the noise efficiency factor of the proposed amplifier is below 1.5. Without consuming any extra power, floating-gate transistors are employed to program the low-frequency cutoff corner of the amplifier and to implement the common-mode feedback. A concept proving prototype chip was designed and fabricated in a 0.35 μm CMOS process occupying 0.17 mm (2) silicon area. With a supply voltage of 2.5 V, the measured midband gain is 40.7 dB and the measured input-referred noise is 2.8 μVrms. The chip was tested under several configurations with the amplifier bandwidth being programmed to 100 Hz, 1 kHz , and 10 kHz. The measured noise efficiency factors in these bandwidth settings are 1.96, 2.01, and 2.25, respectively, which are among the best numbers reported to date. The measured common-mode rejection and the supply rejection are above 70 dB . When the bandwidth is configured to be 10 kHz, the dynamic range measured at 1 kHz is 60 dB with total harmonic distortion less than 0.1%. The proposed amplifier is also demonstrated by recording electromyography (EMG), electrocardiography (ECG), electrooculography (EOG), and electroencephalography (EEG) signals from human bodies.

  11. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    Science.gov (United States)

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and

  12. Class D audio amplifiers for high voltage capacitive transducers

    DEFF Research Database (Denmark)

    Nielsen, Dennis

    of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...

  13. Low noise amplifier for ZnS(Ag) scintillation chamber

    International Nuclear Information System (INIS)

    Do Hoang Cuong

    1998-01-01

    A new pulse amplifier that can be used with standard photomultiplier tubes coupled with Zn(Ag) scintillation chamber is presented. The amplifier based on an IC operational amplifier LF 356N consists of a low-noise charge sensitive preamplifier and pulse shaping circuits for optimization of signal to noise ratio. Temperature instability is ≤ 0.05%/ o C. Dynamic range for linear output signals is equal +7 V. The presented amplifier is used in a measuring head for 0.17 L Lucas chambers developed in Department of Nuclear Instruments and Methods of the INCT in laboratory investigations aimed to develop methods and instruments for measurement of radon concentration in the air. The amplifier can also be employed for measurement of ionizing radiation by means of other scintillators coupled to PM tube. The amplifier is followed by a pulse discriminator with adjustable discrimination level. The amplifier output signal and discriminator output pulses are fed to external devices. (author)

  14. A new semicustom integrated bipolar amplifier for silicon strip detectors

    International Nuclear Information System (INIS)

    Zimmerman, T.

    1989-01-01

    The QPA02 is a four channel DC coupled two stage transimpedance amplifier designed at Fermilab on a semicustom linear array (Quickchip 2S) manufactured by Tektronix. The chip was developed as a silicon strip amplifier but may have other applications as well. Each channel consists of a preamplifier and a second stage amplifier/sharper with differential output which can directly drive a transmission line (90 to 140 ohms). External bypass capacitors are the only discrete components required. QPA02 has been tested and demonstrated to be an effective silicon strip amplifier. Other applications may exist which can use this amplifier or a modified version of this amplifier. For example, another design is now in progress for a wire chamber amplifier, QPA03, to be reported later. Only a relatively small effort was required to modify the design and layout for this application. 11 figs

  15. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  16. High sensitivity amplifier/discriminator for PWC's

    International Nuclear Information System (INIS)

    Hansen, S.

    1983-01-01

    The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design

  17. Numerical simulation of cross field amplifiers

    International Nuclear Information System (INIS)

    Eppley, K.

    1990-01-01

    Cross field amplifiers (CFA) have been used in many applications where high power, high frequency microwaves are needed. Although these tubes have been manufactured for decades, theoretical analysis of their properties is not as highly developed as for other microwave devices such as klystrons. One feature distinguishing cross field amplifiers is that the operating current is produced by secondary emission from a cold cathode. This removes the need for a heater and enables the device to act as a switch tube, drawing no power until the rf drive is applied. However, this method of generating the current does complicate the simulation. We are developing a simulation model of cross field amplifiers using the PIC code CONDOR. We simulate an interaction region, one traveling wavelength long, with periodic boundary conditions. An electric field with the appropriate phase velocity is imposed on the upper boundary of the problem. Evaluation of the integral of E·J gives the power interchanged between the wave and the beam. Given the impedance of the structure, we then calculate the change in the traveling wave field. Thus we simulate the growth of the wave through the device. The main advance of our model over previous CFA simulations is the realistic tracking of absorption and secondary emission. The code uses experimental curves to calculate secondary production as a function of absorbed energy, with a theoretical expression for the angular dependence. We have used this code to model the 100 MW X-band CFA under construction at SLAC, as designed by Joseph Feinstein and Terry Lee. We are examining several questions of practical interest, such as the power and spectrum of absorbed electrons, the minimum traveling wave field needed to initiate spoke formation, and the variation of output power with dc voltage, anode-cathode gap, and magnetic field. 5 refs., 8 figs

  18. Waveguide harmonic damper for klystron amplifier

    International Nuclear Information System (INIS)

    Kang, Y.

    1998-01-01

    A waveguide harmonic damper was designed for removing the harmonic frequency power from the klystron amplifiers of the APS linac. Straight coaxial probe antennas are used in a rectangular waveguide to form a damper. A linear array of the probe antennas is used on a narrow wall of the rectangular waveguide for damping klystron harmonics while decoupling the fundamental frequency in dominent TE 01 mode. The klystron harmonics can exist in the waveguide as waveguide higher-order modes above cutoff. Computer simulations are made to investigate the waveguide harmonic damping characteristics of the damper

  19. Active isotropic slabs: conditions for amplified reflection

    Science.gov (United States)

    Perez, Liliana I.; Matteo, Claudia L.; Etcheverry, Javier; Duplaá, María Celeste

    2012-12-01

    We analyse in detail the necessary conditions to obtain amplified reflection (AR) in isotropic interfaces when a plane wave propagates from a transparent medium towards an active one. First, we demonstrate analytically that AR is not possible if a single interface is involved. Then, we study the conditions for AR in a very simple configuration: normal incidence on an active slab immersed in transparent media. Finally, we develop an analysis in the complex plane in order to establish a geometrical method that not only describes the behaviour of active slabs but also helps to simplify the calculus.

  20. Active isotropic slabs: conditions for amplified reflection

    International Nuclear Information System (INIS)

    Perez, Liliana I; Duplaá, María Celeste; Matteo, Claudia L; Etcheverry, Javier

    2012-01-01

    We analyse in detail the necessary conditions to obtain amplified reflection (AR) in isotropic interfaces when a plane wave propagates from a transparent medium towards an active one. First, we demonstrate analytically that AR is not possible if a single interface is involved. Then, we study the conditions for AR in a very simple configuration: normal incidence on an active slab immersed in transparent media. Finally, we develop an analysis in the complex plane in order to establish a geometrical method that not only describes the behaviour of active slabs but also helps to simplify the calculus. (paper)

  1. Sm 3+-doped polymer optical waveguide amplifiers

    Science.gov (United States)

    Huang, Lihui; Tsang, Kwokchu; Pun, Edwin Yue-Bun; Xu, Shiqing

    2010-04-01

    Trivalent samarium ion (Sm 3+) doped SU8 polymer materials were synthesized and characterized. Intense red emission at 645 nm was observed under UV laser light excitation. Spectroscopic investigations show that the doped materials are suitable for realizing planar optical waveguide amplifiers. About 100 μm wide multimode Sm 3+-doped SU8 channel waveguides were fabricated using a simple UV exposure process. At 250 mW, 351 nm UV pump power, a signal enhancement of ˜7.4 dB at 645 nm was obtained for a 15 mm long channel waveguide.

  2. Solar energetic particles a modern primer on understanding sources, acceleration and propagation

    CERN Document Server

    Reames, Donald V

    2017-01-01

    This concise primer introduces the non-specialist reader to the physics of solar energetic particles (SEP) and systematically reviews the evidence for the two main mechanisms which lead to the so-called impulsive and gradual SEP events. More specifically, the timing of the onsets, the longitude distributions, the high-energy spectral shapes, the correlations with other solar phenomena (e.g. coronal mass ejections), as well as the all-important elemental and isotopic abundances of SEPs are investigated. Impulsive SEP events are related to magnetic reconnection in solar flares and jets. The concept of shock acceleration by scattering on self-amplified Alfvén waves is introduced, as is the evidence of reacceleration of impulsive-SEP material in the seed population accessed by the shocks in gradual events. The text then develops processes of transport of ions out to an observer. Finally, a new technique to determine the source plasma temperature in both impulsive and gradual events is demonstrated. Last but not ...

  3. Genetic Analysis of Aedes aegypti using Random Amplified Polymorphic DNA (RAPD Markers from Dengue Outbreaks in Pakistan

    Directory of Open Access Journals (Sweden)

    Hafiz Muhammad Ashraf

    2016-10-01

    Full Text Available Background: Keeping in view the havoc situation of dengue fever in Pakistan, the current study was designed to demon­strate the genetic variations, gene flow and rate of migration from Lahore and Faisalabad.Methods: The larvae were collected from both natural and artificial breeding places from each collection site. The adult mosquitoes were collected by means of sweep net and battery-operated aspirator. DNA extraction was per­formed using TNE buffer method. Ten GeneLink-A series RAPD primers were used for PCR amplification and the data was analyzed through POPGENE.Results: The number of amplification products produced per primer varied from 8-12, ranging from 200 to 2000 bp with an average of 10.0 bands per primer. The percentage of polymorphic loci amplified by each primer varied from 22.5 to 51%. The UPGMA dendrogram demonstrates two distinct groups from Faisalabad and Lahore populations. The genetic diversity ranged from 0.260 in Faisalabad to 0.294 in Lahore with a total heterozygosity of 0.379. The GST value for nine populations within Lahore was 0.131 (Nm= 3.317, whereas for nine populations in Faisalabad GST value was 0.117 (Nm= 3.773. The overall genetic variation among eighteen populations showed GST= 0.341 and Nm= 1.966.Conclusion: The genetic relatedness and Nm value show that Ae. aegypti populations exhibit intra-population gene flow both in Faisalabad and Lahore. Although, both cities show a distinct pattern of genetic structure; however, few areas from both the cities show genetic similarity. The gene flow and the genetic relatedness in few populations of Lahore and Faisalabad cities need further investigation.

  4. Genetic Analysis of Aedes aegypti Using Random Amplified Polymorphic DNA (RAPD) Markers from Dengue Outbreaks in Pakistan.

    Science.gov (United States)

    Ashraf, Hafiz Muhammad; Zahoor, Muhammad Kashif; Nasir, Shabab; Majeed, Humara Naz; Zahoor, Sarwat

    2016-12-01

    Keeping in view the havoc situation of dengue fever in Pakistan, the current study was designed to demonstrate the genetic variations, gene flow and rate of migration from Lahore and Faisalabad. The larvae were collected from both natural and artificial breeding places from each collection site. The adult mosquitoes were collected by means of sweep net and battery-operated aspirator. DNA extraction was performed using TNE buffer method. Ten GeneLink-A series RAPD primers were used for PCR amplification and the data was analyzed through POPGENE. The number of amplification products produced per primer varied from 8-12, ranging from 200 to 2000 bp with an average of 10.0 bands per primer. The percentage of polymorphic loci amplified by each primer varied from 22.5 to 51%. The UPGMA dendrogram demonstrates two distinct groups from Faisalabad and Lahore populations. The genetic diversity ranged from 0.260 in Faisalabad to 0.294 in Lahore with a total heterozygosity of 0.379. The G ST value for nine populations within Lahore was 0.131 (Nm= 3.317), whereas for nine populations in Faisalabad G ST value was 0.117 (Nm= 3.773). The overall genetic variation among eighteen populations showed G ST = 0.341 and Nm= 1.966. The genetic relatedness and Nm value show that Ae . aegypti populations exhibit intra-population gene flow both in Faisalabad and Lahore. Although, both cities show a distinct pattern of genetic structure; however, few areas from both the cities show genetic similarity. The gene flow and the genetic relatedness in few populations of Lahore and Faisalabad cities need further investigation.

  5. A Hybrid Fiber/Solid-State Regenerative Amplifier with Tunable Pulse Widths for Satellite Laser Ranging

    Science.gov (United States)

    Coyle, Barry; Poulios, Demetrios

    2013-01-01

    A fiber/solid-state hybrid seeded regenerative amplifier, capable of achieving high output energy with tunable pulse widths, has been developed for satellite laser ranging applications. The regenerative amplifier cavity uses a pair of Nd:YAG zigzag slabs oriented orthogonally to one another in order to make thermal lensing effects symmetrical and simplify optical correction schemes. The seed laser used is a fiber-coupled 1,064-nm narrowband (pumped by a single 120-W, pulsed 808-nm laser diode array. In this configuration, the average pump beam distribution in the slabs had a 1-D Gaussian shape, which matches the estimated cavity mode size. A half-wave plate between the slabs reduces losses from Fresnel reflections due to the orthogonal slabs Brewster-cut end faces. Successful "temporal" seeding of the regenerative amplifier cavity results in a cavity Q-switch pulse envelope segmenting into shorter pulses, each having the width of the input seed, and having a uniform temporal separation corresponding to the cavity round-trip time of approx. =10 ns. The pulse energy is allowed to build on successive passes in the regenerative amplifier cavity until a maximum is reached, (when cavity gains and losses are equal), after which the pulse is electro- optically switched out on the next round trip The overall gain of the amplifier is approx. =82 dB (or a factor of 1.26 million). After directing the amplified output through a LBO frequency doubling crystal, approx. = 2.1 W of 532-nm output (>1 mJ) was measured. This corresponds to a nonlinear conversion efficiency of >60%. Furthermore, by pulse pumping this system, a single pulse per laser shot can be created for the SLR (satellite laser ranging) measurement, and this can be ejected into the instrument. This is operated at the precise frequency needed by the measurement, as opposed to commercial short-pulsed, mode-locked systems that need to operate in a continuous fashion, or CW (continuous wave), and create pulses at many

  6. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  7. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  8. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  9. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  10. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  11. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  12. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  13. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  14. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  15. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  16. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  17. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  18. Trial manufacture of an insulated amplifier

    International Nuclear Information System (INIS)

    Okuno, Shigeo; Matsuura, Kiyokata.

    1978-10-01

    Trial manufacture of an insulated amplifier was carried out. The input signals are divided by filters Th and Tl into high frequency component and low frequency component. The high frequency component drives a transformer T 1 , and secondary signals are induced. The low frequency component drives a transformer T 2 through a buffer and a modulator. The secondary signals from both transformers are recombined to make the output signals. Compensation for the frequency characteristics of the high frequency transformer and that for the effect of a filter in the demodulation circuit for low frequency component are considered. The time constant of output signals for rectangular input signals was 30 microsec, when only the low frequency part is operated. The drift of the direct current level is within 5 mV. The characteristic features of the high frequency part was also investigated. The overall characteristic features of this amplifier were good for the frequency range of 0 to 500 kHz. (Kato, T.)

  19. Mechanical Amplifier for a Piezoelectric Transducer

    Science.gov (United States)

    Moore, James; Swain, Mark; Lawson, Peter; Calvet, Robert

    2003-01-01

    A mechanical amplifier has been devised to multiply the stroke of a piezoelectric transducer (PZT) intended for use at liquid helium temperatures. Interferometry holds the key to high angular resolution imaging and astrometry in space. Future space missions that will detect planets around other solar systems and perform detailed studies of the evolution of stars and galaxies will use new interferometers that observe at mid- and far-infrared wavelengths. Phase-measurement interferometry is key to many aspects of astronomical interferometry, and PZTs are ideal modulators for most methods of phase measurement, but primarily at visible wavelengths. At far infrared wavelengths of 150 to 300 m, background noise is a severe problem and all optics must be cooled to about 4 K. Under these conditions, piezos are ill-suited as modulators, because their throw is reduced by as much as a factor of 2, and even a wavelength or two of modulation is beyond their capability. The largest commercially available piezo stacks are about 5 in. (12.7 cm) long and have a throw of about 180 m at room temperature and only 90 m at 4 K. It would seem difficult or impossible to use PZTs for phase measurements in the far infrared were it not for the new mechanical amplifier that was designed and built.

  20. Direct solar-pumped iodine laser amplifier

    Science.gov (United States)

    Han, Kwang S.; Hwang, In Heon

    1990-01-01

    The optimum conditions of a solar pumped iodine laser are found in this research for the case of a continuous wave operation and a pulsed operation. The optimum product of the pressure(p) inside the laser tube and the tube diameter(d) was pd=40 approx. 50 torr-cm on the contrary to the case of a high intensity flashlamp pumped iodine laser where the optimum value of the product is known to be pd=150 torr-cm. The pressure-diameter product is less than 1/3 of that of the high power iodine laser. During the research period, various laser materials were also studied for solar pumping. Among the laser materials, Nd:YAG is found to have the lowest laser threshold pumping intensity of about 200 solar constant. The Rhodamine 6G was also tested as the solar pumped laser material. The threshold pumping power was measured to be about 20,000 solar constant. The amplification experiment for a continuously pumped iodine laser amplifier was performed using Vortek solar simulator and the amplification factors were measured for single pass amplification and triple pass amplification of the 15 cm long amplifier tube. The amplification of 5 was obtained for the triple pass amplification.